EGFR/NEDD9/TGF-BETA INTERACTOME AND METHODS OF USE THEREOF FOR THE IDENTIFICATION OF AGENTS HAVING EFFICACY IN THE TREATMENT OF HYPERPROLIFERATIVE DISORDERS

- Fox Chase Cancer Center

Compositions and methods for the treatment and diagnosis of cancer are disclosed.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description

This application is a continuation application of U.S. patent application Ser. No. 12/777,112, now abandoned, filed May 10, 2010, which is a continuation-in-part Application of PCT/US08/83067, filed Nov. 10, 2008, which in turn claims priority to U.S. Provisional application 60/986,964 filed Nov. 9, 2007. Each of the foregoing applications is incorporated by reference herein.

Incorporated herein by reference in its entirety is the Sequence Listing being submitted on Aug. 21, 2013 via EFS-Web as an ASCII text file named SEQLIST.txt, created Aug. 20, 2013, and having a size of 230,603 bytes.

FIELD OF THE INVENTION

This invention relates to the fields of system biology, pharmacology and drug discovery. More specifically, the invention provides an EGFR/NEDD9/TGF-β interactome that facilitates the identification of agents for the treatment of proliferative disorders, particularly metastatic cancer. Anti-cancer agents having efficacy when used alone and in combination identified using the methods described herein are also provided.

BACKGROUND OF THE INVENTION

Several publications and patent documents are cited throughout the specification in order to describe the state of the art to which this invention pertains. Each of these citations is incorporated herein by reference as though set forth in full.

Cancer is a leading cause of death in the United States. Treatments for metastatic cancer are generally limited, and include radiation, chemotherapy with non-specific cytotoxic agents, and therapy with drugs targeted at specific proteins that have been identified as marking cancer cells, and actively contributing to the aggressiveness of cancer growth. Taking metastatic colorectal cancer as an example, among the relatively limited drugs available for treatment of this disease, the DNA damaging agent irenotecan (a pro-drug for camptothecin), and antibodies (cetuximab, panitumumab) and small molecules (erlotinib, gefitinib) targeting the receptor tyrosine kinase (RTK) EGFR, an upstream regulator of the Ras pathway, have shown some efficacy (1-3). It is likely that improvement of therapies directed against EGFR and its family members (e.g., ERBB2/HER2/NEU, ERBB3/HER3) will be beneficial for treatment of numerous metastatic cancers, including those of breast, lung, and pancreas, as these proteins are often abnormally abundant or active in these tumors (e.g. 4,5), and EGFR-family targeting agents such as erlotinib and cetuximab have recently been approved for use in combination therapies in these cancers (1).

While combination of DNA damaging agents such as irenotecan and EGFR-targeting antibodies in the clinic, in some cases, produces substantial therapeutic benefit, in other cases, patients fail to respond. It is extremely likely that the failed response arises from secondary mutations in cancer cells that confer resistance to DNA damage, or relieve dependence of cells on EGFR: for example, mutations in K-Ras are becoming appreciated as a resistance factor for EGFR-directed therapies (6). In other cases, the sources of resistance or sensitivity are obscure (7).

SUMMARY OF THE INVENTION

In accordance with the present invention, a method for identifying compounds, particularly siRNA molecules which modulate sensitivity to EGFR/MEK-1 targeting agents is provided.

An exemplary method entails providing an EGFR/NEDD9/TGF-β interactome, comprising genes which are involved in cellular proliferation and EGFR/MEK-1 signalling; synthesizing at least one compound (e.g., an siRNA molecule) which targets EGFR/NEDD9/TGF-β interactome genes; contacting a cancer cell with at least one EGFR-MEK-1 targeting agent in the presence and absence of at least one compound from above; and determining cell viability in the presence of said agent alone and in the presence and absence of said at least one compound, compounds which increase or decrease sensitivity modulating cell sensitivity to said agent. Compounds for use in the invention include, without limitation, siRNA, phosphatase inhibitors, kinase inhibitors, inhibitory antibodies, and cholesterol synthesis inhibitors. The method may further include examining the cells for the presence of at least one parameter selected from the group consisting of morphological alterations, altered migratory properties, altered levels of apoptosis, altered angiogenic properties, and altered chromosomal or DNA integrity.

In a preferred embodiment, the EGFR-MEK-1 targeting agent is selected from the group consisting of cetuximab, panitumumab, erlotinib, lapatinib, gefitinib, and U0126. Sequences for the siRNA molecules disclosed herein are provided in Table 3. Sensitizing siRNAs are provided in Table 2.

In yet another aspect of the invention, a pharmaceutical composition comprising an effective amount of at least one EGFR-MEK-1 targeting agent listed above and at least one sensitizing siRNA provided in Table 2, in a pharmaceutically acceptable carrier is provided. Methods of administering the same to patients in need thereof for the treatment of malignancy are also disclosed.

In one embodiment, the cancer cell to be screened is obtained from a cancer cell line. In a particularly preferred embodiment, the cancer cell is isolated from a patient.

Also provided herein is a plurality of biomarkers associated with chemoresistance. Exemplary markers are provided in Table 2.

In yet another aspect, a method for determining whether a patient will respond to EGFR/MEK-1 targeting therapy is provided. An exemplary method comprises assessing a cancer cell from said patient for expression levels of at least one of the biomarkers listed in Table 2.

BRIEF DESCRIPTION OF THE DRAWINGS

The file of this application contains at least one drawing executed in color. Copies of this patent with color drawings will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.

FIG. 1. Selection of siRNAs for targeted library.

FIG. 2. EGFR/HER2 and connected pro-survival signaling pathways. While EGFR/HER2 directly signal through Ras to ERK and PI3K, cross signaling by the TGFβ/integrin-regulated proteins, Src, FAK, and NEDD9 contribute to activation of pro-survival endpoints, Akt and NF-κB. Drugs inhibiting EGFR/HER2 and Ras/Mek1 cascade are indicated.

FIG. 3. Representative dataset indicating convergence of EGFR/HER2-centered and NEDD9/SRC/TGFβ-centered protein interaction networks. Filled circles represent proteins, lines direct physical interactions. Proteins directly binding EGFR, HER2, or their proximal effectors are indicated in green to left; those directly binding NEDD9 and proximal partners are indicated in red, to right. This is one component of the meta-analysis employed to select components of the 638 siRNA library (see FIG. 1).

FIG. 4A. Primary screens, exploration of efficacy for validated hits. FIG. 4B. Knockdown of 39% (247/638) of genes in the library reduced the viability of DMSO-treated A431 cells by at least 15%, with 7% (45/638) reducing viability more than 30%. 214 primary hits (34% of the library), including 95 strong hits (15%, SI<0.7) sensitized to one or both EGFR-targeting agents. In contrast, 84 primary hits (13%), including 30 strong hits (5%, SI<0.7) were obtained that sensitized to the cytotoxic agent CPT11.

FIG. 5. Distribution of hits in relation to effect of siRNA on cells treated with vehicle.

FIG. 6. Muliplexing of Cell Titer. Blue staining for viability (top) with ImageXpress for visualization of cells stained with Hoechst and calcein vital dyes.

FIG. 7. Examples on ImageXpress cellular profiles. Green line represents trace of profile seen with siRNA negative control, as histogram of values for average nuclear staining with Hoechst. Red lines show generally increased (left) or periodically increased (right) staining, which correlates with DNA condensation, e.g., increased frequency of mitotic or apoptotic cells.

FIG. 8. Sensitization profile of screening hit list. 208 hits, 156 sensitized to one drug, 39 sensitized to two drugs, and 13 to three drugs.

FIG. 9A: Cytoscape mapping of the profile of interactions among the screening hits. FIG. 9B: color code of map.

FIG. 10. A network view of connected EGFR interactome components.

FIG. 11. Design and screening of a targeted library. A. Distribution of hits as a factor of overall viability reduction with the siRNA. siRNAs in library are listed in order of intrinsic impact on viability of A431 cells treated with DMSO (gray line). Blue triangles, sensitization index (SI) for primary hits with erlotinib; red triangles, SI for validated hits with erlotinib; green squares, SI for primary hits with CPT11. B. Degree of overlap between primary hits obtained for erlotinib, panitumumab, and CPT11. C. Network of validated (red circles) hits sensitizing to EGFR-targeting agents, in the context of the full library. Lines (edges) represent connections based on direct protein-protein interactions or genetic interactions in Drosophila.

FIG. 12. Network properties of hits. A. Hits by source of input in library. MA, microarray indicates transcriptionally responsive to EGFR; DG, Drosophila genetics; PPI1, direct protein interactions with seeds; PM, pathway maps; PPI2, direct protein interactions with a protein within the PPI1 group, or found in a complex with seed proteins; 3S, any 3 sources combined. B. Topological analysis of erlotinib hit network identified in A431 cells. Data shown represents difference between properties of the set of 61 validated hits and the average for 20 randomly generated sets of 61 genes from the library. Measures including degree, topological coefficient, stress, and neighborhood connectivity (see Methods) in each case show highly significant enrichment for hits validated with erlotinib, with the error bars for the random set data reflecting a 99% confidence interval. C. Enriched GO classifications identified among hits. Enrichment is highly significant for proteins annotated as involved in phosphate metabolism and signal transduction (as shown by *, p<0.01). D. Percentage of hits versus library proteins having a recognized ortholog in S. cerevisiae, C. elegans, or D. melanogaster. X axis, the number of species (among listed) having a recognized ortholog.

FIG. 13. Sensitization profile of hits. A. Left, SI values for erlotinib and CPT11, calculated as (test siRNA)/(GL2) for cells grown in drug, divided by (test siRNA/GL2) for cells grown in DMSO: dim green, SI≦0.85; bright green, SI≦0.7; dim red, SI≧1.15; bright red, SI≧1.3. Right, relative ranking of the efficacy of hits to sensitize cells to drugs indicated: black, most sensitizing; white, least sensitizing. For rank order analysis, cluster analysis was performed to identify genes with similar profiles of sensitization (dendrogram, Y axis), and also to cluster cell lines by similarity of response (dendrogram, X axis): these clustered patterns are used to organize the display of genes selected by threshold. Two cell lines, MIA-Paca2 and LoVo, yielded no reproducible hits sensitizing to erlotinib; BCAR1 and TBL1Y were not tested in LoVo B. Left, siRNA-induced viability reduction below 0.85 (dim green), or 0.7 (bright green) that of control siRNA-treated cells, calculated based on the formula (test siRNA)/(GL2 control siRNA) for cells grown in DMSO. Right, relative ranking of hit efficacy in reducing cell line viability. C. Apoptosis was determined by annexin-V labeling and normalized to negative control siRNA. Composite results from two independent experiments are shown as odds ratio columns; black, DMSO treated; white, erlotinib-treated. Asterisks indicate statistically significant (FDR≦0.05) drug-gene interaction in two independent experiments.

FIG. 14. Functional classification of hits. A. Network of validated hits sensitizing to EGFR-targeting agents. Blue lines represent connections based on direct protein-protein interactions or genetic interactions in Drosophila; yellow lines represent connections generated by pathway maps and text mining. Green shadowing on boxes indicates genes that are in the top quartile by rank order of those strongly sensitizing at least 1 (lightest green) to at least 5 (darkest green) cancer cell lines to erlotinib. B. Analysis of ERK (top) and AKT (bottom) status in cell lysates from A431 cells following siRNA transfection, under basal medium conditions and following EGF-stimulation. Average results of three independent Western blots are shown as ratios of amounts of phosphorylated and total proteins. Results were normalized to corresponding ratios in GL2 control; error bars are standard deviations. Asterisks indicate statistically significant difference with negative control; t-test p<0.05. C. Viability curves for erlotinib and Stattic used as single agents, or combined at 1:1 molar ratio in A431 (left) and HCT116 (right) cells, or for erlotinib and Ro-318220 used as single agents, or combined at 1:5 molar ratio in A431 (left) and HCT116 (right) cells. D. Motility was measured by wound healing assay in A431 cells cells treated with 0.5 μM erlotinib alone or in combination with 0.5 μM Stattic (top) or 0.25 μM Ro-318220, and assessed over 18 hours. NS, not significant. *, FDR=3.57*10−5.

FIG. 15. A. Representative Western blots showing status of EGFR pathway members in A431 cells transfected with siRNAs to the indicated genes. B. Chou Talalay Fa-CI plots obtained for viability of A431 and HCT116 cells treated with protein kinase C inhibitor (Ro, Ro-318220) or STAT3 inhibitor (Stattic) combined with erlotinib at different molar ratios. C. Viability curves for erlotinib and enzastaurin used as single agents, or combined at 5:1 (left) or 1:1 (right) molar ratios in A431 cells.

FIG. 16. Phosphoprotein changes with signaling inhibitors. Western blot quantitative data of the phosphorylated proteins in A431 lysates obtained under serum starvation (basal) or EGF stimulation. The results represent averages of 3 independently conducted experiments; bars indicate SEM. Data shown calculated from 3 independent biological replicates except for IκB, which was derived from 2 replicates.

FIG. 17. Synergy between inhibitors of Aurora-A and of EGFR. A. Kinases directly associated with the BCAR1-NEDD9-SH2D3C cluster. Kinases with no clinical small molecule inhibitor available are indicated in pink; kinases with small molecule inhibitors are indicated in blue, or in green if inhibitor has previously been tested for synergy with EGFR-targeting agents. B. Inhibitors of EGFR and inhibitors of Aurora kinase A synergize to reduce viability of cancer cells in vitro. Summary results of drug interactions calculated as Chou-Talalay coefficient of interaction (CI). The results are based on Cell Titer blue viability determinations; similar results were obtained with BrdU (not shown). C. Combination of PHA-680632 and erlotinib treatment increases apoptosis in HCT116 cells at 72 hours; *, t-test p=0.001. D. Dose-dependent inhibition of HCT116 cell viability by combination of PHA-680632 and erlotinib. E. Cell motility was measured by wound healing assay in cells treated with drugs at concentrations indicated, and assessed over 18 hours. *FDR is <10−5 for (1), (2). F. Left, relative soft agar colony formation of cells grown for 2-3 weeks in drugs at concentrations indicated. FDR is equal to (1) 0.0003, (2) 0.0006, (3) 0.0003, and (4) 0.004. Right, results from typical experiment. G. Tumor xenografts implanted in SCID mice were treated with drugs as indicated beginning at day 0. P-values are (1) 0.005, (2) 0.008. H, Quantitation of 3 independent Western analyses of protein lysates of cells treated with erlotinib and PHA-680632 for 3 hrs followed by EGF stimulation. Error bars represent standard error of the mean (SEM) of three independent experiments; **, t-test p=0.013.

FIG. 18. PHA-680632 and erlotinib combine to reduce AKT phosphorylation. Representative Western blot showing activity of erlotinib and PHA680632 either alone or in combination on serum starved HCT116 cells treated with the indicated inhibitors for 3 hours and stimulated with EGF.

FIG. 19. Dual inhibition of Aurora-A and EGFR suppresses activation of multiple signaling nodes. Ranked fold increase in phosphorylation signal of 46 proteins in A431 cells stimulated with EGF (A) or grown in 1% serum media (B) and treated with indicated drugs. Inset, graphs illustrate magnified scale of indicated phosphoproteins. Proteins showed in red have consistent decrease of >2-fold in signal intensity in independent biological replicates, as indicated.

FIG. 20. Expression profile of hits in cell lines. Not all siRNAs were active in all cell lines. The phenomenon of cell line-specific activity could reflect the presence or absence of expression of a targeted mRNA in specific cell lines, or might instead reflect the presence of the mRNA in multiple cell lines, but a requirement for the gene product only in a subset of cell lines. Establishing this point has important implications, as often a criterion for targeting a given protein therapeutically has been the observable high levels of expression of that protein within a tumor. We performed quantitative RT-PCR of the set of validated hits in each of the reference cell lines, and compared relative expression level with intrinsic siRNA sensitivity. Over the entire set of genes, there was no significant correlation between the relative abundance of a targeted mRNA in a cell line and the efficacy of the corresponding siRNA in influencing either sensitization to the drugs used, or cell viability. Shown, relative expression of genes targeted by siRNAs measured for each cell lines using quantitative RT-PCR. ΔCt value is in each case calibrated to A431; e.g., strongest blue requires 12 additional amplification cycles to detect mRNA, indicating it is 212-fold less abundant than in A431 cells. Genes with significant correlation (*) or anti-correlation (**) with proliferation ability are indicated; Pearson correlation values are respectively, AKT2, 0.91; RASA3, 0.84; STAT3, 0.81; VAV3, 0.80; GRB7, −0.89; PRKCE, −0.87; DUSP4, −0.81.

FIG. 21. Expression profile of hits in Oncomine. To identify genes among the hit set that have been reported as up- or down-regulated in cancerous vs. normal tissues (with a p-value equal or less than 0.01), the Oncomine database was searched across all tissue types. Tissues with fewer than two independent analyses available were excluded from analysis. For each gene, the total number of cancer vs. normal samples analyses reporting it to be up- or downregulated was normalized to the total number of analyses for the corresponding tissue type. Data were visualized using MeV: Red, up-regulation; blue, down-regulation. Intense hues represent a value of 1, meaning all of the available cancer vs. normal analyses found comparable up- or down-regulation; less intense hues indicate expression change was found in some but not all independent studies. Yellow indicates the genes found to be both up- and down-regulated in the same tissue type by different data sets. White boxes indicate no significant change in expression was identified in any study.

DETAILED DESCRIPTION OF THE INVENTION

In accordance with the present invention, compositions and methods are provided to better improve the treatment of cancer. Using small interfering RNA (siRNA) technology to identify proteins that contribute to resistance to clinically important therapeutic agents, we have identified suitable candidates which inhibit the action of identified resistance proteins thereby enhancing therapy. Such proteins also provide novel biomarkers to better select individual patients for specific treatment regimens.

An effective strategy has been devised to enhance the potency of EGFR-targeting agents. First, systems biology studies in model organisms have begun to establish that synthetic lethal relationships commonly involve genes that are involved in redundant, parallel pathways, or are vertically linked in the same pathway (8). It is instructive that in a seminal genome-wide screen to identify sensitizers to the microtubule-targeting agent paclitaxel, many hits could be clustered into coherent groups of genes associated with the proteasome or mitotic spindle (9), which a priori had been linked to paclitaxel activity based on existing pathway knowledge. Further, in the design of combination therapies in the clinic, the selection strategy for drugs to combine frequently involves common principles: that is, identifying two drugs that 1) inhibit the same target, 2) inhibit functionally linked and/or semi-redundant targets, or 3) inhibit vertically linked targets (10). Together, these observations suggested that generation of a mid-throughput siRNA library (−500-800 genes) that is large enough to fully represent genes functionally linked to the EGFR-Ras-MAPK signaling axis, would greatly increase the useful “hit” rate for genes that chemosensitize EGFR-targeted therapies.

This strategy has produced numerous gains, outlined below in detail: 1) we have been able to conduct reiterative screens to test strategies of hits selection and validation; 2) we have been able to test drive our experimental system to identify systematic errors and biases and apply statistical and bioinformatics tools to compensate for these biases; 3) the EGFR-centered library allowed us to validate the siRNA screening as successful strategy to identify interesting chemosensitizing hits; 4) we have identified siRNA molecules that sensitize chemoresistance cancer cells to EGFR based therapies.

DEFINITIONS

As used herein, the phrase “EGFR/MEK1 targeting agent refers to small molecules, antibodies, or RNA agents targeting EGFR, EGFR-related family members, or immediate effectors in the EGFR cascade including but not limited to Ras, Raf, and MEK1.

The phrase “EGFR/NEDD9/TGF-β interactome” refers to proteins linked by close physical or functional association with EGFR, or with the proteins NEDD9, TGF-beta, or their binding partners.

A “small nucleic acid inhibitor” refers to any sequence based nucleic acid molecule which, when introduced into a cell expressing the target nucleic acid, is capable of modulating expression of that target. While siRNA molecules are exemplified herein, antisense, miRNA, shRNA and the like may be utilized in the methods of the invention.

As used herein, the phrase “effective amount” of a compound or pharmaceutical composition refers to an amount sufficient to modulate tumor growth or metastasis in an animal, especially a human, including without limitation decreasing tumor growth or size or preventing formation of tumor growth in an animal lacking any tumor formation prior to administration, i.e., prophylactic administration.

Preferably, as used herein, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term “carrier” refers, for example to a diluent, adjuvant, excipient, auxiliary agent or vehicle with which an active agent of the present invention is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E. W. Martin.

A pharmaceutical composition of the present invention can be administered by any suitable route, for example, by injection, by oral, pulmonary, nasal or other forms of administration. In general, pharmaceutical compositions contemplated to be within the scope of the invention, comprise, inter alia, pharmaceutically acceptable diluents, preservatives, solubilizers, emulsifiers, adjuvants and/or carriers. Such compositions can include diluents of various buffer content (e.g., Tris HCl, acetate, phosphate), pH and ionic strength; additives such as detergents and solubilizing agents (e.g., Tween 80, Polysorbate 80), anti oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimersol, benzyl alcohol) and bulking substances (e.g., lactose, mannitol); incorporation of the material into particulate preparations of polymeric compounds such as polylactic acid, polyglycolic acid, etc., or into liposomes. Such compositions may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of components of a pharmaceutical composition of the present invention. See, e.g., Remington's Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co., Easton, Pa. 18042) pages 1435 1712 which are herein incorporated by reference. A pharmaceutical composition of the present invention can be prepared, for example, in liquid form, or can be in dried powder, such as lyophilized form. Particular methods of administering such compositions are described infra.

In yet another embodiment, a pharmaceutical composition of the present invention can be delivered in a controlled release system, such as using an intravenous infusion, an implantable osmotic pump, a transdermal patch, liposomes, or other modes of administration. In a particular embodiment, a pump may be used [see Langer, supra; Sefton, CRC Crit. Ref. Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek et al., N. Engl. J. Med. 321:574 (1989)]. In another embodiment, polymeric materials can be used [see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Press: Boca Raton, Fla. (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley: New York (1984); Ranger and Peppas, J. Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); see also Levy et al., Science 228:190 (1985); During et al., Ann. Neurol. 25:351 (1989); Howard et al., J. Neurosurg. 71:105 (1989)]. In yet another embodiment, a controlled release system can be placed in proximity of the target tissues of the animal, thus requiring only a fraction of the systemic dose [see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115 138 (1984)]. In particular, a controlled release device can be introduced into an animal in proximity of the site of inappropriate immune activation or a tumor. Other controlled release systems are discussed in the review by Langer [Science 249:1527 1533 (1990)].

As used herein the term “biomarker” refers to a characteristic that is objectively measured and evaluated as an indicator of normal biologic processes, pathogenic processes, or pharmacologic responses to a therapeutic intervention.

As used herein, the terms “modulate”, “modulating” or “modulation” refer to changing the rate at which a particular process occurs, inhibiting a particular process, reversing a particular process, and/or preventing the initiation of a particular process. Accordingly, if the particular process is tumor growth or metastasis, the term “modulation” includes, without limitation, decreasing the rate at which tumor growth and/or metastasis occurs; inhibiting tumor growth and/or metastasis; reversing tumor growth and/or metastasis (including tumor shrinkage and/or eradication) and/or preventing tumor growth and/or metastasis.

As used herein, the terms “tumor”, “tumor growth” or “tumor tissue” can be used interchangeably, and refer to an abnormal growth of tissue resulting from uncontrolled progressive multiplication of cells and serving no physiological function. A solid tumor can be malignant, e.g. tending to metastasize and being life threatening, or benign. Examples of solid tumors that can be treated or prevented according to a method of the present invention include sarcomas and carcinomas such as, but not limited to: fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, colorectal cancer, gastic cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, liver metastases, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, thyroid carcinoma such as anaplastic thyroid cancer, Wilms' tumor, cervical cancer, testicular tumor, lung carcinoma such as small cell lung carcinoma and non-small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, and retinoblastoma.

Moreover, tumors comprising dysproliferative changes (such as metaplasias and dysplasias) can be treated or prevented with a pharmaceutical composition or method of the present invention in epithelial tissues such as those in the cervix, esophagus, and lung. Thus, the present invention provides for treatment of conditions known or suspected of preceding progression to neoplasia or cancer, in particular, where non-neoplastic cell growth consisting of hyperplasia, metaplasia, or most particularly, dysplasia has occurred (for review of such abnormal growth conditions, see Robbins and Angell, 1976, Basic Pathology, 2d Ed., W.B. Saunders Co., Philadelphia, pp. 68 to 79). Hyperplasia is a form of controlled cell proliferation involving an increase in cell number in a tissue or organ, without significant alteration in structure or function. For example, endometrial hyperplasia often precedes endometrial cancer. Metaplasia is a form of controlled cell growth in which one type of adult or fully differentiated cell substitutes for another type of adult cell. Metaplasia can occur in epithelial or connective tissue cells. Atypical metaplasia involves a somewhat disorderly metaplastic epithelium. Dysplasia is frequently a forerunner of cancer, and is found mainly in the epithelia; it is the most disorderly form of non-neoplastic cell growth, involving a loss in individual cell uniformity and in the architectural orientation of cells. Dysplastic cells often have abnormally large, deeply stained nuclei, and exhibit pleomorphism. Dysplasia characteristically occurs where there exists chronic irritation or inflammation, and is often found in the cervix, respiratory passages, oral cavity, and gall bladder. For a review of such disorders, see Fishman et al., 1985, Medicine, 2d Ed., J. B. Lippincott Co., Philadelphia.

Other examples of tumors that are benign and can be treated or prevented in accordance with a method of the present invention include arteriovenous (AV) malformations, particularly in intracranial sites and myoleomas.

Methods for Modulating Tumor Growth or Metastasis

As explained above, the present invention is directed towards methods for modulating tumor growth and metastasis comprising, inter alia, the administration of a EGFR/Mek-1 targeting agent and at least one sensitizing siRNA molecule. The agents of the invention can be administered separately (e.g, formulated and administered separately), or in combination as a pharmaceutical composition of the present invention.

The present invention provides for both prophylactic and therapeutic methods of treating a subject at risk of (or susceptible to) a disorder or having a disorder associated with aberrant or unwanted target gene expression or activity. In one embodiment, the subject is administered a lipid/therapeutic agent complex, for example, a liposome comprising an siRNA for suppressing the expression of an the undesired gene product. It is understood that “treatment” or “treating” as used herein, is defined as the application or administration of a therapeutic agent (e.g., an RNAi agent or vector or transgene encoding same, a polypeptide, e.g., an antibody or fragment thereof, or small molecule) to a patient, or application or administration of a therapeutic agent to an isolated tissue or cell line from a patient, who has a disease or disorder, a symptom of disease or disorder or a predisposition toward a disease or disorder, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disease or disorder, the symptoms of the disease or disorder, or the predisposition toward disease.

In another aspect, the invention provides a method for preventing in a subject, a disease or condition associated with an aberrant or unwanted target gene expression or activity, by administering to the subject a lipid/therapeutic agent complex of the invention (e.g., an siRNA agent or vector or transgene encoding same, a polypeptide, e.g., an antibody or fragment thereof, or small molecule). Subjects at risk for a disease which is caused, or contributed to, by aberrant or unwanted target gene expression or activity can be identified by, for example, any or a combination of diagnostic or prognostic assays as described herein. Administration of a prophylactic agent can occur prior to the manifestation of symptoms characteristic of the target gene aberrancy, such that a disease or disorder is prevented or, alternatively, delayed in its progression. Depending on the type of target gene aberrancy, for example, a target gene, target gene agonist or target gene antagonist agent can be used for treating the subject. The appropriate agent can be determined based on screening assays described herein.

In yet another aspect, the invention pertains to methods of modulating target gene expression, protein expression or activity for therapeutic purposes. Accordingly, in an exemplary embodiment, the modulatory method of the invention involves contacting a cell capable of expressing target gene with a lipid/therapeutic agent complex (e.g., an siRNA agent or vector or transgene encoding same) that is specific for the target gene or protein (e.g., is specific for the mRNA encoded by said gene or specifying the amino acid sequence of said protein) such that expression or one or more of the activities of target protein is modulated. These modulatory methods can be performed in vitro (e.g., by culturing the cell with the agent), in vivo (e.g., by administering the agent to a subject), or ex vivo. As such, the present invention provides methods of treating an individual afflicted with a disease or disorder characterized by aberrant or unwanted expression or activity of a target gene polypeptide or nucleic acid molecule. Inhibition of target gene activity is desirable in situations in which target gene is abnormally unregulated and/or in which decreased target gene activity is likely to have a beneficial effect.

When employing the methods or compositions of the present invention, other agents used in the modulation of tumor growth or metastasis in a clinical setting, such as antiemetics, can also be administered as desired.

Materials and methods are provided herein to facilitate the practice of the present invention.

Cell lines, Compounds, Antibodies.

The A431 cervical adenocarcinoma (K-Ras wt, p53 mutant (Kwok et al. (1994) Cancer Res. 54:2834), HCT116 and LoVo (K-Ras mutant, p53 wt) colorectal carcinoma and the PANC-1 (K-Ras mutant, p53 mutant) and MIA PaCa-2 (K-Ras mutant, p53 and p16 mutant) pancreatic adenocarcinoma (Brunner et al., (2005) Cancer Res. 65:8433) cell lines were obtained from the ATCC (USA). The DLD-1 (K-Ras mutant, p53 mutant) and DKS-8 (with the activated K-Ras allele disrupted [derived from DLD-1], p53 mutant; Sarthy et al. (2007) Mol. Cancer. Ther. 6:269) were a kind gift of Dr. Robert J. Coffey (Vanderbilt University, Tenn.). SCC61 cells (K-Ras wt, p53 mutant), derived from squamous cell carcinomas of the head and neck, were kindly provided by Dr. Tanguy Y. Seiwert (University of Chicago). All cell lines were maintained in DMEM supplemented with 10% v/v fetal bovine serum (FBS) and L-glutamine without antibiotics. Cetuximab, panitumumab and erlotinib were purchased from the Fox Chase Cancer Center pharmacy; CPT11 and C1368 from Sigma-Aldrich (USA); Stattic and Ro-318220 from EMD Chemicals (Gibbstown, N.J., USA). PHA-680632 was obtained from Nerviano Medical Sciences (Nerviano, Italy), as a kind gift of Dr. Jurgen Moll. Enzastaurin was generously provided by the Elli Lilly Company (Indianapolis, Ind.). All antibodies used in Western blot experiments were purchased from Cell Signaling (Danvers, Mass., USA), except anti-p53 mouse monoclonal antibody was from Calbiochem (EMD Biosciences, USA).

EGFR Network Construction. Methods for Library Construction.

Four sources of information were used, including 1) published EGFR pathway maps, 2) human protein-protein interaction (PPI) data, gleaned from various databases, 3) human orthologs of PPIs and genetic interactions modeled from Drosophila, and 4) microarray data obtained at brief intervals after treatment of cells with stimulators or inhibitors of EGFR/ErbB2. Following initial assembly of a larger gene list, genes were parsed into high confidence (“core”, denoted as “1” after the corresponding letter code) versus lower confidence sets (denoted as “2”), based on the confidence criteria outlined for each section below. For each category of information, all “core” components were included in the final library, as were genes noted as lower confidence but included in at least two categories of search criteria (e.g., second order protein-protein interaction and microarray linkage). Finally, for the assembled set of EGFR interactors, multiple paralogous genes were identified in humans using the KEGG Sequence Similarity DataBase (SSDB) resource, see the world wide web at .genome.jp/kegg/ssdb/. 77 paralogs of the best-characterized and biologically significant genes were added to the set. All data storage, handling and analysis were done primarily in Cytoscape (on the world wide web at cytoscape.org).

1) Pathway map sources. Protein names for were extracted from the following pathway maps focused on EGFR: STKE (on the world wide web at stke.sciencemag.org/cgi/cm/stkecm %3BCMP14987); Biocarta (on the world wide web at biocarta.com/pathfiles/PathwayProteinList.asp?showPFID=102); the Systems Biology model repository (on the world wide web at systems biology.org/001/005.html); NetPath (on the world wide web at netpath.org/pathways?path_id=NetPath 4); and from Protein Lounge (on the world wide web at proteinlounge.com/pop_pathwaysl.asp?id=EGF+Pathway). Protein names were individually inspected and, where necessary, converted to the corresponding official (NCBI/EMBL) symbols. Proteins mentioned on at least two EGFR-centered pathways were designated as “pathway core”; we note, significant divergence was seen among different interpretations of the “EGFR pathway” by the 5 sources.
2) PPIs. EGFR/ERBB1 and ErbB2 were used as seeds for PPI searches. Curated information regarding human PPIs of these seeds was collected from the following databases: Biomolecular Object Network Databank (BOND) (on the world wide web at bond.unleashedinformatics.com/); General Repository for Interaction Datasets (on the web at thebiogrid.org/); EMBL_EBI IntAct on the web at ebi.ac.uk/intact/site/index.jsf); The Human Protein Reference Database (on the web at hprd.org/); Kyoto Encyclopedia of Genes and Genomes (KEGG) (on the web at genomejp/about_genomenet/service.html); and Prolinks Database 2.0 (on the web at mysq15.mbi.ucla.edu/cgi-bin/functionator/pronav). Data for first rank (direct) interactors were collected both by export from the corresponding database and subsequent import into Cytoscape, and by directly querying those databases using the BioNetBuilder plugin (on the web at err.bio.nyu.edu/cytoscape/bionetbuilder/), and then cross-comparing retrieved results. Data for the second order interactions were obtained by using EGFR and ERBB2 first rank interactors as seeds for an additional round of query, and only through the BioNetBuilder plugin. Finally, an orthogonal set of second rank interactors was obtained by analysis of protein complexes with more than 2 subunits, which included EGFR. Information for complexes was obtained from BOND and IntAct, and manually compared to the lists in the corresponding publications. We also used the SHC1 and SHC3 adaptors, which bridge between EGFR and downstream signaling effectors, and the CAS (EFS, BCAR1, and NEDD9) scaffolding proteins, which connect EGFR to the SRC and TGF-β core signaling cascades (O'Neill et al., (2000) Trends Cell Biol. 10:111; Defilippi et al. (2006) Trends Cell Biol. 16:257), as seeds for first order PPI searches. Second order PPIs EGFR and ErbB2 were ranked higher (i.e., P1) if they were also first order interactors of SHC or CAS proteins.
3) To extract a set of EGFR-centered interactions potentially conserved between humans and D. melanogaster, information assembled by the Michigan Proteomics Consortium in the Drosophila Interactions Database (DIP) (on the web at proteome.wayne.edu/PIMdb.htm) was used. Briefly, this database integrates genetic and or protein interaction data from a variety of non-mammalian species (yeast, worms, flies). Of 105 EGFR interactors (almost exclusively from Drosophila genetic interactions), 65 had 1-2 conserved human orthologs (117 genes).
4) Microarray data were obtained from The Gene Expression Omnibus (GEO, release date Dec. 15, 2006). In the selected dataset (GSE6521; raw data available at on the web at ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE6521), MCF-7 human breast cancer cells were incubated with the growth hormone heregulin (HRG), or AG1478 (an EGFR kinase inhibitor), or both growth hormone and AG1478. Controls were set as growth hormone/inhibitor non-treated cells. A total of 348 genes with a >1.5 fold change (+ or −) upon AG1478 treatment was identified. In this group, the core set includes 89 genes which showed a >2-fold change in expression level upon AG1478 treatment, or which were inducible by HRG (>1.5 fold) and repressible by AG1478 (>1.5 fold).
High Throughput siRNA Screening Methods.

The custom siRNA library targeting 638 human genes was designed and synthesized with two siRNA duplexes for each gene target (Qiagen, Valencia, Calif.). Transfection conditions were established for the A431 cervical adenocarcinoma (K-Ras wt, p53 mutant) cell line (data not shown) using PLK1 & GL2 siRNA controls to achieve Z′ values of 0.5 or greater. IC values using erlotinib, panitumumab, and camptothecin (CPT11) were established (data not shown). Details of establishment of Z′ factor for transfections, and statistical consideration for selection of preliminary positive candidates graphically outlined in FIG. 4B, and based on standard approaches described in detail in Whitehurst et al., (2007) Nature 446:815). For each gene targeted, two independent siRNA duplexes were combined and arrayed in 96-well plates with a layout intended to seed in regular positive siRNA (targeting PLK1) and negative control siRNA (targeting insect luciferase GL2, Thermo Fisher Scientific, USA) amongst test siRNAs. A reverse transfection protocol was used where siRNA at final concentration of 50 nM was mixed with Dharmafect 1 transfection reagent according to the manufacturer's instructions (Thermo Fisher, USA). Cells (3500 per well, resuspended in 1% FBS/DMEM) were added directly to wells using an automated liquid dispenser. At 24 hr following transfection, two replica plates were treated with drugs at previously established IC30 or 0.02% DMSO diluted in culture media. The viability at 96 hr post-transfection was assessed using Alamar blue (CellTiter Blue Viability Assay, Promega, USA). Dose-responses for each drug and cell line were retested in parallel with each screen.

For screening, A431 cells were transfected with siRNA followed by exposure to vehicle (0.02% DMSO), or drug used at inhibitory concentrations of 30% (IC30). Viability was determined for each target gene and normalized to the averaged GL2 viability on each plate. Sensitization index (SI) was calculated for each individual well on a 96-well plate as SI=(Vdrug/GL2drug)/(VDMSO/GL2DMSO), where V was viability in wells transfected with targeting duplexes and GL2 was the averaged viability of 4 wells with non-targeting negative control siRNA on the same plate. All calculations were automated using cellHTS package within open source Bioconductor Package (on the web at bioconductor.org) (Gentleman et al. (2004) Genome Biol. 5:R80). The effect of drug treatment on viability was measured based on the normalized viabilities in the drug treated and vehicle wells using Limma (Smyth, G. K. (2004) Statistical Applications in genetics and molecular biology 3, Article 3). Limma borrows strength across genes based on an empirical Bayes approach and identifies statistically significant changes in viability by combining information from a set of gene-specific tests. Hits were identified based on statistical significance as well as biological significance. Statistical significance was determined by p-value controlled for the false discovery rate (FDR) using the Benjamini-Hochberg step-up method (Benjamini et al. (1995) J. Royal Stat Soc B 57:289) to account for multiple testing. Hits showing an FDR of less than 20% were considered statistically significant. Biological significance was arbitrarily defined as an increase or decrease in SI greater than 15%. Hits identified as statistically and biologically significant were further validated.

Primary sensitizing hits obtained with erlotinib and/or cetuximab were further tested with erlotinib and DMSO in the A431 cell line by using 4 siRNA duplexes individually (the two originally used in the screen, plus two new non-overlapping RNA oligoribonucleotides), to confirm the sensitization phenotype at 10 nM and 50 nM concentrations. Hits were considered as validated by this method if at least 2 out of 4 siRNA reproduced the sensitization phenotype with SI≦0.85, FDR≦20% for each individual siRNA sequence in at least two independent experiments. For a number of hits, we additionally confirmed sensitizing siRNAs reduced mRNA levels for the targeted genes, using qRT-PCR; and used Western analysis to confirm protein knockdown (data not shown).

Cell Line Specificity of Hit Activity.

Of the confirmed set of 61 siRNA targets identified for erlotinib in A431 cells, 45 were further tested for sensitization to erlotinib, cetuximab and camptothecin in A431 versus refractory adenocarcinoma cell lines for which optimal transfection conditions and drug sensitivity had been established. In this analysis, for each target, the two most active siRNA duplexes identified during the validation stage were pooled in a 96-well format, cells were reverse-transfected and drug-treated under conditions similar to those described above for the initial A431 screen. SI and statistical significance were calculated as in the validation experiments. All experiments were performed at least three times independently.

In subsequent data analysis, two approaches were used. For the relative ranking approach, for each experiment, SI values for each siRNA pool were ranked from the strongest (assigned a value of 0) to the weakest (assigned as 1). For all experiments performed with a given cell:drug combination (e.g., A431:erlotinib, or HCT116:CPT11) averages were determined based on at least three experimental runs. The averaged data were imported and clustered in MultiExperiment Viewer (MeV43) software (Saeed et al. (2003) Biotechniques 34:374), and dendrograms were created using HCL Support Trees (using Euclidian Distance as a metric, and bootstrapping with 100 iterations). For the absolute threshold approach, specific SI thresholds were applied for each data point, considering only data with an FDR ≦20% in each independent experiment. Data were visualized in MultiExperiment Viewer using color assignments to indicate SI cutoffs obtained in at least two independent experiments, as described in figure legends. The resulting output of both analytic strategies was processed in standard graphic software to improve visualization of data.

Quantitative RT-PCR.

For evaluation of expression of validated target genes, each of the cell lines was grown to 70% confluency in full DMEM media, then total RNA was extracted using RNeasy Minikit (Qiagen, Valencia, Calif.). To confirm mRNA depletion by siRNA, 48 hrs after transfection of A431 cells grown in 96-well plates, total RNA was extracted at using a Cell-to-Ct kit (Applied Biosystems, Foster City, Calif.). Subsequent quantitative RT-PCR reactions were performed using TaqMan probes and primers designed by the manufacturer, using an ABI PRISM 7700 detection system (Applied Biosystems, Foster City, Calif.). The results were analyzed using the comparative Ct method to establish relative expression curves.

To assess whether gene expression levels correlated with the ability of gene-targeted siRNAs to inhibit intrinsic cell growth, we used a Pearson correlation of the mean values of gene expression relative to that obtained in A431 cells measured by RT-PCR, against the mean growth observed in DMSO-treated cells in all experiments. To test significance, we performed 100 permutations of the cell line labels in the RT-PCR measurements and generated Pearson correlation values. Significance was defined as a false discovery rate (FDR) of 5%, setting Pearson correlation greater than 0.745 or less than −0.71 for positive correlated or negative-correlated, respectively. Positive correlation indicates that higher expression (lower number of RT-PCR cycles) is correlated with greater growth inhibition, while negative correlation indicates higher expression is correlated with lower inhibition.

Network Analysis with Hits.

For all genes in the library, the String search engine (Jensen et al., (2009) Nucleic Acids Res. 37:D412) was used in subsequent analysis to augment information on PPIs in human cells, PPIs between homologous genes in model organisms, database/pathway links, and textmining (coappearance of gene names in PubMed). Data regarding experimentally proven interactions in human and model organisms were merged. Topological properties of the library network were assessed using NetworkAnalyzer plugin for Cytoscape (Assenov et al., (2008) Bioinformatics 24: 282), based on STRING-expanded defined interactions among genes in the library (based only on experimental data). In this analysis, for each node, degree (reflecting the number of edges linked to it), stress (reflecting how frequently it lies in the shortest paths connecting other nodes), and neighborhood connectivity (the average number of neighbors for each direct interactor of the node) were separately assessed. The topological coefficient was calculated to provide an estimate for the trend of the nodes in the network to have shared neighbors. To provide additional context in some analyses (FIG. 14) STRING-extracted information from pathway databases and textmining data were merged, and displayed using Cytoscape as indicated in figure legends.

Apoptosis Assays.

Apoptosis was measured using the Annexin V assay (Guava Technologies, Hayward, Calif.) Annexin V-positive A431 cells were counted using Guava flow cytometry 72 hours post transfection, 48 hours after treatment. Statistical significance versus control GL2 siRNA was determined by logistic regression models to identify genes increasing apoptosis with erlotinib relative to vehicle.

Pathway Analysis.

To measure the effect of siRNAs on the activity of EGFR effectors, cells were transfected with siRNA, and the culture media replaced with glutamine-supplemented serum-free DMEM at 24 hrs post-transfection. After overnight incubation, cells were treated with DMSO, erlotinib or PHA-680632 for 2 hrs, then either left untreated, or stimulated with EGF at 15 ng/ml for 15 minutes. Cell extracts were prepared using M-PER™ mammalian protein extraction buffer (Thermo Scientific, Rockford, Ill.) supplemented with the Halt™ phosphatase inhibitor cocktail (Thermo Scientific, Rockford, Ill.) and the Complete Mini™ protease inhibitor cocktail (Roche Diagnostics Gmbh, Manheim, Germany). Extracts were centrifuged at 15,000 g for 10 min at 4° C. Western signal detection was performed using antibodies to indicated proteins with LiCor technology (Lincoln, Nebr., USA) or standard X-ray film.

For phosphoproteomic analysis, we used the Proteome Profiler™ array (R&D Systems, Minneapolis, Minn., USA) according to the manufacturer's protocol. In brief, A431 cells were grown for 24 hours in DMEM supplemented with L-glutamine and 1% FBS to 70% confluency. Cells then were either serum starved overnight or remained in the same media. Serum starved and cells incubated in 1% serum were either left untreated or incubated with IC30 concentrations of inhibitors for 3 hours. For FIG. 19A, we used erlotinib at 0.5 μM and PHA-680632 at μM alone or in combination; for FIG. 19B, erlotinib at 1 μM and PHA680632 at 0.5 μM individually, and erlotinib at 0.5 μM plus PHA at 0.1 μM in combination. Serum-starved cells were subsequently stimulated with recombinant EGF (Sigma-Aldrich, USA) at 15 ng/mL for 15 minutes before lysis. For a subset of phospho-proteins, phosphorylation status was confirmed by Western blot. Quantification was done using ImageJ software.

Drug Synergy Testing.

The coefficient of interaction (CI) between pharmacological inhibitors was established by the Chou-Talalay method (Chou et al., (1984) Adv Enzyme Regul 22:27). The software package CalcuSyn (BioSoft, UK) was used to automate calculations. Briefly, for each drug tested, an IC50 curve was established in each cell line, and used to select combination doses of drugs for subsequent synergy tests. 3500 cells were plated per well in 96-well plates. After 24 hours, cells were treated with serial dilutions of individual inhibitors, or combinations of two inhibitors maintained at a constant molar ratio. After 72 hours incubation, cell viability was measured using either CellTiter Blue (Promega, USA) or a WST1 assay (Roche Applied Science, Indianapolis, Ind.). The CI values for each dose and corresponding cytotoxicity were expressed as the fraction affected (Fa) and were calculated using CalcuSyn computer software and presented as Fa-CI plots. CI values <1 indicate synergy, and <0.5 strong synergy, between the two agents in producing cytotoxic effect.

Anchorage-Independent Growth and Cell Motility.

Soft agar assays were done essentially as described (10). Cells were seeded at 2000 cells per well and grown for 2-3 weeks. Colonies were stained with thiazolyl blue tetrazolium bromide, and scored using a Nikon SMZ1500 microscope coupled with Cool Snap charge coupled device camera (Roper Scientific, Inc., Tucson, Ariz.) with Image Pro-Plus software (Media Cybernetics, Silver Spring, Md.). Survival curves were based on at least two concentration points, with values determined in at least two separate experiments, with each assay done in duplicate. Drug interactions were calculated as above using CalcuSyn software (Biosoft, Ferguson, Mo.) to establish the combination index (CI). For motility assays, movement of A431 cells grown in 1% FCS into a scratched area of the monolayer was monitored with a phase contrast 10× objective using an inverted microscope (Nikon TE2000). Images were obtained every 20 min for 18 hours. Areas of migration were estimated using MetaMorph software. For both studies, analysis of variance was used to determine the treatment effect for each comparison. The logarithm of normalized ratios (to vehicle control) was used in the analysis. Multiple hypothesis testing was accounted for by the false discovery rate method of Benjamini & Hochberg (supra).

Tumor Formation in vivo. Male CB.17/scid mice aged 6-8 weeks were obtained from the Fox Chase Cancer Center breeding colony. All experiments were carried out according to protocols approved by the institutional animal use committee. Mice were injected with 3×106 A431 cells subcutaneously into the flanks Palpable tumors appeared in all animals in 10-14 days, and were measured 3 times a week in two dimension and volume calculated by modified ellipsoidal formula as Length×Width2×0.52. Mice were randomized and treatments commenced when tumor volume exceeded 65 mm3. Erlotinib at doses 10-20 mg/kg was given by oral gavage as in 10% DMSO/saline. Enzastaurin was suspended in 5% dextrose in water and dosed at 75 mg/kg by gavage twice daily. PHA-680632 was freshly dissolved in acidified 5% dextrose in water and administered intraperitoneally twice daily at 15 mg/kg dose. The generalized estimating equations approach (with an autoregressive correlation structure) was used to model tumor growth. A linear time-effect was included in the model for the logarithm of tumor volume and interacted with the treatments in each comparison.

The following examples are provided to illustrate certain embodiments of the invention. They are not intended to limit the invention in any way.

Example I Identification of sensitizing siRNA molecules

To generate an EGFR interactome library, we extensively mined public access databases containing information about protein-protein interactions and mRNA expression profiles generated in humans. These databases included among others NetPath, BioGrid, DIP, BIND, KEGG, HPRD, CellCircuits, and NCBI GEO, as well as five different “expert systems” focused on pathway analysis (NetPath, Protein Lounge, Molecular Systems Biology, Biocarta, Science's STKE). This approach identified a set of genes for which the encoded proteins either directly bound EGFR, EGFR-family members such as ERBB2 and ERBB3, and their immediate downstream effectors, or were purified in complexes including these proteins; a set of genes transcriptionally upregulated by EGFR family stimulation and downregulated by EGFR pathway inhibition; and a set of genes otherwise involved in EGFR signaling based on published literature. We also incorporated data generated from genetic interactions reported in Drosophila, C. elegans, and other organisms for strongly conserved evolutionary orthologs of genes in this pathway (11, 12). Using resources in the systems analysis programs Cytoscape and Osprey, we then identified a core high value set of genes that fell into at least two of these linkage categories, and based on other weighting functions. FIG. 1 schematically represents the source for each of the genes in the final custom library.

Drug resistance and propensity to metastasis commonly both characterize the most aggressive tumors. A growing number of proteins that function in pro-metastatic signaling pathways related to cellular invasiveness are also known to function in promoting apoptosis resistance (via modulation of integrin- and cadherin-dependent signaling cascades). To enrich our candidate siRNA set, we then performed a similar analysis for genes physically and functionally linked to TGFβ, Src and NEDD9. It is becoming well established that cancer metastasis requires parallel inputs from EGFR superfamily members, and the Src and TGFβ signaling pathways (13, 14). NEDD9 (also known as HEFT) has long been studied in the Golemis laboratory (15, 16), and elevated expression of NEDD9 has recently been shown to be a critical driver of melanoma metastasis, and linked to metastasis in lung cancers (17, 18); moreover, NEDD9 physically interacts with multiple components of the EGFR/Ras, TGFβ, and Src signaling pathways (19, 20). FIGS. 2 and 3 show an example of the degree of functional overlap between EGFR family and TGF-13/NEDD9 signaling networks.

From these combined data mining efforts, we selected a set of 638 target genes (see Table 1). These genes were ordered as a custom library from Qiagen. Two independent siRNAs for each gene were pooled and arrayed in wells. For the screening experiment, aliquots of the library were transferred to the inner 60 wells of 11 assay plates with a layout intended to seed in negative control siRNA (siControl targeting insect luciferase transcript, Dharmacon), positive control cytotoxic siRNA (targeting Polo-like kinasel), and cytotoxic drug (0.7 mM campthotecin). The siRNA was mixed with the transfection reagent (Dharmafect 1, Dharmacon) diluted 1:100 in Hank's balanced saline in a total volume of 22 ml to produce 25 nM final concentration of each siRNA oligo. The mixture was incubated for 45 minutes. A reverse transfection protocol was used (9) where cells resuspended in DMEM/1% FBS/Glutamine were added at 4000 per well to the assay plates using a Thermo Multidrop bulk reagent dispenser. After overnight incubation, 10 ml per well of the drug was added. For each screening experiment, the effective inhibitory concentration (IC) of the screen drug was pre-determined by rigorous IC50 testing, and screens were consistently performed aiming for IC30-40 range. Viability was measured in the Perkin Elmer Envision plate reader using fluorescent metabolite of Alamar blue (CellTiterBlue TM, Promega).

Screening Conditions: Initial Selection and Optimization.

Our initial screens were performed in A431 cells, for two compelling reasons. First, we wanted to maximize our chances of obtaining any hits that would sensitize to EGFR-targeting antibodies. A431 cells are well known to over-express the EGFR receptor, and to be exquisitely sensitive to inhibition of EGFR-dependent signaling. Second, as outlined below, we have had the opportunity to add value to our screening strategy based on addition of a high throughput microscope-based detection system: based on their regular growth properties, A431 cells have proven excellent for this purpose.

As a second conservative approach, initial EGFR-pathway sensitization screens were performed with panitumumab, and also with the small molecule erlotinib. This was done because of literature suggesting that a significant component of the anti-tumor effect of EGFR-targeting antibodies arises from cell-mediated immunity, which would not apply in cultured cell lines. This restriction should not apply with erlotinib. Because of the relatively low cost of screening, this project also serves as an opportunity to probe the overall “resistance structure” of the EGFR signaling pathway, by examining the overlapping pattern of “hits” arising from drugs targeting different points along the pathway. Hence, we have now screened A431 cells for siRNA sensitizers to erlotinib, panitumumab, and U0126 (targets MEK1), in each case normalizing against the base line inhibitory profile of each siRNA in cells treated with a DMSO (vehicle) control. We have also screened the A431 cell line with CPT11 (an active camptothecin analog of irenotecan). We anticipated that comparison of the CPT11 hit pattern with the EGFR-Ras-MEK1 inhibitor pattern would segment siRNAs into 3 classes: those that sensitize to CPT11 and EGFR-Ras-MEK1 inhibitors, targeting general apoptosis-resistance genes; and those specific either to CPT11 or the EGFR-Ras-MEK1 pathway. Knowledge of each these classes has specific value for specific therapeutic/biomarker applications.

Library Screening: Additional Cell Line Models, Strategy.

A growing consensus among clinicians is that a major source of resistance to EGFR-targeted therapies is the presence of an activating K-Ras mutation (present in up to 70% of resistant tumors) or an activating B-Raf mutation (present in up to 10% of resistant tumors). The colon cancer cell lines HCT116 harbors an activating K-Ras mutation, conferring relative resistance to the EGFR antagonists in vitro. The HCT116 colorectal carcinoma cell line offers advantage of comparison between p53null and p53-positive (intact apoptotic checkpoint) isogenic variants (9) which will be important to determine the p53-dependency of the synthetic lethal phenotype and the mechanism of apoptosis induction. Conditions for these cell lines have been established for siRNA-based screening with high siRNA transfection efficiency (>75% depletion of two housekeeping genes GADPH, PLK1); and consistency in Alamar Blue viability yielding robust Z′-scores with control drugs (see Results below). Additional cell lines with activating mutations in B-Raf will also be worked up for hit validation.

We are using these additional cell lines in two ways. For HCT116, we will repeat interactome library screens essentially as performed in the A431 cell line, using DMSO (vehicle), erlotinib, and CPT11. We will determine whether the overall landscape of hits is similar, or distinct. We anticipate that CPT11 may yield a similar profile in the two lines, while erlotinib may yield a different, extremely restricted, hit map. Hits arising from this screen that also were detected in the A431 line would obviously be of particular interest. Second, for selected, validated hits in the A431 cell line that are of specific interest based on the validation steps described below, we will selectively analyze these hits in HCT116 positive and negative for p53, and in LoVo cells. A summary of our complete set of screens is shown in FIG. 4.

Statistics for Preliminary Selection of Positives.

Positive candidates from the first 5 screens were selected based on standard approaches described in detail in (9) and Swanton et al. (9, 21). Specifically, the Alamar blue fluorescence intensity in the assay wells (R) read after 2 hours of incubation was normalized to the mean siControl (C) on each plate (R/C). The effect of drug treatment on viability was measured based on the normalized viabilities in the drug treated and vehicle wells using Limma (22), Limma borrows strength across genes based on an empirical Bayes approach and identifies statistically significant changes in viability by combining information from a set of gene-specific tests. We utilized the Limma implementation in the Open Source R/Bioconductor Package (available on the world wide web at bioconductor.org) (23), Hits were identified based on statistical significance as well as biological significance. Statistical significance was measured by p-values controlled for the false discovery rate (FDR) using the Benjamini-Hochberg step-up method (24) to account for multiple testing. Hits showing an FDR of less than the desired cut-off were considered statistically significant. The choice of the cut-off itself was flexible. Biological significance was measured by a change of at least 20% in viability relative to vehicle treated cells. Hits identified from each of the above filters were combined and a list of common hits showing greater statistical and biological significance (lower FDR and at least 20% change in viability) were identified.

An initial question working with a custom library is whether a custom panel of siRNAs pre-selected to be relevant to EGFR signaling might contain many siRNAs that strongly inhibit cell growth even in the absence of drug treatment. FIG. 5 plots the baseline degree of growth inhibition for each of the siRNAs used in A431 cells treated with DMSO vehicle. From 638 genes, only 145 reduced cell growth more than 20%,44 more than 30%, and 13 more than 40% (FIG. 5A). This profile contrasted favorably with results observed in the high throughput screening facility with other custom siRNA libraries such as a “cell cycle” library, in which a high percentage of the siRNAs significantly inhibited cell growth, and suggested that inhibition of the EGFR interactome siRNA targets did not induce broad cell cycle arrest or cell death absent drug treatment.

An important fundamental question in relationship of the likelihood of identifying drug sensitizing siRNAs that are useful in predicting a useful clinical strategy is, do the sensitizing siRNAs selectively emerge from the part of the library that intrinsically inhibits cell growth? Or in other words, does sensitization simply reflect the idea that an unhealthy cell is more likely to succumb to drug treatment, or are there specific siRNA-drug interactions? We compared the distribution of siRNAs selected as hits for erlotinib (FIGS. 5A, 5B) or CPT11 (FIG. 5B) versus the ability of the siRNA to reduce cell viability in cells treated only with DMSO (blue). FIG. 5A shows that sensitizing hits were found in bins containing siRNAs intrinsically inducing a 0.6-1.2 relative viability versus control-treated cells. FIG. 5B, which graphically represents all 638 siRNAs aligned from greatest inhibitory effect (left) to least (right) based on behavior with DMSO (blue line): CPT11 (red) and erlotinib (gold) hits are evenly distributed along the gradient. Importantly, FIG. 5C redraws FIG. 5B to indicate the degree of sensitization obtained with each siRNA. Strong hits (indicating those selectively reducing viability to 0.7 or less in the presence of drug versus DMSO) were found among siRNAs that had intrinsic activity in reducing cell growth (e.g., green box) and among those that had no such activity (purple box). siRNAs in the purple box particularly interesting for therapeutic development, as they possess no intrinsic toxicity, and exhibit specific dependence on drug treatment for efficacy.

Microscopy-Based Analysis:

In addition to possessing high throughput robotics supporting a platereader, we also employed a Molecular Devices ImageXpress automated microscope. The ImageXpress captures 1-2 fields, representing 100-200 cells, for each individual well of a 96 well microtiter plate (see FIG. 6); time required to obtain readout from 22 plates in a single screen is typically 2-3 hours. The Acuity software used in association with this system is a sophisticated capture/analysis program for the acquired images; in addition, the system exports specified information classes in Excel format, for application of additional analytic approaches. This capacity allows us to record changes in cell spreading and morphology, or staining with specific indicator dyes and antibodies, as additional primary parameters indicating physiological response to an siRNA/drug combination. We have used calcein labeling to paint metabolically active, viable cells, and Hoechst to stain the DNA of all cells. It is clear that a subset of the siRNAs are inducing striking differences in calcein/Hoechst staining suggestive of specific biological responses to drug treatment (e.g., cytokinetic failure; see FIG. 7), yielding a potential hit list that is non-equivalent to the platereader-based hit list. Further analysis of this data is discussed below.

Initial Hits.

Table 2 summarizes the set of hits obtained to date based on screening the library with erlotinib, panitumumab, U0126, and CPT11, so far extracted solely from plate reader data. In each case the SI (sensitization index) value reflects reduction of Alamar blue signal in relation to the same siRNA used in combination with DMSO/vehicle. Taking as initial threshold for hit selection reduction of signal 20% below vehicle, 145 hits (representing a hit rate of 23% of the total library) were obtained with erlotinib, 19 (3%) with panitumumab, 55 (9%) with CPT11, and 7 (1%) with U0126.

Color-coding indicates a subset of hits that are identified with more than one drug treatment (Table 1; also see Venn Diagram, FIG. 8). In particular, the three classes of hits predicted—common for CPT11 and EGFR-pathway targeting, or specific to each class—were obtained. Hits highlighted in pink were found in common with erlotinib, panitumumab, and CPT11, and are taken to represent general survival factors. Hits highlighted in green were specific to CPT11, while hits highlighted in purple were specific for erlotinib and/or panitumumab. While U0126 yielded many fewer hits overall, all of the hits identified were found to overlap either with the general survival factor group, or the erlotinib/panitumumab group.

Analysis and Conclusions.

We will also perform additional validation experiments described below. However, preliminary consideration of the hit profile obtained to date is suggestive in a number of ways that indicate the clinical relevance of this data. First, erlotinib and panitumumab yielded a large number of overlapping hits. This seems highly unlikely to be a random occurrence. Second, we have used the Cytoscape resource to map the profile of interactions among the screening hits (FIG. 9). A number of the hits that have emerged physically interact with each other, or are known to act in common signaling cascades. As one provocative example, ALK, BCAR1, BCAR3, and CXCL 12 are common components of an integrin-linked general survival pathway (25-27); siRNAs for these genes were identified as strong hits for both erlotinib and CPT11. Third, some siRNAs emerging as strong hits have been previously implicated as highly relevant to EGFR-dependent cell signaling, based mechanistic analyses performed in cell culture, and in some cases demonstrations of resistance factors in tumors. Examples of these include ERBB3 (28,29), PLCG2, and specific protein kinase C family members (30).

We have also identified a set of siRNAs that induce resistance to erlotinib, panitumumab, and CPT11. These include siRNAs that have little or no effect on the viability of cells treated solely with vehicle. However, these siRNAs reduce the ability of panitumumab and/or other agents to decrease cell viability. It appears such genes may target suicide pathways specifically triggered by drug treatment, and as such, these genes may also be valuable for exploitation to improve therapy. Further study of these genes will also inform our understanding of drug resistance mechanisms.

Example 2 Screening Additional Cell Lines for Altered Sensitivity

There is an emerging consensus that a significant degree of the resistance to EGFR-targeting agents is due to activating mutations in K-Ras or B-Raf. Because of the central role of Ras in modulating apoptosis, these mutations may similarly confer resistance to agents such as irenotecan. Following screening and hit validation in the A431 cell line we will perform two classes of screen in colorectal cancer cell lines with mutated K-Ras (HCT116, LoVo) or B-Raf (e.g, WiDr, TCO. First, we will use the same regimen of comparing DMSO, erlotinib, and CPT11 screens as described above for A431 cells, but instead use HCT116 cells to identify a validated sensitization network. Second, we will take all validated hits from the A431 and HCT116 screens, and test them for sensitization in the LoVo and WiDr cell lines.

A relatively small subset of A431-predicted sensitizing siRNAs will be active in conjunction with erlotinib in the resistant cell lines. Among these, siRNAs identified as broadly sensitizing (to erlotinib as well as CPT11), are likely to maintain activity. A higher percentage of the siRNAs identified as sensitizing solely to CPT11 would maintain activity. It also appears that siRNAs targeting genes “upstream” of KRas would be less likely to function in K-Ras mutated lines than siRNAs targeting genes “downstream”, or in independent signaling pathways.

Sensitizing siRNAs will be identified for erlotinib and/or CPT11, but they will be very different from those identified with A431 cells. This outcome would initially suggest that some mRNAs for sensitizers well expressed in A431 cells are not present in HCT116 and other model cell lines, and vice versa. This could be immediately tested with qRT-PCR; if so, sensitization strategies will be tailored based on cell lineage. Regardless of outcome, the results of these experiments will facilitate identification of the factors controlling resistance as a factor of drug resistance network function.

Example 3 Identification of the Network Structure of the Validated Hits

The sensitization network construction shown in FIG. 8 will be refined and expanded. We will create a “live”, interactive resource, with each hit portrayed as a clickable “node” linked back to full information for the gene, and each interaction among hits as a clickable “edge” linked to full information describing the validation of the interaction. We will systematically compare the networks in the sensitive versus resistant cell line. We will compare the properties of the networks conferring resistance to EGFR-targeting agents, CPT11, or both. We will compare the networks of genes sensitizing to erlotinib, panitumumab, and U0126, to gain insight into the epistatic interactions regulating cell survival following inhibition at different stages of the EGFR-Ras-Raf-MEK1 signaling pathway.

Example 4 Identification of “Complementation Groups” that can be Targeted in Parallel to Achieve Super-Sensitization

Complementation groups define sets of genes whose protein products work in a single pathway or multi-protein complex, providing a single chain of input into a biological endpoint. In synthetic lethal analysis, targeting two members of the same complementation group will not enhance the endpoint phenotype, but targeting two members of different complementation groups, which provide parallel input into the biological endpoint, will enhance the final phenotype. The network mapping analysis described above has the potential to identify important “sensitization complementation groups”, which we define as small clusters of proteins known to physically interact with each other, or act in proximity on a sub-pathway: the BCAR1-BCAR3-CXCL 12-ALK cluster would define one such group. After segmentation of the hit network into proposed complementation groups, we would determine the consequences for sensitization of simultaneously targeting two siRNAs within the same group (e.g., BCAR1 and BCAR3) versus different groups (e.g., BCAR1 and BCL3). We will thus identify synergistic interactions that can greatly sensitize cells to the effect of treatment with EGFR-targeting agents, CPT11, or potentially both.

Example 5 Extrapolation from siRNA-Based Sensitization to Drug-Based Sensitization

The set of genes included in the EGFR interactome includes many plasma membrane associated receptors and kinases that had already drawn clinical interest, and for which small molecule and/or antibody inhibitory agents already exist. Some of these inhibitory agents have already passed through Phase I/II trials, and are being effectively used in the clinic. First, we will test whether combination of the siRNA-matched drug with erlotinib (and panitumumab, or CPT11, as appropriate) produces a notable synergistic effect using Alamar blue assay to detect reduced viability in A431 and HCT116 cells. We will determine whether the erlotinib-drug combination has a similar mode of action (see Example 6) as the erlotinib-siRNA combination. We will use the A431 and/or HCT116 cell lines to establish xenografts in nude mice, and erlotinib-drug combination in vivo synergy. This analysis provides the means to rapidly identify valuable synergies that would be immediately translatable to the clinic.

Example 6 Elucidation of the Mode of Action of Sensitizer siRNAs

We will first assess if siRNAs directly affect the expression, activation, or localization of the EGFR receptor itself. We will use antibodies to EGFR and phospho(active) EGFR in Western analysis of cell lysates treated with each siRNA, to look for siRNA-dependent loss of signal. We will use antibody to EGFR and the early endosomal marker EEA 1 in immunofluorescence experiments to determine whether siRNAs induce increased internalization of EGFR from the cell surface. As part of microscope-based analysis, we will also determine whether siRNAs specifically alter the morphology (attachment; cytoskeletal integrity) of drug-treated cells. Reciprocally, we will also determine whether EGFR signaling regulates the genes targeted by the sensitizing siRNAs. We will use qRT-PCR to determine whether treatment of quiescent cells with EGFR stimulates expression of the sensitizing genes, and whether treatment of actively growing cells with panitumumab or erlotinib influences expression of these genes. We will also use FACS and/or Guava analysis to measure whether specific siRNAs confer cell cycle arrest and/or apoptosis.

Example 7 Microscope-Based Analysis of Cells Following Identification of Hits Detected by Reduced Alamar Blue Signal

A complete database of images of calcein- and Hoechst-stained cells from experiments performed in exact parallel with the Alamar blue values (FIGS. 5 and 6) is being assembled. As noted above, even cursory analysis has indicated that some of the siRNAs are producing unusual patterns suggestive of cytokinetic blocks, early stages of apoptosis, unusual cell morphology, etc, and that some of these hits are nonequivalent to those identified by searching for loss of Alamar blue signal. We will extend this analysis in several ways. First, we will run a series of controls (drug treatments, siRNA treatment) known to induce the specific biological endpoints (cytokinetic block, etc) that we believe are suggested by the data, and compare profiles. We will analyze overall cell population properties using the Acuity software associated with the high throughput microscope, and also use customized analysis developed together with the FCCC Biostatistical facility to quantitate the appearance of sub-groups within the larger profiles.

The congruence of specific endpoint phenotypes (cytokinetic block; reduction in cell spreading; etc) with the overall Alamar blue hit list can be established. We will also validate the hits by a similar strategy to that used above for Alamar blue hits, i.e., regenerating the phenotypes with independent siRNAs, and confirming that degree of mRNA depletion of target correlates with degree of induction of the phenotype. This analysis is extremely likely to result in the addition of new siRNAs to the hit list, ie., siRNAs that induce phenotypes that are ultimately likely to result in cell death, but which have sufficiently delayed action that moribund cells did not score as positive using

Alamar blue-based cutoff values.

Next, we will repeat the network construction analysis described above (Examples 3 and 4). This will be done in two ways: by analyzing the expanded network (Alamar blue hits+microscope hits), and by analyzing networks associated with specific phenotypic endpoints. This can extend definition of sensitization clusters/complementation groups, and may bring more druggable (or already drugged) targets into the groups. It will also illuminate the mechanism by which sensitization is induced. As a hypothetical example, one cluster of closely interacting proteins includes some with strong Alamar blue sensitization to erlotinib, and several members that induce loss of cell area only in cells treated with erlotinib. This might imply the entire group is functionally antagonizing the integrin-dependent cell adhesion machinery, and that antibodies generally antagonizing this process might be of interest for exploring experimental synergies with erlotinib.

Example 8 Treatment of Additional Cancer Types in the Clinic with EGFR-Targeting Agents and/or Irenotecan

Besides colorectal cancer, lung cancers, head and neck cancers, and a number of other types of cancer respond to EGFR-targeting agents and/or irenotecan. However, because of differences in cell lineage, these cells will not express an identical complement of proteins as colorectal tumors, implying that their cell signaling/cell survival networks will be non-equivalent. Hence, a subset of the siRNAs that sensitize colorectal tumor cells to EGFR-targeting agents in colorectal cells may not be active in other tumor types, while additional sensitizing siRNAs may be detected in screens of these tumors. We will focus on lung cancer cell lines as a first counter-model to compare with A431 and HCT116 data, and essentially parallel the three Validation Steps outlined above. For the collection of validated hits from A431 and HCT116 screening, we will first use qRT-PCR to determine if the mRNAs are expressed in two erlotinib-sensitive and two K-Ras-mutated, erlotinib resistant lung cancer cell lines. We will then determine what percent of the expressed siRNAs are sensitizing in the lung cancer cell lines. If a significant percentage of A431/HCT116 hits maintain function in lung cancer cell lines, such hits are relevant for improved chemotherapy, particularly if they include siRNAs depleting proteins with existing clinical agents (as discussed in Example 5). If only a very limited number of hits are found to be functional, we will instead repeat the primary screens outlined above, to define the sensitization network of lung cancer tumors. We note this last experiment is of interest in its own right as an inquiry into the basic properties of alternative network construction.

Example 9 Identification of Additional Drugs which Show Promising Experimental Synergies with EGFR-Targeting Agents

Although preclinical and clinical analyses are empirically establishing useful synergies between erlotinib or EGFR-targeting antibodies and drugs targeting the mTOR pathway, such as rapamycin or temsirolimus (Costa, 2007; Jimeno, 2007; Buck, 2006, IGF Morgillo, 2006), and other high-value targets, it is currently largely unknown as to which EGFR-dependent signaling pathways contribute to the sensitization. Using the EGFR interactome library, we can rapidly establish this point, using a strategy similar to that outlined for primary screening above to look for a network of sensitizers to selected drugs in the A431 and HCT116 colorectal cancer cell lines. This screen should identify a number of the hits already identified as common sensitizers to erlotinib, panitumumab, and CPT11, but may also identify a sub-network (sensitization complementation group) of hits that is specific to inhibition by the new test drug.

Example 10 Preferred Combinations for the Treatment of Different Cancer Types

The table below provides 16 genes and combinations of agents which should have efficacy for the treatment of the indicated cancer types. Anti-EGFr drugs (cetuximab, an anti-EGFR antibody; erlotinib, lapatinib or any tyrosine kinase inhibitor specific for the EGFR kinase) can be combined with either existing or potentially available inhibitors of the 16 targets presented. In general, cetuximab is used in colorectal, lung, head and neck (HNSCC). Erlotinib is used in lung, pancreas. Potentially, cetuximab or any other anti-EGFR antibody can be approved for lung cancer (NSCLC), and cancer of the pancreas. Lapatinib is preferred for combination treatment of breast, and ovarian cancers. The gene target activity may be inhibited using small interfering molecules, agents already known to inhibit their function, (e.g., commercially available and clinically safe phosphatase and kinase inhibitors or the small siRNAs interfering molecules described herein.

TABLE A HNSCC Other cancers Colorectal cetuximab Pancreas cetuximab, cancer or Lung erlotinib or Glioma Breast erlotinib, Gene Target Class of inhibitor #cetuximab erlotinib erlotinib cetuximab erlotinib lapatinib lapatinib ANXA6 Interfering small  1* 1 1 1 1 molecule ARF4; ARF5 Ribosyltransferase 1 1 1 1 1 1 inhibitor ASCL2 Transcription factor 1 1 1 1 1 1 Important in inhibitor ovarian cancer CD59 Antibody to CD59 0 1 2 2 0 1 DIXDC1 Interferring small 1 1 1 1 1 1 molecule DUSP4 Phosphatase inhibitor 1 1 1 1 1 1 DUSP6 Phosphatase inhibitor 2 1 1 1 1 1 DUSP7 Phosphatase inhibitor 1 1 1 1 1 1 FER Kinase inhibitor 2 1 1 1 1 1 MATK Kinase inhibitor 4 4 4 4 2 1 NEDD9 Interfering small 1 1 1 1 1 1 molecule PRIAP19/SLP1 Interfering small 0 0 1 1 1 1 Important in molecule ovarian and endometrial cancer PRKACB Kinase inhibitor 2 3 2 2 4 1 RAPGEF1 Small molecule 2 1 1 2 1 1 inhibitor SC4MOL Cholesterol synthesis 1 1 1 1 1 1 inhibitor SH2DC3 Interfering small 1 1 1 1 1 1 molecule *numbers represent expression levels #anti-EGFR agents (cetuximab, erlotinib, and/or lapatinib) to be used in combinations with agents downregulating gene targets listed in column 1

Example 11 Generation of Biomarkers that Predict Patient Response to Treatment

One of the most important uses of the information generated from this study will be as a guide to select patients likely to respond to EGFR-centered treatments. Patients with tumors expressing high levels of the mRNAs and proteins targeted by sensitization hits would prove to be resistant to therapy, while patients with low levels of these mRNAs and proteins might be excellent candidates for treatment with the synergistic combination described herein. Additionally, it will be more informative and better exploit the sensitization network that we have identified if we screen tumors for the expression of sets of sensitizing hits, rather than “cherrypicking” a small number of individual hits. Already, hits of clinical relevance have been identified. We will use these genes to generate a screening chip; alternatively, we can generate a Taqman primer set for qRT-PCR. We will then employ a set of at least 10 pre-treatment colorectal tumors from patients who responded to EGFR-targeted therapy, and a matching set of non-responder tumors, and we will systematically compare the expression of the sensitization panel.

Example 12

As described above, we have developed a protein network centered on the highly validated target EGFR, and used siRNA screening to comparatively probe this network for proteins that regulate the effectiveness of both EGFR-targeted and chemotherapeutic agents. This approach identified sub-networks of proteins influencing resistance, with hits enriched among first order protein interactors of the network seeds. Extrapolation from the network structure led to the identification of synergy between EGFR antagonists and drugs targeting PRKC, STAT3, and AURKA, suggesting a direct path to clinical exploitation of study results. Such a focused approach has significant potential to enhance the future coherent design of combination therapies.

A robust network paradigm has critical implications for targeted cancer therapies, predicting that in cells treated with therapies inhibiting an oncogenic node, rescue signaling can be provided by modifying signaling output from any of a number of distinct proteins that are components of a web of interactions centered around the target of inhibition. This concept is reinforced by studies in model organisms demonstrating that quantitatively significant signal-modulating relationships commonly involve proteins that have closely linked functions. In this example, we describe additional regulators of resistance to EGFR-targeted therapies, which can be used to clinical advantage to overcome therapeutic resistance.

As described in Example 1, the A431 cervical adenocarcinoma cell line is highly dependent on EGFR pathway signaling. This cell line was reiteratively screened with the targeted siRNA library used in combination with DMSO (vehicle), or with EGFR-targeting small molecule and antibody inhibitors, or the non-specific cytotoxic agent camptothecin (CPT11) applied at IC25-IC35 concentrations. Primary hits were defined as siRNAs reducing negative control-normalized viability by at least 15% in the presence of a drug compared to DMSO (defined as the Sensitization Index (SI<0.85), with a false discovery rate (FDR)<20%. The distribution of primary hits was independent of the tendency of a siRNA to affect cell viability in the absence of drug treatment (FIG. 11A). The vast majority of hits obtained with an EGFR-targeting antibody were included within the larger set of EGFR-targeting small molecule hits (FIG. 11B). Subsequent validations confirmed a set of 61 genes (Table B) sensitizing to EGFR-targeting agents in which 2 or more of 4 independent siRNAs recapitulated sensitization to erlotinib. The majority of sensitizing hits (48/61) encoded proteins connected in a physically interacting network (FIG. 11C). The remaining 13 encoded proteins are not known to interact physically with EGFR or its direct partners, but instead are linked to EGFR based on transcriptional response to pathway manipulation.

TABLE B Validated screen hits. Symbol ID Gene Description Origin Clinical agent ABL1 25 v-abl Abelson murine leukemia viral PPI1 Imatinib, dasatinib oncogene homolog 1 AKT2 208 v-akt murine thymoma viral oncogene PG Perifosine, triciribine, homolog 2 GSK690693 ANXA6 309 annexin A6 C, PPI2 APP 351 amyloid beta (A4) precursor protein PPI1 (peptidase nexin-II, Alzheimer disease) ARF4 378 ADP-ribosylation factor 4 PM, PPI1 ARF5 381 ADP-ribosylation factor 5 PG ASCL2 430 achaete-scute complex homolog 2 PPI2, DG (Drosophila) BCAR1 9564 breast cancer anti-estrogen resistance 1 PM, C, PPI1 CALM1 801 calmodulin 1 (phosphorylase kinase, C PPI1 phenothiazines delta) CBLC 23624 Cas-Br-M (murine) ecotropic retroviral PM PPI1 transforming sequence c CCND1 595 cyclin D1 PM, PPI2 CD59 966 CD59 molecule, complement regulatory C, PPI2 Roche, Preclinical protein CDH3 1001 cadherin 3, type 1, P-cadherin (placental) PG CXCL12 6387 chemokine (C—X—C motif) ligand 12 MA (stromal cell-derived factor 1) DCN 1634 decorin PPI1 DDR2 4921 discoidin domain receptor family, member 2 PPI1 DIXDC1 85458 DIX domain containing 1 MA DLG4 1742 discs, large homolog 4 (Drosophila) PPI1 DUSP4 1846 dual specificity phosphatase 4 MA DUSP6 1848 dual specificity phosphatase 6 DG DUSP7 1849 dual specificity phosphatase 7 DG EPHA5 2044 EPH receptor A5 PG ERBB3 2065 v-erb-b2 erythroblastic leukemia viral PM, PPI1, antibodies, e.g. MM-121 oncogene homolog 3 (avian) DG FER 2241 fer (fps/fes related) tyrosine kinase PPI1 (phosphoprotein NCP94) FGFR2 2263 fibroblast growth factor receptor 2 DG e.g. brivanib, masitinib, (bacteria-expressed kinase, keratinocyte TKI258, PHA-739358 FLNA 2316 filamin PG, alpha (actin binding protein C, PPI2 280) GRB7 2886 growth factor receptor-bound protein 7 PM, PPI1 HSPA9 3313 heat shock 70 kDa protein 9 (mortalin) C, PPI2 INPPL1 3636 inositol polyphosphate phosphatase-like 1 PM, PPI1 KLF10 7071 Kruppel-like factor 10 MA LOC284393 284393 similar to ribosomal protein L10 PG LOC63920 63920 transposon-derived Buster3 transposase- MA like LTK 4058 leukocyte tyrosine kinase PPI1 MAP3K1 4214 mitogen-activated protein kinase kinase PM, PPI2 kinase 1 MAPK1 5594 mitogen-activated protein kinase 1 PM, PPI1 MATK 4145 megakaryocyte-associated tyrosine PM, PPI1 kinase NEDD9 4739 neural precursor cell expressed, PPI1 developmentally down-regulated 9 PIK3R1 5295 phosphoinositide-3-kinase, regulatory PM, PPI1 e.g. PX-866, BGT226, subunit 1 (p85 alpha) GDC-0941, XL765 PIK3R2 5296 phosphoinositide-3-kinase, regulatory PM, PPI1 subunit 2 (p85 beta) PIN1 5300 protein (peptidylprolyl cis/trans PM isomerase) NIMA-interacting 1 PKN2 5586 protein kinase N2 PM, PPI2 PLSCR1 5359 phospholipid scramblase 1 PM, PPI1, MA PPIA 5478 peptidylprolyl isomerase PG (cyclophilin C, PPI2 PG) PRKACB 5567 protein kinase, cAMP-dependent, PG catalytic, beta PRKCD 5580 protein kinase C, delta PM, PPI1 ruboxistaurin, PRKCE 5581 protein kinase C, epsilon PM, PPI2 enzastaurin, PRKCZ 5590 protein kinase C, zeta PM, PPI2 tamoxifen RAC1 5879 ras-related C3 botulinum toxin substrate 1 PM, PPI2 (rho family, small GTP binding protein RACGAP1 29127 Rac GTPase activating protein 1 C, PPI2 RAPGEF1 2889 Rap guanine nucleotide exchange factor PPI1 (GEF) 1 RASA3 22821 RAS p21 protein activator 3 DG RET 5979 ret proto-oncogene PPI1, M2 valdetanib RPS6KA5 9252 ribosomal protein S6 kinase, 90 kDa, PM ruboxistaurin polypeptide 5 SC4MOL 6307 sterol-C4-methyl oxidase-like MA SH2D3C 10044 SH2 domain containing 3C PM, PPI1 SHC1 6464 SHC (Src homology 2 domain containing) PM, C, PPI1, transforming protein 1 DG SMAD2 4087 SMAD family member 2 PM, PPI1 peptide 144 targets TGFβ1RIII SOS2 6655 son of sevenless homolog 2 (Drosophila) PM, PPI1, DG STAT3 6774 signal transducer and activator of PM, C, STAT 3 decoy oligo transcription 3 (acute-phase response PPI1 TBL1Y 90665 transducin (beta)-like 1Y-linked DG VAV3 10451 vav 3 oncogene PM, C, PPI1

In analyzing the erlotinib-sensitizing hits in comparison to the overall properties of the 638-gene library, there was a highly significant enrichment for genes that were first order PPIs of the seeds, and were also nominated by pathway maps (FIG. 12A). The erlotinib-sensitizing hits were also significantly more likely to have topology parameters distinct from the overall network, suggesting a higher degree of connectivity for these nodes (FIG. 12B). Based on their GO function, erlotinib-sensitizing hits were enriched for proteins classified as involved in phosphate metabolism (kinases or phosphatases) and signal transduction (FIG. 12C) with p value cut-off of 0.01. Validated hits were equally likely to occur among siRNAs that independently reduced cell viability, or had little effect on cell growth in the absence of drug treatment. A weak trend was observed for hits to be evolutionarily conserved, as reflected by the presence one or more defined orthologs in lower eukaryotes than genes in the overall library (FIG. 12D).

In additional experiments, we comparatively profiled the efficacy of the hit panel as sensitizers of erlotinib, cetuximab, and CPT11 across a set of cell lines, including A431, the colorectal adenocarcinoma cell lines HCT116, DLD-1, DKS-8, and LoVo, the head and neck squamous cell carcinoma cell line SCC61, and the pancreatic adenocarcinoma cell lines PANC-1 and MIA PaCa-2 (FIG. 13A). In this analysis, cell lines with intrinsic drug resistance mutations (for example, in K-Ras and/or p53) had more noise in sensitization responses, with the result that highly resistant lines (DLD1, DKS-8, LoVo, MIA PaCa-2) yielded far fewer sensitizing hits than A431 by rigorous statistical criteria. To compensate for this difference, we analyzed the data in two ways: first, by conventional threshold analysis (FIG. 13A, left), and second, by assessing the rank order of sensitization phenotype, using relaxed statistical criteria (FIG. 13A, right; see Materials and Methods). The ranking order method mitigates the stochastic “noise” common in resistant tumors, and which we observed in the erlotinib-refractory cell lines.

No gene target sensitized to erlotinib in all tested cell lines. Considering only statistically significant thresholds (FIG. 13A, left), depletion of genes initially identified and validated in A431 most consistently sensitized this cell line to erlotinib, with many in this group also sensitizing A431 cells to cetuximab. Depletion of a further small subset of these genes also consistently sensitized cells to erlotinib in at least two additional cell lines with known resistance mutations. These included SH2D3C, DUSP7, and SC4MOL. Other siRNAs (included RPS6KA5, FLNA, PRKCE, PRKACB, SC4MOL, and ASCL2) sensitized to erlotinib and/or CPT11, in 3-5 cell lines, suggesting a broader action in resistance, but less specificity for EGFR-targeting agents; this overlap may reflect the important role of some EGFR effectors in supporting general survival signaling.

Considering instead sensitization rank (FIG. 13A, right), although all genes detected based on thresholds were again detected as highly sensitizing, a broader pattern of activity was detected for some hits. For example, PRKCE is consistently one of the most sensitizing targets in 11//15 conditions assessed, although it only scored as significantly sensitizing in 6. The broader set of genes now detected as particularly sensitizing to erlotinib and cetuximab based on rank order activity in the majority of the cell lines tested included BCAR1, DUSP7, DLG4, SC4MOL, SH2D3C, and NEDD9, beyond those noted above.

As the in vivo effects of inhibiting a selected target will reflect the cumulative sum of intrinsic effect on viability and sensitizing activity, we also established the baseline intrinsic activity of the validated siRNAs in reducing cell growth in DMSO-treated cells (FIG. 13B). Down-modulation of certain genes intrinsically affected cell growth very significantly in multiple cell lines in the presence of vehicle alone. Other effective sensitizers, including DUSP7 and DLG4, exhibited only a minimal effect on viability in the absence of drug treatment. Based on the composite of intrinsic and sensitizing effects, a significant number of the hits (including PRKCE, INPPL1, SH2D3C, SHC1, STAT3, FLNA, and NEDD9) very strongly reduced the growth of multiple tumor cell lines treated with EGFR-targeting agents. 18 of the hits selectively enhanced apoptosis by 2-fold or more in erlotinib-treated versus DMSO treated A431 cells (FIG. 13C), suggesting these genes as desirable targets for cancer therapy.

These findings supported the idea that a cogently designed network focused around a core cancer target such as EGFR would provide a rich source of genes that modulate resistance to EGFR pathway-targeted agents. In general, a greater effect was seen on the core viability of cell lines containing wt versus mutant Ras, although the stronger hits were typically active in both; in contrast, it was impossible to establish a meaningful correlation between sensitization profile and Ras mutational status, suggesting that sensitizing activity occurred downstream or independently from core Ras signaling outputs. We investigated the relative interactions of the stronger hits within the overall topology of the EGFR signaling network (FIG. 14A). The majority of hits could be placed in a connected sub-network based on direct physical interactions. Notably, the analysis identified 2 separate members of the protein kinase C family as sensitizing in multiple cell lines (PRKCD, and PRKCE), with some of these proteins also directly connecting to the strong sensitizers DLG4 and PRKACB. A second cluster included SH2D3C, BCAR1, and NEDD9, which sensitized preferentially to erlotinib and cetuximab, and were all connected by direct physical interactions. Many of these most sensitizing hits were directly connected to MAPK1, PIK3R, STAT3, SHC1, and EGFR itself, supporting the idea that these proteins modulated core outputs of the central EGFR signaling pathway.

We directly tested the ability of a number of hits to directly modulate both basal and EGF-stimulated activation of the core pathway effectors MAPK1 and AKT (FIGS. 14B and 15A). The inhibition of expression of ERBB3, ANXA6, PRKCD, NEDD9, BCAR1 and SH2D3C in each case reduces basal activation of MAPK1 and AKT, implying collateral input to the canonical EGFR-MAPK-AKT pathway from these target genes. By contrast, a small number of the hits, including TBL1Y, PIN1, SC4MOL, and ASCL2, were not connected by direct protein-protein interactions to the core network, suggesting either a different mode of action, or previously undetected connections. Indeed, upon direct testing, ASCL2 affects neither MAPK1 nor AKT activation, although it potently sensitizes erlotinib-treated cells to apoptosis (FIG. 13C). Interestingly, ASCL2 is a target of Wnt signaling that is up-regulated in a subset of colon carcinomas and has very recently been shown to control the expansion of epithelial stem cells, suggesting a possible mode of activity.

A major goal of this work was to gain insights that could be rapidly translated to the clinic. Although the clinical use of RNAi is a topic of intense current research, small molecules and monoclonal antibodies remain the most broadly applicable therapy platforms. Further, given that most drugs target catalytic enzymes, whereas siRNAs typically reduce protein levels by no more than 80-90%, we hypothesized that combining small molecule inhibitors of siRNA-predicted catalytic hits with erlotinib might enhance sensitization phenotypes over those detected in initial screens. For some sensitizing hits, targeted small molecules exist, including Stattic (a small molecule inhibitor of STAT3 activation and dimerization, enzastaurin and Ro-318220 (both targeting the PRKC family, with members well-represented among the hits.

Stattic synergized with erlotinib in inhibiting the growth of both A431 and HCT116 cells (FIGS. 14C and 15B) in keeping with reported dependency of EGFR-driven autocrine growth on STAT3 activation in cancer, but showed no statistically significant synergy in reducing cell motility (FIG. 14D, top). Both Ro-318220 and enzastaurin synergized very significantly with erlotinib in A431 and HCT116 cells (FIGS. 14C and 15C), in experiments employing drugs combined at multiple ratios (1:5, 1:10, 1:20). Combined application of EGFR and Ro-318220 also significantly reduced tumor cell motility (FIG. 14D, bottom). We analyzed the effect of drug combinations on the activation state of a series of benchmark signaling proteins relevant to proliferation and apoptosis, including Akt, Erk, NF-κB, IκB, MDM2, and p53 (FIG. 16). None of these proteins experienced specific activity changes as a consequence of combined application of drugs, with the exception of Akt, which had significantly reduced phosphorylation on 5473 in cells treated with erlotinib in combination with either Stattic or enzastaurin. Akt-S473-phosphorylation has been described as dependent on integrated signaling via PKC, EGFR, and mTOR. This result suggests a potential pathway by which the enzastaurin-erlotinib combination might reduce cell viability.

The proteins of the consistently sensitizing BCAR1-SH3D2C-NEDD9 cluster have been linked previously to cell survival control in the context of integrin-mediated signaling cascades, suggesting this cluster is of particular interest for therapeutic exploitation. However, these proteins are not catalytic, and have not been targeted by existing small molecule agents. Given the results suggesting the enrichment of sensitizing genes among proteins closely linked to core hits, we hypothesized that small molecules targeting kinases closely linked to this cluster by physical interactions might similarly provide a rich source of synergizing agents for combination with erlotinib. FIG. 17A shows the direct interaction neighborhood around BCAR1, SH3D3C, and NEDD9, which includes 16 kinases. Drugs that are in pre-clinical or clinical development, or approved agents, target 10 of these kinases (either uniquely, or as one member of a protein family), and some of these drugs have indeed been combined productively with EGFR-directed therapeutics (e.g. dasatinib, targeting Src family kinases. Among these, the NEDD9-interacting kinase AURKA (Aurora-A, STK6) was notable because it positively and directly regulates the important EGFR effector Ral, and has been reported to indirectly upregulate AKT. Moreover, well-tolerated drugs targeting Aurora-A are currently undergoing clinical evaluation.

The small molecule Aurora-A inhibitors PHA-680632 (Soncini et al. (2006) Clin. Cancer Res. 12:4080) synergized strongly with erlotinib in both A431 and HCT116 cells (FIG. 17B). PHA-680632 also synergized with the EGFR-inhibiting antibody cetuximab (FIG. 17B), while erlotinib also synergized with another Aurora-A inhibitor, C1368 (Tari et al., (2007) Bioorg. Med. Chem. Lett. 17:688) Combination of Aurora-A and EGFR-targeting agents did not merely produce cytostasis, but also cell death, increasing the frequency of apoptosis nearly two-fold (FIGS. 17C, 17D). In addition, combination of these drugs significantly reduced cell motility (FIG. 17E), colony growth in soft agar (FIG. 17F), and the growth of tumor xenografts implanted in SCID mice (FIG. 17G).

We explored the signaling changes underlying the synergy. Treatment of cells with PHA-680632 alone did not inhibit EGFR expression, autophosphorylation, and activation, and had little effect on ERK1/2 or AKT phosphorylation in response to transient EGF stimulation (FIGS. 17H and 16A). However, in combination with erlotinib treatment, PHA-680632 very significantly reduced S473-AKT phosphorylation below levels seen in cells treated with either agent alone, compatible with the reduced survival of cells treated with the drug combination, while not significantly influencing other EGFR-dependent signaling benchmarks (FIGS. 17H, 18).

To explore signaling consequences of co-inhibition of Aurora-A and EGFR in greater depth, we next undertook a more comprehensive phospho-proteomic analysis of 46 signaling proteins linked to cell proliferation and survival responses following cell treatment with erlotinib, PHA-680632, or both. Analysis of two independently performed screens (FIG. 19A) established that erlotinib blocked EGF-induced activation of multiple signaling pathways (reducing Akt and ERK below background levels), and PHA-680632 had little effect when used as single agent. In contrast, the combination of drugs led to specific inhibition of a subset of proteins, including the greater inhibition of ERK and Akt detected by candidate analysis, but also inhibition of GSK3β (a known functional partner of Aurora-A), .INK, and the Src family kinase FGR. We performed similar experiments to analyze signaling changes under the steady state growth conditions used to assess synergistic killing of cells (i.e., when the activation state of pathways was not strictly dependent on EGF) (FIG. 19B). Strikingly, this analysis re-identified the same targets for the drug combination as those seen with EGF-dependent signaling (FIG. 19A), but in addition showed significant reduction in activity of STAT3, and a group of Src kinases, including FGR, Hck, Lyn, Src, and Lck. These last hits in particular are intriguing, as the BCAR1-NEDD9-SH2D3C proteins that led us to consider AurA are direct activators and substrates of these same Src family kinases (FIG. 17A). One possibility is that use of AurA inhibitors weakened this resistance cluster in the network.

As described in Example 11, another potential use of this data set is for the nomination of new biomarkers for selecting patient responsiveness. However, extensive analysis of the expression of siRNA targets in cell lines used for functional analysis (FIG. 20) showed no statistically significant correlation between expression level and role in modulating resistance, while analysis of Oncomine profiles (FIG. 21) did not reveal specific trends of altered expression in tumors. Large sequencing projects, including among others the Cancer Gene Census, have noted mutations with some frequency for RET, FLNA, FGFR2, SMAD2, PIK3R1, ABL1, CCND1, and AKT2. See the world wide web at sanger.ac.uk/CGP/. However, most of the genes we identified are not common targets for mutations. These observations have potentially important translational implications, as much effort has gone into analyzing gene expression or mutational status to predict drug resistance. This cumulative lack of a clear pattern of expression or mutation likely reflects the complexity of cancer-associated signaling networks. For many solid tumors, no unique oncogenic driver has been yet identified, but instead, tumor cells undergo multiple, sequential process-oriented oncogenic alterations that together reprogram multiple yet discrete aspects of tumor functionality. In such a scenario, fitness of a cancer cell is determined by the robustness of its signaling network as a whole. The new resistance-mediating genes we have identified should undergo scrutiny as alternative EGFR modulators, joining with proteins such as K-Ras, B-Raf, c-MET, IGF-1, and others.

A major goal of systems-level bioinformatics analyses is to nominate critical nodes to target in combination to enhance therapy in the clinic, with clear successes beginning to emerge from this information-driven strategy (Pritchard et al., (2009) Mol Cancer Ther. 8:2183). Separately, screening of siRNA libraries has emerged as a powerful approach to identify genes that can kill cancer cells, or sensitize them to cytotoxic agents. To date, such screening has typically employed either full genome screens, or screens of small libraries targeting limited groups of proteins, such as the kinome/phosphatome. Interestingly, a genome-wide screen to identify sensitizers to the microtubule-targeting agent paclitaxel identified a number of hits that clustered into coherent groups of genes associated with the proteasome or mitotic spindle (Whitehurst et al., (2007) Nature 446:815), which a priori had been linked to paclitaxel activity based on existing pathway knowledge.

In the current study, we employed bioinformatics design and direct screening, and found that many proteins influencing cellular resistance to EGFR-targeting agents clustered in connection-dense, highly interactive portions of the EGFR signaling network, thus supporting our core hypothesis that these characteristics would enrich for synthetic lethal interactions. These sensitizing protein clusters were useful for predicting the efficacy of combining protein-targeted drugs with EGFR-pathway signaling inhibitors, suggesting the potential of this approach for speeding the translation of results to the clinic. We believe this targeted approach has several advantages in comparison to a full genome screen. Beyond the obvious factors of convenience, speed, and cost, all hits arising from a targeted screen already have at least some defined functional relationships to the signaling pathway being probed, accelerating validation and mechanism testing. Further, the limited size of the library being probed allowed the use of more relaxed statistical criteria in nominating hits for validation than would be necessary in a full genome screen, and allowed us to repeat the primary screen multiple times: given the intrinsic noise in siRNA screening, these are important advantages. Finally, our observation that the single greatest source of enrichment for hits (FIG. 12C) is among the proteins with both direct physical interactions and literature-based pathway connections to the library seeds provides guidance for future library optimization.

We have defined the network structure for EGFR-pathway specific and general drug resistance in several cell lines. Accordingly, the present invention provides a unique resource: a deeply probed, heavily annotated library with a linked live database that provides a “Rosetta Stone” for drug resistance studies. This work can be rapidly translated into improved therapy for cancer patients, as the information is used to design new Phase I trials. Indeed, new combinatorial approaches for the eradication of cancer cells is discloses as are efficacious agents for effecting the same.

REFERENCES

  • 1. Rocha-Lima C M, Soares H P, Raez L E, Singal R. EGFR targeting of solid tumors. Cancer Control 2007; 14:295-304.
  • 2. Ciardiello F, De Vita F. Epidermal growth factor receptor (EGFR) inhibitors in cancer therapy. Prog Drug Res 2005; 63:93-114.
  • 3. Raymond E, Faivre S, Armand J P. Epidermal growth factor receptor tyrosine kinase as a target for anticancer therapy. Drugs 2000; 60:15-23; discussion 41-2.
  • 4. Buchholz T A, Tu X, Ang K K, Esteva F J, Kuerer H M, Pusztai L, Cristofanilli M, Singletary S E, Hortobagyi G N, Sahin A A. Epidermal growth factor receptor expression correlates with poor survival in patients who have breast carcinoma treated with doxorubicin-based neoadjuvant chemotherapy. Cancer 2005; 104:676-81.
  • 5. Chan S K, Hill M E, Gullick W J. The role of the epidermal growth factor receptor in breast cancer. J Mammary Gland Biol Neoplasia 2006; 11:3-11.
  • 6. Cappuzzo F, Toschi L, Finocchiaro G, Ligorio C, Santoro A. Surrogate predictive biomarkers for response to anti-EGFR agents: state of the art and challenges. Int J Biol Markers 2007; 22:S10-23.
  • 7. Jimeno A, Hidalgo M. Pharmacogenomics of epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors. Biochim Biophys Acta 2006; 1766:217-29.
  • 8. Eddy S R. Genetics. Total information awareness for worm genetics. Science 2006; 311:1381-2.
  • 9. Whitehurst A W, Bodemann B O, Cardenas J, Ferguson D, Girard L, Peyton M, Minna J D, Michnoff C, Hao W, Roth M G, Xie X J, White M A. Synthetic lethal screen identification of chemosensitizer loci in cancer cells. Nature 2007; 446:815-9.
  • 10. Skobeleva N, Menon S, Weber L, Golemis E A, Khazak V. In vitro and in vivo synergy of MCP compounds with mitogen-activated protein kinase pathway- and microtubule-targeting inhibitors. Mol Cancer Ther 2007; 6:898-906.
  • 11. Mishra G R, Suresh M, Kumaran K, Kannabiran N, Suresh S, Bala P, Shivakumar K, Anuradha N, Reddy R, Raghavan T M, Menon S, Hanumanthu G, Gupta M, Upendran S, Gupta S, Mahesh M, Jacob B, Mathew P, Chatterjee P, Arun K S, Sharma S, Chandrika K N, Deshpande N, Palvankar K, Raghavnath R, Krishnakanth R, Karathia H, Rekha B, Nayak R, Vishnupriya G, Kumar H G, Nagini M, Kumar G S, Jose R, Deepthi P, Mohan S S, Gandhi T K, Harsha H C, Deshpande K S, Sarker M, Prasad T S, Pandey A. Human protein reference database-2006 update. Nucleic Acids Res 2006; 34:D411-4.
  • 12. Mak H C, Daly M, Gruebel B, Ideker T. CellCircuits: a database of protein network models. Nucleic Acids Res 2007; 35:D538-45.
  • 13. Dimri M, Naramura M, Duan L, Chen J, Ortega-Cava C, Chen G, Goswami R, Fernandes N, Gao Q, Dimri G P, Band V, Band H. Modeling breast cancer-associated c-Src and EGFR overexpression in human MECs: c-Src and EGFR cooperatively promote aberrant three-dimensional acinar structure and invasive behavior. Cancer Res 2007; 67:4164-72.
  • 14. Seton-Rogers S E, Brugge J S. ErbB2 and TGF-beta: a cooperative role in mammary tumor progression? Cell Cycle 2004; 3:597-600.
  • 15. O'Neill G M, Fashena S J, Golemis E A. Integrin signaling: a new Cas(t) of characters enters the stage. Trends Cell Biol 2000; 10:111-9.
  • 16. Singh M K, Cowell L, Seo S, O'Neill G M, Golemis E A. Molecular basis for HEF1/NEDD9/Cas-L action as a multifunctional co-ordinator of invasion, apoptosis, and cell cycle. Cell Biochem Biophys 2007 in press.
  • 17. Ji H, Ramsey M R, Hayes D N, Fan C, McNamara K, Kozlowski P, Torrice C, Wu M C, Shimamura T, Perera S A, Liang M C, Cai D, Naumov G N, Bao L, Contreras C M, Li D, Chen L, Krishnamurthy J, Koivunen J, Chirieac L R, Padera R F, Bronson R T, Lindeman N I, Christiani D C, Lin X, Shapiro G I, Janne P A, Johnson B E, Meyerson M, Kwiatkowski D J, Castrillon D H, Bardeesy N, Sharpless N E, Wong K K. LKB1 modulates lung cancer differentiation and metastasis. Nature 2007; 448:807-10.
  • 18. Kim M, Gans J D, Nogueira C, Wang A, Paik J H, Feng B, Brennan C, Hahn W C, Cordon-Cardo C, Wagner S N, Flotte T J, Duncan L M, Granter S R, Chin L. Comparative oncogenomics identifies NEDD9 as a melanoma metastasis gene. Cell 2006; 125:1269-81.
  • 19. O'Neill G M, Seo S, Serebriiskii I G, Lessin S R, Golemis E A. A new central scaffold for metastasis: parsing HEF1/Cas-L/NEDD9. Cancer Res 2007; 67:8975-9.
  • 20. Singh M, Cowell L, Seo S, O'Neill G, Golemis E. Molecular basis for HEF1/NEDD9/Cas-L action as a multifunctional co-ordinator of invasion, apoptosis and cell cycle. Cell Biochem Biophys 2007; 48:54-72.
  • 21. Swanton C, Marani M, Pardo O, Warne P H, Kelly G, Sahai E, Elustondo F, Chang J, Temple J, Ahmed A A, Brenton J D, Downward J, Nicke B. Regulators of mitotic arrest and ceramide metabolism are determinants of sensitivity to Paclitaxel and other chemotherapeutic drugs. Cancer Cell 2007; 11:498-512.
  • 22. Smyth G K. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Statistical applications in genetics and molecular biology 2004; 3:Article3.
  • 23. Gentleman R C, Carey V J, Bates D M, Bolstad B, Dettling M, Dudoit S, Ellis B, Gautier L, Ge Y, Gentry J, Hornik K, Hothorn T, Huber W, Iacus S, Irizarry R, Leisch F, Li C, Maechler M, Rossini A J, Sawitzki G, Smith C, Smyth G, Tierney L, Yang J Y, Zhang J. Bioconductor: open software development for computational biology and bioinformatics. Genome Biol 2004; 5:R80.
  • 24. Benjamini Y, Hochhberg Y. Controlling the False Discovery Rate: A practical and powerful approach to multiple testing. J Royal Stat Soc B 1995; 57:289-300.
  • 25. Defilippi P, Di Stefano P, Cabodi S. p130Cas: a versatile scaffold in signaling networks. Trends Cell Biol 2006; 16:257-63.
  • 26. Cai D, Iyer A, Felekkis K N, Near R I, Luo Z, Chernoff J, Albanese C, Pestell R G, Lerner A. AND-34/BCAR3, a GDP exchange factor whose overexpression confers antiestrogen resistance, activates Rac, PAK1, and the cyclin D1 promoter. Cancer Res 2003; 63:6802-8.
  • 27. Ambrogio C, Voena C, Manazza A D, Riera L, Piva R, Barberis L, Costa C, Tarone G, Defilippi P, Hirsch E, Boeri Erba E, Mohammed S, Jensen O N, Palestro G, Inghirami G, Chiarle R. p130cas mediates the transforming properties of the anaplastic lymphoma kinase. Blood 2005.
  • 28. Engelman J A, Zejnullahu K, Mitsudomi T, Song Y, Hyland C, Park J O, Lindeman N, Gale C M, Zhao X, Christensen J, Kosaka T, Holmes A J, Rogers A M, Cappuzzo F, Mok T, Lee C, Johnson B E, Cantley L C, Janne P A. MET amplification leads to gefitinib resistance in lung cancer by activating ERBB3 signaling. Science 2007; 316:1039-43.
  • 29. Frolov A, Schuller K, Tzeng C W, Cannon E E, Ku B C, Howard J H, Vickers S M, Heslin M J, Buchsbaum D J, Arnoletti J P. ErbB3 Expression and Dimerization with EGFR Influence Pancreatic Cancer Cell Sensitivity to Erlotinib. Cancer Biol Ther 2007; 6.
  • 30. Valkova C, Maerz S, Imhof D, Liebmann C. Protein kinase Cepsilon may act as EGFinducible scaffold protein for phospholipase Cgammal. Cell Signal 2007; 19:1830-43.

TABLE 1 Trancriptional Gene change (AG/HRG Fly Local name AG fold) Pathways PPI Complex homolog Paralog expert ABHD2 −2 −2 ABI1 core round 2 ABL1 round 1 ACTC round 2 complex ACTN4 1.5 2 complex ACTR3 round 2 complex AEBP2 1 AKT1 core round 2 AKT2 paralog AKT3 paralog ALK round 1 AMH round 1 ANKRD11 1.5 round 2 ANXA2 round 2 complex ANXA6 round 2 complex AP2A1 five round 1 complex AP2A2 round 1 APP round 1 ARAF core round 2 3 AREG round 1 ARF1 1.5 round 2 ARF3 paralog ARF4 five round 1 ARF5 paralog ARG1 paralog ARG2 1 ARRDC3 −2 ASCL1 2 ASCL2 round 2 1 ATP1B3 2 AVIL 1.5 2 round 2 AXL round 1 AZIN1 2 B4GALT1 1.5 2 BARHL1 2 BARHL2 1 BCAR1 five round 1 complex BCAR3 round 1 complex BCL10 2 BCL3 round 1 BCR round 1 BIRC4 −2 −2 BLK paralog BMP2 2 BMP4 1 BMPR1A 2 BMPR1B round 2 1 BRAF five 2 BRD4 2 BTC round 1 BTRC 1.5 round 2 C14orf120 1.5 2 C20orf119 paralog CALCOCO2 round 1 CALD1 round 1 CALM1 round 1 complex CALM2 round 2 complex CALM3 round 2 complex CAMK2G five round 2 CAMLG round 1 CASP1 round 1 CAV1 core round 1 complex CAV2 core round 2 complex CAV3 round 1 CBL core round 1 complex CBLB five round 1 complex CBLC five round 1 CCND1 five round 2 CCND2 paralog CCND3 paralog CCNE1 round 2 2 CCNE2 five 1 CCR1 paralog CCR2 paralog CCR5 round 2 complex CD22 round 1 CD247 round 1 CD2AP round 1 CD3E round 1 CD44 round 1 CD59 round 2 complex CD82 round 1 CDC25A 1.5 round 1 CDC42 −1.5 core round 2 CDCP1 round 2 complex CDH1 five round 1 CDH3 paralog CDH5 round 1 CDK2 five round 2 CEACAM1 five round 1 CEBPA five round 2 CEBPB five round 1 CEBPZ −2 CHAT round 1 CHKB 1.5 2 CHL1 2 CHUK five round 2 COPS5 1 CPSF6 1.5 round 2 CREB1 core round 2 CRK five round 1 CRKL five round 1 CSF2RB round 1 CSF3R round 1 CSK core round 1 CSNK2A1 1.5 five round 2 CSPG4 round 1 CTGF 2 CTNNA1 −2 round 2 complex CTNNB1 2 five round 1 1 CTNND1 five round 2 complex CTTN 2 round 2 complex CUTL1 1.5 round 2 CXCL12 −2 CXorf33 −2 −2 CXorf56 −2 −2 CYR61 2 DAB2 1.5 round 2 DAG1 five round 1 DCDC2 −2 DCN round 1 DDEF1 five round 2 DDHD1 1.5 2 DDR1 round 1 DDR2 round 1 DDX50 1.5 2 DEGS1 round 1 DIDO1 1.5 2 DIXDC1 −2 −2 DLG4 round 1 DLG5 1.5 round 2 DLL1 2 DLL4 1 DNAJA3 round 2 complex DNM1 five round 2 DOCK1 round 1 DOCK2 paralog DOCK5 paralog DOK2 five round 2 DUSP1 2 five DUSP4 2 DUSP6 3 DUSP7 2 DUSP9 1 DYNLL1 round 2 complex DYNLL2 paralog E2F5 1 EBF 2 EBF3 1 EDN1 2 EEF1A1 five round 2 complex EEF1A2 paralog EFS round 1 EGF core round 1 EGFR core round 1 complex 4 EGR1 2 round 2 EGR2 2 EGR3 2 EIF3S9 1.5 2 EIF4A1 2 complex EIF4A2 paralog EIF4A3 paralog ELF3 2 2 five round 2 ELK1 core round 2 EPB41 4 EPB41L1 3 EPB41L2 2 EPB41L3 1 EPGN expert EPHA2 round 1 complex EPHA3 paralog EPHA5 paralog EPHA7 paralog EPN1 five round 2 EPOR round 1 EPPK1 five round 1 complex EPS15 five round 1 EPS15L1 1.5 five EPS8 core round 1 ERBB2 core round 1 3 ERBB2IP round 1 ERBB3 core round 1 2 ERBB4 ERBB4 five round 2 1 EREG round 1 ERRFI1 five round 1 ESR1 round 1 ETF1 1 ETV6 2 ETV7 1 EXOC4 1.5 1.5 round 2 EYA1 4 EYA2 round 2 3 EYA3 2 EYA4 1 FBRS 2 FCGR3A round 1 FDFT1 1.5 2 FER round 1 FES round 1 FGFR1 round 1 4 FGFR2 3 FGFR3 round 2 2 FGFR4 1 FGR paralog FIGF 2 FLJ11903 2 FLJ20280 −2 −2 FLNA round 2 complex FLT1 round 1 3 FLT3 round 1 FLT4 round 1 2 FMN2 1 FOS 2 core 1 FOSB 2 FOXO1A core round 2 FRK 1 FSCN1 round 2 complex FUS 1.5 2 FYN round 1 FZR1 round 1 GAB1 core round 1 GAB2 five round 2 GAPDH round 2 complex GFRA1 −2 GHR round 1 GIT1 five round 2 GIT2 paralog GJA1 five round 2 GLI2 2 GLI3 1 GNA12 1.5 five GNAI1 five round 2 GNAI2 round 1 GNAI3 paralog GNAO1 paralog GNB2L1 five round 2 GRAP paralog GRAP2 round 1 GRB10 round 1 GRB14 five round 1 GRB2 core round 1 complex GRB7 core round 1 GSK3b expert GSN round 1 complex HBEGF five round 1 hCG_1757335 paralog HCK round 1 HD five round 1 HDAC1 five round 2 HDAC6 expert HES1 2 HGF expert HIP1 five round 2 HLA-A round 1 HNRPA1 1.5 complex HNRPK round 2 complex HRAS core round 2 2 HSP90AA1 round 1 HSP90B1 round 1 HSPA5 round 2 complex HSPA8 round 2 complex HSPA9B round 2 complex HSPD1 round 2 complex ID1 2 ID2 round 1 IER2 2 IGF1R 1.5 1.5 round 1 IKBKB five round 2 IKBKG five round 2 IL2 round 1 IL2RB round 1 IL2RG round 1 IL4R round 1 IL6ST round 1 ILF3 round 2 complex INPP5D round 1 INPPL1 core round 1 INSR round 1 INSRR paralog IQGAP1 round 2 complex IRS1 round 1 IRS2 round 1 ITCH five round 1 ITGA5 round 1 ITGB3 round 1 ITGB4 round 1 JAK1 1.5 core round 2 JAK2 core round 1 JUN 1.5 core round 2 3 JUNB 2 2 JUND five 1 JUP round 1 KDR round 1 1 KLF10 2 KLF6 1.5 2 KRAS core KRT17 five round 1 complex KRT18 five round 1 complex KRT5 round 2 complex KRT6A round 2 complex KRT6B paralog KRT6C paralog KRT6E paralog KRT7 five round 1 complex KRT8 five round 1 complex KSR2 1 L1CAM round 2 1 LCK round 1 LCP2 round 1 LGALS3 −2 −2 LIN7A round 2 3 LIN7B round 2 2 LIN7C 1 LMNA round 2 complex LOC284393 paralog LOC387927 round 1 LOC389342 paralog LOC390006 paralog LOC63920 −2 LOC642045 paralog LOC642954 paralog LOC643751 paralog LOC643997 paralog LOC645691 paralog LOC648695 paralog LOC650332 paralog LOC728198 paralog LOC731173 paralog LOC731292 paralog LOC731751 paralog LRBA 2 LRP1 round 1 LRP11 −2 −2 LRRC4B 1 LTK round 1 LYN round 1 complex MAD1L1 2 2 MAP2K1 core round 2 2 MAP2K2 core 1 MAP2K3 core MAP2K4 core MAP2K7 core MAP3K1 core round 2 MAP3K11 five round 2 MAP3K14 five round 1 MAP3K3 five round 2 MAP3K4 core MAP3K5 1.5 round 2 MAP4K1 round 1 MAPK1 core round 1 MAPK10 paralog MAPK14 core round 2 MAPK3 2 MAPK3 core MAPK8 core round 2 MAPK9 paralog MAPKAPK2 round 1 MATK five round 1 MCF2 five round 2 MDM4 −2 MET round 1 MGC14376 2 MICAL1 round 1 MME round 1 MRCL3 1.5 2 complex MRLC2 paralog MST1R round 1 MUC1 five round 1 MUC5B 1 MYC core round 2 MYH9 1.5 complex MYL9 paralog NBEA 1 NCK1 core round 1 NCK2 core round 1 NDUFA13 five round 2 NEDD9 round 1 NFKB1 1.5 five round 2 NGFR round 1 NOTCH2 1 NPHP1 round 1 NPTN 2 NR4A1 1.5 2 NR4A2 2 NRAS core 1 NRG1 round 1 NRG2 expert NTRK1 round 1 NTRK2 round 1 NTRK3 round 1 OVOL1 1 PABPC1 1.5 complex PABPC3 paralog PABPC4 paralog PAFAH1B1 1 PAG1 round 1 PAK1 core round 1 PAK2 paralog PAK3 paralog PAR6 expert PARD3 expert PCYT1A 2 PCYT1B 1 PDGFRB round 1 PDLIM7 round 2 complex PDPK1 core round 2 PDZK1 2 1.5 round 2 PEBP1 five round 2 PICK1 round 1 PIK3C2B five round 1 PIK3CA core round 2 PIK3CB five round 2 PIK3CD five round 2 PIK3CG five round 2 PIK3R1 core round 1 PIK3R2 five round 1 PIK3R3 five round 2 Pin1 expert PIP5K1A five round 2 PIP5K1B five round 2 PIP5K2A five round 2 PIP5K2B five round 2 PITPNA five round 1 2 PITPNB 1 PKD1 round 1 PKN2 five round 2 PLCB1 five round 2 PLCG1 core round 1 2 PLCG2 round 1 1 PLD1 core round 2 PLD1 paralog PLD2 five round 1 PLEC1 five round 1 complex PLSCR1 1.5 five round 1 POU3F1 4 POU3F2 3 POU3F3 2 POU3F4 1 PPIA round 2 complex PPP1CB five round 2 complex PPP1R10 2 2 PPP2R5A round 1 PPP4R2 2 PRKACA round 1 PRKACB paralog PRKACG paralog PRKAR1A −1.5 five round 1 PRKCA core round 1 PRKCB1 core PRKCD five round 1 PRKCE five round 2 PRKCG core PRKCI core PRKCQ five round 2 PRKCZ core round 2 PRKD1 core round 2 PRKDC round 2 complex PRKX paralog PRMT5 round 2 complex PRODH 1 PRSS12 1 PSME4 2 PTEN five round 2 PTGER4 −2 five PTK2 five round 1 complex PTK2B core round 1 complex PTK6 five round 1 PTPN1 round 1 PTPN11 core round 1 complex PTPN12 five round 1 PTPN2 paralog PTPN6 five round 2 PTPRF round 1 PTPRH round 1 PTPRJ round 1 PXN core round 1 complex RAB22A 2 RAB5A core RAC1 core round 2 RAC2 paralog RAC3 paralog RACGAP1 round 2 complex RAF1 1.5 core round 2 1 RALA paralog RALB five round 2 RAP1A 1.5 round 2 RAP1B paralog RAP2A paralog RAPGEF1 round 1 RARA 1.5 2 round 2 RARB paralog RARG paralog RASA1 core round 1 1 RASA2 2 RASA3 1 RASD1 2 round 2 RB1 five round 2 RBBP4 paralog RBBP7 five complex REPS1 five round 2 RET 1.5 round 1 RGS16 five round 1 RGS4 five round 2 RHO 1 RHOA core round 2 2 RHOB paralog RHOC five 1 RHOG five round 2 RICS round 1 RIPK1 five round 1 RLF 2 ROS1 round 2 1 RP11- paralog 78J21.1 RPL10 2 complex RPL10L paralog RPL23 1.5 complex RPS6KA1 core RPS6KA2 core RPS6KA3 core RPS6KA5 core RRAS five round 2 RRAS2 five round 2 RREB1 1.5 1.5 1 RUNX1 1.5 1.5 round 2 RUVBL2 round 2 complex RYR1 five round 2 SAFB2 round 2 complex SC4MOL 2 2 SERPINA3 round 1 SFN round 2 complex SH2D3A round 1 SH2D3C five round 1 SH3GL3 five round 2 SH3KBP1 five round 2 SHC1 core round 1 complex 3 SHC2 2 SHC3 five round 1 1 SHCBP1 round 1 SKIL 1.5 round 2 SLC35A3 −2 SLC39A6 −2 SLPI 1.5 round 2 SMAD1 round 1 SMAD2 five round 1 SMAD3 five round 1 SMAD9 paralog SMARCB1 round 2 1 SNCA five round 2 SNF1LK 2 SNIP round 1 SNRPD2 five round 1 complex SNX1 round 1 SNX2 round 1 SNX4 round 1 SNX6 round 1 SOCS1 five round 1 SOCS3 1.5 five round 1 SORBS3 round 1 SOS1 1.5 core round 1 complex 2 SOS2 five round 1 1 SP1 five round 1 SPECC1 1.5 complex SPEN 1 SPG7 1.5 round 2 SPIRE1 1 SPRY1 round 2 4 SPRY2 core round 2 3 SPRY3 2 SPRY4 1 SPTAN1 round 2 complex SQLE 2 SRC core round 1 SRF five round 2 1 SSR3 −2 −2 STAT1 core round 1 STAT2 five round 2 STAT3 core round 1 complex STAT4 paralog STAT5A core round 1 3 STAT5B five round 1 2 STAT6 round 2 1 STK3 paralog STK4 2 STUB1 round 1 TAF9B −2 TBL1X paralog TBL1XR1 2 TBL1Y 1 TCF12 3 TCF3 round 1 2 TCF4 round 2 1 TFDP2 −2 1 TGFA round 1 TGFBR1 1.5 round 2 TJP1 round 1 TLE3 1 TLN1 1.5 round 2 TMEM1 2 TMPO −2 TNC round 1 TNK2 five round 1 TOB1 round 1 TP53 five round 2 TPM4 2 TPR round 1 TRAF4 1.5 round 2 TRAPPC6A round 1 TRIM24 round 2 complex TRIP12 1.5 2 TRIP6 round 1 TRPM7 1.5 round 2 TUBA1B round 2 complex TUBA2 paralog TUBA3 paralog TUBA6 paralog TXNIP −2 UBE1L2 2 UBE2L3 five round 2 UQCRFS1 2 VAV1 core round 1 VAV2 core round 1 complex VAV3 core round 1 complex VEGFC 1 WASL −2 core round 2 WDR1 2 complex WWP1 paralog WWP2 paralog XRCC5 2 round 2 XRCC6 round 1 complex YES1 round 2 complex YWHAB five round 2 YWHAE round 2 complex YWHAQ five round 2 complex YWHAZ round 1 complex ZAP70 round 1 ZNF259 round 1 ZNF69 −2 ZYX round 1

TABLE 2 Erlotinib Panitumumab CPT11 U0126 Gene Ratio Gene Ratio Gene Ratio Gene Ratio 1 ALK 0.57 ALK 0.77 ALK 0.73 2 ANXA6 0.47 ANXA6 0.78 ANXA6 0.82 ANXA6 0.64 3 ASCL2 0.52 ASCL2 0.82 4 BCL3 0.64 BCL3 0.64 5 CAV2 0.56 CAV2 0.72 6 CD22 0.70 CD22 0.79 7 CD59 0.71 CD59 0.82 8 CDC42 0.72 CDC42 0.73 9 CTNNA1 0.72 CTNNA1 0.69 10 DCN 0.71 DCN 0.71 11 EPB41L1 0.44 EPB41L1 0.73 12 EPHA5 0.67 EPHA5 0.59 EPHA5 0.61 13 ERBB3 0.61 ERBB3 0.49 ERBB3 0.76 14 FGFR2 0.73 FGFR2 0.72 15 RAPGEF1 0.59 RAPGEF1 0.69 RAPGEF1 0.84 16 PLCG2 0.57 PLCG2 0.65 PLCG2 0.68 17 PLSCR1 0.61 PLSCR1 0.71 PLSCR1 0.72 18 PRKACB 0.53 PRKACB 0.63 PRKACB 0.43 19 PRKCE 0.52 PRKCE 0.66 PRKCE 0.70 20 SC4MOL 0.61 SC4MOL 0.65 21 CXCL12 0.61 CXCL12 0.70 CXCL12* 0.83 22 SLP1 0.60 SLP1 0.84 23 SOS2 0.69 SOS2 0.74 24 STAT3 0.56 STAT3 0.66 STAT3* 0.75 25 TLN1 0.72 TLN1 0.80 26 PIP5K1B 0.72 PIP5K1B 0.75 27 BCAR3 0.58 BCAR3 0.52 28 TRIP12 0.63 TRIP12 0.50 29 BCAR1 0.67 BCAR1 0.80 30 TOB1 0.38 TOB1 0.75 31 VAV3 0.66 VAV3 0.76 32 SPECC1 0.68 SPECC1 0.73 SPECC1 0.75 SPECC1 0.76 33 ARF4 0.79 34 ARF5 0.82 35 RHOA 0.63 RHOA 0.67 36 CALD1 0.76 37 CDC25A 0.78 38 CDH3 0.78 39 DAG1 0.74 40 DLG4 0.73 41 DOCK2 0.74 42 DUSP4 0.71 43 DUSP7 0.83 44 EGR3 0.73 45 ERBB2 0.80 46 FCGR3A 0.52 47 FER 0.63 48 FES 0.66 49 FGR 0.70 50 FLNA 0.48 51 FUS 0.81 52 GAPDH 0.68 53 GNAI2 0.65 GNAI2 0.58 54 GRB7 0.67 55 GRB14 0.54 56 NRG1 0.70 57 HIP1 0.59 58 HES1 0.66 59 INPPL1 0.57 60 LTK 0.55 LTK 0.81 61 MATK 0.70 62 MAP3K1 0.66 63 MYC 0.78 64 POU3F2 0.65 POU3F2 0.69 65 PKN2 0.66 66 MAP2K1 0.34 67 RET 0.75 68 RPL10 0.55 69 RPS6KA3 0.69 70 SHC1 0.63 71 SRF 0.81 72 KLF10 0.69 73 TMEM1 0.77 74 RPS6KA5 0.62 75 RPL23 0.69 76 NRG2 0.69 77 SH2D3C 0.61 78 ANKRD11 0.74 79 DLL4 0.75 80 PARD3 0.72 81 LOC63920 0.62 82 DIXDC1 0.81 83 TBL1Y 0.66 84 ACTN4 0.83 85 BCR 0.78 86 CEACAM1 0.61 87 BLK 0.69 88 CAMLG 0.76 89 CAV3 0.78 90 CBLB 0.60 91 CHUK 0.74 92 CCR5 0.60 93 CTGF 0.83 94 DUSP1 0.58 95 EPHA7 0.73 96 ESR1 0.76 97 EYA2 0.81 98 GRB10 0.76 99 HSPA5 0.80 100 TNC 0.72 101 SMAD9 0.71 102 PIK3R2 0.44 103 PLEC1 0.67 104 PRKACG 0.74 105 PRKCB1 0.71 106 RHO 0.82 107 RRAS 0.82 108 TGFBR1 0.77 109 TPR 0.82 110 UBE2L3 0.76 111 MAPKAPK2 0.81 112 TRAF4 0.67 113 EIF4A3 0.56 114 GAB2 0.83 115 SORBS3 0.56 116 FZR1 0.68 117 FMN2 0.64 118 REPS1 0.70 119 LYN 0.82 120 LOC390006 0.76 LOC390006 0.66 121 LOC284393 0.75 Notes. False discovery rate set at 5%, except for 2 U0126 hits marked *, where 7.5% was used (statisticians say up to 20% is ok).

TABLE 3 SEQ ID Entrez NCBI gene Plate Id Plate Name NO: Gene Id symbol Gene Description 900029-1-A single siRNA, 0.9 nmol 1 12 SERPINA3 serpin peptidase inhibitor, clade  900029-1-A single siRNA, 0.9 nmol 2 207 AKT1 v-akt murine thymoma viral onco 900029-1-A single siRNA, 0.9 nmol 3 331 BIRC4 baculoviral IAP repeat-containing 900029-1-A single siRNA, 0.9 nmol 4 378 ARF4 ADP-ribosylation factor 4 900029-1-A single siRNA, 0.9 nmol 5 389 RHOC ras homolog gene family, membe 900029-1-A single siRNA, 0.9 nmol 6 595 CCND1 cyclin D1 900029-1-A single siRNA, 0.9 nmol 7 652 BMP4 bone morphogenetic protein 4 900029-1-A single siRNA, 0.9 nmol 8 800 CALD1 caldesmon 1 900029-1-A single siRNA, 0.9 nmol 9 834 CASP1 caspase 1, apoptosis-related cyst 900029-1-A single siRNA, 0.9 nmol 10 868 CBLB Cas-Br-M (murine) ecotropic retr 900029-1-A single siRNA, 0.9 nmol 11 25 ABL1 v-abl Abelson murine leukemia vi 900029-1-A single siRNA, 0.9 nmol 12 208 AKT2 v-akt murine thymoma viral onco 900029-1-A single siRNA, 0.9 nmol 13 351 APP amyloid beta (A4) precursor prote 900029-1-A single siRNA, 0.9 nmol 14 381 ARF5 ADP-ribosylation factor 5 900029-1-A single siRNA, 0.9 nmol 15 391 RHOG ras homolog gene family, membe 900029-1-A single siRNA, 0.9 nmol 16 602 BCL3 B-cel   LL/lymphoma 3 900029-1-A single siRNA, 0.9 nmol 17 657 BMPR1A bone morphogenetic protein rece 900029-1-A single siRNA, 0.9 nmol 18 801 CALM1 calmodulin 1 (phosphorylas   ina 900029-1-A single siRNA, 0.9 nmol 19 857 CAV1 caveolin 1, caveolae protein, 22k 900029-1-A single siRNA, 0.9 nmol 20 894 CCND2 cyclin D2 900029-1-A single siRNA, 0.9 nmol 21 70 ACTC1 actin, alpha, cardiac muscle 1 900029-1-A single siRNA, 0.9 nmol 22 238 ALK anaplastic lymphoma kinase (Ki-1 900029-1-A single siRNA, 0.9 nmol 23 369 ARAF v-raf murine sarcoma 3611 viral c 900029-1-A single siRNA, 0.9 nmol 24 383 ARG1 arginase, liver 900029-1-A single siRNA, 0.9 nmol 25 429 ASCL1 achaete-scute complex homolog 900029-1-A single siRNA, 0.9 nmol 26 613 BCR breakpoint cluster region 900029-1-A single siRNA, 0.9 nmol 27 658 BMPR1B bone morphogenetic protein rece 900029-1-A single siRNA, 0.9 nmol 28 805 CALM2 calmodulin 2 (phosphorylase kina 900029-1-A single siRNA, 0.9 nmol 29 858 CAV2 caveolin 2 900029-1-A single siRNA, 0.9 nmol 30 896 CCND3 cyclin D3 900029-1-A single siRNA, 0.9 nmol 31 81 ACTN4 actinin, alpha 4 900029-1-A single siRNA, 0.9 nmol 32 268 AMH anti-Mullerian hormone 900029-1-A single siRNA, 0.9 nmol 33 374 AREG amphiregulin (schwannoma-deriv 900029-1-A single siRNA, 0.9 nmol 34 384 ARG2 arginase, type II 900029-1-A single siRNA, 0.9 nmol 35 430 ASCL2 achaete-scute complex homolog 900029-1-A single siRNA, 0.9 nmol 36 634 CEACAM1 carcinoembryonic antigen-related 900029-1-A single siRNA, 0.9 nmol 37 673 BRAF v-raf murine sarcoma viral oncog 900029-1-A single siRNA, 0.9 nmol 38 808 CALM3 calmodulin 3 (phosphorylase kina 900029-1-A single siRNA, 0.9 nmol 39 859 CAV3 caveolin 3 900029-1-A single siRNA, 0.9 nmol 40 898 CCNE1 cyclin E1 900029-1-A single siRNA, 0.9 nmol 41 160 AP2A1 adaptor-related protein complex 2 900029-1-A single siRNA, 0.9 nmol 42 302 ANXA2 annexin A2 900029-1-A single siRNA, 0.9 nmol 43 375 ARF1 ADP-ribosylation factor 1 900029-1-A single siRNA, 0.9 nmol 44 387 RHOA ras homolog gene family, membe 900029-1-A single siRNA, 0.9 nmol 45 483 ATP1B3 ATPase, Na+/K+transporting, be 900029-1-A single siRNA, 0.9 nmol 46 640 BLK B lymphoid tyrosine kinase 900029-1-A single siRNA, 0.9 nmol 47 685 BTC betacellulin 900029-1-A single siRNA, 0.9 nmol 48 818 CAMK2G calcium/calmodulin-dependent pr 900029-1-A single siRNA, 0.9 nmol 49 861 RUNX1 runt-related transcription factor 1 900029-1-A single siRNA, 0.9 nmol 50 916 CD3E CD3e molecule, epsilon (CD3-TC 900029-1-A single siRNA, 0.9 nmol 51 161 AP2A2 adaptor-related protein complex 2 900029-1-A single siRNA, 0.9 nmol 52 309 ANXA6 annexin A6 900029-1-A single siRNA, 0.9 nmol 53 377 ARF3 ADP-ribosylation factor 3 900029-1-A single siRNA, 0.9 nmol 54 388 RHOB ras homolog gene family, membe 900029-1-A single siRNA, 0.9 nmol 55 558 AXL AXL receptor tyrosine kinase 900029-1-A single siRNA, 0.9 nmol 56 650 BMP2 bone morphogenetic protein 2 900029-1-A single siRNA, 0.9 nmol 57 780 DDR1 discoidin domain receptor family, 900029-1-A single siRNA, 0.9 nmol 58 819 CAMLG calcium modulating ligand 900029-1-A single siRNA, 0.9 nmol 59 867 CBL Cas-Br-M (murine) ecotropic retr 900029-1-A single siRNA, 0.9 nmol 60 919 CD247 CD247 molecule 900029-1-B single siRNA, 0.9 nmol 61 12 SERPINA3 serpin peptidase inhibitor, clade  900029-1-B single siRNA, 0.9 nmol 62 207 AKT1 v-akt murine thymoma viral onco 900029-1-B single siRNA, 0.9 nmol 63 331 BIRC4 baculoviral IAP repeat-containing 900029-1-B single siRNA, 0.9 nmol 64 378 ARF4 ADP-ribosylation factor 4 900029-1-B single siRNA, 0.9 nmol 65 389 RHOC ras homolog gene family, membe 900029-1-B single siRNA, 0.9 nmol 66 595 CCND1 cyclin D1 900029-1-B single siRNA, 0.9 nmol 67 652 BMP4 bone morphogenetic protein 4 900029-1-B single siRNA, 0.9 nmol 68 800 CALD1 caldesmon 1 900029-1-B single siRNA, 0.9 nmol 69 834 CASP1 caspase 1, apoptosis-related cyst 900029-1-B single siRNA, 0.9 nmol 70 868 CBLB Cas-Br-M (murine) ecotropic retr 900029-1-B single siRNA, 0.9 nmol 71 25 ABL1 v-abl Abelson murine leukemia vi 900029-1-B single siRNA, 0.9 nmol 72 208 AKT2 v-akt murine thymoma viral onco 900029-1-B single siRNA, 0.9 nmol 73 351 APP amyloid beta (A4) precursor prote 900029-1-B single siRNA, 0.9 nmol 74 381 ARF5 ADP-ribosylation factor 5 900029-1-B single siRNA, 0.9 nmol 75 391 RHOG ras homolog gene family, membe 900029-1-B single siRNA, 0.9 nmol 76 602 BCL3 B-cell CLL/lymphoma 3 900029-1-B single siRNA, 0.9 nmol 77 657 BMPR1A bone morphogenetic protein rece 900029-1-B single siRNA, 0.9 nmol 78 801 CALM1 calmodulin 1 (phosphorylase kina 900029-1-B single siRNA, 0.9 nmol 79 857 CAV1 caveolin 1, caveolae protein, 22k 900029-1-B single siRNA, 0.9 nmol 80 894 CCND2 cyclin D2 900029-1-B single siRNA, 0.9 nmol 81 70 ACTC1 actin, alpha, cardiac muscle 1 900029-1-B single siRNA, 0.9 nmol 82 238 ALK anaplastic lymphoma kinase (Ki-1 900029-1-B single siRNA, 0.9 nmol 83 369 ARAF v-raf murine sarcoma 3611 viral c 900029-1-B single siRNA, 0.9 nmol 84 383 ARG1 arginase, liver 900029-1-B single siRNA, 0.9 nmol 85 429 ASCL1 achaete-scute complex homolog 900029-1-B single siRNA, 0.9 nmol 86 613 BCR breakpoint cluster region 900029-1-B single siRNA, 0.9 nmol 87 658 BMPR1B bone morphogenetic protein rece 900029-1-B single siRNA, 0.9 nmol 88 805 CALM2 calmodulin 2 (phosphorylase kina 900029-1-B single siRNA, 0.9 nmol 89 858 CAV2 caveolin 2 900029-1-B single siRNA, 0.9 nmol 90 896 CCND3 cyclin D3 900029-1-B single siRNA, 0.9 nmol 91 81 ACTN4 actinin, alpha 4 900029-1-B single siRNA, 0.9 nmol 92 268 AMH anti-Mullerian hormone 900029-1-B single siRNA, 0.9 nmol 93 374 AREG amphiregulin (schwannoma-deriv 900029-1-B single siRNA, 0.9 nmol 94 384 ARG2 arginase, type II 900029-1-B single siRNA, 0.9 nmol 95 430 ASCL2 achaete-scute complex homolog 900029-1-B single siRNA, 0.9 nmol 96 634 CEACAM1 carcinoembryonic antigen-related 900029-1-B single siRNA, 0.9 nmol 97 673 BRAF v-raf murine sarcoma viral oncog 900029-1-B single siRNA, 0.9 nmol 98 808 CALM3 calmodulin 3 (phosphorylase kina 900029-1-B single siRNA, 0.9 nmol 99 859 CAV3 caveolin 3 900029-1-B single siRNA, 0.9 nmol 100 898 CCNE1 cyclin E1 900029-1-B single siRNA, 0.9 nmol 101 160 AP2A1 adaptor-related protein complex 2 900029-1-B single siRNA, 0.9 nmol 102 302 ANXA2 annexin A2 900029-1-B single siRNA, 0.9 nmol 103 375 ARF1 ADP-ribosylation factor 1 900029-1-B single siRNA, 0.9 nmol 104 387 RHOA ras homolog gene family, membe 900029-1-B single siRNA, 0.9 nmol 105 483 ATP1B3 ATPase, Na+/K+transporting, be 900029-1-B single siRNA, 0.9 nmol 106 640 BLK B lymphoid tyrosine kinase 900029-1-B single siRNA, 0.9 nmol 107 685 BTC betacellulin 900029-1-B single siRNA, 0.9 nmol 108 818 CAMK2G calcium/calmodulin-dependent pr 900029-1-B single siRNA, 0.9 nmol 109 861 RUNX1 runt-related transcription factor 1 900029-1-B single siRNA, 0.9 nmol 110 916 CD3E CD3e molecule, epsilon (CD3-TC 900029-1-B single siRNA, 0.9 nmol 111 161 AP2A2 adaptor-related protein complex 2 900029-1-B single siRNA, 0.9 nmol 112 309 ANXA6 annexin A6 900029-1-B single siRNA, 0.9 nmol 113 377 ARF3 ADP-ribosylation factor 3 900029-1-B single siRNA, 0.9 nmol 114 388 RHOB ras homolog gene family, membe 900029-1-B single siRNA, 0.9 nmol 115 558 AXL AXL receptor tyrosine kinase 900029-1-B single siRNA, 0.9 nmol 116 650 BMP2 bone morphogenetic protein 2 900029-1-B single siRNA, 0.9 nmol 117 780 DDR1 discoidin domain receptor family, 900029-1-B single siRNA, 0.9 nmol 118 819 CAMLG calcium modulating ligand 900029-1-B single siRNA, 0.9 nmol 119 867 CBL Cas-Br-M (murine) ecotropic retr 900029-1-B single siRNA, 0.9 nmol 120 919 CD247 CD247 molecule 900029-2-A single siRNA, 0.9 nmol 121 933 CD22 CD22 molecule 900029-2-A single siRNA, 0.9 nmol 122 999 CDH1 cadherin 1, type 1, E-cadherin (er 900029-2-A single siRNA, 0.9 nmol 123 1103 CHAT choline acetyltransferase 900029-2-A single siRNA, 0.9 nmol 124 1316 KLF6 Kruppel-like factor 6 900029-2-A single siRNA, 0.9 nmol 125 1441 CSF3R colony stimulating factor 3 recept 900029-2-A single siRNA, 0.9 nmol 126 1499 CTNNB1 catenin (cadherin-associated prot 900029-2-A single siRNA, 0.9 nmol 127 1742 DLG4 discs, large homolog 4 (Drosophil 900029-2-A single siRNA, 0.9 nmol 128 1846 DUSP4 dual specificity phosphatase 4 900029-2-A single siRNA, 0.9 nmol 129 1906 EDN1 endothelin 1 900029-2-A single siRNA, 0.9 nmol 130 1959 EGR2 early growth response 2 (Krox-20 900029-2-A single siRNA, 0.9 nmol 131 960 CD44 CD44 molecule (Indian blood gro 900029-2-A single siRNA, 0.9 nmol 132 1001 CDH3 cadherin 3, type 1, P-cadherin (p 900029-2-A single siRNA, 0.9 nmol 133 1120 CHKB choline kinase beta 900029-2-A single siRNA, 0.9 nmol 134 1385 CREB1 cAMP responsive element bindin 900029-2-A single siRNA, 0.9 nmol 135 1445 CSK c-src tyrosine kinase 900029-2-A single siRNA, 0.9 nmol 136 1500 CTNND1 catenin (cadherin-associated prot 900029-2-A single siRNA, 0.9 nmol 137 1759 DNM1 dynamin 1 900029-2-A single siRNA, 0.9 nmol 138 1848 DUSP6 dual specificity phosphatase 6 900029-2-A single siRNA, 0.9 nmol 139 1915 EEF1A1 eukaryotic translation elongation  900029-2-A single siRNA, 0.9 nmol 140 1960 EGR3 early growth response 3 900029-2-A single siRNA, 0.9 nmol 141 966 CD59 CD59 molecule, complement reg 900029-2-A single siRNA, 0.9 nmol 142 1003 CDH5 cadherin 5, type 2, VE-cadherin ( 900029-2-A single siRNA, 0.9 nmol 143 1147 CHUK conserved helix-loop-helix ubiquit 900029-2-A single siRNA, 0.9 nmol 144 1398 CRK v-crk sarcoma virus CT10 oncog 900029-2-A single siRNA, 0.9 nmol 145 1457 CSNK2A1 casein kinase 2, alpha 1 polypept 900029-2-A single siRNA, 0.9 nmol 146 1523 CUTL1 cut-like 1, CCAAT displacement  900029-2-A single siRNA, 0.9 nmol 147 1793 DOCK1 dedicator of cytokinesis 1 900029-2-A single siRNA, 0.9 nmol 148 1849 DUSP7 dual specificity phosphatase 7 900029-2-A single siRNA, 0.9 nmol 149 1917 EEF1A2 eukaryotic translation elongation  900029-2-A single siRNA, 0.9 nmol 150 1969 EPHA2 EPH receptor A2 900029-2-A single siRNA, 0.9 nmol 151 987 LRBA LPS-responsive vesicle trafficking 900029-2-A single siRNA, 0.9 nmol 152 1017 CDK2 cyclin-dependent kinase 2 900029-2-A single siRNA, 0.9 nmol 153 1230 CCR1 chemokine (C-C motif) receptor 1 900029-2-A single siRNA, 0.9 nmol 154 1399 CRKL v-crk sarcoma virus CT10 oncoge 900029-2-A single siRNA, 0.9 nmol 155 1464 CSPG4 chondroitin sulfate proteoglycan 4 900029-2-A single siRNA, 0.9 nmol 156 1601 DAB2 disabled homolog 2, mitogen-res 900029-2-A single siRNA, 0.9 nmol 157 1794 DOCK2 dedicator of cytokinesis 2 900029-2-A single siRNA, 0.9 nmol 158 1852 DUSP9 dual specificity phosphatase 9 900029-2-A single siRNA, 0.9 nmol 159 1950 EGF epidermal growth factor (beta-uro 900029-2-A single siRNA, 0.9 nmol 160 1973 EIF4A1 eukaryotic translation initiation fa 900029-2-A single siRNA, 0.9 nmol 161 993 CDC25A cell division cycle 25 homolog A ( 900029-2-A single siRNA, 0.9 nmol 162 1050 CEBPA CCAAT/enhancer binding protein 900029-2-A single siRNA, 0.9 nmol 163 1231 CCR2 chemokine (C-C motif) receptor 2 900029-2-A single siRNA, 0.9 nmol 164 1432 MAPK14 mitogen-activated protein kinase 900029-2-A single siRNA, 0.9 nmol 165 1490 CTGF connective tissue growth factor 900029-2-A single siRNA, 0.9 nmol 166 1605 DAG1 dystroglycan 1 (dystrophin-associ 900029-2-A single siRNA, 0.9 nmol 167 1839 HBEGF heparin-binding EGF-like growth 1 900029-2-A single siRNA, 0.9 nmol 168 1875 E2F5 E2F transcription factor 5, p130-b 900029-2-A single siRNA, 0.9 nmol 169 1956 EGFR epidermal growth factor receptor  900029-2-A single siRNA, 0.9 nmol 170 1974 EIF4A2 eukaryotic translation initiation fa 900029-2-A single siRNA, 0.9 nmol 171 998 CDC42 cell division cycle 42 (GTP bindin 900029-2-A single siRNA, 0.9 nmol 172 1051 CEBPB CCAAT/enhancer binding protein 900029-2-A single siRNA, 0.9 nmol 173 1234 CCR5 chemokine (C-C motif) receptor 5 900029-2-A single siRNA, 0.9 nmol 174 1439 CSF2RB colony stimulating factor 2 recept 900029-2-A single siRNA, 0.9 nmol 175 1495 CTNNA1 catenin (cadherin-associated prot 900029-2-A single siRNA, 0.9 nmol 176 1634 DCN decorin 900029-2-A single siRNA, 0.9 nmol 177 1843 DUSP1 dual specificity phosphatase 1 900029-2-A single siRNA, 0.9 nmol 178 1879 EBF1 early B-cell factor 1 900029-2-A single siRNA, 0.9 nmol 179 1958 EGR1 early growth response 1 900029-2-A single siRNA, 0.9 nmol 180 1999 ELF3 E74-like factor 3 (ets domain tran 900029-2-B single siRNA, 0.9 nmol 181 933 CD22 CD22 molecule 900029-2-B single siRNA, 0.9 nmol 182 999 CDH1 cadherin 1, type 1, E-cadherin (e 900029-2-B single siRNA, 0.9 nmol 183 1103 CHAT choline acetyltransferase 900029-2-B single siRNA, 0.9 nmol 184 1316 KLF6 Kruppel-like factor 6 900029-2-B single siRNA, 0.9 nmol 185 1441 CSF3R colony stimulating factor 3 recept 900029-2-B single siRNA, 0.9 nmol 186 1499 CTNNB1 catenin (cadherin-associated prot 900029-2-B single siRNA, 0.9 nmol 187 1742 DLG4 discs, large homolog 4 (Drosophil 900029-2-B single siRNA, 0.9 nmol 188 1846 DUSP4 dual specificity phosphatase 4 900029-2-B single siRNA, 0.9 nmol 189 1906 EDN1 endothelin 1 900029-2-B single siRNA, 0.9 nmol 190 1959 EGR2 early growth response 2 (Krox-20 900029-2-B single siRNA, 0.9 nmol 191 960 CD44 CD44 molecule (Indian blood gro 900029-2-B single siRNA, 0.9 nmol 192 1001 CDH3 cadherin 3, type 1, P-cadherin (p 900029-2-B single siRNA, 0.9 nmol 193 1120 CHKB choline kinase beta 900029-2-B single siRNA, 0.9 nmol 194 1385 CREB1 cAMP responsive element bindin 900029-2-B single siRNA, 0.9 nmol 195 1445 CSK c-src tyrosine kinase 900029-2-B single siRNA, 0.9 nmol 196 1500 CTNND1 catenin (cadherin-associated prot 900029-2-B single siRNA, 0.9 nmol 197 1759 DNM1 dynamin 1 900029-2-B single siRNA, 0.9 nmol 198 1848 DUSP6 dual specificity phosphatase 6 900029-2-B single siRNA, 0.9 nmol 199 1915 EEF1A1 eukaryotic translation elongation  900029-2-B single siRNA, 0.9 nmol 200 1960 EGR3 early growth response 3 900029-2-B single siRNA, 0.9 nmol 201 966 CD59 CD59 molecule, complement reg 900029-2-B single siRNA, 0.9 nmol 202 1003 CDH5 cadherin 5, type 2, VE-cadherin ( 900029-2-B single siRNA, 0.9 nmol 203 1147 CHUK conserved helix-loop-helix ubiquit 900029-2-B single siRNA, 0.9 nmol 204 1398 CRK v-crk sarcoma virus CT10 oncog 900029-2-B single siRNA, 0.9 nmol 205 1457 CSNK2A1 casein kinase 2, alpha 1 polypept 900029-2-B single siRNA, 0.9 nmol 206 1523 CUTL1 cut-like 1, CCAAT displacement  900029-2-B single siRNA, 0.9 nmol 207 1793 DOCK1 dedicator of cytokinesis 1 900029-2-B single siRNA, 0.9 nmol 208 1849 DUSP7 dual specificity phosphatase 7 900029-2-B single siRNA, 0.9 nmol 209 1917 EEF1A2 eukaryotic translation elongation  900029-2-B single siRNA, 0.9 nmol 210 1969 EPHA2 EPH receptor A2 900029-2-B single siRNA, 0.9 nmol 211 987 LRBA LPS-responsive vesicle trafficking 900029-2-B single siRNA, 0.9 nmol 212 1017 CDK2 cyclin-dependent kinase 2 900029-2-B single siRNA, 0.9 nmol 213 1230 CCR1 chemokine (C-C motif) receptor 1 900029-2-B single siRNA, 0.9 nmol 214 1399 CRKL v-crk sarcoma virus CT10 oncog 900029-2-B single siRNA, 0.9 nmol 215 1464 CSPG4 chondroitin sulfate proteoglycan 4 900029-2-B single siRNA, 0.9 nmol 216 1601 DAB2 disabled homolog 2, mitogen-res 900029-2-B single siRNA, 0.9 nmol 217 1794 DOCK2 dedicator of cytokinesis 2 900029-2-B single siRNA, 0.9 nmol 218 1852 DUSP9 dual specificity phosphatase 9 900029-2-B single siRNA, 0.9 nmol 219 1950 EGF epidermal growth factor (beta-uro 900029-2-B single siRNA, 0.9 nmol 220 1973 EIF4A1 eukaryotic translation initiation fa 900029-2-B single siRNA, 0.9 nmol 221 993 CDC25A cell division cycle 25 homolog A ( 900029-2-B single siRNA, 0.9 nmol 222 1050 CEBPA CCAAT/enhancer binding protein 900029-2-B single siRNA, 0.9 nmol 223 1231 CCR2 chemokine (C-C motif) receptor 2 900029-2-B single siRNA, 0.9 nmol 224 1432 MAPK14 mitogen-activated protein kinase 900029-2-B single siRNA, 0.9 nmol 225 1490 CTGF connective tissue growth factor 900029-2-B single siRNA, 0.9 nmol 226 1605 DAG1 dystroglycan 1 (dystrophin-associ 900029-2-B single siRNA, 0.9 nmol 227 1839 HBEGF heparin-binding EGF-like growth  900029-2-B single siRNA, 0.9 nmol 228 1875 E2F5 E2F transcription factor 5, p130-b 900029-2-B single siRNA, 0.9 nmol 229 1956 EGFR epidermal growth factor receptor  900029-2-B single siRNA, 0.9 nmol 230 1974 EIF4A2 eukaryotic translation initiation fa 900029-2-B single siRNA, 0.9 nmol 231 998 CDC42 cell division cycle 42 (GTP bindin 900029-2-B single siRNA, 0.9 nmol 232 1051 CEBPB CCAAT/enhancer binding protein 900029-2-B single siRNA, 0.9 nmol 233 1234 CCR5 chemokine (C-C motif) receptor 5 900029-2-B single siRNA, 0.9 nmol 234 1439 CSF2RB colony stimulating factor 2 recept 900029-2-B single siRNA, 0.9 nmol 235 1495 CTNNA1 catenin (cadherin-associated prot 900029-2-B single siRNA, 0.9 nmol 236 1634 DCN decorin 900029-2-B single siRNA, 0.9 nmol 237 1843 DUSP1 dual specificity phosphatase 1 900029-2-B single siRNA, 0.9 nmol 238 1879 EBF1 early B-cell factor 1 900029-2-B single siRNA, 0.9 nmol 239 1958 EGR1 early growth response 1 900029-2-B single siRNA, 0.9 nmol 240 1999 ELF3 E74-like factor 3 (ets domain tran 900029-3-A single siRNA, 0.9 nmol 241 2002 ELK1 ELK1, member of ETS oncogene 900029-3-A single siRNA, 0.9 nmol 242 2044 EPHA5 EPH receptor A5 900029-3-A single siRNA, 0.9 nmol 243 2065 ERBB3 v-erb-b2 erythroblastic leukemia  900029-3-A single siRNA, 0.9 nmol 244 2120 ETV6 ets variant gene 6 (TEL oncogen 900029-3-A single siRNA, 0.9 nmol 245 2222 FDFT1 farnesyl-diphosphate farnesyltran 900029-3-A single siRNA, 0.9 nmol 246 2264 FGFR4 fibroblast growth factor receptor 4 900029-3-A single siRNA, 0.9 nmol 247 2322 FLT3 fms-related tyrosine kinase 3 900029-3-A single siRNA, 0.9 nmol 248 2534 FYN FYN oncogene related to SRC, F 900029-3-A single siRNA, 0.9 nmol 249 2690 GHR growth hormone receptor 900029-3-A single siRNA, 0.9 nmol 250 2771 GNAI2 guanine nucleotide binding protei 900029-3-A single siRNA, 0.9 nmol 251 2017 CTTN cortactin 900029-3-A single siRNA, 0.9 nmol 252 2045 EPHA7 EPH receptor A7 900029-3-A single siRNA, 0.9 nmol 253 2066 ERBB4 v-erb-a erythroblastic leukemia vi 900029-3-A single siRNA, 0.9 nmol 254 2138 EYA1 eyes absent homolog 1 (Drosoph 900029-3-A single siRNA, 0.9 nmol 255 2241 FER fer (fps/fes related) tyrosine kinas 900029-3-A single siRNA, 0.9 nmol 256 2268 FGR Gardner-Rasheed feline sarcoma 900029-3-A single siRNA, 0.9 nmol 257 2324 FLT4 fms-related tyrosine kinase 4 900029-3-A single siRNA, 0.9 nmol 258 2547 XRCC6 X-ray repair complementing defe 900029-3-A single siRNA, 0.9 nmol 259 2697 GJA1 gap junction protein, alpha 1, 43k 900029-3-A single siRNA, 0.9 nmol 260 2773 GNAI3 guanine nucleotide binding protei 900029-3-A single siRNA, 0.9 nmol 261 2035 EPB41 erythrocyte membrane protein ba 900029-3-A single siRNA, 0.9 nmol 262 2057 EPOR erythropoietin receptor 900029-3-A single siRNA, 0.9 nmol 263 2069 EREG epiregulin 900029-3-A single siRNA, 0.9 nmol 264 2139 EYA2 eyes absent homolog 2 (Drosoph 900029-3-A single siRNA, 0.9 nmol 265 2242 FES feline sarcoma oncogene 900029-3-A single siRNA, 0.9 nmol 266 2277 FIGF c-fos induced growth factor (vasc 900029-3-A single siRNA, 0.9 nmol 267 2353 FOS v-fos FBJ murine osteosarcoma  900029-3-A single siRNA, 0.9 nmol 268 2549 GAB1 GRB2-associated binding protein 900029-3-A single siRNA, 0.9 nmol 269 2736 GLI2 GLI-Kruppel family member GLI2 900029-3-A single siRNA, 0.9 nmol 270 2775 GNAO1 guanine nucleotide binding protei 900029-3-A single siRNA, 0.9 nmol 271 2036 EPB41L1 erythrocyte membrane protein ba 900029-3-A single siRNA, 0.9 nmol 272 2059 EPS8 epidermal growth factor receptor  900029-3-A single siRNA, 0.9 nmol 273 2070 EYA4 eyes absent homolog 4 (Drosoph 900029-3-A single siRNA, 0.9 nmol 274 2140 EYA3 eyes absent homolog 3 (Drosoph 900029-3-A single siRNA, 0.9 nmol 275 2260 FGFR1 fibroblast growth factor receptor 1 900029-3-A single siRNA, 0.9 nmol 276 2308 FOXO1 forkhead box O1 900029-3-A single siRNA, 0.9 nmol 277 2354 FOSB FBJ murine osteosarcoma viral o 900029-3-A single siRNA, 0.9 nmol 278 2597 GAPDH glyceraldehyde-3-phosphate deh 900029-3-A single siRNA, 0.9 nmol 279 2737 GLI3 GLI-Kruppel family member GLI3 900029-3-A single siRNA, 0.9 nmol 280 2810 SFN stratifin 900029-3-A single siRNA, 0.9 nmol 281 2037 EPB41L2 erythrocyte membrane protein ba 900029-3-A single siRNA, 0.9 nmol 282 2060 EPS15 epidermal growth factor receptor  900029-3-A single siRNA, 0.9 nmol 283 2099 ESR1 estrogen receptor 1 900029-3-A single siRNA, 0.9 nmol 284 2185 PTK2B PTK2B protein tyrosine kinase 2 900029-3-A single siRNA, 0.9 nmol 285 2261 FGFR3 fibroblast growth factor receptor 3 900029-3-A single siRNA, 0.9 nmol 286 2316 FLNA filamin A, alpha (actin binding pro 900029-3-A single siRNA, 0.9 nmol 287 2444 FRK fyn-related kinase 900029-3-A single siRNA, 0.9 nmol 288 2674 GFRA1 GDNF family receptor alpha 1 900029-3-A single siRNA, 0.9 nmol 289 2768 GNA12 guanine nucleotide binding protei 900029-3-A single siRNA, 0.9 nmol 290 2885 GRB2 growth factor receptor-bound prot 900029-3-A single siRNA, 0.9 nmol 291 2042 EPHA3 EPH receptor A3 900029-3-A single siRNA, 0.9 nmol 292 2064 ERBB2 v-erb-b2 erythroblastic leukemia  900029-3-A single siRNA, 0.9 nmol 293 2107 ETF1 eukaryotic translation termination 900029-3-A single siRNA, 0.9 nmol 294 2214 FCGR3A Fc fragment of IgG, low affinity III 900029-3-A single siRNA, 0.9 nmol 295 2263 FGFR2 fibroblast growth factor receptor 2 900029-3-A single siRNA, 0.9 nmol 296 2321 FLT1 fms-related tyrosine kinase 1 (va 900029-3-A single siRNA, 0.9 nmol 297 2521 FUS fusion (involved in t(12;16) in mal 900029-3-A single siRNA, 0.9 nmol 298 2683 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4-g 900029-3-A single siRNA, 0.9 nmol 299 2770 GNAI1 guanine nucleotide binding protei 900029-3-A single siRNA, 0.9 nmol 300 2886 GRB7 growth factor receptor-bound prot 900029-3-B single siRNA, 0.9 nmol 301 2002 ELK1 ELK1, member of ETS oncogene 900029-3-B single siRNA, 0.9 nmol 302 2044 EPHA5 EPH receptor A5 900029-3-B single siRNA, 0.9 nmol 303 2065 ERBB3 v-erb-b2 erythroblastic leukemia  900029-3-B single siRNA, 0.9 nmol 304 2120 ETV6 ets variant gene 6 (TEL oncogen 900029-3-B single siRNA, 0.9 nmol 305 2222 FDFT1 farnesyl-diphosphate farnesyltran 900029-3-B single siRNA, 0.9 nmol 306 2264 FGFR4 fibroblast growth factor receptor 4 900029-3-B single siRNA, 0.9 nmol 307 2322 FLT3 fms-related tyrosine kinase 3 900029-3-B single siRNA, 0.9 nmol 308 2534 FYN FYN oncogene related to SRC, F 900029-3-B single siRNA, 0.9 nmol 309 2690 GHR growth hormone receptor 900029-3-B single siRNA, 0.9 nmol 310 2771 GNAI2 guanine nucleotide binding protei 900029-3-B single siRNA, 0.9 nmol 311 2017 CTTN cortactin 900029-3-B single siRNA, 0.9 nmol 312 2045 EPHA7 EPH receptor A7 900029-3-B single siRNA, 0.9 nmol 313 2066 ERBB4 v-erb-a erythroblastic leukemia vi 900029-3-B single siRNA, 0.9 nmol 314 2138 EYA1 eyes absent homolog 1 (Drosoph 900029-3-B single siRNA, 0.9 nmol 315 2241 FER fer (fps/fes related) tyrosine kinas 900029-3-B single siRNA, 0.9 nmol 316 2268 FGR Gardner-Rasheed feline sarcoma 900029-3-B single siRNA, 0.9 nmol 317 2324 FLT4 fms-related tyrosine kinase 4 900029-3-B single siRNA, 0.9 nmol 318 2547 XRCC6 X-ray repair complementing defe 900029-3-B single siRNA, 0.9 nmol 319 2697 GJA1 gap junction protein, alpha 1, 43k 900029-3-B single siRNA, 0.9 nmol 320 2773 GNAI3 guanine nucleotide binding protei 900029-3-B single siRNA, 0.9 nmol 321 2035 EPB41 erythrocyte membrane protein ba 900029-3-B single siRNA, 0.9 nmol 322 2057 EPOR erythropoietin receptor 900029-3-B single siRNA, 0.9 nmol 323 2069 EREG epiregulin 900029-3-B single siRNA, 0.9 nmol 324 2139 EYA2 eyes absent homolog 2 (Drosoph 900029-3-B single siRNA, 0.9 nmol 325 2242 FES feline sarcoma oncogene 900029-3-B single siRNA, 0.9 nmol 326 2277 FIGF c-fos induced growth factor (vasc 900029-3-B single siRNA, 0.9 nmol 327 2353 FOS v-fos FBJ murine osteosarcoma  900029-3-B single siRNA, 0.9 nmol 328 2549 GAB1 GRB2-associated binding protein 900029-3-B single siRNA, 0.9 nmol 329 2736 GLI2 GLI-Kruppel family member GLI2 900029-3-B single siRNA, 0.9 nmol 330 2775 GNAO1 guanine nucleotide binding protei 900029-3-B single siRNA, 0.9 nmol 331 2036 EPB41L1 erythrocyte membrane protein ba 900029-3-B single siRNA, 0.9 nmol 332 2059 EPS8 epidermal growth factor receptor  900029-3-B single siRNA, 0.9 nmol 333 2070 EYA4 eyes absent homolog 4 (Drosoph 900029-3-B single siRNA, 0.9 nmol 334 2140 EYA3 eyes absent homolog 3 (Drosoph 900029-3-B single siRNA, 0.9 nmol 335 2260 FGFR1 fibroblast growth factor receptor 1 900029-3-B single siRNA, 0.9 nmol 336 2308 FOXO1 forkhead box O1 900029-3-B single siRNA, 0.9 nmol 337 2354 FOSB FBJ murine osteosarcoma viral o 900029-3-B single siRNA, 0.9 nmol 338 2597 GAPDH glyceraldehyde-3-phosphate deh 900029-3-B single siRNA, 0.9 nmol 339 2737 GLI3 GLI-Kruppel family member GLI3 900029-3-B single siRNA, 0.9 nmol 340 2810 SFN stratifin 900029-3-B single siRNA, 0.9 nmol 341 2037 EPB41L2 erythrocyte membrane protein ba 900029-3-B single siRNA, 0.9 nmol 342 2060 EPS15 epidermal growth factor receptor  900029-3-B single siRNA, 0.9 nmol 343 2099 ESR1 estrogen receptor 1 900029-3-B single siRNA, 0.9 nmol 344 2185 PTK2B PTK2B protein tyrosine kinase 2  900029-3-B single siRNA, 0.9 nmol 345 2261 FGFR3 fibroblast growth factor receptor 3 900029-3-B single siRNA, 0.9 nmol 346 2316 FLNA filamin A, alpha (actin binding pro 900029-3-B single siRNA, 0.9 nmol 347 2444 FRK fyn-related kinase 900029-3-B single siRNA, 0.9 nmol 348 2674 GFRA1 GDNF family receptor alpha 1 900029-3-B single siRNA, 0.9 nmol 349 2768 GNA12 guanine nucleotide binding protei 900029-3-B single siRNA, 0.9 nmol 350 2885 GRB2 growth factor receptor-bound prot 900029-3-B single siRNA, 0.9 nmol 351 2042 EPHA3 EPH receptor A3 900029-3-B single siRNA, 0.9 nmol 352 2064 ERBB2 v-erb-b2 erythroblastic leukemia  900029-3-B single siRNA, 0.9 nmol 353 2107 ETF1 eukaryotic translation termination 900029-3-B single siRNA, 0.9 nmol 354 2214 FCGR3A Fc fragment of IgG, low affinity III 900029-3-B single siRNA, 0.9 nmol 355 2263 FGFR2 fibroblast growth factor receptor 2 900029-3-B single siRNA, 0.9 nmol 356 2321 FLT1 fms-related tyrosine kinase 1 (va 900029-3-B single siRNA, 0.9 nmol 357 2521 FUS fusion (involved in t(12;16) in mal 900029-3-B single siRNA, 0.9 nmol 358 2683 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4-g 900029-3-B single siRNA, 0.9 nmol 359 2770 GNAI1 guanine nucleotide binding protei 900029-3-B single siRNA, 0.9 nmol 360 2886 GRB7 growth factor receptor-bound prot 900029-4-A single siRNA, 0.9 nmol 361 2887 GRB10 growth factor receptor-bound prot 900029-4-A single siRNA, 0.9 nmol 362 3064 HD huntingtin (Huntington disease) 900029-4-A single siRNA, 0.9 nmol 363 3164 NR4A1 nuclear receptor subfamily 4, gro 900029-4-A single siRNA, 0.9 nmol 364 3312 HSPA8 heat shock 70 kDa protein 8 900029-4-A single siRNA, 0.9 nmol 365 3398 ID2 inhibitor of DNA binding 2, domin 900029-4-A single siRNA, 0.9 nmol 366 3561 IL2RG interleukin 2 receptor, gamma (s 900029-4-A single siRNA, 0.9 nmol 367 3643 INSR insulin receptor 900029-4-A single siRNA, 0.9 nmol 368 3716 JAK1 Janus kinase 1 (a protein tyrosin 900029-4-A single siRNA, 0.9 nmol 369 3732 CD82 CD82 molecule 900029-4-A single siRNA, 0.9 nmol 370 3855 KRT7 keratin 7 900029-4-A single siRNA, 0.9 nmol 371 2888 GRB14 growth factor receptor-bound prot 900029-4-A single siRNA, 0.9 nmol 372 3065 HDAC1 histone deacetylase 1 900029-4-A single siRNA, 0.9 nmol 373 3178 HNRPA1 heterogeneous nuclear ribonucle 900029-4-A single siRNA, 0.9 nmol 374 3313 HSPA9 heat shock 70 kDa protein 9 (mor 900029-4-A single siRNA, 0.9 nmol 375 3480 IGF1R insulin-like growth factor 1 recept 900029-4-A single siRNA, 0.9 nmol 376 3566 IL4R interleukin 4 receptor 900029-4-A single siRNA, 0.9 nmol 377 3645 INSRR insulin receptor-related receptor 900029-4-A single siRNA, 0.9 nmol 378 3717 JAK2 Janus kinase 2 (a protein tyrosin 900029-4-A single siRNA, 0.9 nmol 379 3791 KDR kinase insert domain receptor (a  900029-4-A single siRNA, 0.9 nmol 380 3856 KRT8 keratin 8 900029-4-A single siRNA, 0.9 nmol 381 2889 RAPGEF1 Rap guanine nucleotide exchang 900029-4-A single siRNA, 0.9 nmol 382 3082 HGF hepatocyte growth factor (hepapo 900029-4-A single siRNA, 0.9 nmol 383 3190 HNRPK heterogeneous nuclear ribonucle 900029-4-A single siRNA, 0.9 nmol 384 3320 HSP90AA1 heat shock protein 90 kDa alpha ( 900029-4-A single siRNA, 0.9 nmol 385 3491 CYR61 cysteine-rich, angiogenic inducer, 900029-4-A single siRNA, 0.9 nmol 386 3572 IL6ST interleukin 6 signal transducer (gr 900029-4-A single siRNA, 0.9 nmol 387 3667 IRS1 insulin receptor substrate 1 900029-4-A single siRNA, 0.9 nmol 388 3725 JUN jun oncogene 900029-4-A single siRNA, 0.9 nmol 389 3845 KRAS v-Ki-ras2 Kirsten rat sarcoma vira 900029-4-A single siRNA, 0.9 nmol 390 3872 KRT17 keratin 17 900029-4-A single siRNA, 0.9 nmol 391 2932 GSK3B glycogen synthase kinase 3 beta 900029-4-A single siRNA, 0.9 nmol 392 3084 NRG1 neuregulin 1 900029-4-A single siRNA, 0.9 nmol 393 3265 HRAS v-Ha-ras Harvey rat sarcoma vira 900029-4-A single siRNA, 0.9 nmol 394 3329 HSPD1 heat shock 60 kDa protein 1 (cha 900029-4-A single siRNA, 0.9 nmol 395 3551 IKBKB inhibitor of kappa light polypeptid 900029-4-A single siRNA, 0.9 nmol 396 3609 ILF3 interleukin enhancer binding fact 900029-4-A single siRNA, 0.9 nmol 397 3678 ITGA5 integrin, alpha 5 (fibronectin rece 900029-4-A single siRNA, 0.9 nmol 398 3726 JUNB jun B proto-oncogene 900029-4-A single siRNA, 0.9 nmol 399 3852 KRT5 keratin 5 (epidermolysis bullosa s 900029-4-A single siRNA, 0.9 nmol 400 3875 KRT18 keratin 18 900029-4-A single siRNA, 0.9 nmol 401 2934 GSN gelsolin (amyloidosis, Finnish typ 900029-4-A single siRNA, 0.9 nmol 402 3092 HIP1 huntingtin interacting protein 1 900029-4-A single siRNA, 0.9 nmol 403 3280 HES1 hairy and enhancer of split 1, (Dr 900029-4-A single siRNA, 0.9 nmol 404 3371 TNC tenascin C (hexabrachion) 900029-4-A single siRNA, 0.9 nmol 405 3558 IL2 interleukin 2 900029-4-A single siRNA, 0.9 nmol 406 3635 INPP5D inositol polyphosphate-5-phospha 900029-4-A single siRNA, 0.9 nmol 407 3690 ITGB3 integrin, beta 3 (platelet glycoprot 900029-4-A single siRNA, 0.9 nmol 408 3727 JUND jun D proto-oncogene 900029-4-A single siRNA, 0.9 nmol 409 3853 KRT6A keratin 6A 900029-4-A single siRNA, 0.9 nmol 410 3897 L1CAM L1 cell adhesion molecule 900029-4-A single siRNA, 0.9 nmol 411 3055 HCK hemopoietic cell kinase 900029-4-A single siRNA, 0.9 nmol 412 3105 HLA-A major histocompatibility complex, 900029-4-A single siRNA, 0.9 nmol 413 3309 HSPA5 heat shock 70 kDa protein 5 (gluc 900029-4-A single siRNA, 0.9 nmol 414 3397 ID1 inhibitor of DNA binding 1, domin 900029-4-A single siRNA, 0.9 nmol 415 3560 IL2RB interleukin 2 receptor, beta 900029-4-A single siRNA, 0.9 nmol 416 3636 INPPL1 inositol polyphosphate phosphata 900029-4-A single siRNA, 0.9 nmol 417 3691 ITGB4 integrin, beta 4 900029-4-A single siRNA, 0.9 nmol 418 3728 JUP junction plakoglobin 900029-4-A single siRNA, 0.9 nmol 419 3854 KRT68 keratin 6B 900029-4-A single siRNA, 0.9 nmol 420 3932 LCK lymphocyte-specific protein tyrosi 900029-4-B single siRNA, 0.9 nmol 421 2887 GRB10 growth factor receptor-bound prot 900029-4-B single siRNA, 0.9 nmol 422 3064 HD huntingtin (Huntington disease) 900029-4-B single siRNA, 0.9 nmol 423 3164 NR4A1 nuclear receptor subfamily 4, gro 900029-4-B single siRNA, 0.9 nmol 424 3312 HSPA8 heat shock 70 kDa protein 8 900029-4-B single siRNA, 0.9 nmol 425 3398 ID2 inhibitor of DNA binding 2, domin 900029-4-B single siRNA, 0.9 nmol 426 3561 IL2RG interleukin 2 receptor, gamma (s 900029-4-B single siRNA, 0.9 nmol 427 3643 INSR insulin receptor 900029-4-B single siRNA, 0.9 nmol 428 3716 JAK1 Janus kinase 1 (a protein tyrosin 900029-4-B single siRNA, 0.9 nmol 429 3732 CD82 CD82 molecule 900029-4-B single siRNA, 0.9 nmol 430 3855 KRT7 keratin 7 900029-4-B single siRNA, 0.9 nmol 431 2888 GRB14 growth factor receptor-bound prot 900029-4-B single siRNA, 0.9 nmol 432 3065 HDAC1 histone deacetylase 1 900029-4-B single siRNA, 0.9 nmol 433 3178 HNRPA1 heterogeneous nuclear ribonucle 900029-4-B single siRNA, 0.9 nmol 434 3313 HSPA9 heat shock 70 kDa protein 9 (mor 900029-4-B single siRNA, 0.9 nmol 435 3480 IGF1R insulin-like growth factor 1 recept 900029-4-B single siRNA, 0.9 nmol 436 3566 IL4R interleukin 4 receptor 900029-4-B single siRNA, 0.9 nmol 437 3645 INSRR insulin receptor-related receptor 900029-4-B single siRNA, 0.9 nmol 438 3717 JAK2 Janus kinase 2 (a protein tyrosin 900029-4-B single siRNA, 0.9 nmol 439 3791 KDR kinase insert domain receptor (a  900029-4-B single siRNA, 0.9 nmol 440 3856 KRT8 keratin 8 900029-4-B single siRNA, 0.9 nmol 441 2889 RAPGEF1 Rap guanine nucleotide exchang 900029-4-B single siRNA, 0.9 nmol 442 3082 HGF hepatocyte growth factor (hepapo 900029-4-B single siRNA, 0.9 nmol 443 3190 HNRPK heterogeneous nuclear ribonucle 900029-4-B single siRNA, 0.9 nmol 444 3320 HSP90AA1 heat shock protein 90 kDa alpha  900029-4-B single siRNA, 0.9 nmol 445 3491 CYR61 cysteine-rich, angiogenic inducer, 900029-4-B single siRNA, 0.9 nmol 446 3572 IL6ST interleukin 6 signal transducer (g 900029-4-B single siRNA, 0.9 nmol 447 3667 IRS1 insulin receptor substrate 1 900029-4-B single siRNA, 0.9 nmol 448 3725 JUN jun oncogene 900029-4-B single siRNA, 0.9 nmol 449 3845 KRAS v-Ki-ras2 Kirsten rat sarcoma vira 900029-4-B single siRNA, 0.9 nmol 450 3872 KRT17 keratin 17 900029-4-B single siRNA, 0.9 nmol 451 2932 GSK3B glycogen synthase kinase 3 beta 900029-4-B single siRNA, 0.9 nmol 452 3084 NRG1 neuregulin 1 900029-4-B single siRNA, 0.9 nmol 453 3265 HRAS v-Ha-ras Harvey rat sarcoma vira 900029-4-B single siRNA, 0.9 nmol 454 3329 HSPD1 heat shock 60 kDa protein 1 (cha 900029-4-B single siRNA, 0.9 nmol 455 3551 IKBKB inhibitor of kappa light polypeptid 900029-4-B single siRNA, 0.9 nmol 456 3609 ILF3 interleukin enhancer binding fact 900029-4-B single siRNA, 0.9 nmol 457 3678 ITGA5 integrin, alpha 5 (fibronectin rece 900029-4-B single siRNA, 0.9 nmol 458 3726 JUNB jun B proto-oncogene 900029-4-B single siRNA, 0.9 nmol 459 3852 KRT5 keratin 5 (epidermolysis bullosa s 900029-4-B single siRNA, 0.9 nmol 460 3875 KRT18 keratin 18 900029-4-B single siRNA, 0.9 nmol 461 2934 GSN gelsolin (amyloidosis, Finnish typ 900029-4-B single siRNA, 0.9 nmol 462 3092 HIP1 huntingtin interacting protein 1 900029-4-B single siRNA, 0.9 nmol 463 3280 HES1 hairy and enhancer of split 1, (Dr 900029-4-B single siRNA, 0.9 nmol 464 3371 TNC tenascin C (hexabrachion) 900029-4-B single siRNA, 0.9 nmol 465 3558 IL2 interleukin 2 900029-4-B single siRNA, 0.9 nmol 466 3635 INPP5D inositol polyphosphate-5-phosph 900029-4-B single siRNA, 0.9 nmol 467 3690 ITGB3 integrin, beta 3 (platelet glycoprot 900029-4-B single siRNA, 0.9 nmol 468 3727 JUND jun D proto-oncogene 900029-4-B single siRNA, 0.9 nmol 469 3853 KRT6A keratin 6A 900029-4-B single siRNA, 0.9 nmol 470 3897 L1CAM L1 cell adhesion molecule 900029-4-B single siRNA, 0.9 nmol 471 3055 HCK hemopoietic cell kinase 900029-4-B single siRNA, 0.9 nmol 472 3105 HLA-A major histocompatibility complex, 900029-4-B single siRNA, 0.9 nmol 473 3309 HSPA5 heat shock 70 kDa protein 5 (gluc 900029-4-B single siRNA, 0.9 nmol 474 3397 ID1 inhibitor of DNA binding 1, domin 900029-4-B single siRNA, 0.9 nmol 475 3560 IL2RB interleukin 2 receptor, beta 900029-4-B single siRNA, 0.9 nmol 476 3636 INPPL1 inositol polyphosphate phosphata 900029-4-B single siRNA, 0.9 nmol 477 3691 ITGB4 integrin, beta 4 900029-4-B single siRNA, 0.9 nmol 478 3728 JUP junction plakoglobin 900029-4-B single siRNA, 0.9 nmol 479 3854 KRT6B keratin 6B 900029-4-B single siRNA, 0.9 nmol 480 3932 LCK lymphocyte-specific protein tyrosi 900029-5-A single siRNA, 0.9 nmol 481 3937 LCP2 lymphocyte cytosolic protein 2 (S 900029-5-A single siRNA, 0.9 nmol 482 4086 SMAD1 SMAD family member 1 900029-5-A single siRNA, 0.9 nmol 483 4194 MDM4 Mdm4, transformed 3T3 cell dou 900029-5-A single siRNA, 0.9 nmol 484 4296 MAP3K11 mitogen-activated protein kinase 900029-5-A single siRNA, 0.9 nmol 485 4690 NCK1 NCK adaptor protein 1 900029-5-A single siRNA, 0.9 nmol 486 4893 NRAS neuroblastoma RAS viral (v-ras)  900029-5-A single siRNA, 0.9 nmol 487 5017 OVOL1 ovo-like 1(Drosophila) 900029-5-A single siRNA, 0.9 nmol 488 5063 PAK3 p21 (CDKN1A)-activated kinase  900029-5-A single siRNA, 0.9 nmol 489 5290 PIK3CA phosphoinositide-3-kinase, cataly 900029-5-A single siRNA, 0.9 nmol 490 5300 PIN1 protein (peptidylprolyl cis/trans is 900029-5-A single siRNA, 0.9 nmol 491 3958 LGALS3 lectin, galactoside-binding, solubl 900029-5-A single siRNA, 0.9 nmol 492 4087 SMAD2 SMAD family member 2 900029-5-A single siRNA, 0.9 nmol 493 4214 MAP3K1 mitogen-activated protein kinase 900029-5-A single siRNA, 0.9 nmol 494 4311 MME membrane metallo-endopeptidas 900029-5-A single siRNA, 0.9 nmol 495 4739 NEDD9 neural precursor cell expressed,  900029-5-A single siRNA, 0.9 nmol 496 4914 NTRK1 neurotrophic tyrosine kinase, rec 900029-5-A single siRNA, 0.9 nmol 497 5037 PEBP1 phosphatidylethanolamine bindin 900029-5-A single siRNA, 0.9 nmol 498 5130 PCYT1A phosphate cytidytyltransferase 1, 900029-5-A single siRNA, 0.9 nmol 499 5291 PIK3CB phosphoinositide-3-kinase, cataly 900029-5-A single siRNA, 0.9 nmol 500 5305 PIP5K2A phosphatidylinositol-4-phosphate 900029-5-A single siRNA, 0.9 nmol 501 4000 LMNA lamin A/C 900029-5-A single siRNA, 0.9 nmol 502 4088 SMAD3 SMAD family member 3 900029-5-A single siRNA, 0.9 nmol 503 4215 MAP3K3 mitogen-activated protein kinase 900029-5-A single siRNA, 0.9 nmol 504 4486 MST1R macrophage stimulating 1 recept 900029-5-A single siRNA, 0.9 nmol 505 4790 NFKB1 nuclear factor of kappa light poly 900029-5-A single siRNA, 0.9 nmol 506 4915 NTRK2 neurotrophic tyrosine kinase, rec 900029-5-A single siRNA, 0.9 nmol 507 5042 PABPC3 poly(A) binding protein, cytoplas 900029-5-A single siRNA, 0.9 nmol 508 5159 PDGFRB platelet-derived growth factor rec 900029-5-A single siRNA, 0.9 nmol 509 5293 PIK3CD phosphoinositide-3-kinase, cataly 900029-5-A single siRNA, 0.9 nmol 510 5306 PITPNA phosphatidylinositol transfer prote 900029-5-A single siRNA, 0.9 nmol 511 4035 LRP1 low density lipoprotein-related pr 900029-5-A single siRNA, 0.9 nmol 512 4093 SMAD9 SMAD family member 9 900029-5-A single siRNA, 0.9 nmol 513 4216 MAP3K4 mitogen-activated protein kinase 900029-5-A single siRNA, 0.9 nmol 514 4582 MUC1 mucin 1, cell surface associated 900029-5-A single siRNA, 0.9 nmol 515 4804 NGFR nerve growth factor receptor (TN 900029-5-A single siRNA, 0.9 nmol 516 4916 NTRK3 neurotrophic tyrosine kinase, rec 900029-5-A single siRNA, 0.9 nmol 517 5048 PAFAH1B1 platelet-activating factor acetylhy 900029-5-A single siRNA, 0.9 nmol 518 5170 PDPK1 3-phosphoinositide dependent pr 900029-5-A single siRNA, 0.9 nmol 519 5294 PIK3CG phosphoinositide-3-kinase, cataly 900029-5-A single siRNA, 0.9 nmol 520 5310 PKD1 polycystic kidney disease 1 (auto 900029-5-A single siRNA, 0.9 nmol 521 4058 LTK leukocyte tyrosine kinase 900029-5-A single siRNA, 0.9 nmol 522 4145 MATK megakaryocyte-associated tyrosi 900029-5-A single siRNA, 0.9 nmol 523 4217 MAP3K5 mitogen-activated protein kinase 900029-5-A single siRNA, 0.9 nmol 524 4609 MYC v-myc myelocytomatosis viral on 900029-5-A single siRNA, 0.9 nmol 525 4853 NOTCH2 Notch homolog 2 (Drosophila) 900029-5-A single siRNA, 0.9 nmol 526 4921 DDR2 discoidin domain receptor family, 900029-5-A single siRNA, 0.9 nmol 527 5058 PAK1 p21/Cdc42/Rac1-activated kinas 900029-5-A single siRNA, 0.9 nmol 528 5174 PDZK1 PDZ domain containing 1 900029-5-A single siRNA, 0.9 nmol 529 5295 PIK3R1 phosphoinositide-3-kinase, regul 900029-5-A single siRNA, 0.9 nmol 530 5335 PLCG1 phospholipase C, gamma 1 900029-5-A single siRNA, 0.9 nmol 531 4067 LYN v-yes-1 Yamaguchi sarcoma viral 900029-5-A single siRNA, 0.9 nmol 532 4168 MCF2 MCF2 cell line derived transform 900029-5-A single siRNA, 0.9 nmol 533 4233 MET met proto-oncogene (hepatocyte  900029-5-A single siRNA, 0.9 nmol 534 4627 MYH9 myosin, heavy chain 9, non-musc 900029-5-A single siRNA, 0.9 nmol 535 4867 NPHP1 nephronophthisis 1 (juvenile) 900029-5-A single siRNA, 0.9 nmol 536 4929 NR4A2 nuclear receptor subfamily 4, gro 900029-5-A single siRNA, 0.9 nmol 537 5062 PAK2 p21 (CDKN1A)-activated kinase  900029-5-A single siRNA, 0.9 nmol 538 5287 PIK3C2B phosphoinositide-3-kinase, class 900029-5-A single siRNA, 0.9 nmol 539 5296 PIK3R2 phosphoinositide-3-kinase, regul 900029-5-A single siRNA, 0.9 nmol 540 5336 PLCG2 phospholipase C, gamma 2 (pho 900029-5-B single siRNA, 0.9 nmol 541 3937 LCP2 lymphocyte cytosolic protein 2 (S 900029-5-B single siRNA, 0.9 nmol 542 4086 SMAD1 SMAD family member 1 900029-5-B single siRNA, 0.9 nmol 543 4194 MDM4 Mdm4, transformed 3T3 cell dou 900029-5-B single siRNA, 0.9 nmol 544 4296 MAP3K11 mitogen-activated protein kinase 900029-5-B single siRNA, 0.9 nmol 545 4690 NCK1 NCK adaptor protein 1 900029-5-B single siRNA, 0.9 nmol 546 4893 NRAS neuroblastoma RAS viral (v-ras)  900029-5-B single siRNA, 0.9 nmol 547 5017 OVOL1 ovo-like 1(Drosophila) 900029-5-B single siRNA, 0.9 nmol 548 5063 PAK3 p21 (CDKN1A)-activated kinase  900029-5-B single siRNA, 0.9 nmol 549 5290 PIK3CA phosphoinositide-3-kinase, cataly 900029-5-B single siRNA, 0.9 nmol 550 5300 PIN1 protein (peptidylprolyl cis/trans is 900029-5-B single siRNA, 0.9 nmol 551 3958 LGALS3 lectin, galactoside-binding, solubl 900029-5-B single siRNA, 0.9 nmol 552 4087 SMAD2 SMAD family member 2 900029-5-B single siRNA, 0.9 nmol 553 4214 MAP3K1 mitogen-activated protein kinase 900029-5-B single siRNA, 0.9 nmol 554 4311 MME membrane metallo-endopeptidas 900029-5-B single siRNA, 0.9 nmol 555 4739 NEDD9 neural precursor cell expressed,  900029-5-B single siRNA, 0.9 nmol 556 4914 NTRK1 neurotrophic tyrosine kinase, rec 900029-5-B single siRNA, 0.9 nmol 557 5037 PEBP1 phosphatidylethanolamine binding 900029-5-B single siRNA, 0.9 nmol 558 5130 PCYT1A phosphate cytidylyltransferase 1, 900029-5-B single siRNA, 0.9 nmol 559 5291 PIK3CB phosphoinositide-3-kinase, cataly 900029-5-B single siRNA, 0.9 nmol 560 5305 PIP5K2A phosphatidylinositol-4-phosphate 900029-5-B single siRNA, 0.9 nmol 561 4000 LMNA lamin A/C 900029-5-B single siRNA, 0.9 nmol 562 4088 SMAD3 SMAD family member 3 900029-5-B single siRNA, 0.9 nmol 563 4215 MAP3K3 mitogen-activated protein kinase 900029-5-B single siRNA, 0.9 nmol 564 4486 MST1R macrophage stimulating 1 recept 900029-5-B single siRNA, 0.9 nmol 565 4790 NFKB1 nuclear factor of kappa light polyp 900029-5-B single siRNA, 0.9 nmol 566 4915 NTRK2 neurotrophic tyrosine kinase, rece 900029-5-B single siRNA, 0.9 nmol 567 5042 PABPC3 poly(A) binding protein, cytoplas 900029-5-B single siRNA, 0.9 nmol 568 5159 PDGFRB platelet-derived growth factor rece 900029-5-B single siRNA, 0.9 nmol 569 5293 PIK3CD phosphoinositide-3-kinase, cataly 900029-5-B single siRNA, 0.9 nmol 570 5306 PITPNA phosphatidylinositol transfer prote 900029-5-B single siRNA, 0.9 nmol 571 4035 LRP1 low density lipoprotein-related pr 900029-5-B single siRNA, 0.9 nmol 572 4093 SMAD9 SMAD family member 9 900029-5-B single siRNA, 0.9 nmol 573 4216 MAP3K4 mitogen-activated protein kinase 900029-5-B single siRNA, 0.9 nmol 574 4582 MUC1 mucin 1, cell surface associated 900029-5-B single siRNA, 0.9 nmol 575 4804 NGFR nerve growth factor receptor (TN 900029-5-B single siRNA, 0.9 nmol 576 4916 NTRK3 neurotrophic tyrosine kinase, rec 900029-5-B single siRNA, 0.9 nmol 577 5048 PAFAH1B1 platelet-activating factor acetylhy 900029-5-B single siRNA, 0.9 nmol 578 5170 PDPK1 3-phosphoinositide dependent pr 900029-5-B single siRNA, 0.9 nmol 579 5294 PIK3CG phosphoinositide-3-kinase, cataly 900029-5-B single siRNA, 0.9 nmol 580 5310 PKD1 polycystic kidney disease 1 (auto 900029-5-B single siRNA, 0.9 nmol 581 4058 LTK leukocyte tyrosine kinase 900029-5-B single siRNA, 0.9 nmol 582 4145 MATK megakaryocyte-associated tyrosi 900029-5-B single siRNA, 0.9 nmol 583 4217 MAP3K5 mitogen-activated protein kinase 900029-5-B single siRNA, 0.9 nmol 584 4609 MYC v-myc myelocytomatosis viral on 900029-5-B single siRNA, 0.9 nmol 585 4853 NOTCH2 Notch homolog 2 (Drosophila) 900029-5-B single siRNA, 0.9 nmol 586 4921 DDR2 discoidin domain receptor family, 900029-5-B single siRNA, 0.9 nmol 587 5058 PAK1 p21/Cdc42/Rac1-activated kinase 900029-5-B single siRNA, 0.9 nmol 588 5174 PDZK1 PDZ domain containing 1 900029-5-B single siRNA, 0.9 nmol 589 5295 PIK3R1 phosphoinositide-3-kinase, regul 900029-5-B single siRNA, 0.9 nmol 590 5335 PLCG1 phospholipase C, gamma 1 900029-5-B single siRNA, 0.9 nmol 591 4067 LYN v-yes-1 Yamaguchi sarcoma viral 900029-5-B single siRNA, 0.9 nmol 592 4168 MCF2 MCF.2 cell line derived transform 900029-5-B single siRNA, 0.9 nmol 593 4233 MET met proto-oncogene (hepatocyte  900029-5-B single siRNA, 0.9 nmol 594 4627 MYH9 myosin, heavy chain 9, non-mus 900029-5-B single siRNA, 0.9 nmol 595 4867 NPHP1 nephronophthisis 1 (juvenile) 900029-5-B single siRNA, 0.9 nmol 596 4929 NR4A2 nuclear receptor subfamily 4, gro 900029-5-B single siRNA, 0.9 nmol 597 5062 PAK2 p21 (CDKN1A)-activated kinase  900029-5-B single siRNA, 0.9 nmol 598 5287 PIK3C2B phosphoinositide-3-kinase, class 900029-5-B single siRNA, 0.9 nmol 599 5296 PIK3R2 phosphoinositide-3-kinase, regul 900029-5-B single siRNA, 0.9 nmol 600 5336 PLCG2 phospholipase C, gamma 2 (pho 900029-6-A single siRNA, 0.9 nmol 601 5337 PLD1 phospholipase D1, phosphatidylc 900029-6-A single siRNA, 0.9 nmol 602 5455 POU3F3 POU domain, class 3, transcripti 900029-6-A single siRNA, 0.9 nmol 603 5566 PRKACA protein kinase, cAMP-dependent, 900029-6-A single siRNA, 0.9 nmol 604 5580 PRKCD protein kinase C, delta 900029-6-A single siRNA, 0.9 nmol 605 5588 PRKCQ protein kinase C, theta 900029-6-A single siRNA, 0.9 nmol 606 5601 MAPK9 mitogen-activated protein kinase 900029-6-A single siRNA, 0.9 nmol 607 5613 PRKX protein kinase, X-linked 900029-6-A single siRNA, 0.9 nmol 608 5770 PTPN1 protein tyrosine phosphatase, no 900029-6-A single siRNA, 0.9 nmol 609 5794 PTPRH protein tyrosine phosphatase, rec 900029-6-A single siRNA, 0.9 nmol 610 5881 RAC3 ras-related C3 botulinum toxin su 900029-6-A single siRNA, 0.9 nmol 611 5338 PLD2 phospholipase D2 900029-6-A single siRNA, 0.9 nmol 612 5456 POU3F4 POU domain, class 3, transcripti 900029-6-A single siRNA, 0.9 nmol 613 5567 PRKACB protein kinase, cAMP-dependent, 900029-6-A single siRNA, 0.9 nmol 614 5581 PRKCE protein kinase C, epsilon 900029-6-A single siRNA, 0.9 nmol 615 5590 PRKCZ protein kinase C, zeta 900029-6-A single siRNA, 0.9 nmol 616 5602 MAPK10 mitogen-activated protein kinase 900029-6-A single siRNA, 0.9 nmol 617 5625 PRODH proline dehydrogenase (oxidase) 900029-6-A single siRNA, 0.9 nmol 618 5771 PTPN2 protein tyrosine phosphatase, no 900029-6-A single siRNA, 0.9 nmol 619 5795 PTPRJ protein tyrosine phosphatase, rec 900029-6-A single siRNA, 0.9 nmol 620 5894 RAF1 v-raf-1 murine leukemia viral onc 900029-6-A single siRNA, 0.9 nmol 621 5339 PLEC1 plectin 1, intermediate filament bi 900029-6-A single siRNA, 0.9 nmol 622 5478 PPIA peptidylprolyl isomerase A (cyclo 900029-6-A single siRNA, 0.9 nmol 623 5568 PRKACG protein kinase, cAMP-dependent, 900029-6-A single siRNA, 0.9 nmol 624 5582 PRKCG protein kinase C, gamma 900029-6-A single siRNA, 0.9 nmol 625 5591 PRKDC protein kinase, DNA-activated, ca 900029-6-A single siRNA, 0.9 nmol 626 5604 MAP2K1 mitogen-activated protein kinase 900029-6-A single siRNA, 0.9 nmol 627 5728 PTEN phosphatase and tensin homolog 900029-6-A single siRNA, 0.9 nmol 628 5777 PTPN6 protein tyrosine phosphatase, no 900029-6-A single siRNA, 0.9 nmol 629 5829 PXN paxillin 900029-6-A single siRNA, 0.9 nmol 630 5898 RALA v-ral simian leukemia viral oncog 900029-6-A single siRNA, 0.9 nmol 631 5359 PLSCR1 phospholipid scramblase 1 900029-6-A single siRNA, 0.9 nmol 632 5500 PPP1CB protein phosphatase 1, catalytic s 900029-6-A single siRNA, 0.9 nmol 633 5573 PRKAR1A protein kinase, cAMP-dependent, 900029-6-A single siRNA, 0.9 nmol 634 5584 PRKCI protein kinase C, iota 900029-6-A single siRNA, 0.9 nmol 635 5594 MAPK1 mitogen-activated protein kinase 900029-6-A single siRNA, 0.9 nmol 636 5605 MAP2K2 mitogen-activated protein kinase 900029-6-A single siRNA, 0.9 nmol 637 5734 PTGER4 prostaglandin E receptor 4 (subty 900029-6-A single siRNA, 0.9 nmol 638 5781 PTPN11 protein tyrosine phosphatase, no 900029-6-A single siRNA, 0.9 nmol 639 5868 RAB5A RAB5A, member RAS oncogene 900029-6-A single siRNA, 0.9 nmol 640 5899 RALB v-ral simian leukemia viral oncog 900029-6-A single siRNA, 0.9 nmol 641 5453 POU3F1 POU domain, class 3, transcripti 900029-6-A single siRNA, 0.9 nmol 642 5514 PPP1R10 protein phosphatase 1, regulatory 900029-6-A single siRNA, 0.9 nmol 643 5578 PRKCA protein kinase C, alpha 900029-6-A single siRNA, 0.9 nmol 644 5586 PKN2 protein kinase N2 900029-6-A single siRNA, 0.9 nmol 645 5595 MAPK3 mitogen-activated protein kinase 900029-6-A single siRNA, 0.9 nmol 646 5606 MAP2K3 mitogen-activated protein kinase 900029-6-A single siRNA, 0.9 nmol 647 5747 PTK2 PTK2 protein tyrosine kinase 2 900029-6-A single siRNA, 0.9 nmol 648 5782 PTPN12 protein tyrosine phosphatase, no 900029-6-A single siRNA, 0.9 nmol 649 5879 RAC1 ras-related C3 botulinum toxin su 900029-6-A single siRNA, 0.9 nmol 650 5906 RAP1A RAP1A, member of RAS oncoge 900029-6-A single siRNA, 0.9 nmol 651 5454 POU3F2 POU domain, class 3, transcripti 900029-6-A single siRNA, 0.9 nmol 652 5525 PPP2R5A protein phosphatase 2, regulatory 900029-6-A single siRNA, 0.9 nmol 653 5579 PRKCB1 protein kinase C, beta 1 900029-6-A single siRNA, 0.9 nmol 654 5587 PRKD1 protein kinase D1 900029-6-A single siRNA, 0.9 nmol 655 5599 MAPK8 mitogen-activated protein kinase 900029-6-A single siRNA, 0.9 nmol 656 5609 MAP2K7 mitogen-activated protein kinase 900029-6-A single siRNA, 0.9 nmol 657 5753 PTK6 PTK6 protein tyrosine kinase 6 900029-6-A single siRNA, 0.9 nmol 658 5792 PTPRF protein tyrosine phosphatase, re 900029-6-A single siRNA, 0.9 nmol 659 5880 RAC2 ras-related C3 botulinum toxin su 900029-6-A single siRNA, 0.9 nmol 660 5908 RAP1B RAP1B, member of RAS oncoge 900029-6-B single siRNA, 0.9 nmol 661 5337 PLD1 phospholipase D1, phosphatidylc 900029-6-B single siRNA, 0.9 nmol 662 5455 POU3F3 POU domain, class 3, transcripti 900029-6-B single siRNA, 0.9 nmol 663 5566 PRKACA protein kinase, cAMP-dependent, 900029-6-B single siRNA, 0.9 nmol 664 5580 PRKCD protein kinase C, delta 900029-6-B single siRNA, 0.9 nmol 665 5588 PRKCQ protein kinase C, theta 900029-6-B single siRNA, 0.9 nmol 666 5601 MAPK9 mitogen-activated protein kinase 900029-6-B single siRNA, 0.9 nmol 667 5613 PRKX protein kinase, X-linked 900029-6-B single siRNA, 0.9 nmol 668 5770 PTPN1 protein tyrosine phosphatase, no 900029-6-B single siRNA, 0.9 nmol 669 5794 PTPRH protein tyrosine phosphatase, rec 900029-6-B single siRNA, 0.9 nmol 670 5881 RAC3 ras-related C3 botulinum toxin su 900029-6-B single siRNA, 0.9 nmol 671 5338 PLD2 phospholipase D2 900029-6-B single siRNA, 0.9 nmol 672 5456 POU3F4 POU domain, class 3, transcripti 900029-6-B single siRNA, 0.9 nmol 673 5567 PRKACB protein kinase, cAMP-dependent, 900029-6-B single siRNA, 0.9 nmol 674 5581 PRKCE protein kinase C, epsilon 900029-6-B single siRNA, 0.9 nmol 675 5590 PRKCZ protein kinase C, zeta 900029-6-B single siRNA, 0.9 nmol 676 5602 MAPK10 mitogen-activated protein kinase 900029-6-B single siRNA, 0.9 nmol 677 5625 PRODH proline dehydrogenase (oxidase) 900029-6-B single siRNA, 0.9 nmol 678 5771 PTPN2 protein tyrosine phosphatase, no 900029-6-B single siRNA, 0.9 nmol 679 5795 PTPRJ protein tyrosine phosphatase, rec 900029-6-B single siRNA, 0.9 nmol 680 5894 RAF1 v-raf-1 murine leukemia viral onc 900029-6-B single siRNA, 0.9 nmol 681 5339 PLEC1 plectin 1, intermediate filament bi 900029-6-B single siRNA, 0.9 nmol 682 5478 PPIA peptidylprolyl isomerase A (cyclo 900029-6-B single siRNA, 0.9 nmol 683 5568 PRKACG protein kinase, cAMP-dependent, 900029-6-B single siRNA, 0.9 nmol 684 5582 PRKCG protein kinase C, gamma 900029-6-B single siRNA, 0.9 nmol 685 5591 PRKDC protein kinase, DNA-activated, ca 900029-6-B single siRNA, 0.9 nmol 686 5604 MAP2K1 mitogen-activated protein kinase 900029-6-B single siRNA, 0.9 nmol 687 5728 PTEN phosphatase and tensin homolog 900029-6-B single siRNA, 0.9 nmol 688 5777 PTPN6 protein tyrosine phosphatase, no 900029-6-B single siRNA, 0.9 nmol 689 5829 PXN paxillin 900029-6-B single siRNA, 0.9 nmol 690 5898 RALA v-ral simian leukemia viral oncog 900029-6-B single siRNA, 0.9 nmol 691 5359 PLSCR1 phospholipid scramblase 1 900029-6-B single siRNA, 0.9 nmol 692 5500 PPP1CB protein phosphatase 1, catalytic s 900029-6-B single siRNA, 0.9 nmol 693 5573 PRKAR1A protein kinase, cAMP-dependent, 900029-6-B single siRNA, 0.9 nmol 694 5584 PRKCI protein kinase C, iota 900029-6-B single siRNA, 0.9 nmol 695 5594 MAPK1 mitogen-activated protein kinase 900029-6-B single siRNA, 0.9 nmol 696 5605 MAP2K2 mitogen-activated protein kinase 900029-6-B single siRNA, 0.9 nmol 697 5734 PTGER4 prostaglandin E receptor 4 (subty 900029-6-B single siRNA, 0.9 nmol 698 5781 PTPN11 protein tyrosine phosphatase, no 900029-6-B single siRNA, 0.9 nmol 699 5868 RAB5A RAB5A, member RAS oncogene 900029-6-B single siRNA, 0.9 nmol 700 5899 RALB v-ral simian leukemia viral oncog 900029-6-B single siRNA, 0.9 nmol 701 5453 POU3F1 POU domain, class 3, transcripti 900029-6-B single siRNA, 0.9 nmol 702 5514 PPP1R10 protein phosphatase 1, regulatory 900029-6-B single siRNA, 0.9 nmol 703 5578 PRKCA protein kinase C, alpha 900029-6-B single siRNA, 0.9 nmol 704 5586 PKN2 protein kinase N2 900029-6-B single siRNA, 0.9 nmol 705 5595 MAPK3 mitogen-activated protein kinase 900029-6-B single siRNA, 0.9 nmol 706 5606 MAP2K3 mitogen-activated protein kinase 900029-6-B single siRNA, 0.9 nmol 707 5747 PTK2 PTK2 protein tyrosine kinase 2 900029-6-B single siRNA, 0.9 nmol 708 5782 PTPN12 protein tyrosine phosphatase, no 900029-6-B single siRNA, 0.9 nmol 709 5879 RAC1 ras-related C3 botulinum toxin su 900029-6-B single siRNA, 0.9 nmol 710 5906 RAP1A RAP1A, member of RAS oncoge 900029-6-B single siRNA, 0.9 nmol 711 5454 POU3F2 POU domain, class 3, transcripti 900029-6-B single siRNA, 0.9 nmol 712 5525 PPP2R5A protein phosphatase 2, regulatory 900029-6-B single siRNA, 0.9 nmol 713 5579 PRKCB1 protein kinase C, beta 1 900029-6-B single siRNA, 0.9 nmol 714 5587 PRKD1 protein kinase D1 900029-6-B single siRNA, 0.9 nmol 715 5599 MAPK8 mitogen-activated protein kinase 900029-6-B single siRNA, 0.9 nmol 716 5609 MAP2K7 mitogen-activated protein kinase 900029-6-B single siRNA, 0.9 nmol 717 5753 PTK6 PTK6 protein tyrosine kinase 6 900029-6-B single siRNA, 0.9 nmol 718 5792 PTPRF protein tyrosine phosphatase, rec 900029-6-B single siRNA, 0.9 nmol 719 5880 RAC2 ras-related C3 botulinum toxin su 900029-6-B single siRNA, 0.9 nmol 720 5908 RAP1B RAP1B, member of RAS oncoge 900029-7-A single siRNA, 0.9 nmol 721 5911 RAP2A RAP2A, member of RAS oncoge 900029-7-A single siRNA, 0.9 nmol 722 5925 RB1 retinoblastoma 1 (including osteo 900029-7-A single siRNA, 0.9 nmol 723 6010 RHO rhodopsin (opsin 2, rod pigment) 900029-7-A single siRNA, 0.9 nmol 724 6197 RPS6KA3 ribosomal protein S6 kinase, 90k 900029-7-A single siRNA, 0.9 nmol 725 6416 MAP2K4 mitogen-activated protein kinase 900029-7-A single siRNA, 0.9 nmol 726 6622 SNCA synuclein, alpha (non A4 compon 900029-7-A single siRNA, 0.9 nmol 727 6655 SOS2 son of sevenless homolog 2 (Dro 900029-7-A single siRNA, 0.9 nmol 728 6722 SRF serum response factor (c-fos ser 900029-7-A single siRNA, 0.9 nmol 729 6776 STAT5A signal transducer and activator of 900029-7-A single siRNA, 0.9 nmol 730 6907 TBL1X transducin (beta)-like 1X-linked 900029-7-A single siRNA, 0.9 nmol 731 5914 RARA retinoic acid receptor, alpha 900029-7-A single siRNA, 0.9 nmol 732 5928 RBBP4 retinoblastoma binding protein 4 900029-7-A single siRNA, 0.9 nmol 733 6018 RLF rearranged L-myc fusion 900029-7-A single siRNA, 0.9 nmol 734 6237 RRAS related RAS viral (r-ras) oncogen 900029-7-A single siRNA, 0.9 nmol 735 6457 SH3GL3 SH3-domain GRB2-like 3 900029-7-A single siRNA, 0.9 nmol 736 6624 FSCN1 fascin homolog 1, actin-bundling  900029-7-A single siRNA, 0.9 nmol 737 6667 SP1 Sp1 transcription factor 900029-7-A single siRNA, 0.9 nmol 738 6747 SSR3 signal sequence receptor, gamm 900029-7-A single siRNA, 0.9 nmol 739 6777 STAT5B signal transducer and activator of 900029-7-A single siRNA, 0.9 nmol 740 6925 TCF4 transcription factor 4 900029-7-A single siRNA, 0.9 nmol 741 5915 RARB retinoic acid receptor, beta 900029-7-A single siRNA, 0.9 nmol 742 5931 RBBP7 retinoblastoma binding protein 7 900029-7-A single siRNA, 0.9 nmol 743 6098 ROS1 v-ros UR2 sarcoma virus oncoge 900029-7-A single siRNA, 0.9 nmol 744 6239 RREB1 ras responsive element binding p 900029-7-A single siRNA, 0.9 nmol 745 6464 SHC1 SHC (Src homology 2 domain co 900029-7-A single siRNA, 0.9 nmol 746 6633 SNRPD2 small nuclear ribonucleoprotein D 900029-7-A single siRNA, 0.9 nmol 747 6687 SPG7 spastic paraplegia 7 (pure and co 900029-7-A single siRNA, 0.9 nmol 748 6772 STAT1 signal transducer and activator of 900029-7-A single siRNA, 0.9 nmol 749 6778 STAT6 signal transducer and activator of 900029-7-A single siRNA, 0.9 nmol 750 6929 TCF3 transcription factor 3 (E2A immun 900029-7-A single siRNA, 0.9 nmol 751 5916 RARG retinoic acid receptor, gamma 900029-7-A single siRNA, 0.9 nmol 752 5979 RET ret proto-oncogene 900029-7-A single siRNA, 0.9 nmol 753 6134 RPL10 ribosomal protein L10 900029-7-A single siRNA, 0.9 nmol 754 6261 RYR1 ryanodine receptor 1 (skeletal) 900029-7-A single siRNA, 0.9 nmol 755 6498 SKIL SKI-like oncogene 900029-7-A single siRNA, 0.9 nmol 756 6642 SNX1 sorting nexin 1 900029-7-A single siRNA, 0.9 nmol 757 6709 SPTAN1 spectrin, alpha, non-erythrocytic 1 900029-7-A single siRNA, 0.9 nmol 758 6773 STAT2 signal transducer and activator of 900029-7-A single siRNA, 0.9 nmol 759 6788 STK3 serine/threonine kinase 3 (STE2C 900029-7-A single siRNA, 0.9 nmol 760 6938 TCF12 transcription factor 12 (HTF4, heli 900029-7-A single siRNA, 0.9 nmol 761 5921 RASA1 RAS p21 protein activator (GTPa 900029-7-A single siRNA, 0.9 nmol 762 5999 RGS4 regulator of G-protein signalling 4 900029-7-A single siRNA, 0.9 nmol 763 6195 RPS6KA1 ribosomal protein S6 kinase, 90 k 900029-7-A single siRNA, 0.9 nmol 764 6307 SC4MOL sterol-C4-methyl oxidase-like 900029-7-A single siRNA, 0.9 nmol 765 6590 SLPI secretory leukocyte peptidase inh 900029-7-A single siRNA, 0.9 nmol 766 6643 SNX2 sorting nexin 2 900029-7-A single siRNA, 0.9 nmol 767 6713 SQLE squalene epoxidase 900029-7-A single siRNA, 0.9 nmol 768 6774 STAT3 signal transducer and activator of 900029-7-A single siRNA, 0.9 nmol 769 6789 STK4 serine/threonine kinase 4 900029-7-A single siRNA, 0.9 nmol 770 7029 TFDP2 transcription factor Dp-2 (E2F di 900029-7-A single siRNA, 0.9 nmol 771 5922 RASA2 RAS p21 protein activator 2 900029-7-A single siRNA, 0.9 nmol 772 6004 RGS16 regulator of G-protein signalling 1 900029-7-A single siRNA, 0.9 nmol 773 6196 RPS6KA2 ribosomal protein S6 kinase, 90 k 900029-7-A single siRNA, 0.9 nmol 774 6387 CXCL12 chemokine (C—X—C motif) ligand 1 900029-7-A single siRNA, 0.9 nmol 775 6598 SMARCB1 SWI/SNF related, matrix associat 900029-7-A single siRNA, 0.9 nmol 776 6654 SOS1 son of sevenless homolog 1 (Dro 900029-7-A single siRNA, 0.9 nmol 777 6714 SRC v-src sarcoma (Schmidt-Ruppin A 900029-7-A single siRNA, 0.9 nmol 778 6775 STAT4 signal transducer and activator of 900029-7-A single siRNA, 0.9 nmol 779 6790 AURKA aurora kinase A 900029-7-A single siRNA, 0.9 nmol 780 7039 TGFA transforming growth factor, alpha 900029-7-B single siRNA, 0.9 nmol 781 5911 RAP2A RAP2A, member of RAS oncoge 900029-7-B single siRNA, 0.9 nmol 782 5925 RB1 retinoblastoma 1 (including osteo 900029-7-B single siRNA, 0.9 nmol 783 6010 RHO rhodopsin (opsin 2, rod pigment) 900029-7-B single siRNA, 0.9 nmol 784 6197 RPS6KA3 ribosomal protein S6 kinase, 90 k 900029-7-B single siRNA, 0.9 nmol 785 6416 MAP2K4 mitogen-activated protein kinase 900029-7-B single siRNA, 0.9 nmol 786 6622 SNCA synuclein, alpha (non A4 compon 900029-7-B single siRNA, 0.9 nmol 787 6655 SOS2 son of sevenless homolog 2 (Dro 900029-7-B single siRNA, 0.9 nmol 788 6722 SRF serum response factor (c-fos sen 900029-7-B single siRNA, 0.9 nmol 789 6776 STAT5A signal transducer and activator of 900029-7-B single siRNA, 0.9 nmol 790 6907 TBL1X transducin (beta)-like 1X-linked 900029-7-B single siRNA, 0.9 nmol 791 5914 RARA retinoic acid receptor, alpha 900029-7-B single siRNA, 0.9 nmol 792 5928 RBBP4 retinoblastoma binding protein 4 900029-7-B single siRNA, 0.9 nmol 793 6018 RLF rearranged L-myc fusion 900029-7-B single siRNA, 0.9 nmol 794 6237 RRAS related RAS viral (r-ras) oncogen 900029-7-B single siRNA, 0.9 nmol 795 6457 SH3GL3 SH3-domain GRB2-like 3 900029-7-B single siRNA, 0.9 nmol 796 6624 FSCN1 fascin homolog 1, actin-bundling  900029-7-B single siRNA, 0.9 nmol 797 6667 SP1 Sp1 transcription factor 900029-7-B single siRNA, 0.9 nmol 798 6747 SSR3 signal sequence receptor, gamm 900029-7-B single siRNA, 0.9 nmol 799 6777 STAT5B signal transducer and activator of 900029-7-B single siRNA, 0.9 nmol 800 6925 TCF4 transcription factor 4 900029-7-B single siRNA, 0.9 nmol 801 5915 RARB retinoic acid receptor, beta 900029-7-B single siRNA, 0.9 nmol 802 5931 RBBP7 retinoblastoma binding protein 7 900029-7-B single siRNA, 0.9 nmol 803 6098 ROS1 v-ros UR2 sarcoma virus oncoge 900029-7-B single siRNA, 0.9 nmol 804 6239 RREB1 ras responsive element binding p 900029-7-B single siRNA, 0.9 nmol 805 6464 SHC1 SHC (Src homology 2 domain co 900029-7-B single siRNA, 0.9 nmol 806 6633 SNRPD2 small nuclear ribonucleoprotein D 900029-7-B single siRNA, 0.9 nmol 807 6687 SPG7 spastic paraplegia 7 (pure and co 900029-7-B single siRNA, 0.9 nmol 808 6772 STAT1 signal transducer and activator of 900029-7-B single siRNA, 0.9 nmol 809 6778 STAT6 signal transducer and activator of 900029-7-B single siRNA, 0.9 nmol 810 6929 TCF3 transcription factor 3 (E2A immun 900029-7-B single siRNA, 0.9 nmol 811 5916 RARG retinoic acid receptor, gamma 900029-7-B single siRNA, 0.9 nmol 812 5979 RET ret proto-oncogene 900029-7-B single siRNA, 0.9 nmol 813 6134 RPL10 ribosomal protein L10 900029-7-B single siRNA, 0.9 nmol 814 6261 RYR1 ryanodine receptor 1 (skeletal) 900029-7-B single siRNA, 0.9 nmol 815 6498 SKIL SKI-like oncogene 900029-7-B single siRNA, 0.9 nmol 816 6642 SNX1 sorting nexin 1 900029-7-B single siRNA, 0.9 nmol 817 6709 SPTAN1 spectrin, alpha, non-erythrocytic 1 900029-7-B single siRNA, 0.9 nmol 818 6773 STAT2 signal transducer and activator of 900029-7-B single siRNA, 0.9 nmol 819 6788 STK3 serine/threonine kinase 3 (STE2C 900029-7-B single siRNA, 0.9 nmol 820 6938 TCF12 transcription factor 12 (HTF4, heli 900029-7-B single siRNA, 0.9 nmol 821 5921 RASA1 RAS p21 protein activator (GTPa 900029-7-B single siRNA, 0.9 nmol 822 5999 RGS4 regulator of G-protein signalling 4 900029-7-B single siRNA, 0.9 nmol 823 6195 RPS6KA1 ribosomal protein S6 kinase, 90 k 900029-7-B single siRNA, 0.9 nmol 824 6307 SC4MOL sterol-C4-methyl oxidase-like 900029-7-B single siRNA, 0.9 nmol 825 6590 SLPI secretory leukocyte peptidase inh 900029-7-B single siRNA, 0.9 nmol 826 6643 SNX2 sorting nexin 2 900029-7-B single siRNA, 0.9 nmol 827 6713 SQLE squalene epoxidase 900029-7-B single siRNA, 0.9 nmol 828 6774 STAT3 signal transducer and activator of 900029-7-B single siRNA, 0.9 nmol 829 6789 STK4 serine/threonine kinase 4 900029-7-B single siRNA, 0.9 nmol 830 7029 TFDP2 transcription factor Dp-2 (E2F di 900029-7-B single siRNA, 0.9 nmol 831 5922 RASA2 RAS p21 protein activator 2 900029-7-B single siRNA, 0.9 nmol 832 6004 RGS16 regulator of G-protein signalling 1 900029-7-B single siRNA, 0.9 nmol 833 6196 RPS6KA2 ribosomal protein S6 kinase, 90 k 900029-7-B single siRNA, 0.9 nmol 834 6387 CXCL12 chemokine (C—X—C motif) ligand 1 900029-7-B single siRNA, 0.9 nmol 835 6598 SMARCB1 SWI/SNF related, matrix associat 900029-7-B single siRNA, 0.9 nmol 836 6654 SOS1 son of sevenless homolog 1 (Dro 900029-7-B single siRNA, 0.9 nmol 837 6714 SRC v-src sarcoma (Schmidt-Ruppin A 900029-7-B single siRNA, 0.9 nmol 838 6775 STAT4 signal transducer and activator of 900029-7-B single siRNA, 0.9 nmol 839 6790 AURKA aurora kinase A 900029-7-B single siRNA, 0.9 nmol 840 7039 TGFA transforming growth factor, alpha 900029-8-A single siRNA, 0.9 nmol 841 7046 TGFBR1 transforming growth factor, beta  900029-8-A single siRNA, 0.9 nmol 842 7112 TMPO thymopoietin 900029-8-A single siRNA, 0.9 nmol 843 7278 TUBA3C tubulin, alpha 3c 900029-8-A single siRNA, 0.9 nmol 844 7520 XRCC5 X-ray repair complementing defe 900029-8-A single siRNA, 0.9 nmol 845 7620 ZNF69 zinc finger protein 69 900029-8-A single siRNA, 0.9 nmol 846 8396 PIP5K2B phosphatidylinositol-4-phosphate 900029-8-A single siRNA, 0.9 nmol 847 8560 DEGS1 degenerative spermatocyte homo 900029-8-A single siRNA, 0.9 nmol 848 8737 RIPK1 receptor (TNFRSF)-interacting se 900029-8-A single siRNA, 0.9 nmol 849 8915 BCL10 B-cell CLL/lymphoma 10 900029-8-A single siRNA, 0.9 nmol 850 9093 DNAJA3 DnaJ (Hsp40) homolog, subfamil 900029-8-A single siRNA, 0.9 nmol 851 7071 KLF10 Kruppel-like factor 10 900029-8-A single siRNA, 0.9 nmol 852 7157 TP53 tumor protein p53 (Li-Fraumeni s 900029-8-A single siRNA, 0.9 nmol 853 7332 UBE2L3 ubiquitin-conjugating enzyme E2 900029-8-A single siRNA, 0.9 nmol 854 7525 YES1 v-yes-1 Yamaguchi sarcoma viral 900029-8-A single siRNA, 0.9 nmol 855 7791 ZYX zyxin 900029-8-A single siRNA, 0.9 nmol 856 8412 BCAR3 breast cancer anti-estrogen resist 900029-8-A single siRNA, 0.9 nmol 857 8651 SOCS1 suppressor of cytokine signaling 900029-8-A single siRNA, 0.9 nmol 858 8761 PABPC4 poly(A) binding protein, cytoplasm 900029-8-A single siRNA, 0.9 nmol 859 8945 BTRC beta-transducin repeat containing 900029-8-A single siRNA, 0.9 nmol 860 9134 CCNE2 cyclin E2 900029-8-A single siRNA, 0.9 nmol 861 7082 TJP1 tight junction protein 1 (zona occ 900029-8-A single siRNA, 0.9 nmol 862 7171 TPM4 tropomyosin 4 900029-8-A single siRNA, 0.9 nmol 863 7386 UQCRFS1 ubiquinol-cytochrome c reductase 900029-8-A single siRNA, 0.9 nmol 864 7529 YWHAB tyrosine 3-monooxygenase/trypto 900029-8-A single siRNA, 0.9 nmol 865 7846 TUBA1A tubulin, alpha 1a 900029-8-A single siRNA, 0.9 nmol 866 8440 NCK2 NCK adaptor protein 2 900029-8-A single siRNA, 0.9 nmol 867 8655 DYNLL1 dynein, light chain, LC8-type 1 900029-8-A single siRNA, 0.9 nmol 868 8805 TRIM24 tripartite motif-containing 24 900029-8-A single siRNA, 0.9 nmol 869 8976 WASL Wiskott-Aldrich syndrome-like 900029-8-A single siRNA, 0.9 nmol 870 9231 DLG5 discs, large homolog 5 (Drosophil 900029-8-A single siRNA, 0.9 nmol 871 7090 TLE3 transducin-like enhancer of split 3 900029-8-A single siRNA, 0.9 nmol 872 7175 TPR translocated promoter region (to  900029-8-A single siRNA, 0.9 nmol 873 7409 VAV1 vav 1 oncogene 900029-8-A single siRNA, 0.9 nmol 874 7531 YWHAE tyrosine 3-monooxygenase/trypto 900029-8-A single siRNA, 0.9 nmol 875 8379 MAD1L1 MAD1 mitotic arrest deficient-like 900029-8-A single siRNA, 0.9 nmol 876 8492 PRSS12 protease, serine, 12 (neurotrypsi 900029-8-A single siRNA, 0.9 nmol 877 8660 IRS2 insulin receptor substrate 2 900029-8-A single siRNA, 0.9 nmol 878 8825 LIN7A lin-7 homolog A (C. elegans) 900029-8-A single siRNA, 0.9 nmol 879 9020 MAP3K14 mitogen-activated protein kinase 900029-8-A single siRNA, 0.9 nmol 880 9252 RPS6KA5 ribosomal protein S6 kinase, 90 k 900029-8-A single siRNA, 0.9 nmol 881 7094 TLN1 talin 1 900029-8-A single siRNA, 0.9 nmol 882 7184 HSP90B1 heat shock protein 90 kDa beta ( 900029-8-A single siRNA, 0.9 nmol 883 7410 VAV2 vav 2 oncogene 900029-8-A single siRNA, 0.9 nmol 884 7534 YWHAZ tyrosine 3-monooxygenase/trypto 900029-8-A single siRNA, 0.9 nmol 885 8394 PIP5K1A phosphatidylinositol-4-phosphate 900029-8-A single siRNA, 0.9 nmol 886 8503 PIK3R3 phosphoinositide-3-kinase, regul 900029-8-A single siRNA, 0.9 nmol 887 8662 EIF3S9 eukaryotic translation initiation fa 900029-8-A single siRNA, 0.9 nmol 888 8826 IQGAP1 IQ motif containing GTPase activ 900029-8-A single siRNA, 0.9 nmol 889 9021 SOCS3 suppressor of cytokine signaling  900029-8-A single siRNA, 0.9 nmol 890 9260 PDLIM7 PDZ and LIM domain 7 (enigma) 900029-8-A single siRNA, 0.9 nmol 891 7109 TMEM1 transmembrane protein 1 900029-8-A single siRNA, 0.9 nmol 892 7205 TRIP6 thyroid hormone receptor interact 900029-8-A single siRNA, 0.9 nmol 893 7424 VEGFC vascular endothelial growth factor 900029-8-A single siRNA, 0.9 nmol 894 7535 ZAP70 zeta-chain (TCR) associated prot 900029-8-A single siRNA, 0.9 nmol 895 8395 PIP5K1B phosphatidylinositol-4-phosphate 900029-8-A single siRNA, 0.9 nmol 896 8517 IKBKG inhibitor of kappa light polypeptide 900029-8-A single siRNA, 0.9 nmol 897 8723 SNX4 sorting nexin 4 900029-8-A single siRNA, 0.9 nmol 898 8882 ZNF259 zinc finger protein 259 900029-8-A single siRNA, 0.9 nmol 899 9046 DOK2 docking protein 2, 56 kDa 900029-8-A single siRNA, 0.9 nmol 900 9261 MAPKAPK2 mitogen-activated protein kinase- 900029-8-B single siRNA, 0.9 nmol 901 7046 TGFBR1 transforming growth factor, beta  900029-8-B single siRNA, 0.9 nmol 902 7112 TMPO thymopoietin 900029-8-B single siRNA, 0.9 nmol 903 7278 TUBA3C tubulin, alpha 3c 900029-8-B single siRNA, 0.9 nmol 904 7520 XRCC5 X-ray repair complementing defec 900029-8-B single siRNA, 0.9 nmol 905 7620 ZNF69 zinc finger protein 69 900029-8-B single siRNA, 0.9 nmol 906 8396 PIP5K2B phosphatidylinositol-4-phosphate 900029-8-B single siRNA, 0.9 nmol 907 8560 DEGS1 degenerative spermatocyte homo 900029-8-B single siRNA, 0.9 nmol 908 8737 RIPK1 receptor (TNFRSF)-interacting se 900029-8-B single siRNA, 0.9 nmol 909 8915 BCL10 B-cell CLL/lymphoma 10 900029-8-B single siRNA, 0.9 nmol 910 9093 DNAJA3 DnaJ (Hsp40) homolog, subfamily 900029-8-B single siRNA, 0.9 nmol 911 7071 KLF10 Kruppel-like factor 10 900029-8-B single siRNA, 0.9 nmol 912 7157 TP53 tumor protein p53 (Li-Fraumeni s 900029-8-B single siRNA, 0.9 nmol 913 7332 UBE2L3 ubiquitin-conjugating enzyme E2 900029-8-B single siRNA, 0.9 nmol 914 7525 YES1 v-yes-1 Yamaguchi sarcoma viral 900029-8-B single siRNA, 0.9 nmol 915 7791 ZYX zyxin 900029-8-B single siRNA, 0.9 nmol 916 8412 BCAR3 breast cancer anti-estrogen resist 900029-8-B single siRNA, 0.9 nmol 917 8651 SOCS1 suppressor of cytokine signaling 900029-8-B single siRNA, 0.9 nmol 918 8761 PABPC4 poly(A) binding protein, cytoplasm 900029-8-B single siRNA, 0.9 nmol 919 8945 BTRC beta-transducin repeat containing 900029-8-B single siRNA, 0.9 nmol 920 9134 CCNE2 cyclin E2 900029-8-B single siRNA, 0.9 nmol 921 7082 TJP1 tight junction protein 1 (zona occl 900029-8-B single siRNA, 0.9 nmol 922 7171 TPM4 tropomyosin 4 900029-8-B single siRNA, 0.9 nmol 923 7386 UQCRFS1 ubiquinol-cytochrome c reductase 900029-8-B single siRNA, 0.9 nmol 924 7529 YWHAB tyrosine 3-monooxygenase/trypto 900029-8-B single siRNA, 0.9 nmol 925 7846 TUBA1A tubulin, alpha 1a 900029-8-B single siRNA, 0.9 nmol 926 8440 NCK2 NCK adaptor protein 2 900029-8-B single siRNA, 0.9 nmol 927 8655 DYNLL1 dynein, light chain, LC8-type 1 900029-8-B single siRNA, 0.9 nmol 928 8805 TRIM24 tripartite motif-containing 24 900029-8-B single siRNA, 0.9 nmol 929 8976 WASL Wiskott-Aldrich syndrome-like 900029-8-B single siRNA, 0.9 nmol 930 9231 DLG5 discs, large homolog 5 (Drosophil 900029-8-B single siRNA, 0.9 nmol 931 7090 TLE3 transducin-like enhancer of split 3 900029-8-B single siRNA, 0.9 nmol 932 7175 TPR translocated promoter region (to  900029-8-B single siRNA, 0.9 nmol 933 7409 VAV1 vav 1 oncogene 900029-8-B single siRNA, 0.9 nmol 934 7531 YWHAE tyrosine 3-monooxygenase/trypto 900029-8-B single siRNA, 0.9 nmol 935 8379 MAD1L1 MAD1 mitotic arrest deficient-like 900029-8-B single siRNA, 0.9 nmol 936 8492 PRSS12 protease, serine, 12 (neurotrypsin 900029-8-B single siRNA, 0.9 nmol 937 8660 IRS2 insulin receptor substrate 2 900029-8-B single siRNA, 0.9 nmol 938 8825 LIN7A lin-7 homolog A (C. elegans) 900029-8-B single siRNA, 0.9 nmol 939 9020 MAP3K14 mitogen-activated protein kinase 900029-8-B single siRNA, 0.9 nmol 940 9252 RPS6KA5 ribosomal protein S6 kinase, 90 k 900029-8-B single siRNA, 0.9 nmol 941 7094 TLN1 talin 1 900029-8-B single siRNA, 0.9 nmol 942 7184 HSP90B1 heat shock protein 90 kDa beta ( 900029-8-B single siRNA, 0.9 nmol 943 7410 VAV2 vav 2 oncogene 900029-8-B single siRNA, 0.9 nmol 944 7534 YWHAZ tyrosine 3-monooxygenase/trypto 900029-8-B single siRNA, 0.9 nmol 945 8394 PIP5K1A phosphatidylinositol-4-phosphate 900029-8-B single siRNA, 0.9 nmol 946 8503 PIK3R3 phosphoinositide-3-kinase, regula 900029-8-B single siRNA, 0.9 nmol 947 8662 EIF3S9 eukaryotic translation initiation fa 900029-8-B single siRNA, 0.9 nmol 948 8826 IQGAP1 IQ motif containing GTPase activ 900029-8-B single siRNA, 0.9 nmol 949 9021 SOCS3 suppressor of cytokine signaling  900029-8-B single siRNA, 0.9 nmol 950 9260 PDLIM7 PDZ and LIM domain 7 (enigma) 900029-8-B single siRNA, 0.9 nmol 951 7109 TMEM1 transmembrane protein 1 900029-8-B single siRNA, 0.9 nmol 952 7205 TRIP6 thyroid hormone receptor interact 900029-8-B single siRNA, 0.9 nmol 953 7424 VEGFC vascular endothelial growth factor 900029-8-B single siRNA, 0.9 nmol 954 7535 ZAP70 zeta-chain (TCR) associated prot 900029-8-B single siRNA, 0.9 nmol 955 8395 PIP5K1B phosphatidylinositol-4-phosphate 900029-8-B single siRNA, 0.9 nmol 956 8517 IKBKG inhibitor of kappa light polypeptid 900029-8-B single siRNA, 0.9 nmol 957 8723 SNX4 sorting nexin 4 900029-8-B single siRNA, 0.9 nmol 958 8882 ZNF259 zinc finger protein 259 900029-8-B single siRNA, 0.9 nmol 959 9046 DOK2 docking protein 2, 56 kDa 900029-8-B single siRNA, 0.9 nmol 960 9261 MAPKAPK2 mitogen-activated protein kinase- 900029-9-A single siRNA, 0.9 nmol 961 9320 TRIP12 thyroid hormone receptor interact 900029-9-A single siRNA, 0.9 nmol 962 9564 BCAR1 breast cancer anti-estrogen resist 900029-9-A single siRNA, 0.9 nmol 963 9815 GIT2 G protein-coupled receptor kinas 900029-9-A single siRNA, 0.9 nmol 964 10044 SH2D3C SH2 domain containing 3C 900029-9-A single siRNA, 0.9 nmol 965 10188 TNK2 tyrosine kinase, non-receptor, 2 900029-9-A single siRNA, 0.9 nmol 966 10278 EFS embryonal Fyn-associated substr 900029-9-A single siRNA, 0.9 nmol 967 10627 MRCL3 myosin regulatory light chain MR 900029-9-A single siRNA, 0.9 nmol 968 10971 YWHAQ tyrosine 3-monooxygenase/trypto 900029-9-A single siRNA, 0.9 nmol 969 11083 DIDO1 death inducer-obliterator 1 900029-9-A single siRNA, 0.9 nmol 970 23198 PSME4 proteasome (prosome, macropai 900029-9-A single siRNA, 0.9 nmol 971 9349 RPL23 ribosomal protein L23 900029-9-A single siRNA, 0.9 nmol 972 9592 IER2 immediate early response 2 900029-9-A single siRNA, 0.9 nmol 973 9846 GAB2 GRB2-associated binding protein 900029-9-A single siRNA, 0.9 nmol 974 10045 SH2D3A SH2 domain containing 3A 900029-9-A single siRNA, 0.9 nmol 975 10241 CALCOCO2 calcium binding and coiled-coil d 900029-9-A single siRNA, 0.9 nmol 976 10376 TUBA1B tubulin, alpha 1b 900029-9-A single siRNA, 0.9 nmol 977 10628 TXNIP thioredoxin interacting protein 900029-9-A single siRNA, 0.9 nmol 978 10987 COPS5 COP9 constitutive photomorphog 900029-9-A single siRNA, 0.9 nmol 979 11184 MAP4K1 mitogen-activated protein kinase 900029-9-A single siRNA, 0.9 nmol 980 23236 PLCB1 phospholipase C, beta 1 (phosph 900029-9-A single siRNA, 0.9 nmol 981 9402 GRAP2 GRB2-related adaptor protein 2 900029-9-A single siRNA, 0.9 nmol 982 9618 TRAF4 TNF receptor-associated factor 4 900029-9-A single siRNA, 0.9 nmol 983 9948 WDR1 WD repeat domain 1 900029-9-A single siRNA, 0.9 nmol 984 10096 ACTR3 ARP3 actin-related protein 3 hom 900029-9-A single siRNA, 0.9 nmol 985 10251 SPRY3 sprouty homolog 3 (Drosophila) 900029-9-A single siRNA, 0.9 nmol 986 10398 MYL9 myosin, light chain 9, regulatory 900029-9-A single siRNA, 0.9 nmol 987 10677 AVIL advillin 900029-9-A single siRNA, 0.9 nmol 988 11052 CPSF6 cleavage and polyadenylation sp 900029-9-A single siRNA, 0.9 nmol 989 22800 RRAS2 related RAS viral (r-ras) oncogen 900029-9-A single siRNA, 0.9 nmol 990 23443 SLC35A3 solute carrier family 35 (UDP-N-a 900029-9-A single siRNA, 0.9 nmol 991 9463 PICK1 protein interacting with PRKCA 1 900029-9-A single siRNA, 0.9 nmol 992 9667 SAFB2 scaffold attachment factor B2 900029-9-A single siRNA, 0.9 nmol 993 10000 AKT3 v-akt murine thymoma viral onco 900029-9-A single siRNA, 0.9 nmol 994 10140 TOB1 transducer of ERBB2, 1 900029-9-A single siRNA, 0.9 nmol 995 10252 SPRY1 sprouty homolog 1, antagonist of 900029-9-A single siRNA, 0.9 nmol 996 10399 GNB2L1 guanine nucleotide binding protei 900029-9-A single siRNA, 0.9 nmol 997 10750 GRAP GRB2-related adaptor protein 900029-9-A single siRNA, 0.9 nmol 998 11057 ABHD2 abhydrolase domain containing 2 900029-9-A single siRNA, 0.9 nmol 999 22821 RASA3 RAS p21 protein activator 3 900029-9-A single siRNA, 0.9 nmol 1000 23476 BRD4 bromodomain containing 4 900029-9-A single siRNA, 0.9 nmol 1001 9468 PCYT1B phosphate cytidylyltransferase 1 900029-9-A single siRNA, 0.9 nmol 1002 9743 RICS Rho GTPase-activating protein 900029-9-A single siRNA, 0.9 nmol 1003 10006 ABI1 abi-interactor 1 900029-9-A single siRNA, 0.9 nmol 1004 10153 CEBPZ CCAAT/enhancer binding protein 900029-9-A single siRNA, 0.9 nmol 1005 10253 SPRY2 sprouty homolog 2 (Drosophila) 900029-9-A single siRNA, 0.9 nmol 1006 10419 PRMT5 protein arginine methyltransferas 900029-9-A single siRNA, 0.9 nmol 1007 10752 CHL1 cell adhesion molecule with hom 900029-9-A single siRNA, 0.9 nmol 1008 11059 WWP1 WW domain containing E3 ubiqui 900029-9-A single siRNA, 0.9 nmol 1009 23013 SPEN spen homolog, transcriptional reg 900029-9-A single siRNA, 0.9 nmol 1010 23607 CD2AP CD2-associated protein 900029-9-A single siRNA, 0.9 nmol 1011 9542 NRG2 neuregulin 2 900029-9-A single siRNA, 0.9 nmol 1012 9775 EIF4A3 eukaryotic translation initiation fa 900029-9-A single siRNA, 0.9 nmol 1013 10013 HDAC6 histone deacetylase 6 900029-9-A single siRNA, 0.9 nmol 1014 10174 SORBS3 sorbin and SH3 domain containin 900029-9-A single siRNA, 0.9 nmol 1015 10273 STUB1 STIP1 homology and U-box cont 900029-9-A single siRNA, 0.9 nmol 1016 10451 VAV3 vav 3 oncogene 900029-9-A single siRNA, 0.9 nmol 1017 10856 RUVBL2 RuvB-like 2 (E. coli) 900029-9-A single siRNA, 0.9 nmol 1018 11060 WWP2 WW domain containing E3 ubiqui 900029-9-A single siRNA, 0.9 nmol 1019 23136 EPB41L3 erythrocyte membrane protein ba 900029-9-A single siRNA, 0.9 nmol 1020 23624 CBLC Cas-Br-M (murine) ecotropic retr 900029-9-B single siRNA, 0.9 nmol 1021 9320 TRIP12 thyroid hormone receptor interact 900029-9-B single siRNA, 0.9 nmol 1022 9564 BCAR1 breast cancer anti-estrogen resist 900029-9-B single siRNA, 0.9 nmol 1023 9815 GIT2 G protein-coupled receptor kinas 900029-9-B single siRNA, 0.9 nmol 1024 10044 SH2D3C SH2 domain containing 3C 900029-9-B single siRNA, 0.9 nmol 1025 10188 TNK2 tyrosine kinase, non-receptor, 2 900029-9-B single siRNA, 0.9 nmol 1026 10278 EFS embryonal Fyn-associated subst 900029-9-B single siRNA, 0.9 nmol 1027 10627 MRCL3 myosin regulatory light chain MR 900029-9-B single siRNA, 0.9 nmol 1028 10971 YWHAQ tyrosine 3-monooxygenase/trypto 900029-9-B single siRNA, 0.9 nmol 1029 11083 DIDO1 death inducer-obliterator 1 900029-9-B single siRNA, 0.9 nmol 1030 23198 PSME4 proteasome (prosome, macropai 900029-9-B single siRNA, 0.9 nmol 1031 9349 RPL23 ribosomal protein L23 900029-9-B single siRNA, 0.9 nmol 1032 9592 IER2 immediate early response 2 900029-9-B single siRNA, 0.9 nmol 1033 9846 GAB2 GRB2-associated binding protein 900029-9-B single siRNA, 0.9 nmol 1034 10045 SH2D3A SH2 domain containing 3A 900029-9-B single siRNA, 0.9 nmol 1035 10241 CALCOCO2 calcium binding and coiled-coil d 900029-9-B single siRNA, 0.9 nmol 1036 10376 TUBA1B tubulin, alpha 1b 900029-9-B single siRNA, 0.9 nmol 1037 10628 TXNIP thioredoxin interacting protein 900029-9-B single siRNA, 0.9 nmol 1038 10987 COPS5 COP9 constitutive photomorphog 900029-9-B single siRNA, 0.9 nmol 1039 11184 MAP4K1 mitogen-activated protein kinase 900029-9-B single siRNA, 0.9 nmol 1040 23236 PLCB1 phospholipase C, beta 1 (phosph 900029-9-B single siRNA, 0.9 nmol 1041 9402 GRAP2 GRB2-related adaptor protein 2 900029-9-B single siRNA, 0.9 nmol 1042 9618 TRAF4 TNF receptor-associated factor 4 900029-9-B single siRNA, 0.9 nmol 1043 9948 WDR1 WD repeat domain 1 900029-9-B single siRNA, 0.9 nmol 1044 10096 ACTR3 ARP3 actin-related protein 3 hom 900029-9-B single siRNA, 0.9 nmol 1045 10251 SPRY3 sprouty homolog 3 (Drosophila) 900029-9-B single siRNA, 0.9 nmol 1046 10398 MYL9 myosin, light chain 9, regulatory 900029-9-B single siRNA, 0.9 nmol 1047 10677 AVIL advillin 900029-9-B single siRNA, 0.9 nmol 1048 11052 CPSF6 cleavage and polyadenylation sp 900029-9-B single siRNA, 0.9 nmol 1049 22800 RRAS2 related RAS viral (r-ras) oncogen 900029-9-B single siRNA, 0.9 nmol 1050 23443 SLC35A3 solute carrier family 35 (UDP-N-a 900029-9-B single siRNA, 0.9 nmol 1051 9463 PICK1 protein interacting with PRKCA 1 900029-9-B single siRNA, 0.9 nmol 1052 9667 SAFB2 scaffold attachment factor B2 900029-9-B single siRNA, 0.9 nmol 1053 10000 AKT3 v-akt murine thymoma viral onco 900029-9-B single siRNA, 0.9 nmol 1054 10140 TOB1 transducer of ERBB2, 1 900029-9-B single siRNA, 0.9 nmol 1055 10252 SPRY1 sprouty homolog 1, antagonist of 900029-9-B single siRNA, 0.9 nmol 1056 10399 GNB2L1 guanine nucleotide binding protei 900029-9-B single siRNA, 0.9 nmol 1057 10750 GRAP GRB2-related adaptor protein 900029-9-B single siRNA, 0.9 nmol 1058 11057 ABHD2 abhydrolase domain containing 2 900029-9-B single siRNA, 0.9 nmol 1059 22821 RASA3 RAS p21 protein activator 3 900029-9-B single siRNA, 0.9 nmol 1060 23476 BRD4 bromodomain containing 4 900029-9-B single siRNA, 0.9 nmol 1061 9468 PCYT1B phosphate cytidylyltransferase 1, 900029-9-B single siRNA, 0.9 nmol 1062 9743 RICS Rho GTPase-activating protein 900029-9-B single siRNA, 0.9 nmol 1063 10006 ABI1 abi-interactor 1 900029-9-B single siRNA, 0.9 nmol 1064 10153 CEBPZ CCAAT/enhancer binding protein 900029-9-B single siRNA, 0.9 nmol 1065 10253 SPRY2 sprouty homolog 2 (Drosophila) 900029-9-B single siRNA, 0.9 nmol 1066 10419 PRMT5 protein arginine methyltransferas 900029-9-B single siRNA, 0.9 nmol 1067 10752 CHL1 cell adhesion molecule with hom 900029-9-B single siRNA, 0.9 nmol 1068 11059 WWP1 WW domain containing E3 ubiqui 900029-9-B single siRNA, 0.9 nmol 1069 23013 SPEN spen homolog, transcriptional reg 900029-9-B single siRNA, 0.9 nmol 1070 23607 CD2AP CD2-associated protein 900029-9-B single siRNA, 0.9 nmol 1071 9542 NRG2 neuregulin 2 900029-9-B single siRNA, 0.9 nmol 1072 9775 EIF4A3 eukaryotic translation initiation fa 900029-9-B single siRNA, 0.9 nmol 1073 10013 HDAC6 histone deacetylase 6 900029-9-B single siRNA, 0.9 nmol 1074 10174 SORBS3 sorbin and SH3 domain containin 900029-9-B single siRNA, 0.9 nmol 1075 10273 STUB1 STIP1 homology and U-box cont 900029-9-B single siRNA, 0.9 nmol 1076 10451 VAV3 vav 3 oncogene 900029-9-B single siRNA, 0.9 nmol 1077 10856 RUVBL2 RuvB-like 2 (E. coli) 900029-9-B single siRNA, 0.9 nmol 1078 11060 WWP2 WW domain containing E3 ubiqui 900029-9-B single siRNA, 0.9 nmol 1079 23136 EPB41L3 erythrocyte membrane protein ba 900029-9-B single siRNA, 0.9 nmol 1080 23624 CBLC Cas-Br-M (murine) ecotropic retr 900029-10-A single siRNA, 0.9 nmol 1081 23760 PITPNB phosphatidylinositol transfer prot 900029-10-A single siRNA, 0.9 nmol 1082 27020 NPTN neuroplastin 900029-10-A single siRNA, 0.9 nmol 1083 30011 SH3KBP1 SH3-domain kinase binding prote 900029-10-A single siRNA, 0.9 nmol 1084 51513 ETV7 ets variant gene 7 (TEL2 oncoge 900029-10-A single siRNA, 0.9 nmol 1085 54567 DLL4 delta-like 4 (Drosophila) 900029-10-A single siRNA, 0.9 nmol 1086 55914 ERBB2IP erbb2 interacting protein 900029-10-A single siRNA, 0.9 nmol 1087 57561 ARRDC3 arrestin domain containing 3 900029-10-A single siRNA, 0.9 nmol 1088 64130 LIN7B lin-7 homolog B (C. elegans) 900029-10-A single siRNA, 0.9 nmol 1089 79718 TBL1XR1 transducin (beta)-like 1X-linked r 900029-10-A single siRNA, 0.9 nmol 1090 80821 DDHD1 DDHD domain containing 1 900029-10-A single siRNA, 0.9 nmol 1091 25759 SHC2 SHC (Src homology 2 domain co 900029-10-A single siRNA, 0.9 nmol 1092 28514 DLL1 delta-like 1 (Drosophila) 900029-10-A single siRNA, 0.9 nmol 1093 50807 DDEF1 development and differentiation e 900029-10-A single siRNA, 0.9 nmol 1094 51582 AZIN1 antizyme inhibitor 1 900029-10-A single siRNA, 0.9 nmol 1095 54822 TRPM7 transient receptor potential cation 900029-10-A single siRNA, 0.9 nmol 1096 56288 PARD3 par-3 partitioning defective 3 hom 900029-10-A single siRNA, 0.9 nmol 1097 58513 EPS15L1 epidermal growth factor receptor  900029-10-A single siRNA, 0.9 nmol 1098 64319 FBRS fibrosin 900029-10-A single siRNA, 0.9 nmol 1099 79801 SHCBP1 SHC SH2-domain binding protein 900029-10-A single siRNA, 0.9 nmol 1100 81848 SPRY4 sprouty homolog 4 (Drosophila) 900029-10-A single siRNA, 0.9 nmol 1101 25800 SLC39A6 solute carrier family 39 (zinc tran 900029-10-A single siRNA, 0.9 nmol 1102 28964 GIT1 G protein-coupled receptor kinas 900029-10-A single siRNA, 0.9 nmol 1103 50855 PARD6A par-6 partitioning defective 6 hom 900029-10-A single siRNA, 0.9 nmol 1104 51616 TAF9B TAF9B RNA polymerase II, TAT 900029-10-A single siRNA, 0.9 nmol 1105 54876 C4orf30 chromosome 4 open reading fra 900029-10-A single siRNA, 0.9 nmol 1106 56751 BARHL1 BarH-like 1 (Drosophila) 900029-10-A single siRNA, 0.9 nmol 1107 58533 SNX6 sorting nexin 6 900029-10-A single siRNA, 0.9 nmol 1108 64780 MICAL1 microtubule associated monoxyg 900029-10-A single siRNA, 0.9 nmol 1109 80005 DOCK5 dedicator of cytokinesis 5 900029-10-A single siRNA, 0.9 nmol 1110 83481 EPPK1 epiplakin 1 900029-10-A single siRNA, 0.9 nmol 1111 25983 NGDN neuroguidin, EIF4E binding protei 900029-10-A single siRNA, 0.9 nmol 1112 29123 ANKRD11 ankyrin repeat domain 11 900029-10-A single siRNA, 0.9 nmol 1113 51079 NDUFA13 NADH dehydrogenase (ubiquinor 900029-10-A single siRNA, 0.9 nmol 1114 51655 RASD1 RAS, dexamethasone-induced 1 900029-10-A single siRNA, 0.9 nmol 1115 55236 UBE1L2 ubiquitin-activating enzyme E1-lik 900029-10-A single siRNA, 0.9 nmol 1116 56776 FMN2 formin 2 900029-10-A single siRNA, 0.9 nmol 1117 60412 EXOC4 exocyst complex component 4 900029-10-A single siRNA, 0.9 nmol 1118 64866 CDCP1 CUB domain containing protein 1 900029-10-A single siRNA, 0.9 nmol 1119 80218 NAT13 N-acetyltransferase 13 900029-10-A single siRNA, 0.9 nmol 1120 83737 ITCH itchy homolog E3 ubiquitin protei 900029-10-A single siRNA, 0.9 nmol 1121 26960 NBEA neurobeachin 900029-10-A single siRNA, 0.9 nmol 1122 29127 RACGAP1 Rac GTPase activating protein 1 900029-10-A single siRNA, 0.9 nmol 1123 51343 FZR1 fizzy/cell division cycle 20 related 900029-10-A single siRNA, 0.9 nmol 1124 53358 SHC3 SHC (Src homology 2 domain co 900029-10-A single siRNA, 0.9 nmol 1125 55327 LIN7C lin-7 homolog C (C. elegans) 900029-10-A single siRNA, 0.9 nmol 1126 56907 SPIRE1 spire homolog 1 (Drosophila) 900029-10-A single siRNA, 0.9 nmol 1127 63920 LOC63920 transposon-derived Buster3 trans 900029-10-A single siRNA, 0.9 nmol 1128 79009 DDX50 DEAD (Asp-Glu-Ala-Asp) box po 900029-10-A single siRNA, 0.9 nmol 1129 80336 C20orf119 chromosome 20 open reading fra 900029-10-A single siRNA, 0.9 nmol 1130 84790 TUBA1C tubulin, alpha 1c 900029-10-A single siRNA, 0.9 nmol 1131 26986 PABPC1 poly(A) binding protein, cytoplas 900029-10-A single siRNA, 0.9 nmol 1132 29924 EPN1 epsin 1 900029-10-A single siRNA, 0.9 nmol 1133 51473 DCDC2 doublecortin domain containing 2 900029-10-A single siRNA, 0.9 nmol 1134 54206 ERRFI1 ERBB receptor feedback inhibitor 900029-10-A single siRNA, 0.9 nmol 1135 55824 PAG1 phosphoprotein associated with g 900029-10-A single siRNA, 0.9 nmol 1136 57403 RAB22A RAB22A, member RAS oncogen 900029-10-A single siRNA, 0.9 nmol 1137 63932 CXorf56 chromosome X open reading fra 900029-10-A single siRNA, 0.9 nmol 1138 79090 TRAPPC6A trafficking protein particle comple 900029-10-A single siRNA, 0.9 nmol 1139 80725 SNIP SNAP25-interacting protein 900029-10-A single siRNA, 0.9 nmol 1140 84918 LRP11 low density lipoprotein receptor-r 900029-10-B single siRNA, 0.9 nmol 1141 23760 PITPNB phosphatidylinositol transfer prot 900029-10-B single siRNA, 0.9 nmol 1142 27020 NPTN neuroplastin 900029-10-B single siRNA, 0.9 nmol 1143 30011 SH3KBP1 SH3-domain kinase binding prote 900029-10-B single siRNA, 0.9 nmol 1144 51513 ETV7 ets variant gene 7 (TEL2 oncoge 900029-10-B single siRNA, 0.9 nmol 1145 54567 DLL4 delta-like 4 (Drosophila) 900029-10-B single siRNA, 0.9 nmol 1146 55914 ERBB2IP erbb2 interacting protein 900029-10-B single siRNA, 0.9 nmol 1147 57561 ARRDC3 arrestin domain containing 3 900029-10-B single siRNA, 0.9 nmol 1148 64130 LIN7B lin-7 homolog B (C. elegans) 900029-10-B single siRNA, 0.9 nmol 1149 79718 TBL1XR1 transducin (beta)-like 1X-linked re 900029-10-B single siRNA, 0.9 nmol 1150 80821 DDHD1 DDHD domain containing 1 900029-10-B single siRNA, 0.9 nmol 1151 25759 SHC2 SHC (Src homology 2 domain co 900029-10-B single siRNA, 0.9 nmol 1152 28514 DLL1 delta-like 1 (Drosophila) 900029-10-B single siRNA, 0.9 nmol 1153 50807 DDEF1 development and differentiation e 900029-10-B single siRNA, 0.9 nmol 1154 51582 AZIN1 antizyme inhibitor 1 900029-10-B single siRNA, 0.9 nmol 1155 54822 TRPM7 transient receptor potential cation 900029-10-B single siRNA, 0.9 nmol 1156 56288 PARD3 par-3 partitioning defective 3 hom 900029-10-B single siRNA, 0.9 nmol 1157 58513 EPS15L1 epidermal growth factor receptor 900029-10-B single siRNA, 0.9 nmol 1158 64319 FBRS fibrosin 900029-10-B single siRNA, 0.9 nmol 1159 79801 SHCBP1 SHC SH2-domain binding protein 900029-10-B single siRNA, 0.9 nmol 1160 81848 SPRY4 sprouty homolog 4 (Drosophila) 900029-10-B single siRNA, 0.9 nmol 1161 25800 SLC39A6 solute carrier family 39 (zinc tran 900029-10-B single siRNA, 0.9 nmol 1162 28964 GIT1 G protein-coupled receptor kinas 900029-10-B single siRNA, 0.9 nmol 1163 50855 PARD6A par-6 partitioning defective 6 hom 900029-10-B single siRNA, 0.9 nmol 1164 51616 TAF9B TAF9B RNA polymerase II, TAT 900029-10-B single siRNA, 0.9 nmol 1165 54876 C4orf30 chromosome 4 open reading fra 900029-10-B single siRNA, 0.9 nmol 1166 56751 BARHL1 BarH-like 1 (Drosophila) 900029-10-B single siRNA, 0.9 nmol 1167 58533 SNX6 sorting nexin 6 900029-10-B single siRNA, 0.9 nmol 1168 64780 MICAL1 microtubule associated monoxyg 900029-10-B single siRNA, 0.9 nmol 1169 80005 DOCK5 dedicator of cytokinesis 5 900029-10-B single siRNA, 0.9 nmol 1170 83481 EPPK1 epiplakin 1 900029-10-B single siRNA, 0.9 nmol 1171 25983 NGDN neuroguidin, EIF4E binding prote 900029-10-B single siRNA, 0.9 nmol 1172 29123 ANKRD11 ankyrin repeat domain 11 900029-10-B single siRNA, 0.9 nmol 1173 51079 NDUFA13 NADH dehydrogenase (ubiquino 900029-10-B single siRNA, 0.9 nmol 1174 51655 RASD1 RAS, dexamethasone-induced 1 900029-10-B single siRNA, 0.9 nmol 1175 55236 UBE1L2 ubiquitin-activating enzyme E1-lik 900029-10-B single siRNA, 0.9 nmol 1176 56776 FMN2 formin 2 900029-10-B single siRNA, 0.9 nmol 1177 60412 EXOC4 exocyst complex component 4 900029-10-B single siRNA, 0.9 nmol 1178 64866 CDCP1 CUB domain containing protein 1 900029-10-B single siRNA, 0.9 nmol 1179 80218 NAT13 N-acetyltransferase 13 900029-10-B single siRNA, 0.9 nmol 1180 83737 ITCH itchy homolog E3 ubiquitin protei 900029-10-B single siRNA, 0.9 nmol 1181 26960 NBEA neurobeachin 900029-10-B single siRNA, 0.9 nmol 1182 29127 RACGAP1 Rac GTPase activating protein 1 900029-10-B single siRNA, 0.9 nmol 1183 51343 FZR1 fizzy/cell division cycle 20 related 900029-10-B single siRNA, 0.9 nmol 1184 53358 SHC3 SHC (Src homology 2 domain co 900029-10-B single siRNA, 0.9 nmol 1185 55327 LIN7C lin-7 homolog C (C. elegans) 900029-10-B single siRNA, 0.9 nmol 1186 56907 SPIRE1 spire homolog 1 (Drosophila) 900029-10-B single siRNA, 0.9 nmol 1187 63920 LOC63920 transposon-derived Buster3 trans 900029-10-B single siRNA, 0.9 nmol 1188 79009 DDX50 DEAD (Asp-Glu-Ala-Asp) box po 900029-10-B single siRNA, 0.9 nmol 1189 80336 C20orf119 chromosome 20 open reading fra 900029-10-B single siRNA, 0.9 nmol 1190 84790 TUBA1C tubulin, alpha 1c 900029-10-B single siRNA, 0.9 nmol 1191 26986 PABPC1 poly(A) binding protein, cytoplas 900029-10-B single siRNA, 0.9 nmol 1192 29924 EPN1 epsin 1 900029-10-B single siRNA, 0.9 nmol 1193 51473 DCDC2 doublecortin domain containing 2 900029-10-B single siRNA, 0.9 nmol 1194 54206 ERRFI1 ERBB receptor feedback inhibitor 900029-10-B single siRNA, 0.9 nmol 1195 55824 PAG1 phosphoprotein associated with g 900029-10-B single siRNA, 0.9 nmol 1196 57403 RAB22A RAB22A, member RAS oncogen 900029-10-B single siRNA, 0.9 nmol 1197 63932 CXorf56 chromosome X open reading fra 900029-10-B single siRNA, 0.9 nmol 1198 79090 TRAPPC6A trafficking protein particle comple 900029-10-B single siRNA, 0.9 nmol 1199 80725 SNIP SNAP25-interacting protein 900029-10-B single siRNA, 0.9 nmol 1200 84918 LRP11 low density lipoprotein receptor-r 900029-11-A single siRNA, 0.9 nmol 1201 84962 JUB jub, ajuba homolog (Xenopus lae 900029-11-A single siRNA, 0.9 nmol 1202 94030 LRRC4B leucine rich repeat containing 4B 900029-11-A single siRNA, 0.9 nmol 1203 144983 RP11-78J21.1 heterogeneous nuclear ribonucle 900029-11-A single siRNA, 0.9 nmol 1204 284393 LOC284393 similar to ribosomal protein L10 900029-11-A single siRNA, 0.9 nmol 1205 642045 LOC642045 similar to myosin regulatory light  900029-11-A single siRNA, 0.9 nmol 1206 648695 LOC648695 similar to retinoblastoma binding  900029-11-A single siRNA, 0.9 nmol 1207 731292 LOC731292 similar to Phosphatidylinositol-3,4 900029-11-A single siRNA, 0.9 nmol 1208 84981 MGC14376 hypothetical protein MGC14376 900029-11-A single siRNA, 0.9 nmol 1209 103910 MRLC2 myosin regulatory light chain MR 900029-11-A single siRNA, 0.9 nmol 1210 150094 SNF1LK SNF1-like kinase 900029-11-A single siRNA, 0.9 nmol 1211 286887 KRT6C keratin 6C 900029-11-A single siRNA, 0.9 nmol 1212 642954 LOC642954 similar to retinoblastoma binding 900029-11-A single siRNA, 0.9 nmol 1213 643997 LOC643997 similar to peptidylprolyl isomeras 900029-11-A single siRNA, 0.9 nmol 1214 731751 LOC731751 similar to protein kinase, DNA-ac 900029-11-A single siRNA, 0.9 nmol 1215 85021 REPS1 RALBP1 associated Eps domain 900029-11-A single siRNA, 0.9 nmol 1216 121536 AEBP2 AE binding protein 2 900029-11-A single siRNA, 0.9 nmol 1217 151987 PPP4R2 protein phosphatase 4, regulatory 900029-11-A single siRNA, 0.9 nmol 1218 343472 BARHL2 BarH-like 2 (Drosophila) 900029-11-A single siRNA, 0.9 nmol 1219 643751 LOC643751 similar to cell division cycle 42 900029-11-A single siRNA, 0.9 nmol 1220 727897 MUC5B mucin 5B, oligomeric mucus/gel-f 900029-11-A single siRNA, 0.9 nmol 1221 85458 DIXDC1 DIX domain containing 1 900029-11-A single siRNA, 0.9 nmol 1227 139322 APOOL apolipoprotein O-like 900029-11-A single siRNA, 0.9 nmol 1223 253738 EBF3 early B-cell factor 3 900029-11-A single siRNA, 0.9 nmol 1224 387927 LOC387927 similar to NIMA (never in mitosis  900029-11-A single siRNA, 0.9 nmol 1225 643752 hCG_1757335 hCG1757335 900029-11-A single siRNA, 0.9 nmol 1226 728153 LOC728153 hypothetical protein LOC728153 900029-11-A single siRNA, 0.9 nmol 1227 90665 TBL1Y transducin (beta)-like 1Y-linked 900029-11-A single siRNA, 0.9 nmol 1228 140735 DYNLL2 dynein, light chain, LC8-type 2 900029-11-A single siRNA, 0.9 nmol 1229 255324 EPGN epithelial mitogen homolog (mou 900029-11-A single siRNA, 0.9 nmol 1230 389342 LOC389342 similar to ribosomal protein L10 900029-11-A single siRNA, 0.9 nmol 1231 643997 LOC643997 similar to peptidylprolyl isomeras 900029-11-A single siRNA, 0.9 nmol 1232 728198 LOC728198 similar to transcription associated 900029-11-A single siRNA, 0.9 nmol 1233 92521 SPECC1 sperm antigen with calponin hom 900029-11-A single siRNA, 0.9 nmol 1234 140801 RPL10L ribosomal protein L10-like 900029-11-A single siRNA, 0.9 nmol 1235 283455 KSR2 kinase suppressor of ras 2 900029-11-A single siRNA, 0.9 nmol 1236 390006 LOC390006 similar to peptidylprolyl isomerase 900029-11-A single siRNA, 0.9 nmol 1237 645691 LOC645691 similar to Heterogeneous nuclear 900029-11-A single siRNA, 0.9 nmol 1238 728024 hCG_1640171 hCG1640171 900029-11-B single siRNA, 0.9 nmol 1239 84962 JUB jub, ajuba homolog (Xenopus lae 900029-11-B single siRNA, 0.9 nmol 1240 94030 LRRC4B leucine rich repeat containing 4B 900029-11-B single siRNA, 0.9 nmol 1241 144983 RP11-78J21.1 heterogeneous nuclear ribonucle 900029-11-B single siRNA, 0.9 nmol 1242 284393 LOC284393 similar to ribosomal protein L10 900029-11-B single siRNA, 0.9 nmol 1243 642045 LOC642045 similar to myosin regulatory light  900029-11-B single siRNA, 0.9 nmol 1244 648695 LOC648695 similar to retinoblastoma binding  900029-11-B single siRNA, 0.9 nmol 1245 731292 LOC731292 similar to Phosphatidylinositol-3,4 900029-11-B single siRNA, 0.9 nmol 1246 84981 MGC14376 hypothetical protein MGC14376 900029-11-B single siRNA, 0.9 nmol 1247 103910 MRLC2 myosin regulatory light chain MR 900029-11-B single siRNA, 0.9 nmol 1248 150094 SNF1LK SNF1-like kinase 900029-11-B single siRNA, 0.9 nmol 1249 286887 KRT6C keratin 6C 900029-11-B single siRNA, 0.9 nmol 1250 642954 LOC642954 similar to retinoblastoma binding  900029-11-B single siRNA, 0.9 nmol 1251 643997 LOC643997 similar to peptidylprolyl isomeras 900029-11-B single siRNA, 0.9 nmol 1252 731751 LOC731751 similar to protein kinase, DNA-ac 900029-11-B single siRNA, 0.9 nmol 1253 85021 REPS1 RALBP1 associated Eps domain 900029-11-B single siRNA, 0.9 nmol 1254 121536 AEBP2 AE binding protein 2 900029-11-8 single siRNA, 0.9 nmol 1255 151987 PPP4R2 protein phosphatase 4, regulatory 900029-11-B single siRNA, 0.9 nmol 1256 343472 BARHL2 BarH-like 2 (Drosophila) 900029-11-B single siRNA, 0.9 nmol 1257 643751 LOC643751 similar to cell division cycle 42 900029-11-B single siRNA, 0.9 nmol 1258 727897 MUC5B mucin 5B, oligomeric mucus/gel- 900029-11-B single siRNA, 0.9 nmol 1259 85458 DIXDC1 DIX domain containing 1 900029-11-B single siRNA, 0.9 nmol 1260 139322 APOOL apolipoprotein O-like 900029-11-B single siRNA, 0.9 nmol 1261 253738 EBF3 early B-cell factor 3 900029-11-B single siRNA, 0.9 nmol 1262 387927 LOC387927 similar to NIMA (never in mitosis  900029-11-B single siRNA, 0.9 nmol 1263 643752 hCG_1757335 hCG1757335 900029-11-B single siRNA, 0.9 nmol 1264 728153 LOC728153 hypothetical protein LOC728153 900029-11-B single siRNA, 0.9 nmol 1265 90665 TBL1Y transducin (beta)-like 1Y-linked 900029-11-B single siRNA, 0.9 nmol 1266 140735 DYNLL2 dynein, light chain, LC8-type 2 900029-11-B single siRNA, 0.9 nmol 1267 255324 EPGN epithelial mitogen homolog (mou 900029-11-B single siRNA, 0.9 nmol 1268 389342 LOC389342 similar to ribosomal protein L10 900029-11-B single siRNA, 0.9 nmol 1269 643997 LOC643997 similar to peptidylprolyl isomeras 900029-11-B single siRNA, 0.9 nmol 1270 728198 LOC728198 similar to transcription associated 900029-11-B single siRNA, 0.9 nmol 1271 92521 SPECC1 sperm antigen with calponin hom 900029-11-B single siRNA, 0.9 nmol 1272 140801 RPL10L ribosomal protein L10-like 900029-11-B single siRNA, 0.9 nmol 1273 283455 KSR2 kinase suppressor of ras 2 900029-11-B single siRNA, 0.9 nmol 1274 390006 LOC390006 similar to peptidylprolyl isomeras 900029-11-B single siRNA, 0.9 nmol 1275 645691 LOC645691 similar to Heterogeneous nuclear 900029-11-B single siRNA, 0.9 nmol 1276 728024 hCG_1640171 hCG1640171 mRNA Plate Id Accessions siRNA Target Sequence Product Id Product Name 900029-1-A NM_001085 AAGGTTCTACTTGAGCAAGAA SI00715540 Hs_SERPINA3_4 900029-1-A NM_001014431 N CACCATGAGCGACGTGGCTAT SI02758406 Hs_AKT1_11 900029-1-A NM_001167 AAGTGCTTTCACTGTGGAGGA SI00299446 Hs_BIRC4_5 900029-1-A NM_001660 XM_ ACCAAGGACATGTTTGATAAA SI00300076 Hs_ARF4_4 900029-1-A NM_001042678 N CCCTACTGTCTTTGAGAACTA SI02663913 Hs_RHOC_6 900029-1-A NM_053056 CCCTACTGTCTTTGAGAACTA SI02654547 Hs_CCND1_6 900029-1-A NM_001202 NM_ GCGAGCCATGCTAGTTTGATA SI03105193 Hs_BMP4_7 900029-1-A NM_004342 NM_ CGCCAAGAAAGATACGAGATA SI03193498 Hs_CALD1_6 900029-1-A NM_001223 NM_ TACCTCTTCCCAGGACATTAA SI02662443 Hs_CASP1_15 900029-1-A NM_170662 CAGGTGTTGCAGCATCATTGA SI03072398 Hs_CBLB_5 900029-1-A NM_005157 NM_ AACGGCTGATGTGGACTGTCT SI00299110 Hs_ABL1_9 900029-1-A NM_001626 AAGGTACTTCGATGATGAATT SI00299173 Hs_AKT2_6 900029-1-A NM_000484 NM_ CTGGTCTTCAATTACCAAGAA SI02780288 Hs_APP_10 900029-1-A NM_001662 TTCGCGGATCTTCGGGAAGAA SI03242351 Hs_ARF5_5 900029-1-A NM_001665 CACGCTGTGCGCTACCTCGAA SI00702884 Hs_RHOG_4 900029-1-A NM_005178 CAACGTGAACGCGCAAATGTA SI02654554 Hs_BCL3_5 900029-1-A NM_004329 GCGGCAGACATTAAAGGTACA SI02659629 Hs_BMPR1A_6 900029-1-A NM_006888 CTGGTTGTATCTTATTAGCAA SI02224222 Hs_CA   _6 900029-1-A NM_001753 AAGCAAGTGTACGACGCGCAC SI00299642 Hs_CAV1_10 900029-1-A NM_001759 CAGGGCCGTGCGGGACCGCAA SI03071369 Hs_CCND2_5 900029-1-A NM_005159 CTGATCGTATGCAGAAGGAAA SI00291389 Hs_ACTC_3 900029-1-A NM_004304 CTGGGCCTGTATACCGGATAA SI02632854 Hs_ALK_6 900029-1-A NM_001654 CCGGGATGGCATGAGTGTCTA SI0028   3 Hs_ARAF_6 900029-1-A NM_000045 AGCGCCAAGTCCAGAACCATA SI03043859 Hs_ARG1_5 900029-1-A NM_004316 CCAGTTGTACTTCAGCACCAA SI03075793 Hs_ASCL1_5 900029-1-A NM_004327 NM_ AAGGTCAACGACAAAGAGGTG SI00299425 Hs_BCR_5 900029-1-A NM_001203 ACGGATATTGTTTCACGATGA SI00604989 Hs_BMPR1B_6 900029-1-A NM_0017  AAGCCCTTCTGCACATCTAAA S   758420 Hs_CALM2_9 900029-1-A NM_001233 NM_ ACGCTAATAAGTGACAAATAA SI02664389 Hs_CAV2_10 900029-1-A NM_001760 CATGCGGAAGATGCTGGCTTA SI03073924 Hs_CCND3_5 900029-1-A NM_04924 CCCGCAAATCATCAACTCCAA SI02779980 Hs_ACTN4_6 900029-1-A NM_000479 CCAATAAAGACCAGCAAGCAA SI02623572 Hs_AMH_4 900029-1-A NM_001657 ATGATTGACAGTAGTTTATCA SI03049683 Hs_AREG_5 900029-1-A NM_001172 AACCTTGTATCTCTTCTGCAA SI00301210 Hs_ARG2_4 900029-1-A NM_005170 CTCGACTTCTCCAGCTGGTTA SI03091018 Hs_ASCL2_6 900029-1-A NM_001024912 N CTCCATCCGTTGGTTCTTCAA SI03089632 Hs_CEACAM1_7 900029-1-A NM_004333 AACATATAGAGGCCCTATTGG SI00299488 Hs_BRAF_1 900029-1-A NM_005184 CCGCAGAGCTGCGTCACGTAA SI02659685 Hs_CALM3_7 900029-1-A NM_001234 NM_ CAGCTTTGACGGCGTGTGGAA SI03068730 Hs_CAV3_9 900029-1-A NM_001238 NM_ AAGGCAAACGTGACCGTTTTT SI00299691 Hs_CCNE1_5 900029-1-A NM_014203 NM_ CACCGTCATCAATGCCCTCAA SI02661610 Hs_AP2A1_6 900029-1-A NM_001002857 N CACGGCCTGAGCGTCCAGAAA SI03060855 Hs_ANXA2_10 900029-1-A NM_001024226 N AGGGAAGACCACGATCCTCTA SI02757279 Hs_ARF1_11 900029-1-A NM_001664 TACCTTATAGTTACTGTGTAA SI02776907 Hs_RHOA_8 900029-1-A NM_001679 XM_ AAGGATAGATTGTGTTTCAAA SI00306614 Hs_ATP1B3_4 900029-1-A NM_001715 CTGGTAAGCGACTGTCATCAA SI02626785 Hs_BLK_5 900029-1-A NM_001729 ATCCATGAGATAGCTATTATA SI02626820 Hs_BTC_6 900029-1-A NM_001222 NM_ CTCGGATATGTCGACTTCTGA SI02758427 Hs_CAMK2G_7 900029-1-A NM_001001890 N CAGGATACAAGGCAGATCCAA SI03069766 Hs_RUNX1_6 900029-1-A NM_000733 CTCAGTATCCTGGATCTGAAA SI03088848 Hs_CD3E_7 900029-1-A NM_012305 AGGCTCTTGATGGCTATAGTA SI03146633 Hs_AP2A2_5 900029-1-A NM_001155 NM_ CCGACAAACTTTACAAATCCA SI00297024 Hs_ANXA6_4 900029-1-A NM_001659 CACCTATATGACCAATCCCTA SI02654477 Hs_ARF3_5 900029-1-A NM_004040 CCCGGACTCGCTGGAGAACAT SI03078257 Hs_RHOB_6 900029-1-A NM_001699 NM_ TCCAAGATTCTAGATGATTAA SI00605311 Hs_AXL_10 900029-1-A NM_001200 CACCGAATTAATATTTATGAA SI00023373 Hs_BMP2_4 900029-1-A NM_001954 NM_ CAGGAATGATTTCCTGAAAGA SI00605444 Hs_DDR1_10 900029-1-A NM_001745 AGGGCTGAGTTTGTATTATTA SI02777110 Hs_CAMLG_8 900029-1-A NM_005188 CCGTACTATCTTGTCAAGATA SI02757321 Hs_CBL_8 900029-1-A NM_000734 NM_ AACGAGCTCAATCTAGGACGA SI03029397 Hs_CD247_1 900029-1-B NM_001085 CCCAAGATACTCATCAGTCAA SI00715533 Hs_SERPINA3_3 900029-1-B NM_001014431 N CACGCTTGGTCCCGAGGCCAA SI02757244 Hs_AKT1_10 900029-1-B NM_001167 GGCCGGAATCTTAATATTCGA SI03105739 Hs_BIRC4_8 900029-1-B NM_001660 CCCATTTGGAATTATTCCTAA SI00300069 Hs_ARF4_3 900029-1-B NM_001042678 N CACCATGGCTGCAATCCGAAA SI02663906 Hs_RHOC_5 900029-1-B NM_053056 AACACCAGCTCCTGTGCTGCG SI02654540 Hs_CCND1_5 900029-1-B NM_001202 NM_ CAGCAGCATCCCTGAGAACGA SI03065643 Hs_BMP4_6 900029-1-B NM_004342 NM_ ATGGATCAAAGTTTGAATTAA SI02731232 Hs_CALD1_5 900029-1-B NM_001223 NM_ CTCATTGAACATATGCAAGAA SI02661932 Hs_CASP1_14 900029-1-B NM_170662 ACGGGCAATAAGACTCTTTAA SI00156779 Hs_CBLB_3 900029-1-B NM_005157 NM_ AACCAAGCCTTTGAAACAATG SI00299103 Hs_ABL1_8 900029-1-B NM_001626 AACAACTTCTCCGTAGCAGAA SI00299166 Hs_AKT2_5 900029-1-B NM_000484 NM_ ACCCAATTAAGTCCTACTTTA SI02780281 Hs_APP_9 900029-1-B NM_001662 CATCTTTGTGGTGGACAGTAA SI00300321 Hs_ARF5_4 900029-1-B NM_001665 GAGAAGGTGAATGTACCCTAA SI00702877 Hs_RHOG_3 900029-1-B NM_005178 CCGGCCGGAGGCGCTTTACTA SI03082156 Hs_BCL3_6 900029-1-B NM_004329 CAGCTACGCCGGACAATAGAA SI02659622 Hs_BMPR1A_5 900029-1-B NM_006888 CGGCAACTTACACACATTGAA SI02224215 Hs_CALM1_5 900029-1-B NM_001753 CACCTTCACTGTGACGAAATA SI00299614 Hs_CAV1_6 900029-1-B NM_001759 AAGAAATAGACTTGCACCTTA SI00027853 Hs_CCND2_4 900029-1-B NM_005159 TCCTAGCACCATGAAGATTAA SI00291382 Hs_ACTC_2 900029-1-B NM_004304 CACCTACGTATTTAAGATGAA SI02632847 Hs_ALK_5 900029-1-B NM_001654 CCGACTCATCAAGGGACGAAA SI00287686 Hs_ARAF_5 900029-1-B NM_000045 AAGCATAGAGTTATCCTTCTA SI00000707 Hs_ARG1_4 900029-1-B NM_004316 ACGCGTTATAGTAACTCCCAT SI00062587 Hs_ASCL1_3 900029-1-B NM_004327 NM_ CAGCATTCCGCTGACCATCAA SI00288141 Hs_BCR_8 900029-1-B NM_001203 AACGAATGTAATAAAGACCTA SI00604982 Hs_BMPR1B_5 900029-1-B NM_001743 GACCTTGTACAGAATGTGTTA SI02758413 Hs_CALM2_8 900029-1-B NM_001233 NM_ CCGGCTCAACTCGCATCTCAA SI00299663 Hs_CAV2_7 900029-1-B NM_001760 TGGGACAGAATTGGATACATA SI00027881 Hs_CCND3_4 900029-1-B NM_004924 ACGCAGCATCGTGGACTACAA SI02779973 Hs_ACTN4_5 900029-1-B NM_000479 CAGGCCATCCGCGGAACTCGA SI02623565 Hs_AMH_3 900029-1-B NM_001657 ATGGATTTGAGGTTACCTCAA SI00299936 Hs_AREG_3 900029-1-B NM_001172 TTGGATAACCTTCCTTCTAAA SI00301203 Hs_ARG2_3 900029-1-B NM_005170 CCGCGTGAAGCTGGTGAACTT SI03081218 Hs_ASCL2_5 900029-1-B NM_001024912 N CAAGACGATCATAGTCACTGA SI03053694 Hs_CEACAM1_6 900029-1-B NM_004333 TTGCTTATATGTTAAATTGAA SI02632966 Hs_BRAF_5 900029-1-B NM_005184 CACCAATTGATTGACTGAGAA SI02622060 Hs_CALM3_5 900029-1-B NM_001234 NM_ TTGCGTTCACTTGTACTGTAA SI02625665 Hs_CAV3_7 900029-1-B NM_001238 NM_ CAAGATTTCTTTGACCGGTAT SI03054037 Hs_CCNE1_8 900029-1-B NM_014203 NM_ TTGGATGGCTACAGTAAGAAA SI02661603 Hs_AP2A1_5 900029-1-B NM_001002857 N CGGCAAGTCCCTGTACTATTA SI02632385 Hs_ANXA2_8 900029-1-B NM_001024226 N CACGATCCTCTACAAGCTTAA SI02757272 Hs_ARF1_10 900029-1-B NM_001664 CAAGCTAGACGTGGGAAGAAA SI02654267 Hs_RHOA_7 900029-1-B NM_001679 XM_ CAGGATGATCGTGACAAGTTT SI00306607 Hs_ATP1B3_3 900029-1-B NM_001715 CAACATGAAGGTGGCCATTAA SI00027055 Hs_BLK_3 900029-1-B NM_001729 CACCAGAAGTCCTGAAACTAA SI02626813 Hs_BTC_5 900029-1-B NM_001222 NM_ CCGATGAGAAACCTCGTGTTA SI00157402 Hs_CAMK2G_3 900029-1-B NM_001001890 N CAGGTCGTTCTTATCTAGAGA SI00027769 Hs_RUNX1_4 900029-1-B NM_000733 CACAATTGTCATAGTGGACAT SI03055598 Hs_CD3E_6 900029-1-B NM_012305 TCGGATATCCGCAACTGTAAA SI00297444 Hs_AP2A2_4 900029-1-B NM_001155 NM_ AAGGCTCTTCAAGGCTATGAA SI00297017 Hs_ANXA6_3 900029-1-B NM_001659 TTCCAATTTACTGGATTTAAA SI00300020 Hs_ARF3_4 900029-1-B NM_004040 ACAAGGCATTCTCTAAAGCTA SI03037531 Hs_RHOB_5 900029-1-B NM_001699 NM_ CCGGTGTTCTAAGATGTGATA SI00605304 Hs_AXL_9 900029-1-B NM_001200 CTCAGCATGTTCGGCCTGAAA SI00023366 Hs_BMP2_3 900029-1-B NM_001954 NM_ ACGGTGTGAATCACACATCCA SI00605437 Hs_DDR1_9 900029-1-B NM_001745 ATCGATCAATGGATACCTATA SI02777103 Hs_CAMLG_7 900029-1-B NM_005188 CCCGCCGAACTCTCTCAGATA SI02662471 Hs_CBL_7 900029-1-B NM_000734 NM_ CAGGAAGGCCTGTACAATGAA SI00014462 Hs_CD3Z_4 900029-2-A NM_001771 AAGCAGAATACATTCACGCTA SI03032820 Hs_CD22_7 900029-2-A NM_004360 TCGGCCTGAAGTGACTCGTAA SI02654029 Hs_CDH1_13 900029-2-A NM_020549 NM_ CACGGAGATGTTCTGCTGCTA SI00127022 Hs_CHAT_4 900029-2-A NM_001008490 N CAGGAAGATCTGTGGACCAAA SI03068968 Hs_KLF6_5 900029-2-A NM_000760 NM_ CCAGGCGATCTGCATACTTTA SI00156723 Hs_CSF3R_5 900029-2-A NM_001904 XM_ CTCGGGATGTTCACAACCGAA SI02662478 Hs_CTNNB1_5 900029-2-A NM_001365 CAGGATATGAGTTGCAGGTGA SI02626106 Hs_DLG4_6 900029-2-A NM_001394 NM_ AAGGACTCCGAATACATAATA SI03132227 Hs_DUSP4_5 900029-2-A NM_001955 CAGGTCGGAGACCATGAGAAA SI02627380 Hs_EDN1_6 900029-2-A NM_000399 GAGCGAGGAGCAATTGATTAA SI00008792 Hs_EGR2_4 900029-2-A NM_000610 NM_ AACTCCATCTGTGCAGCAAAC SI00299705 Hs_CD44_5 900029-2-A NM_001793 AAGCCTCTTACCTGCCGTAAA SI02663941 Hs_CDH3_6 900029-2-A NM_005198 NM_ GACCATGGAGCGGTACCTAAA SI03101511 Hs_CHKB_5 900029-2-A NM_004379 NM_ AAGCCCAGCCACAGATTGCCA SI00299908 Hs_CREB1_7 900029-2-A NM_004383 AAGTACAACTTCCACGGCACT SI00299943 Hs_CSK_1 900029-2-A NM_001331 XM_ CTGGTGTTGATCAACAAATCA SI02626001 Hs_CTNND1_5 900029-2-A NM_001005336 N CAGGTCATGCTTCTCATCGAT SI03071894 Hs_DNM1_5 900029-2-A NM_001946 NM_ GTCGGAAATGGCGATCAGCAA SI03106404 Hs_DUSP6_6 900029-2-A NM_001402 CAGAATAGGAACAAGGTTCTA SI03063235 Hs_EEF1A1_8 900029-2-A NM_004430 XM_ CGGCAACAAGACCGTGACCTA SI03195766 Hs_EGR3_6 900029-2-A NM_000611 NM_ TAGGTGTGACTTGAACTAGAT SI03112200 Hs_CD59_6 900029-2-A NM_001795 CAAGGACATAACACCACGAAA SI00028497 Hs_CDH5_4 900029-2-A NM_001278 AAGCAGAAGATTATTGATCTA SI02654659 Hs_CHUK_8 900029-2-A NM_005206 NM_ AATCCGGGACAAGCCTGAAGA SI00299929 Hs_CRK_5 900029-2-A NM_001895 NM_ CTGGTCGCTTACATCACTTTA SI02660504 Hs_CSNK2A1_10 900029-2-A NM_001913 NM_ AACAGAATTATTTGACCTGAA SI02660994 Hs_CUTL1_6 900029-2-A NM_001380 AACGAGGTCCAGCGATTTGAA SI00372526 Hs_DOCK1_4 900029-2-A NM_001947 CAAGGTGGTTTCAACAAGTTT SI02658663 Hs_DUSP7_7 900029-2-A NM_001958 CTGGAAGTTCGAGACCACCAA SI02662492 Hs_EEF1A2_7 900029-2-A NM_004431 TCGGACAGACATATAGGATAT SI02223515 Hs_EPHA2_8 900029-2-A NM_006726 CCGGCGACGATTTGTGCGTAA SI03190880 Hs_LRBA_5 900029-2-A NM_001798 NM_ AAGATGGACGGAGCTTGTTAT SI02654638 Hs_CDK2_12 900029-2-A NM_001295 GACGGAAGAGTTGAGACCTAA SI02625889 Hs_CCR1_6 900029-2-A NM_005207 TAGTTTATCATTAACCACTTA SI02634688 Hs_CRKL_6 900029-2-A NM_001897 TACGCTGGGAATATTCTGTAT SI00355446 Hs_CSPG4_4 900029-2-A NM_001343 TAGAGCATGAACATCCAGTAA SI02780386 Hs_DAB2_6 900029-2-A NM_004946 CCCGGTTACAGCTGAGAATGA SI00070350 Hs_DOCK2_4 900029-2-A NM_001395 CTGAATAAACAGTTTATTTAA SI02665572 Hs_DUSP9_5 900029-2-A NM_001963 GCGGTTGTTCCTCACCCGATA SI03105613 Hs_EGF_5 900029-2-A NM_001416 ACGAGACGTGATTATGAGGGA SI02655849 Hs_EIF4A1_6 900029-2-A NM_001789 NM_ AAGGGTTATCTCTTTCATACA SI02653273 Hs_CDC25A_9 900029-2-A NM_004364 CCGGACTTGGTGCGTCTAAGA SI03081806 Hs_CEBPA_6 900029-2-A NM_000647 NM_ CTGGTCGTCCTCATCTTAATA SI03099677 Hs_CCR2_6 900029-2-A NM_001315 NM_ CTCAGTGATACGTACAGCCAA SI00605164 Hs_MAPK14_7 900029-2-A NM_001901 AAAGATTCCCACCCAATTCAA SI00029694 Hs_CTGF_4 900029-2-A NM_004393 CAAGAAGATTGCCTTGGTAAA SI02633176 Hs_DAG1_7 900029-2-A NM_001945 TCCCATAATTGCTTTGCCAAA SI03114195 Hs_HBEGF_7 900029-2-A NM_001951 GACGGCGTTCTGGATCTCAAA SI03102141 Hs_E2F5_7 900029-2-A NM_005228 NM_ CAGGAACTGGATATTCTGAAA SI02663983 Hs_EGFR_12 900029-2-A NM_001967 TGCCATATTGCACATGTCTTA SI03236051 Hs_EIF4A2_6 900029-2-A NM_001039802 N CATCAGATTTGAAATATTTAA SI02757328 Hs_CDC42_7 900029-2-A NM_005194 CGGGCCCTGAGTAATCGCTTA SI02777292 Hs_CEBPB_5 900029-2-A NM_000579 AAGATGGATTATCAAGTGTCA SI00012180 Hs_CCR5_2 900029-2-A NM_000395 AAGGACAGCCCTGTGGCTATA SI03034381 Hs_CSF2RB_6 900029-2-A NM_001903 CACCCTGATGTCGCAGCCTAT SI02757377 Hs_CTNNA1_9 900029-2-A NM_001920 NM_ AAGCTAGATACTGGAAACCTA SI02647960 Hs_DCN_9 900029-2-A NM_004417 CTGGTTCAACGAGGCCATTGA SI03100048 Hs_DUSP1_5 900029-2-A NM_024007 TACAAGGGACACTATAAATAA SI00375746 Hs_EBF_4 900029-2-A NM_001964 CCCGTCGGTGGCCACCACGTA SI03078950 Hs_EGR1_7 900029-2-A NM_004433 TCAGATGTACATAGAGATCTA SI00378462 Hs_ELF3_4 900029-2-B NM_001771 CACGAATATTATGCCCAGTTT SI02627016 Hs_CD22_6 900029-2-B NM_004360 CTAGGTATTGTCTACTCTGAA SI02653546 Hs_CDH1_12 900029-2-B NM_020549 NM_ CCCGAGATGTTCATGGATGAA SI00127015 Hs_CHAT_3 900029-2-B NM_001008490 N CACGGCCAAGTTTACCTCCGA SI00025095 Hs_KLF6_4 900029-2-B NM_000760 NM_ TCCTATAACTTCAGTATTGTA SI00015022 Hs_CSF3R_4 900029-2-B NM_001904 TAAGAATTGAGTAATGGTGTA SI00029750 Hs_CTNNB1_4 900029-2-B NM_001365 GACGAGAGTGGTCAAGGTTAA SI02626099 Hs_DLG4_5 900029-2-B NM_001394 NM_ TACCCAGAATTCTGTTCTAAA SI00374934 Hs_DUSP4_4 900029-2-B NM_001955 ACCGAGCACATTGGTGACAGA SI02627373 Hs_EDN1_5 900029-2-B NM_000399 TCCACTCTCTACAATCCGTAA SI00008785 Hs_EGR2_3 900029-2-B NM_000610 NM_ CTGGCGCAGATCGATTTGAAT SI03098123 Hs_CD44_10 900029-2-B NM_001793 CAGATGAAATCGGCAACTTTA SI02663934 Hs_CDH3_5 900029-2-B NM_005198 NM_ CTGGTAGAAGTCAGTCGGTAT SI02634639 Hs_CHKB_4 900029-2-B NM_004379 NM_ AACTGATTCCCAAAAGCGAAG SI00299901 Hs_CREB1_6 900029-2-B NM_004383 TACGCGCCTCATTAAACCAAA SI00288169 Hs_CSK_3 900029-2-B NM_001331 XM_ AAGGGTTAAGATCTATGGGAA SI00025396 Hs_CTNND1_4 900029-2-B NM_001005336 N GAGGAATGTCTACAAGGATTA SI00063392 Hs_DNM1_3 900029-2-B NM_001946 NM_ TACGGACACTATTATCACTAA SI02627338 Hs_DUSP6_5 900029-2-B NM_001402 CACCGAGACATTTAGGTGAAA SI03058230 Hs_EEF1A1_7 900029-2-B NM_004430 XM_ CAGCGACTCGGTAGTCCATTA SI03171623 Hs_EGR3_5 900029-2-B NM_000611 NM_ CAAAGCTGGGTTACAAGTGTA SI03052616 Hs_CD59_5 900029-2-B NM_001795 ACCACGAAACGTGAAGTTCAA SI00028490 Hs_CDH5_3 900029-2-B NM_001278 TTCCATAAGCTTGGTGACAAA SI00605122 Hs_CHUK_6 900029-2-B NM_005206 NM_ CAGGATGTACCGAGCACTTTA SI00073780 Hs_CRK_1 900029-2-B NM_001895 NM_ TCCATTGAAGCTGAAATGGTA SI02660497 Hs_CSNK2A1_9 900029-2-B NM_001913 NM_ CAGCGCCTGCACGATATTGAA SI00357070 Hs_CUTL1_4 900029-2-B NM_001380 CCGAGGTTACACGTTACGAAA SI00372519 Hs_DOCK1_3 900029-2-B NM_001947 TACGACTTTGTCAAGAGGAAA SI02658656 Hs_DUSP7_6 900029-2-B NM_001958 CAAGGAGAAGACCCACATCAA SI02661967 Hs_EEF1A2_6 900029-2-B NM_004431 CAGCGCCAAGTAAACAGGGTA SI02223508 Hs_EPHA2_7 900029-2-B NM_006726 CAGGCCATTCTTAATTACCTA SI00623224 Hs_LRBA_4 900029-2-B NM_001798 NM_ AACTTGCCTTAAACACTCACC SI02654631 Hs_CDK2_11 900029-2-B NM_001295 CTGGATCGACTACAAGTTGAA SI02625882 Hs_CCR1_5 900029-2-B NM_005207 CAGGTGTTTATAATTAATCCT SI00073829 Hs_CRKL_4 900029-2-B NM_001897 CACGGTGAGGGATGTAAATGA SI00355439 Hs_CSPG4_3 900029-2-B NM_001343 AAGGTTGGCCTTAGTAGTCAA SI02780316 Hs_DAB2_5 900029-2-B NM_004946 CAGGTCTATGCTGCGCTCATA SI00070343 Hs_DOCK2_3 900029-2-B NM_001395 CCGGGATTCCGCCAATTTGGA SI03191349 Hs_DUSP9_6 900029-2-B NM_001963 TACGACTAATCACCTACTCAA SI00030681 Hs_EGF_4 900029-2-B NM_001416 AGGGATGGACATCTTGTCATT SI02655842 Hs_EIF4A1_5 900029-2-B NM_001789 NM_ CTGGCCAAATAGCAAAGACAA SI02225545 Hs_CDC25A_6 900029-2-B NM_004364 CCCGGCAACTCTAGTATTTAG SI03078425 Hs_CEBPA_5 900029-2-B NM_000647 NM_ AGGGCTGTATCACATCGGTTA SI03046036 Hs_CCR2_5 900029-2-B NM_001315 NM_ CAGAGAACTGCGGTTACTTAA SI00605157 Hs_MAPK14_6 900029-2-B NM_001901 CTGATCGTTCAAAGCATGAAA SI00029687 Hs_CTGF_3 900029-2-B NM_004393 AAGGGTGTGCATTACATTTCA SI02633169 Hs_DAG1_6 900029-2-B NM_001945 GTGCTGGATTTGATGAGTTAA SI03106726 Hs_HBEGF_6 900029-2-B NM_001951 CTGGAGGTACCCATTCCAGAA SI03097276 Hs_E2F5_6 900029-2-B NM_005228 NM_ ATAGGTATTGGTGAATTTAAA SI02660147 Hs_EGFR_11 900029-2-B NM_001967 AAAGATATAAGTGCTGTATAA SI02655877 Hs_EIF4A2_5 900029-2-B NM_044472 TACAATTGTGGTTACCTTCAA SI03107965 Hs_CDC42_14 900029-2-B NM_005194 CACCCTGCGGAACTTGTTCAA SI03058062 Hs_CEBPB_7 900029-2-B NM_000579 AAGGGACATATTCATTTGGAA SI00012194 Hs_CCR5_4 900029-2-B NM_000395 AAGCATGTCTGTGATCCACCA SI03033079 Hs_CSF2RB_5 900029-2-B NM_001903 GCGAATTGTGGCAGAGTGTAA SI02663962 Hs_CTNNA1_8 900029-2-B NM_001920 NM_ TACGTGCGCTCTGCCATTCAA SI00150290 Hs_DCN_8 900029-2-B NM_004417 CAGTTGTATGTTTGCTGATTA SI00374822 Hs_DUSP1_4 900029-2-B NM_024007 AGGGTGTTGGTTAAAGTTGTA SI00375739 Hs_EBF_3 900029-2-B NM_001964 CAGGACAATTGAAATTTGCTA SI03069108 Hs_EGR1_6 900029-2-B NM_004433 CAGACTCTGACAATCATTAAA SI00378455 Hs_ELF3_3 900029-3-A NM_005229 AGGGAGTCATCTCTTCCTATA SI02662506 Hs_ELK1_7 900029-3-A NM_004439 NM_ ACCAGTTGGATCTCCAATGAA SI02223536 Hs_EPHA5_5 900029-3-A NM_001982 CCCAGTGAGAAGGCTAACAAA SI02660252 Hs_ERBB3_7 900029-3-A NM_001987 TAGCATTAAGCAGGAACGAAT SI03111038 Hs_ETV6_5 900029-3-A NM_004462 CTGGCGGTTCATGGAGAGCAA SI03098221 Hs_FDFT1_8 900029-3-A NM_002011 NM_ CAGGCTCTTCCGGCAAGTCAA SI02665306 Hs_FGFR4_6 900029-3-A NM_004119 TACGTTGATTTCAGAGAATAT SI02659615 Hs_FLT3_7 900029-3-A NM_002037 AAGAAGCAGGATGCTGATCTA SI02659545 Hs_FYN_8 900029-3-A NM_000163 CAGGTGAGCGACATTACACCA SI03072104 Hs_GHR_6 900029-3-A NM_002070 CCGGGCGGTTGTCTACAGCAA SI02780981 Hs_GNAI2_6 900029-3-A NM_005231 NM_ ATGCAACTTATTGTATCTGAA SI02662485 Hs_CTTN_6 900029-3-A NM_004440 CAGGCTGCGAAGGAAGTACTA SI02223550 Hs_EPHA7_6 900029-3-A NM_001042599 N TCGGGATTTGGCAGCCCGTAA SI02223900 Hs_ERBB4_6 900029-3-A NM_000503 NM_ CTCACCGTATCCAGCACATTA SI03088407 Hs_EYA1_10 900029-3-A NM_005246 CAGAACAACTTAGTAGGATAA SI02622067 Hs_FER_6 900029-3-A NM_001042729 N CACCACACGGGTTCAGTTCAA SI03057047 Hs_FGR_6 900029-3-A NM_002020 NM_ CACGCTCTTGGTCAACAGGAA SI02225454 Hs_FLT4_9 900029-3-A NM_001469 ACCGAGGGCGATGAAGAAGCA SI03039855 Hs_XRCC6_4 900029-3-A NM_000165 ATGCTTAGAGTGGACTATTAA SI02780491 Hs_GJA1_5 900029-3-A NM_006496 CAGATGATGCCCGGCAATTAT SI03064803 Hs_GNAI3_5 900029-3-A NM_004437 NM_ GAAGGAGTAGATATCATCCTA SI03101084 Hs_EPB41_6 900029-3-A NM_000121 CAGATGATCAGGGATCCAATA SI02780400 Hs_EPOR_6 900029-3-A NM_001432 CAGGAATATTAAGTTCTATAA SI03019387 Hs_EREG_7 900029-3-A NM_005244 NM_ TGGGTGCTTTGTGATGGATAA SI00382214 Hs_EYA2_4 900029-3-A NM_002005 CAGCCTGAGGCTGAGTACCAA SI02659496 Hs_FES_6 900029-3-A NM_004469 TTCTATGACATTGAAACACTA SI02633358 Hs_FIGF_6 900029-3-A NM_005252 TGGGTTCATTATTGGAATTAA SI02781464 Hs_FOS_6 900029-3-A NM_002039 NM_ TAGATGCTGGATTGACATTTA SI02654736 Hs_GAB1_6 900029-3-A NM_005270 NM_ TACCCGGGCTACAGTCCGCAA SI03108847 Hs_GLI2_9 900029-3-A NM_020988 NM_ CCGGGAGTATCAACTCAACGA SI03082506 Hs_GNAO1_8 900029-3-A NM_012156 NM_ CACGTTACAGTTAGCAGACGA SI02639014 Hs_EPB41L1_7 900029-3-A NM_004447 TACCTTTGTCCTGGATCGGAA SI03109302 Hs_EPS8_5 900029-3-A NM_004100 NM_ CAGCTTTAGCAAAGAACTCTT SI00059717 Hs_EYA4_4 900029-3-A NM_001990 NM_ CAGACTCAATACCAGACACTA SI03167612 Hs_EYA3_5 900029-3-A NM_000604 NM_ CCGGCCTCTATGCTTGCGTAA SI02224684 Hs_FGFR1_7 900029-3-A NM_002015 CCCGAGTTTAGTAACAGTGCA SI02781450 Hs_FOXO1A_7 900029-3-A NM_006732 TTCCTGGTTTCCGAAAGGCAA SI00091378 Hs_FOSB_4 900029-3-A NM_002046 AAGGTCGGAGTCAACGGATTT SI03571113 Hs_GAPDH_3 900029-3-A NM_000168 CTGACCGATGGAGGTAGTATA SI00003591 Hs_GLI3_4 900029-3-A NM_006142 CCGGGAGAAGGTGGAGACTGA SI02653679 Hs_SFN_6 900029-3-A NM_001431 TCCCATGCATTTAATATATTA SI00380254 Hs_EPB41L2_4 900029-3-A NM_001981 TACATCGGTAGAAACGTTGAA SI03108350 Hs_EPS15_8 900029-3-A NM_000125 GAGACTTGAATTAATAAGTGA SI02781401 Hs_ESR1_8 900029-3-A NM_004103 NM_ CAGGAGAACTTAAAGCCCAAA SI02225328 Hs_PTK2B_14 900029-3-A NM_000142 NM_ CCGATGTTATTAGATGTTACA SI00604779 Hs_FGFR3_6 900029-3-A NM_001456 GTGGAAGAAGATCCAGCAGAA SI02654722 Hs_FLNA_5 900029-3-A NM_002031 CTGGGAGTACCTAGAACCCTA SI00287427 Hs_FRK_6 900029-3-A NM_005264 NM_ TCGGTGCTTCCAGCCACATAA SI03117205 Hs_GFRA1_7 900029-3-A NM_007353 CGGCCGCGAGTTCGACCAGAA SI03086195 Hs_GNA12_5 900029-3-A NM_002086 NM_ CAAGAACTACATAGAAATGAA SI02654750 Hs_GRB2_8 900029-3-A NM_005233 TTGGATAGTTTCCTACGTAAA SI00287553 Hs_EPHA3_6 900029-3-A NM_001005862 N CACGTTTGAGTCCATGCCCAA SI02223578 Hs_ERBB2_15 900029-3-A NM_004730 TTGGAACTGCATCTAACATTA SI03244416 Hs_ETF1_5 900029-3-A NM_000569 CTGGAAGGACCATAAATTTAA SI03209913 Hs_FCGR3A_5 900029-3-A NM_000141 NM_ CAGCATATGTGTAAAGATTTA SI02665299 Hs_FGFR2_7 900029-3-A NM_002019 CACTACAGTATTAGCAAGCAA SI02627576 Hs_FLT1_6 900029-3-A NM_001010850 N AAGATCAATCCTCCATGAGTA SI03032225 Hs_FUS_5 900029-3-A NM_001497 GGCGGGAGACACTATATTCAA SI03105907 Hs_B4GALT1_6 900029-3-A NM_002069 TACGACCTGGTTCTAGCTGAA SI03109414 Hs_GNAI1_6 900029-3-A NM_001030002 N CTGGATCTGTCTCCACCTCAT SI03097598 Hs_GRB7_7 900029-3-B NM_005229 CTGCTGAGAGAGCAAGGCAAT SI00300146 Hs_ELK1_5 900029-3-B NM_004439 NM_ CCCGGCAGTATGTGTCTGTAA SI00287511 Hs_EPHA5_6 900029-3-B NM_001005915 N CTTCGTCATGTTGAACTATAA SI02660245 Hs_ERBB3_6 900029-3-B NM_001987 GCGCCACTACTACAAACTAAA SI00030996 Hs_ETV6_3 900029-3-B NM_004462 TTGAATGTTCGTAATAGTAGA SI02633330 Hs_FDFT1_6 900029-3-B NM_002011 NM_ CCGCCTGACCTTCGGACCCTA SI02659979 Hs_FGFR4_5 900029-3-B NM_004119 ACCAATTCAAGTGAAGATTAT SI00059878 Hs_FLT3_3 900029-3-B NM_002037 NM_ GTGGCCCTTTATGACTATGAA SI02654729 Hs_FYN_7 900029-3-B NM_000163 AAGTGTTAATCCAGGCCTAAA SI03037090 Hs_GHR_5 900029-3-B NM_002070 CAGCCCAAGTCCAAATGTTTA SI02780505 Hs_GNAI2_5 900029-3-B NM_005231 NM_ CACCAGGAGCATATCAACATA SI02661960 Hs_CTTN_5 900029-3-B NM_004440 ACCAGTCATGATAGTAATAGA SI02223543 Hs_EPHA7_5 900029-3-B NM_001042599 N CTACGTGTTAGTGGCTCTTAA SI02223893 Hs_ERBB4_5 900029-3-B NM_000503 NM_ AGCCGACGGGTCTTTAAACAA SI03043334 Hs_EYA1_9 900029-3-B NM_005246 CAGATAGATCCTAGTACAGAA SI00287756 Hs_FER_5 900029-3-B NM_001042729 N CACGTGGAACGGCAGCACTAA SI02634807 Hs_FGR_5 900029-3-B NM_002020 NM_ CACCGTGTGGGCTGAGTTTAA SI02225447 Hs_FLT4_8 900029-3-B NM_001469 AAGCTCTATCGGGAAACAAAT SI03033884 Hs_XRCC6_3 900029-3-B NM_000165 CAGGGAATCAAGCCATGCTTA SI00003507 Hs_GJA1_4 900029-3-B NM_006496 AAAGTGTGATTCGATCGTCAA SI00088956 Hs_GNAI3_4 900029-3-B NM_004437 NM_ TTCGAGCGTACAGCAAGTAAA SI03022698 Hs_EPB41_5 900029-3-B NM_000121 CCAGTGCAGACTCAAGACTTA SI02780351 Hs_EPOR_5 900029-3-B NM_001432 CACCATGGTATCATATATTAA SI02655863 Hs_EREG_5 900029-3-B NM_005244 NM_ AAGGCAGTTCAAGCTGTTGAA SI00382207 Hs_EYA2_3 900029-3-B NM_002005 AAGGCCAAGTTTCTACAGGAA SI02659489 Hs_FES_5 900029-3-B NM_004469 CAGGTTGTAAGTGCTTGCCAA SI02633351 Hs_FIGF_5 900029-3-B NM_005252 GACCAATATTATACTAAGAAA SI02781429 Hs_FOS_5 900029-3-B NM_002039 NM_ CCCGACCAGATTCAGTGCATA SI03077403 Hs_GAB1_7 900029-3-B NM_005270 CTCGCTAGTGGCCTACATCAA SI03091445 Hs_GLI2_8 900029-3-B NM_020988 NM_ ATGGACACTTTGGGCATCGAA SI03050523 Hs_GNAO1_7 900029-3-B NM_012156 NM_ CAGAGTCTCCGCTATGGATAA SI00160489 Hs_EPB41L1_5 900029-3-B NM_004447 CAGGTGGATGTTAGAAGTCGA SI00380751 Hs_EPS8_3 900029-3-B NM_004100 NM_ CTGGGTCAGTAATTACAAGTA SI00059710 Hs_EYA4_3 900029-3-B NM_001990 NM_ CAGTCACATAAGTATAATAAA SI00382242 Hs_EYA3_4 900029-3-B NM_000604 NM_ CAGAGATTTACCCATCGGGTA SI02224677 Hs_FGFR1_6 900029-3-B NM_002015 AACCAAGTAGCCTGTTATCAA SI02781415 Hs_FOXO1A_6 900029-3-B NM_006732 AAGGGTGCGCCGGGAACGAAA SI00091371 Hs_FOSB_3 900029-3-B NM_002046 CCGAGCCACATCGCTCAGACA SI02653266 Hs_GAPD_5 900029-3-B NM_000168 CCGCCTTATCTAGTAGCCCTA SI00003584 Hs_GLI3_3 900029-3-B NM_006142 ACCATGTTTCCTCTCAATAAA SI02653637 Hs_SFN_5 900029-3-B NM_001431 CAGGCTAAGGGTGATGCTGAA SI00380247 Hs_EPB41L2_3 900029-3-B NM_001981 TAGCCTATAAATAAATTCCAA SI02627457 Hs_EPS15_7 900029-3-B NM_000125 TCCGAGTATGATCCTACCAGA SI03114979 Hs_ESR1_11 900029-3-B NM_004103 NM_ AAGCTGATCGGCATCATTGAA SI02225321 Hs_PTK2B_13 900029-3-B NM_000142 NM_ ACCCTACGTTACCGTGCTCAA SI00604772 Hs_FGFR3_5 900029-3-B NM_001456 CACCCATGGAGTAGTGAACAA SI02655912 Hs_FLNA_7 900029-3-B NM_002031 CAGGACAGTCAAGGTGATATA SI00287420 Hs_FRK_5 900029-3-B NM_005264 NM_ AAGGCAGTGCGTGGCGGGCAA SI03035256 Hs_GFRA1_6 900029-3-B NM_007353 GTCCGTTTAACTCGATAGAAA SI00096572 Hs_GNA12_4 900029-3-B NM_002086 AAGTTTGGAAACGATGTGCAG SI00300328 Hs_GRB2_5 900029-3-B NM_005233 TCGGATATGATTGTTTCTCAA SI00287546 Hs_EPHA3_5 900029-3-B NM_001005862 N AACAAAGAAATCTTAGACGAA SI02223571 Hs_ERBB2_14 900029-3-B NM_004730 AGGGAGTATGTCTTAAATGTA SI00381346 Hs_ETF1_4 900029-3-B NM_000569 CAAGTTGCTAAGTGAACAGAA SI00386099 Hs_FCGR3A_3 900029-3-B NM_000141 NM_ TTAGTTGAGGATACCACATTA SI02623047 Hs_FGFR2_6 900029-3-B NM_002019 ACCGCATATGGTATCCCTCAA SI02627569 Hs_FLT1_5 900029-3-B NM_001010850 N ACAGGATAATTCAGACAACAA SI00070518 Hs_FUS_4 900029-3-B NM_001497 CAGAGGTTTGACCGAATTGCA SI03064250 Hs_B4GALT1_5 900029-3-B NM_002069 CGGGCGGATGATGCACGCCAA SI03087140 Hs_GNAI1_5 900029-3-B NM_001030002 N CCTGCAGAAAGTGAAGCATTA SI03083381 Hs_GRB7_6 900029-4-A NM_001001549 N CTAGATGACGGGAACACCAAA SI02780526 Hs_GRB10_6 900029-4-A NM_002111 CCCGCTGACATTTCCGTTGTA SI02662555 Hs_HD_7 900029-4-A NM_002135 NM_ CTCCAGTGGCTCTGACTACTA SI03089576 Hs_NR4A1_6 900029-4-A NM_006597 NM_ AGGAAATAACATTGCACTTTA SI03145317 Hs_HSPA8_9 900029-4-A NM_002166 TTGGACTGTGATATTCGTTAT SI03244605 Hs_ID2_6 900029-4-A NM_000206 AAGAACTCGGATAATGATAAA SI00004466 Hs_IL2RG_4 900029-4-A NM_000208 NM_ TCCGGGTACCGCGAAGGGCAA SI03115434 Hs_INSR_6 900029-4-A NM_002227 CACGGATAACATCAGCTTCAT SI00605521 Hs_JAK1_6 900029-4-A NM_001024844 N CGGCTGGGTCAGCTTCTACAA SI03086650 Hs_CD82_4 900029-4-A NM_005556 CCGCGAGGTCACCATTAACCA SI00465073 Hs_KRT7_4 900029-4-A NM_004490 XM_ CAGACCTATTTCCCAAAGCAA SI00430717 Hs_GRB14_4 900029-4-A NM_004964 CACCCGGAGGAAAGTCTGTTA SI02663472 Hs_HDAC1_6 900029-4-A NM_002136 NM_ AATCATGACTGACCGAGGCAG SI00300419 Hs_HNRPA1_1 900029-4-A NM_004134 AATTGTATTCTCCGAGTCAGA SI02654813 Hs_HSPA9B_5 900029-4-A NM_000875 CTGGACTCAGTACGCCGTTTA SI03096926 Hs_IGF1R_8 900029-4-A NM_000418 NM_ CACGTGTATCCCTGAGAACAA SI03061765 Hs_IL4R_6 900029-4-A NM_014215 CAAGATCTACTTCGCCTTCAA SI00103642 Hs_INSRR_4 900029-4-A NM_004972 CTGCCTTACGATGACAGAAAT SI02659664 Hs_JAK2_8 900029-4-A NM_002253 AAGGCTAATACAACTCTTCAA SI00605535 Hs_KDR_6 900029-4-A NM_002273 CCTGAGAGCTCTCCTCACCAA SI03083304 Hs_KRT8_8 900029-4-A NM_005312 NM_ CTGGGTCCGGTCCATAATCAT SI03099194 Hs_RAPGEF1_7 900029-4-A NM_000601 NM_ TAGCATGTCAAGTGGAGTGAA SI03111031 Hs_HGF_9 900029-4-A NM_002140 NM_ AATCTGATGCTGTGGAATGCT SI00300468 Hs_HNRPK_1 900029-4-A NM_001017963 N TGCACTGTAAGACGTATGTAA SI03117814 Hs_HSP90AA1_2 900029-4-A NM_001554 CAAGAACGTCATGATGATCCA SI03053477 Hs_CYR61_8 900029-4-A NM_002184 NM_ ATGGACCAACCCAAGTATTAA SI03050544 Hs_IL6ST_5 900029-4-A NM_005544 ACAATAGGCCATGTTAATTAA SI00078652 Hs_IRS1_4 900029-4-A NM_002228 AAGAACGTGACAGATGAGCAG SI00300580 Hs_JUN_5 900029-4-A NM_004985 NM_ AAGGAGAATTTAATAAAGATA SI02662051 Hs_KRAS2_8 900029-4-A NM_000422 TCCTTGCCTGATGACAATAAA SI03233307 Hs_KRT17_5 900029-4-A NM_002093 CTGCATTTATCGTTAACCTAA SI00605479 Hs_GSK3B_8 900029-4-A NM_004495 NM_ TGGCTGATTCTGGAGAGTATA SI03120530 Hs_NRG1_11 900029-4-A NM_005343 NM_ AGGAGCGATGACGGAATATAA SI02662576 Hs_HRAS_8 900029-4-A NM_002156 NM_ CAGGGTTTGGTGACAATAGAA SI02654162 Hs_HSPD1_8 900029-4-A NM_001556 CTGGAGAAGTACAGCGAGCAA SI02777376 Hs_IKBKB_9 900029-4-A NM_004516 NM_ CTCGCCCTTGATGCCAACAAA SI03091361 Hs_ILF3_12 900029-4-A NM_002205 AATCCTTAATGGCTCAGACAT SI02654841 Hs_ITGA5_5 900029-4-A NM_002229 CCCGACGACCACCATCAGCTA SI03077445 Hs_JUNB_5 900029-4-A NM_000424 ACGCATGTCTCTGACACCTCA SI03140788 Hs_KRT5_6 900029-4-A NM_000224 NM_ CCGCCGGATAGTGGATGGCAA SI02653658 Hs_KRT18_3 900029-4-A NM_000177 NM_ CAGCTACATCATTCTGTACAA SI02664046 Hs_GSN_6 900029-4-A NM_005338 CAGGTTAGGGTGCTAGAGCTA SI00075859 Hs_HIP1_4 900029-4-A NM_005524 CCAGATCAATGCCATGACCTA SI03075016 Hs_HES1_5 900029-4-A NM_002160 CACGCCTTATAGAGTCTCCAT SI03060232 Hs_TNC_6 900029-4-A NM_000586 GTGCACCTACTTCAAGTTCTA SI03106600 Hs_IL2_5 900029-4-A NM_001017915 N AACCTCCTTAGGGTTCGTCAA SI03029005 Hs_INPP5D_5 900029-4-A NM_000212 CACGTGTGGCCTGTTCTTCTA SI02623159 Hs_ITGB3_5 900029-4-A NM_005354 CGCGGCCGGCAGCATGATGAA SI03085201 Hs_JUND_6 900029-4-A NM_058242 TTCACTCTTTGCAATTGCTAA SI03240776 Hs_KRT6C_7 900029-4-A NM_000425 NM_ CACCCTCAAGCTGTCGCCCTA SI00009296 Hs_L1CAM_4 900029-4-A NM_002110 CCGGGATAGCGAGACCACTAA SI02665327 Hs_HCK_8 900029-4-A NM_002116 TGCCGTGATGTGGAGGAGGAA SI03236338 Hs_HLA-A_5 900029-4-A NM_005347 TGGGATAAGGAAACACTTCTA SI02781016 Hs_HSPA5_7 900029-4-A NM_002165 NM_ CCAGTCGCCAAGAATCATGAA SI03075653 Hs_ID1_7 900029-4-A NM_000878 CTGCCAGGTGTACTTTACTTA SI03094714 Hs_IL2RB_6 900029-4-A NM_001567 ACCCAAGAACAGCTTCAATAA SI00447825 Hs_INPPL1_4 900029-4-A NM_000213 NM_ AACGATGACAACCGACCTATT SI02664109 Hs_ITGB4_6 900029-4-A NM_002230 NM_ CCGCATCTCCGAGGACAAGAA SI00034741 Hs_JUP_4 900029-4-A NM_005555 CTCTCTTTAATTGCTAACCAT SI00464933 Hs_KRT6B_4 900029-4-A NM_001042771 N AGGCATCAAGTTGACCATCAA SI02635066 Hs_LCK_5 900029-4-B NM_001001549 N CCGCCGCAAAGCAGGATGTTA SI03080868 Hs_GRB10_7 900029-4-B NM_002111 CACACGCTAACTACAAGGTCA SI03055696 Hs_HD_9 900029-4-B NM_002135 NM_ CACAGGAGAGTTTGACACCTT SI03056221 Hs_NR4A1_5 900029-4-B NM_006597 NM_ AACACTGTATTGTAAGTGGAA SI03123218 Hs_HSPA8_8 900029-4-B NM_002166 AAAGTTTAGTTGTAAACTTAA SI03122518 Hs_ID2_5 900029-4-B NM_000206 CACGACAATTCTGACGCCCAA SI00004459 Hs_IL2RG_3 900029-4-B NM_000208 NM_ TTGGACGGTGGTAGACATTGA SI03024581 Hs_INSR_5 900029-4-B NM_002227 ACCGGATGAGGTTCTATTTCA SI00605514 Hs_JAK1_5 900029-4-B NM_001024844 N CGCAGGTGGGCTGGACTTCTA SI03084123 Hs_CD82_3 900029-4-B NM_005556 TGCCCTGAATGATGAGATCAA SI00465066 Hs_KRT7_3 900029-4-B NM_004490 XM_ AAGAATGTATTTCACCTGCAA SI00430710 Hs_GRB14_3 900029-4-B NM_004964 CCCGTTCTTAACTTTGAACCA SI02634149 Hs_HDAC1_5 900029-4-B NM_002136 NM_ CTCTTAAGCCATCTTGGTAAA SI03205657 Hs_HNRPA1_10 900029-4-B NM_004134 AAGAGACTTCCTGAGCAGAAA SI03128496 Hs_HSPA9B_6 900029-4-B NM_000875 TCGAAGAATCGCATCATCATA SI02624552 Hs_IGF1R_7 900029-4-B NM_000418 NM_ AAGCCCAGCGAGCATGTGAAA SI03033177 Hs_IL4R_5 900029-4-B NM_014215 CAGCTCGGATTTCGAGATCCA SI00103635 Hs_INSRR_3 900029-4-B NM_004972 AGCCATCATACGAGATCTTAA SI02659657 Hs_JAK2_7 900029-4-B NM_002253 AACGCTGACATGTACGGTCTA SI00605528 Hs_KDR_5 900029-4-B NM_002273 CACCGCAGTTACGGTCAACCA SI03058356 Hs_KRT8_7 900029-4-B NM_005312 NM_ CAGGAAAGATTTGGTGTTGTA SI02634989 Hs_RAPGEF1_5 900029-4-B NM_000601 NM_ CTGGAGTTCCATGATACCACA SI03097395 Hs_HGF_8 900029-4-B NM_002140 NM_ TTCCATTGTATGCAAATTGAA SI02650844 Hs_HNRPK_5 900029-4-B NM_001017963 N AACCCTGACCATTCCATTATT SI03028606 Hs_HSP90AA1_1 900029-4-B NM_001554 AACCCTTTACAAGGCCAGAAA SI03028655 Hs_CYR61_7 900029-4-B NM_002184 NM_ CACATTGTACATGGTACGAAT SI00033740 Hs_IL6ST_4 900029-4-B NM_005544 CCGGTATCGTTTCGCATGGAA SI00078645 Hs_IRS1_3 900029-4-B NM_002228 CCCGAGCTGGAGCGCCTGATA SI03077599 Hs_JUN_7 900029-4-B NM_004985 NM_ GTGGACGAATATGATCCAACA SI03106824 Hs_KRAS_2 900029-4-B NM_000422 CACCGTGGACAATGCCAACAT SI00464513 Hs_KRT17_4 900029-4-B NM_002093 AACACTGGTCACGTTTGGAAA SI00605472 Hs_GSK3B_7 900029-4-B NM_004495 NM_ TCGGCTGCAGGTTCCAAACTA SI03116974 Hs_NRG1_10 900029-4-B NM_005343 NM_ CACAGATGGGATCACAGTAAA SI02662030 Hs_HRAS_7 900029-4-B NM_002156 NM_ CACCACCAGATGAGAAGTTAA SI02653007 Hs_HSPD1_7 900029-4-B NM_001556 AAACCGAGTTTGGGATCACAT SI00300545 Hs_IKKB2_1 900029-4-B NM_004516 NM_ CACAACCGCCCTCCTGGACAA SI03055297 Hs_ILF3_11 900029-4-B NM_002205 CAGGGTCTACGTCTACCTGCA SI03071572 Hs_ITGA5_7 900029-4-B NM_002229 AAACACGCACTTAGTCTCTAA SI00034713 Hs_JUNB_4 900029-4-B NM_000424 AAGCCGAGTCCTGGTATCAGA SI03130414 Hs_KRT5_5 900029-4-B NM_000224 NM_ TCGCTCCACCTTCTCCACCAA SI03234091 Hs_KRT18_10 900029-4-B NM_000177 NM_ AACGATGCCTTTGTTCTGAAA SI02664039 Hs_GSN_5 900029-4-B NM_005338 CACAACAATGGGTATCCTTAA SI00075852 Hs_HIP1_3 900029-4-B NM_005524 AAAGACGAAGAGCAAGAATAA SI00078344 Hs_HES1_4 900029-4-B NM_002160 CACGATGGCTTTGCAGGCGAT SI03059987 Hs_TNC_5 900029-4-B NM_000586 CTGGAGGAAGTGCTAAATTTA SI00012271 Hs_IL2_3 900029-4-B NM_001017915 N CCCGGGACTGTTGACAGCCAA SI00078589 Hs_INPP5D_3 900029-4-B NM_000212 CAAGCTGAACCTAATAGCCAT SI00004606 Hs_ITGB3_4 900029-4-B NM_005354 CCCGCCGTTGTCGCCCATCGA SI03077956 Hs_JUND_5 900029-4-B NM_005554 NM_ CTGGAGCTTCACTGTTACTAA SI03210725 Hs_KRT6C_6 900029-4-B NM_000425 NM_ CCGCGGATACAATGTGACGTA SI00009289 Hs_L1CAM_3 900029-4-B NM_002110 CGGCAGGGAGATACCGTGAAA SI02665320 Hs_HCK_7 900029-4-B NM_002116 TAGAACCTTAGTATAAATTTA SI00438641 Hs_HLA-A_4 900029-4-B NM_005347 TAGGGTGTGTGTTCACCTTCA SI02780554 Hs_HSPA5_6 900029-4-B NM_002165 NM_ CAGTTGGAGCTGAACTCGGAA SI03073525 Hs_ID1_6 900029-4-B NM_000878 ACAGACGGCGGTGGAACCAAA SI03037664 Hs_IL2RB_5 900029-4-B NM_001567 CAAGTTCTTCATCGAGTTCTA SI00447818 Hs_INPPL1_3 900029-4-B NM_000213 NM_ GTGGATGAGTTCCGGAATAAA SI02664102 Hs_ITGB4_5 900029-4-B NM_002230 NM_ AACCATCGGCTTGATCAGGAA SI00034734 Hs_JUP_3 900029-4-B NM_005555 TCAGGAGTTCTCATCTGACAA SI00464926 Hs_KRT6B_3 900029-4-B NM_001042771 N CTACGGGACATTCACCATCAA SI00076013 Hs_LCK_4 900029-5-A NM_005565 CCGGGTGCCGATTCTCAGTAA SI02656185 Hs_LCP2_8 900029-5-A NM_001003688 N CTGGTGCTCTATTGTCTACTA SI03099824 Hs_SMAD1_9 900029-5-A NM_002393 GACCACGAGACGGGAACATTA SI03101476 Hs_MDM4_5 900029-5-A NM_002419 CCCGACGTCTGGAGGACTCAA SI02659552 Hs_MAP3K11_6 900029-5-A NM_006153 ACCGTTATGCAGAATAATCCA SI02654918 Hs_NCK1_5 900029-5-A NM_002524 CTGAGATACGTCTGTGACTTA SI02662632 Hs_NRAS_6 900029-5-A NM_004561 XM_ CAAGGCTGCCTTCAATTAGAA SI00065261 Hs_OVOL1_4 900029-5-A NM_002578 TTCCAGTACTTTGTACAGGAA SI00287434 Hs_PAK3_5 900029-5-A NM_006218 CTCCGTGAGGCTACATTAATA SI02665369 Hs_PIK3CA_8 900029-5-A NM_006221 CAGTATTTATTGTTCCCACAA SI02662667 Hs_PIN1_6 900029-5-A NM_002306 NM_ CAATACAAAGCTGGATAATAA SI02731183 Hs_LGALS3_6 900029-5-A NM_001003652 N CAGGTAATGTATCATGATCCA SI02757496 Hs_SMAD2_6 900029-5-A XM_001128827 X CTCCGGGTGTTTCAACTAGAA SI02659965 Hs_MAP3K1_11 900029-5-A NM_000902 NM_ AGGTGTGGTGTGGAACCTATA SI03046302 Hs_MME_5 900029-5-A NM_006403 NM_ CCTGACCGTCATAGAGCAGAA SI03192406 Hs_NEDD9_6 900029-5-A NM_001007204 N CTGGGAGTGGTTAGCCGGAAT SI03098697 Hs_NTRK1_6 900029-5-A NM_002567 CAGGTCTACAGTGATAGAGCA SI03246376 Hs_PEBP1_2 900029-5-A NM_005017 AAGCGCCACCTCAGAAGATAA SI00681016 Hs_PCYT1A_4 900029-5-A NM_006219 TCGGGAAGCTACCATTTCTTA SI02622221 Hs_PIK3CB_6 900029-5-A NM_005028 CTGCCCGATGGTCTTCCGTAA SI02223830 Hs_PIP5K2A_6 900029-5-A NM_005572 NM_ CCAGGAGCTTCTGGACATCAA SI02662597 Hs_LMNA_14 900029-5-A NM_005902 ATGGTGCGAGAAGGCGGTCAA SI03052126 Hs_SMAD3_5 900029-5-A NM_002401 NM_ CCACGTGTCTGTGCACCACAA SI00605619 Hs_MAP3K3_6 900029-5-A NM_002447 CAGGTCTGCGTAGATGGTGAA SI02758539 Hs_MST1R_7 900029-5-A NM_003998 GACGCCATCTATGACAGTAAA SI02662618 Hs_NFKB1_10 900029-5-A NM_001007097 N GGGCTCCTTAAGGATAACTAA SI03106173 Hs_NTRK2_7 900029-5-A NM_030979 CACGGTTCCACGGTATAAATA SI03164812 Hs_PABPC3_5 900029-5-A NM_002609 CTGCCGAGCAACTTTGATCAA SI00605745 Hs_PDGFRB_6 900029-5-A NM_005026 CGCCGTGATCGAGAAAGCCAA SI02223816 Hs_PIK3CD_6 900029-5-A NM_006224 CTGCACAATATGAGCATGCAA SI03019436 Hs_PITPNA_5 900029-5-A NM_002332 TACGACCGCATCGAGACGATA SI03109400 Hs_LRP1_5 900029-5-A NM_005905 CTGGTGCTCGGTCGCCTACTA SI03213882 Hs_SMAD9_5 900029-5-A NM_005922 NM_ CTCAAGCATCGCATAGTTTAA SI02224012 Hs_MAP3K4_6 900029-5-A NM_001018016 N CAGCAGCCTCTCTTACACAAA SI02780673 Hs_MUC1_7 900029-5-A NM_002507 CCGAGCACATAGACTCCTTTA SI03080119 Hs_NGFR_7 900029-5-A NM_001007155 N CTGGTTGGAGCGAATCTGCTA SI00605689 Hs_NTRK3_10 900029-5-A NM_000430 ATGCGCATGAACACTTTGTTA SI03152576 Hs_PAFAH1B1_5 900029-5-A NM_002613 NM_ CACGCCTAACAGGACGTATTA SI00605787 Hs_PDPK1_9 900029-5-A NM_002649 CACCTTTACTCTATAACTCAA SI00605843 Hs_PIK3CG_6 900029-5-A NM_000296 NM_ TCCGTCTTTGGCAAGACATTA SI03115560 Hs_PKD1_6 900029-5-A NM_002344 NM_ CCTGCAGATGCTTCTAATAAA SI00605563 Hs_LTK_6 900029-5-A NM_002378 NM_ GACGGATTCTAAGGACTCTAA SI00605605 Hs_MATK_10 900029-5-A NM_005923 AACGAAGCGAGCCAAGGGCAA SI02654890 Hs_MAP3K5_7 900029-5-A NM_002467 CTCGGTGCAGCCGTATTTCTA SI02662611 Hs_MYC_7 900029-5-A NM_024408 XM_ CAGCGGTGTACCATTGACATT SI03067526 Hs_NOTCH2_5 900029-5-A NM_001014796 N CACCCACAACCTATGATCCAA SI03649499 Hs_DDR2_6 900029-5-A NM_002576 TTGAAGAGAACTGCAACTGAA SI00605703 Hs_PAK1_9 900029-5-A NM_002614 AAGGCCTATGATTATTTCCAA SI00681800 Hs_PDZK1_4 900029-5-A NM_181504 NM_ TAGCTGGTTATGAACTAGTAA SI02225412 Hs_PIK3R1_6 900029-5-A NM_002660 NM_ CAAGTTCTTCTTGACAGACAA SI00041195 Hs_PLCG1_4 900029-5-A NM_002350 CGGGAAATATGGGATGTATAA SI00605577 Hs_LYN_13 900029-5-A NM_005369 GAGGTGCAATGAGCTACGTTA SI03104227 Hs_MCF2_6 900029-5-A NM_000245 CAACACCCATCCAGAATGTCA SI02654897 Hs_MET_10 900029-5-A NM_002473 CAGGAGCAGCTCCAGGCAGAA SI02654911 Hs_MYH9_6 900029-5-A NM_000272 NM_ CCAGTTAAAGCAGGCAATAGA SI03075772 Hs_NPHP1_7 900029-5-A NM_006186 NM_ TACGACACTGTCCACCTTTAA SI00085330 Hs_NR4A2_4 900029-5-A NM_002577 XM_ CCGGATCATACGAAATCAATT SI00605717 Hs_PAK2_9 900029-5-A NM_002646 CACTGTAGACTTGCTTATCTA SI02660070 Hs_PIK3C2B_6 900029-5-A NM_005027 TTGGTACGTGGGCAAGATCAA SI00287539 Hs_PIK3R2_6 900029-5-A NM_002661 GACGACGGTTGTGAATGATAA SI02662681 Hs_PLCG2_5 900029-5-B NM_005565 AAGCTGCTCTTAGAAAGATAA SI02656178 Hs_LCP2_7 900029-5-B NM_001003688 N CTCCCAATAGCAGTTACCCAA SI03089716 Hs_SMAD1_8 900029-5-B NM_002393 GACCTAAAGATGCGTATATAA SI00037163 Hs_MDM4_4 900029-5-B NM_002419 CCGGAGGAGAAACGTCTTCGA SI00605626 Hs_MAP3K11_5 900029-5-B NM_006153 AGCAGTCGTCAATAACCTAAA SI03042767 Hs_NCK1_6 900029-5-B NM_002524 AACCTGTTTGTTGGACATACT SI00300993 Hs_NRAS_5 900029-5-B NM_004561 CCGCGCGTTCCTGGTGAAGAA SI00065254 Hs_OVOL1_3 900029-5-B NM_002578 CAAGAAGGAATTAATTATTAA SI02628983 Hs_PAK3_6 900029-5-B NM_006218 CTGAGTCAGTATAAGTATATA SI02622207 Hs_PIK3CA_5 900029-5-B NM_006221 GACCGCCAGATTCTCCCTTAA SI02662128 Hs_PIN1_5 900029-5-B NM_002306 NM_ ATGCGTTATCTGGGTCTGGAA SI02707292 Hs_LGALS3_5 900029-5-B NM_001003652 N AAGCCGTCTATCAGCTAACTA SI03033275 Hs_SMAD2_8 900029-5-B XM_001128827 X CACGCATGTCAAATTCTCATA SI02659958 Hs_MAP3K1_10 900029-5-B NM_000902 NM_ CACCGTTACAAGTATACTTAT SI00018130 Hs_MME_4 900029-5-B NM_006403 NM_ CAGAAGCTCTATCAAGTGCCA SI03166898 Hs_NEDD9_5 900029-5-B NM_001007204 N CACATCATCGAGAACCCACAA SI02628836 Hs_NTRK1_5 900029-5-B NM_002567 CCGCTATGTCTGGCTGGTTTA SI03189739 Hs_PEBP1_1 900029-5-B NM_005017 CAGCTTTATCAACGAGAAGAA SI00681009 Hs_PCYT1A_3 900029-5-B NM_006219 CCCTTCGATAAGATTATTGAA SI02622214 Hs_PIK3CB_5 900029-5-B NM_005028 ATGGAATTAAGTGCCATGAAA SI02223823 Hs_PIP5K2A_5 900029-5-B NM_005572 NM_ AACTGGACTTCCAGAAGAACA SI02654862 Hs_LMNA_13 900029-5-B NM_005902 AAGGAGCACCTTGACAGACTT SI00082502 Hs_SMAD3_4 900029-5-B NM_002401 NM_ CAGGAATACTCAGATCGGGAA SI00605612 Hs_MAP3K3_5 900029-5-B NM_002447 TCCCGGTGACACAGACACAAA SI02758532 Hs_MST1R_6 900029-5-B NM_003998 CTGGGTATACTTCATGTGACA SI02662093 Hs_NFKB1_9 900029-5-B NM_001007097 N CAGCGCTTCAGTGGTTCTATA SI03067246 Hs_NTRK2_6 900029-5-B NM_030979 CTCCAACTACGCGTATGTGAA SI00676697 Hs_PABPC3_3 900029-5-B NM_002609 CCGAGCAACTTTGATCAACGA SI00605738 Hs_PDGFRB_5 900029-5-B NM_005026 CCGGTCACGCATGAAGGCAAA SI02223809 Hs_PIK3CD_5 900029-5-B NM_006224 AAGGATGGAAGAAGAGACGAA SI00685188 Hs_PITPNA_4 900029-5-B NM_002332 CTGGCTATTGACTTCCCTGAA SI00036204 Hs_LRP1_3 900029-5-B NM_005905 CAGATGAAACAAAGCAGTGAA SI00726572 Hs_SMAD9_4 900029-5-B NM_005922 NM_ CACCAATCCCTGAAAGATTAA SI02224005 Hs_MAP3K4_5 900029-5-B NM_001018016 N CTGGCCATTGTCTATCTCATT SI03097927 Hs_MUC1_8 900029-5-B NM_002507 CACAGCGGTGAGTGCTGCAAA SI03056151 Hs_NGFR_6 900029-5-B NM_001007155 N CACGGATAACTTTATCTTGTT SI00605682 Hs_NTRK3_9 900029-5-B NM_000430 CAGAATCTTCTGAACCATCTA SI00677012 Hs_PAFAH1B1_4 900029-5-B NM_002613 NM_ AAGCGGTTAGGCTGTGAGGAA SI00605780 Hs_PDPK1_8 900029-5-B NM_002649 ATCGAAGTTTGCAGAGACAAA SI00605836 Hs_PIK3CG_5 900029-5-B NM_000296 NM_ TCCGGAGGTCACCCACGCTTA SI03115287 Hs_PKD1_5 900029-5-B NM_002344 NM_ ACAGATCTTTGGAGTGCCTAA SI00605556 Hs_LTK_5 900029-5-B NM_002378 NM_ ACGGATTCTAAGGACTCTAAA SI00605598 Hs_MATK_9 900029-5-B NM_005923 CCGGGAATCTATACTCAATGA SI02224026 Hs_MAP3K5_6 900029-5-B NM_002467 GATCCCGGAGTTGGAAAACAA SI00300902 Hs_MYC_5 900029-5-B NM_024408 XM_ TTAGATGATAATGGACAACTA SI00136206 Hs_NOTCH2_3 900029-5-B NM_001014796 N AAAGAAGCGTTTCACAACAAA SI03649492 Hs_DDR2_5 900029-5-B NM_002576 TCCACTGATTGCTGCAGCTAA SI00605696 Hs_PAK1_8 900029-5-B NM_002614 XM_ ATGACTGATATTACACCTCAA SI00681793 Hs_PDZK1_3 900029-5-B NM_181504 NM_ CAGCATTAAACCAGACCTTAT SI02225405 Hs_PIK3R1_5 900029-5-B NM_002660 NM_ CACGCTCTCTTTCTGGCGGAA SI00041188 Hs_PLCG1_3 900029-5-B NM_002350 CCCGGACGACTTGTCTTTCAA SI00605570 Hs_LYN_12 900029-5-B NM_005369 CAGCGTTTGGATAGGGCACAA SI03067862 Hs_MCF2_5 900029-5-B NM_000245 CGCGCCGTGATGAATATCGAA SI00604821 Hs_MET_9 900029-5-B NM_002473 AACCGGGACGAAGCCATCAAA SI00038360 Hs_MYH9_3 900029-5-B NM_000272 NM_ CAGGGCCTTGCTGTGACAATA SI03071397 Hs_NPHP1_6 900029-5-B NM_006186 NM_ CTGGATTTAGAACATGGACTA SI00085323 Hs_NR4A2_3 900029-5-B NM_002577 XM_ CCGCGACCGGATCATACGAAA SI00605710 Hs_PAK2_8 900029-5-B NM_002646 GAGGGAGGAGCTAAACGGTTA SI02660063 Hs_PIK3C2B_5 900029-5-B NM_005027 CCGCGAGTATGACCAGCTTTA SI00287532 Hs_PIK3R2_5 900029-5-B NM_002661 GGGCGGGACCCTGAAATACTA SI03106138 Hs_PLCG2_7 900029-6-A NM_002662 TCCGAATTGATAATCTTTCAA SI03232152 Hs_PLD1_5 900029-6-A NM_006236 CACGCCAGAGCTGGCCGAGCA SI00690284 Hs_POU3F3_4 900029-6-A NM_002730 NM_ CAGAAGGTGGTGAAACTGAAA SI00605864 Hs_PRKACA_6 900029-6-A NM_006254 NM_ CAGCAGCAAGTGCAACATCAA SI02660539 Hs_PRKCD_11 900029-6-A NM_006257 CACAAGAAGTGTATTGATAAA SI03571148 Hs_PRKCQ_12 900029-6-A NM_002752 NM_ ATCGTGAACTTGTCCTCTTAA SI02222920 Hs_MAPK9_7 900029-6-A NM_005044 TTGGAATACTCTAAGAGAATA SI02223858 Hs_PRKX_6 900029-6-A NM_002827 ACGGACGTTGGTTCTGCACTA SI00043827 Hs_PTPN1_4 900029-6-A NM_002842 CACGACCATCTGGGACGGAAT SI03059588 Hs_PTPRH_6 900029-6-A NM_005052 GACATGCTTGCTGATCAGCTA SI02634310 Hs_RAC3_5 900029-6-A NM_002663 CAGCAAGGTGCTCATCGCAGA SI03065335 Hs_PLD2_6 900029-6-A NM_000307 CCCGACCAGCATTGACAAGAT SI03077410 Hs_POU3F4_7 900029-6-A NM_002731 NM_ CTGACCAATCAAGTACACTAA SI02225468 Hs_PRKACB_10 900029-6-A NM_005400 CACGGAAACACCCGTACCTTA SI02622088 Hs_PRKCE_6 900029-6-A NM_001033581 N GACCAAATTTACGCCATGAAA SI00605976 Hs_PRKCZ_6 900029-6-A NM_002753 NM_ TCCGAGCACAATAAACTCAAA SI02222934 Hs_MAPK10_6 900029-6-A NM_016335 CCGCACCTACTTCTACGCCAA SI03080518 Hs_PRODH_5 900029-6-A NM_002828 NM_ CACAAAGGAGTTACATCTTAA SI02759239 Hs_PTPN2_10 900029-6-A NM_002843 TCCGAGTATGTCTACCATTTA SI02658817 Hs_PTPRJ_6 900029-6-A NM_002880 TGGGAAATAGAAGCCAGTGAA SI02223039 Hs_RAF1_7 900029-6-A NM_000445 NM_ CCAGACTAATATATTAATATA SI02662142 Hs_PLEC1_9 900029-6-A NM_021130 NM_ TTCAAGATGACTAATGTCAAA SI00690921 Hs_PPIA_3 900029-6-A NM_002732 CTGGATCGCCATCTATGAGAA SI00605878 Hs_PRKACG_6 900029-6-A NM_002739 CTACGCCATCAAGATCTTGAA SI03087763 Hs_PRKCG_6 900029-6-A NM_001081640 N GACCCTGTTGACAGTACTTTA SI02663633 Hs_PRKDC_8 900029-6-A NM_002755 CTGGATCAAGTCCTGAAGAAA SI02222962 Hs_MAP2K1_8 900029-6-A NM_000314 AAGGCGTATACAGGAACAATA SI00301504 Hs_PTEN_6 900029-6-A NM_002831 NM_ TAGGCCCTGATGAGAACGCTA SI02658733 Hs_PTPN6_6 900029-6-A NM_002859 TCCGACTTTGATAGATTTCTA SI02757601 Hs_PXN_7 900029-6-A NM_005402 CGCGGTGCAGATTCTTCTTAA SI02662835 Hs_RALA_7 900029-6-A NM_021105 CCAGTGTATAATCAGCCAGTA SI03075751 Hs_PLSCR1_6 900029-6-A NM_002709 NM_ CACTATTGGATGTGATTCTAA SI02759204 Hs_PPP1CB_6 900029-6-A NM_002734 NM_ CTGGACCGACCTAGATTTGAA SI00605906 Hs_PRKAR1A_8 900029-6-A NM_002740 GTGCCGGTACATTTACTTAAA SI02660105 Hs_PRKCI_11 900029-6-A NM_002745 ATCATGGTAGTCACTAACATA SI00605990 Hs_MAPK1_13 900029-6-A NM_030662 CCGGCCTGCCATGGCCATCTT SI02225097 Hs_MAP2K2_6 900029-6-A NM_000958 AGGCTCTATTCCAATAAACTA SI02624699 Hs_PTGER4_6 900029-6-A NM_002834 CCGCTCATGACTATACGCTAA SI02225909 Hs_PTPN11_7 900029-6-A NM_004162 AACCCAAACTGTATGTCTTGA SI02655037 Hs_RAB5A_8 900029-6-A NM_002881 TGACGAGTTTGTAGAAGACTA SI03117492 Hs_RALB_7 900029-6-A NM_002699 CCGCCCGCGCCCTTAATTTAA SI00690228 Hs_POU3F1_4 900029-6-A NM_002714 CTCAAACGTCAGAGCAACGTA SI03088141 Hs_PPP1R10_6 900029-6-A NM_002737 TACAAGTTGCTTAACCAAGAA SI00605934 Hs_PRKCA_7 900029-6-A NM_006256 CACGTCAAAGTATGATATCTA SI02224096 Hs_PKN2_6 900029-6-A NM_001040056 N CTCCCTGACCCGTCTAATATA SI00606004 Hs_MAPK3_7 900029-6-A NM_002756 NM_ CCGGGCCACCGTGAACTCACA SI02222976 Hs_MAP2K3_6 900029-6-A NM_005607 NM_ CCGGTCGAATGATAAGGTGTA SI02622130 Hs_PTK2_10 900029-6-A NM_002835 AAGCTTAATGAGGAAATATCA SI02658768 Hs_PTPN12_8 900029-6-A NM_006908 NM_ ATGCATTTCCTGGAGAATATA SI02655051 Hs_RAC1_6 900029-6-A NM_001010935 N CAGGGCCAGAATTTAGCAAGA SI02662296 Hs_RAP1A_6 900029-6-A NM_005604 TACCCGCTTTATCGAAGGCAA SI03224683 Hs_POU3F2_6 900029-6-A NM_006243 CAGCGTATTCTGATATAGTAA SI02225846 Hs_PPP2R5A_6 900029-6-A NM_002738 NM_ CCGGATGAAACTGACCGATTT SI00605948 Hs_PRKCB1_6 900029-6-A NM_002742 AAGCGGCACATTCCCATTTAA SI00301350 Hs_PRKCM_2 900029-6-A NM_002750 NM_ ATGATGTGTCTTCAATGTCAA SI02758651 Hs_MAPK8_15 900029-6-A NM_145185 CAGGAAGAGACCAAAGTATAA SI02660588 Hs_MAP2K7_9 900029-6-A NM_005975 CTCCGCGACTCTGATGAGAAA SI03090024 Hs_PTK6_5 900029-6-A NM_002840 NM_ CATCGTGTTTGCAAAGGTTAA SI02658796 Hs_PTPRF_6 900029-6-A NM_002872 AACTATTCAGCCAATGTGATG SI02655058 Hs_RAC2_5 900029-6-A NM_001010942 N CAGTATAATGTCTTAGATTAA SI02662849 Hs_RAP1B_7 900029-6-B NM_002662 ATGGGATATTTGATTACGTAA SI00686357 Hs_PLD1_3 900029-6-B NM_006236 CGGCTCTATTGTGCACTCGGA SI00690277 Hs_POU3F3_3 900029-6-B NM_002730 NM_ CAAGGACAACTCAAACTTATA SI00605857 Hs_PRKACA_5 900029-6-B NM_006254 NM_ AACTCTACCGTGCCACGTTTT SI00301329 Hs_PRKCD_7 900029-6-B NM_006257 AACCATAGTTATTTACTTGAA SI02758623 Hs_PRKCQ_8 900029-6-B NM_002752 NM_ AAAGTCGATTTATGTGTATTA SI02222913 Hs_MAPK9_6 900029-6-B NM_005044 CGGATGGGATTCACTTAAGAA SI02223851 Hs_PRKX_5 900029-6-B NM_002827 CAGGAATAGGCATTTGCCTAA SI00043820 Hs_PTPN1_3 900029-6-B NM_002842 ATCACCGTGGATAGACTTGAA SI03046904 Hs_PTPRH_5 900029-6-B NM_005052 CCGGGAGATTGGCTCTGTGAA SI00071890 Hs_RAC3_4 900029-6-B NM_002663 TGGGCGGACGGTTCTGAACAA SI03020857 Hs_PLD2_5 900029-6-B NM_000307 CAGAAACTTCTCCAAAGTGAT SI03062675 Hs_POU3F4_6 900029-6-B NM_002731 NM_ CAGCCTGTGTAGTGTGACAAA SI02225461 Hs_PRKACB_9 900029-6-B NM_005400 CCCGACCATGGTAGTGTTCAA SI00287784 Hs_PRKCE_5 900029-6-B NM_001033581 N CGGAAGCATGACAGCATTAAA SI00605969 Hs_PRKCZ_5 900029-6-B NM_002753 NM_ CCGCATGTGTCTGTATTCATA SI02222927 Hs_MAPK10_5 900029-6-B NM_016335 CTGGCATTTGTCAGGAATATA SI00115451 Hs_PRODH_3 900029-6-B NM_002828 NM_ CCGCTGTACTTGGAAATTCGA SI02225895 Hs_PTPN2_9 900029-6-B NM_002843 TCGGGTAGAAATAACCACCAA SI02658810 Hs_PTPRJ_5 900029-6-B NM_002880 CAGATCTTAGTAAGCTATATA SI02223032 Hs_RAF1_6 900029-6-B NM_000445 NM_ CCGCCAGGTGAAGCTGGTGAA SI02654988 Hs_PLEC1_8 900029-6-B NM_021130 NM_ CAGTAATGGGTTACTTCTGAA SI00690914 Hs_PPIA_2 900029-6-B NM_002732 AACCAGCTGGATCGCCATCTA SI00605871 Hs_PRKACG_5 900029-6-B NM_002739 CCCGGAGATCATTGCCTACCA SI03078306 Hs_PRKCG_5 900029-6-B NM_001081640 N TTCGGCTAACTCGCCAGTTTA SI02224236 Hs_PRKDC_6 900029-6-B NM_002755 CTGGAAGAATTCCTGAACAAA SI02222955 Hs_MAP2K1_7 900029-6-B NM_000314 TCGACTTAGACTTGACCTATA SI03116092 Hs_PTEN_9 900029-6-B NM_002831 NM_ CCGGAACAAATGCGTCCCATA SI02658726 Hs_PTPN6_5 900029-6-B NM_002859 CCGACTGAAACTGGAACCCTT SI02757594 Hs_PXN_6 900029-6-B NM_005402 TAGGAACTCACTCTTTAGATA SI00076608 Hs_RALA_3 900029-6-B NM_021105 CAGCGCCACAGCCTCCATTAA SI03067043 Hs_PLSCR1_5 900029-6-B NM_002709 NM_ TACGAGGATGTCGTCCAGGAA SI02225762 Hs_PPP1CB_5 900029-6-B NM_002734 NM_ CAGCTAGTGCCAAATAATTGA SI00605899 Hs_PRKAR1A_7 900029-6-B NM_002740 CAGATTGTTCTTTGTTATAGA SI02660098 Hs_PRKCI_10 900029-6-B NM_002745 AACACTTGTCAAGAAGCGTTA SI00605983 Hs_MAPK1_12 900029-6-B NM_030662 CAGCATTTGCATGGAACACAT SI02225090 Hs_MAP2K2_5 900029-6-B NM_000958 ACCCATAATTGAAGTGTATAA SI02624692 Hs_PTGER4_5 900029-6-B NM_002834 CAGAAGCACAGTACCGATTTA SI02225902 Hs_PTPN11_6 900029-6-B NM_004162 ATTCATGGAGACATCCGCTAA SI00301588 Hs_RAB5A_5 900029-6-B NM_002881 CAAGGTGTTCTTTGACCTAAT SI03054793 Hs_RALB_6 900029-6-B NM_002699 CCCGCCCATGGACGATGTATA SI00690221 Hs_POU3F1_3 900029-6-B NM_002714 AAGCAATAGTCAGGAGCGATA SI03032666 Hs_PPP1R10_5 900029-6-B NM_002737 CGCAGTGGAATGAGTCCTTTA SI00605927 Hs_PRKCA_6 900029-6-B NM_006256 AAAGTATGATATCTACGCAAA SI02224089 Hs_PKN2_5 900029-6-B NM_001040056 N CCCGTCTAATATATAAATATA SI00605997 Hs_MAPK3_6 900029-6-B NM_002756 NM_ ACGGATATCCTGCATGTCCAA SI02222969 Hs_MAP2K3_5 900029-6-B NM_005607 NM_ AATCACACACCAAATTCGAGT SI00301532 Hs_PTK2_9 900029-6-B NM_002835 TTGCAGGTTATCAGAGATCAA SI02658761 Hs_PTPN12_7 900029-6-B NM_006908 NM_ CAGCACGTGTTCCCGACATAA SI03065531 Hs_RAC1_10 900029-6-B NM_001010935 N CCCAACGATAGAAGATTCCTA SI03075961 Hs_RAP1A_8 900029-6-B NM_005604 CCGCAGCGTCTAACCACTACA SI03188626 Hs_POU3F2_5 900029-6-B NM_006243 CTGTATCATGGCCATAGTATA SI02225839 Hs_PPP2R5A_5 900029-6-B NM_002738 CAAGAGCTAAGTAGATGTGTA SI00605941 Hs_PRKCB1_5 900029-6-B NM_002742 TCGATTATTTCCAGTGTTCTA SI00042378 Hs_PRKD1_3 900029-6-B NM_002750 NM_ ATGAAATGTGTTAATCACAAA SI02758644 Hs_MAPK8_14 900029-6-B NM_145185 AAAGATGACAGTGGCGATTGT SI00300720 Hs_MAP2K7_1 900029-6-B NM_005975 ACGCGTGTGCTCCTCTCCTTA SI00083314 Hs_PTK6_3 900029-6-B NM_002840 NM_ CAGCGCTATCTAGATAGGTAA SI02658789 Hs_PTPRF_5 900029-6-B NM_002872 CAATGTGATGGTGGACAGCAA SI00044947 Hs_RAC2_4 900029-6-B NM_001010942 N GACGAGTACTGTGGATGTGAA SI02662303 Hs_RAP1B_6 900029-7-A NM_021033 CCAGTGTATTCCGTCAAGTAA SI02663087 Hs_RAP2A_6 900029-7-A NM_000321 CAGGGTTGTGTCGAAATTGGA SI02653931 Hs_RB1_8 900029-7-A NM_000539 CAGCTTAGGGATAAGTGTCTA SI03068555 Hs_RHO_5 900029-7-A NM_004586 TCCAAACATTATCACTCTAAA SI00288197 Hs_RPS6KA3_6 900029-7-A NM_003010 TTGGACGAGGAGCTTATGGTT SI02655079 Hs_MAP2K4_10 900029-7-A NM_000345 NM_ ATGGATGTATTCATGAAAGGA SI03051209 Hs_SNCA_6 900029-7-A NM_006939 AAGCATTTGATCCTTATGAAA SI00729344 Hs_SOS2_4 900029-7-A NM_003131 CAAGATGGAGTTCATCGACAA SI02757622 Hs_SRF_5 900029-7-A NM_003152 AGGCACGTGGAGGAACTCTTA SI03045014 Hs_STAT5A_5 900029-7-A NM_005647 CCCGCATGTCACTTAGTCTAA SI00740432 Hs_TBL1X_4 900029-7-A NM_000964 NM_ CAGGAAATGTTGGAGAACTCA SI03068821 Hs_RARA_6 900029-7-A NM_005610 CAGCTATCCCTCTATATAATA SI02653420 Hs_RBBP4_8 900029-7-A NM_012421 CACCTTAGGATTCATTATAAA SI00703752 Hs_RLF_4 900029-7-A NM_006270 CTCGGCCAAACTGCGTCTCAA SI02663115 Hs_RRAS_6 900029-7-A NM_003027 CAAGGAGAATTAGGATTTAAA SI00717388 Hs_SH3GL3_4 900029-7-A NM_003088 CTGAGCCTTATTTCTCTGGAA SI00421813 Hs_FSCN1_4 900029-7-A NM_138473 CAGGTCAGTTGGCAGACTCTA SI03071887 Hs_SP1_8 900029-7-A NM_007107 CTCCGCGCTCTTCTTCGGAAA SI03090031 Hs_SSR3_10 900029-7-A NM_012448 ATGGGACTCAGTAGATCTTGA SI03051678 Hs_STAT5B_5 900029-7-A NM_003199 GACGACAAGAAGGATATCAAA SI03101805 Hs_TCF4_5 900029-7-A NM_000965 NM_ GAGCGTGTAATTACCTTGAAA SI00019411 Hs_RARB_4 900029-7-A NM_002893 XM_ CCGACGCAAGATGGCGAGTAA SI02664466 Hs_RBBP7_6 900029-7-A NM_002944 ACCGAGAAGGGTTAAACTATA SI02223053 Hs_ROS1_6 900029-7-A NM_001003698 N CGGAGGTGCATCAGCGAGCAA SI03195605 Hs_RREB1_6 900029-7-A NM_003029 NM_ CTGAAATTTGCTGGAATGCCA SI02655100 Hs_SHC1_11 900029-7-A NM_004597 NM_ TGCCATTGGTGTTGAGAATAA SI03236156 Hs_SNRPD2_5 900029-7-A NM_003119 NM_ AAGGTTGAAGCAGAAGAATAA SI03019695 Hs_SPG7_5 900029-7-A NM_007315 NM_ CCAGATGTCTATGATCATTTA SI02662884 Hs_STAT1_7 900029-7-A NM_003153 ACGGATAGGCAGGAACATACA SI02662905 Hs_STAT6_5 900029-7-A NM_003200 GAGCGGAACCTGAATCCCAAA SI03103086 Hs_TCF3_5 900029-7-A NM_001042728 X TCCTGTTTCGCCGGACTTGAA SI04025616 Hs_RARG_9 900029-7-A NM_000323 NM_ TAGGCTGGTTCTCAACCGGAA SI02224992 Hs_RET_10 900029-7-A NM_006013 CAGCAAAGCCTTGCAATCCCA SI02636473 Hs_RPL10_5 900029-7-A NM_000540 NM_ CCGCTATGGCCTCCTCATAAA SI00011494 Hs_RYR1_4 900029-7-A NM_005414 TTGGTTCAGGGCTCAACTAAA SI00076776 Hs_SKIL_4 900029-7-A NM_003099 NM_ GAGGGCCGCTTTAGAAAGGTA SI03104003 Hs_SNX1_7 900029-7-A NM_003127 AACGCTTCCTTGCTGACTTCC SI00301861 Hs_SPTAN1_5 900029-7-A NM_005419 AACGTTCAGGTGGTTCAGGAA SI02662891 Hs_STAT2_7 900029-7-A NM_006281 CGGCGCCTAAGAGTAAACTAA SI02622263 Hs_STK3_6 900029-7-A NM_003205 NM_ ATGGTTGGAACTCATCGGGAA SI03052231 Hs_TCF12_6 900029-7-A NM_002890 NM_ CAGACCTAATAGGTTATTACA SI00045367 Hs_RASA1_4 900029-7-A NM_005613 CTGGTCCCTCAGTGTGCCTAA SI03099600 Hs_RGS4_11 900029-7-A NM_001006665 N TGCCACGTACTCCGCACTCAA SI02223067 Hs_RPS6KA1_10 900029-7-A NM_001017369 N TTGAAGATACTTGGCACTATT SI03243149 Hs_SC4MOL_8 900029-7-A NM_003064 AAGGCTCTGGAAAGTCCTTCA SI00726404 Hs_SLPI_4 900029-7-A NM_003100 AAGTGCTGCCATGTTAGGTAA SI03135454 Hs_SNX2_5 900029-7-A NM_003129 TGGGAGACGCATATAATATGA SI03120894 Hs_SQLE_6 900029-7-A NM_003150 NM_ CAGGCTGGTAATTTATATAAT SI02662898 Hs_STAT3_8 900029-7-A NM_006282 CACCATTTGCTGTGCGAATTA SI02622277 Hs_STK4_6 900029-7-A NM_006286 CATGATGACATAGAAGTACTA SI03073868 Hs_TFDP2_6 900029-7-A NM_006506 CCGCAGTTTAATGAAATCTTT SI00698740 Hs_RASA2_4 900029-7-A NM_002928 CAGGACCATGGCACCCTTAGA SI03069178 Hs_RGS16_7 900029-7-A NM_001006932 N CCGGAGGTCCTGAAGCGTCAA SI02225006 Hs_RPS6KA2_10 900029-7-A NM_000609 NM_ GTGCATTGACCCGAAGCTAAA SI03649149 Hs_CXCL12_11 900029-7-A NM_001007468 N CTCCACAACCATCAACAGGAA SI00726824 Hs_SMARCB1_4 900029-7-A NM_005633 AAGGAGGTCCTAGGTTATAAA SI02655121 Hs_SOS1_5 900029-7-A NM_005417 NM_ CTCCATGTGCGTCCATATTTA SI02664151 Hs_SRC_10 900029-7-A NM_003151 TCAGAGGCCGTTGGTACTTAA SI00048412 Hs_STAT4_4 900029-7-A NM_003600 NM_ CACCTTCGGCATCCTAATATT SI02223305 Hs_STK6_5 900029-7-A NM_003236 CTGGCTGTCCTTATCATCACA SI03098403 Hs_TGFA_5 900029-7-B NM_021033 ACCGGCACCTTCATCGAGAAA SI03040198 Hs_RAP2A_7 900029-7-B NM_000321 CGCGTGTAAATTCTACTGCAA SI02653819 Hs_RB1_7 900029-7-B NM_000539 CCACATTTAATTAACAGCTGA SI00011466 Hs_RHO_4 900029-7-B NM_004586 AGCGCTGAGAATGGACAGCAA SI00288190 Hs_RPS6KA3_5 900029-7-B NM_003010 AGGGTGTATAGTGTTCACAAA SI02223102 Hs_MAP2K4_8 900029-7-B NM_000345 NM_ AAAGAGGGTGTTCTCTATGTA SI03026478 Hs_SNCA_5 900029-7-B NM_006939 CAGCATAATATTTGCTGCTAA SI00729337 Hs_SOS2_3 900029-7-B NM_003131 AAGGAGCGGCCTCGCCATAAA SI03034731 Hs_SRF_7 900029-7-B NM_003152 TTCGAAGTTAGGAGGACTCAA SI00048440 Hs_STAT5A_4 900029-7-B NM_005647 TAGAGTCATCCCTGTAATCAA SI00740425 Hs_TBL1X_3 900029-7-B NM_000964 NM_ CACTGAGATCTACTGGATAAA SI03062318 Hs_RARA_5 900029-7-B NM_005610 AAGACTCCTTCCAGTGATGTT SI00301658 Hs_RBBP4_5 900029-7-B NM_012421 AAGGATGAATGTAGTTCTGAA SI00703745 Hs_RLF_3 900029-7-B NM_006270 CCGGGTCACTGCTGTATATAA SI02663108 Hs_RRAS_5 900029-7-B NM_003027 CGCCTGGATTACGATTATAAA SI00717381 Hs_SH3GL3_3 900029-7-B NM_003088 CAGCTGCTACTTTGACATCGA SI00421806 Hs_FSCN1_3 900029-7-B NM_138473 ATGCCTAATATTCAGTATCAA SI03050054 Hs_SP1_7 900029-7-B NM_007107 CAGCCGCAATCTCTCGGCCAA SI03066371 Hs_SSR3_9 900029-7-B NM 012448 GCCACCCTAATTTGACATCAA SI00100415 Hs_STAT5B_4 900029-7-B NM_003199 AGCCGAATTGAAGATCGTTTA SI00048965 Hs_TCF4_4 900029-7-B NM_000965 NM_ CTGCCAGTTCAGTTAATCAAA SI00019404 Hs_RARB_3 900029-7-B NM_002893 XM_ GCGGATAAGACCGTAGCTTTA SI02664459 Hs_RBBP7_5 900029-7-B NM_002944 AAGGTAATTGCTCTAACTTTA SI02223046 Hs_ROS1_5 900029-7-B NM_001003698 N AACGCGCTTGTCCACAAACAA SI03125843 Hs_RREB1_5 900029-7-B NM_003029 NM_ AAGAGCCACCTGACCATCAGT SI00301791 Hs_SHC1_9 900029-7-B NM_004597 NM_ CCGCAACAATAAGAAACTCCT SI00728385 Hs_SNRPD2_3 900029-7-B NM_003119 NM_ GAGCGACGTGGTGGAAGTCTA SI03217753 Hs_SPG7_7 900029-7-B NM_007315 NM_ CAGAAAGAGCTTGACAGTAAA SI02662324 Hs_STAT1_6 900029-7-B NM_003153 CAGCGGCTCTATGTCGACTTT SI03067414 Hs_STAT6_6 900029-7-B NM_003200 CTGGATGATTGGGACTTTAAA SI00048993 Hs_TCF3_4 900029-7-B NM_001042728 X TACGACTGTATGGAAACGTTT SI04025609 Hs_RARG_8 900029-7-B NM_000323 NM_ CCGCTGGTGGACTGTAATAAT SI02224985 Hs_RET_9 900029-7-B NM_006013 CAGAAACAGGTTGACAACTCA SI00083685 Hs_RPL10_2 900029-7-B NM_000540 NM_ CTGGGAATGGACGATAGAGAA SI00011487 Hs_RYR1_3 900029-7-B NM_005414 AGGCAAGTAAGTCCATATCAA SI00076769 Hs_SKIL_3 900029-7-B NM_003099 NM_ CTGGGTCTTTATGAGAAGCTT SI02630250 Hs_SNX1_6 900029-7-B NM_003127 CCGGCTGCGTACGTGAAGAAA SI00048069 Hs_SPTAN1_4 900029-7-B NM_005419 TAGGCCGATTAACTACCCTAA SI02662331 Hs_STAT2_6 900029-7-B NM_006281 CCGGCGCCTAAGAGTAAACTA SI02622256 Hs_STK3_5 900029-7-B NM_003205 NM_ AACCGTGAATCTCCTAGTTAT SI03028893 Hs_TCF12_5 900029-7-B NM_002890 NM_ ACGGACCTGTCCCGTGATTTA SI00045360 Hs_RASA1_3 900029-7-B NM_005613 CTGGATTCTTGCACCAGGGAA SI03097766 Hs_RGS4_10 900029-7-B NM_001006665 N CCCAACATCATCACTCTGAAA SI02223060 Hs_RPS6KA1_9 900029-7-B NM_001017369 N CTCTCAGTATAATGCCTATAA SI03205398 Hs_SC4MOL_7 900029-7-B NM_003064 CAGTGCCTTAGATACAAGAAA SI00726397 Hs_SLPI_3 900029-7-B NM_003100 CTGGATCAGCAACTTAGGAAA SI00728840 Hs_SNX2_4 900029-7-B NM_003129 CTCGAGTACTTGTTGACATTA SI03091123 Hs_SQLE_5 900029-7-B NM_003150 NM_ CAGCCTCTCTGCAGAATTCAA SI02662338 Hs_STAT3_7 900029-7-B NM_006282 AGGATTCATAGCATCACTATA SI02622270 Hs_STK4_5 900029-7-B NM_006286 CAGAGGCGGATAGAACGGATA SI00086954 Hs_TFDP2_4 900029-7-B NM_006506 CTACCTGAAAGTAACATTAAA SI00698733 Hs_RASA2_3 900029-7-B NM_002928 CAGACTGTTCTGGGCACGGAA SI03063760 Hs_RGS16_6 900029-7-B NM_001006932 N CCGAGTGAGATCGAAGATGGA SI02224999 Hs_RPS6KA2_9 900029-7-B NM_000609 NM_ CTGAAGAACAACAACAGACAA SI03649100 Hs_CXCL12_10 900029-7-B NM_001007468 N ACCAGAGAAGTTTGCCCTGAA SI00726817 Hs_SMARCB1_3 900029-7-B NM_005633 TGGGTTGAATCCATCACTAAA SI00079807 Hs_SOS1_3 900029-7-B NM_005417 NM_ CGGCTTGTGGGTGATGTTTGA SI02223928 Hs_SRC_7 900029-7-B NM_003151 TGGAATCAAGTCCAACAGTTA SI00048405 lis_STAT4_3 900029-7-B NM_003600 NM_ TCCCAGCGCATTCCTTTGCAA SI03114111 Hs_AURKA_1 900029-7-B NM_003236 AAGCCGGTAAATGCCTCAATA SI00049448 Hs_TGFA_4 900029-8-A NM_004612 CTGCCTTATTATGATCTTGTA SI02664158 Hs_TGFBR1_9 900029-8-A NM_001032283 N CCCAGACAAGAAGATAAAGAT SI03183061 Hs_TMPO_6 900029-8-A NM_006001 NM_ TGGATTTAAGGTGGGCATTAA SI03119858 Hs_TUBA2_8 900029-8-A NM_021141 AAGCGAGTAACCAGCTCATAA SI02663773 Hs_XRCC5_7 900029-8-A NM_021915 TTGGCCATGTTTATGATTTGA SI03245186 Hs_ZNF69_8 900029-8-A NM_003559 NM_ CACGATCAATGAGCTGAGCAA SI02660133 Hs_PIP5K2B_9 900029-8-A NM_003676 NM_ TACGTATCTGGAAGTTATCAA SI03109946 Hs_DEGS1_8 900029-8-A NM_003804 CCGACATTTCCTGGCATTGAA SI02621983 Hs_RIPK1_6 900029-8-A NM_003921 CTTGTCGAACATCAAGTAGAA SI03100958 Hs_BCL10_8 900029-8-A NM_005147 ATGATTCTGTATTAATGTAAA SI00370678 Hs_DNAJA3_4 900029-8-A NM_001032282 N CCGGCGGTTCATGAGGAGTGA SI03082268 Hs_KLF10_9 900029-8-A NM_000546 AAGGAAATTTGCGTGTGGAGT SI02655170 Hs_TP53_9 900029-8-A NM_003347 NM_ CCGCACTAGTAGAGAATCCAT SI03188563 Hs_UBE2L3_5 900029-8-A NM_005433 GAGGCTCCTGCTTATTTATAA SI02223942 Hs_YES1_7 900029-8-A NM_001010972 N AAGGTGAGCAGTATTGATTTG SI00302225 Hs_ZYX_1 900029-8-A NM_003567 CCGGAACTCTGGCGTCAACTA SI03081603 Hs_BCAR3_6 900029-8-A NM_003745 TACCCAGTATCTTTGCACAAA SI03108812 Hs_SOCS1_6 900029-8-A NM_003819 AACTTTGATGTGATTAAGGGA SI00301035 Hs_PABPC4_1 900029-8-A NM_003939 NM_ CAGGATGAGCAACAACAGTAA SI02632322 Hs_BTRC_10 900029-8-A NM_004702 NM_ CTCCAAGTTGATGCTCTTAAA SI02653238 Hs_CCNE2_8 900029-8-A NM_003257 NM_ CCAGTATCTGATAATGAAGAA SI02655149 Hs_TJP1_7 900029-8-A NM_003290 CTGGCCCAACTTCATTTCCAT SI03211551 Hs_TPM4_5 900029-8-A NM_006003 TAGATAGTACGAAGTCTTCAA SI03227154 Hs_UQCRFS1_6 900029-8-A NM_003404 NM_ AAAGAGTACCGTGAGAAGATA SI03026499 Hs_YWHAB_6 900029-8-A NM_006009 AAGTTGTGGTCTGATCAGTTA SI03037251 Hs_TUBA3_5 900029-8-A NM_001004720 N GACGGGCTATGTACCGTCCAA SI03102190 Hs_NCK2_11 900029-8-A NM_001037494 N CAGAATAGCCTACATTTGTAT SI03167052 Hs_DYNLL1_3 900029-8-A NM_003852 NM_ CAGAACGGTCCAGTCACCAAA SI03062899 Hs_TRIM24_1 900029-8-A NM_003941 AACCTTAATGTAATTTACTTA SI02757692 Hs_WASL_7 900029-8-A NM_004747 CTGTGGCATATTTGTCACTAA SI00067879 Hs_DLG5_4 900029-8-A NM_005078 CACCATGAACTCGATCACAGA SI00745696 Hs_TLE3_4 900029-8-A NM_003292 CAGCGTGATATGTACCGTATT SI03172260 Hs_TPR_5 900029-8-A NM_005428 CAAGGAGAGGTTCCTCGTCTA SI03054401 Hs_VAV1_5 900029-8-A NM_006761 ACCATTAGCAAATGGAAATTA SI03038868 Hs_YWHAE_8 900029-8-A NM_001013836 N CACGCTCAGGTTGAAGGTCGA SI03060365 Hs_MAD1L1_7 900029-8-A NM_003619 CTCAGTGTAGTGGAAGTGATA SI00053830 Hs_PRSS12_4 900029-8-A NM_003749 CAGTGTATTGACGCATATTTA SI02662583 Hs_IRS2_6 900029-8-A NM_004664 CCCATTTATATCTCTCGCATA SI00066822 Hs_LIN7A_3 900029-8-A NM_003954 TACCTAGTGCATGCTCTGCAA SI02632343 Hs_MAP3K14_6 900029-8-A NM_182398 CTGGATCTCTTACGTAATTCA SI02225440 Hs_RPS6KA5_9 900029-8-A NM_006289 AACAGAGACCCCTGAAGATCC SI00301931 Hs_TLN1_5 900029-8-A NM_003299 TCGCCTCAGTTTGAACATTGA SI02663738 Hs_TRA1_9 900029-8-A NM_003371 CTGAAAGTCTGCCACGATAAA SI02662947 Hs_VAV2_6 900029-8-A NM_003406 NM_ CAATCCAAGCATAATTGTTAA SI03158295 Hs_YWHAZ_5 900029-8-A NM_003557 CCCTGCCTTGATAATATGTTA SI02223263 Hs_PIP5K1A_6 900029-8-A NM_003629 ATGAATTATGATAAATTGAAA SI02777446 Hs_PIK3R3_9 900029-8-A NM_001037283 N CCGCACTTCCATATTCTGGAA SI00377846 Hs_EIF3S9_4 900029-8-A NM_003870 AAGGAGACGTCAGAACGTGGC SI02655268 Hs_IQGAP1_5 900029-8-A NM_003955 TCGGGAGTTCCTGGACCAGTA SI00058345 Hs_SOCS3_1 900029-8-A NM_005451 NM_ CTGAGCATCGATGGCGAGAAT SI03093405 Hs_PDLIM7_10 900029-8-A NM_001001723 N TCCGAAGATGATTCACCTAGA SI03114860 Hs_TMEM1_8 900029-8-A NM_003302 CAGGAGGAGACTGTGAGAATT SI03069654 Hs_TRIP6_5 900029-8-A NM_005429 TTGCTGCAGCACATTATAATA SI02664221 Hs_VEGFC_6 900029-8-A NM_001079 NM_ CACGGAAGAGATGATGCGCGA SI03060540 Hs_ZAP70_6 900029-8-A NM_001031687 N AAGGGTTACCTTCCAGTTCAA SI03571155 Hs_PIP5K1B_7 900029-8-A NM_003639 TTCGGAAATGCCTCACATATA SI02223340 Hs_IKBKG_6 900029-8-A NM_003794 TGGCGGCGATATAGTGAATTT SI03120376 Hs_SNX4_10 900029-8-A NM_003904 TAGGAGGAAACCCAGAAATGA SI03228267 Hs_ZNF259_8 900029-8-A NM_003974 NM_ GAGTATGACAATGTTGTACTA SI03104346 Hs_DOK2_6 900029-8-A NM_004759 NM_ CTACGAGCAGATCAAGATAAA SI02223697 Hs_MAPKAPK2_5 900029-8-B NM_004612 TGGGATTGTACTATACCAGTA SI02223634 Hs_TGFBR1_7 900029-8-B NM_001032283 N TAGATGTAACAGAGCTCACTA SI03227217 Hs_TMPO_9 900029-8-B NM_006001 NM_ CAGCTGATCACCGGGAAGGAA SI03068296 Hs_TUBA2_7 900029-8-B NM_021141 AAGCATAACTATGAGTGTTTA SI02663766 Hs_XRCC5_6 900029-8-B NM_021915 TACCAACAGTTATCTCATGTA SI03224417 Hs_ZNF69_7 900029-8-B NM_003559 NM_ GCGGAGATGCACAACATCTTA SI02660126 Hs_PIP5K2B_8 900029-8-B NM_003676 NM_ ATGCGTTTGGCAGTTGCATTA SI03050201 Hs_DEGS1_7 900029-8-B NM_003804 TACCACTAGTCTGACGGATAA SI00288092 Hs_RIPK1_5 900029-8-B NM_003921 CAGAAGGAGAATCCAGCACGA SI03063144 Hs_BCL10_7 900029-8-B NM_005147 TCCGACCTCTTTATTTCTATA SI00370671 Hs_DNAJA3_3 900029-8-B NM_001032282 N AGCCCGTTGTGCAGAGTTCAA S103043236 Hs_KLF10_8 900029-8-B NM_000546 CAGAGTGCATTGTGAGGGTTA SI00011655 Hs_TP53_3 900029-8-B NM_003347 NM_ CACACTCCAGTTTGTAATAAA SI00754649 Hs_UBE2L3_3 900029-8-B NM_005433 CCAGCCTACATTCACTTCTAA SI02223935 Hs_YES1_6 900029-8-B NM_001010972 N ACCAAGAATGATCCTTTCAAA SI02651334 Hs_ZYX_5 900029-8-B NM_003567 CCGAGCGGCCACTCTGAGTAA SI03080196 Hs_BCAR3_5 900029-8-B NM_003745 TAAAGTCAGTTTAGGTAATAA SI03107342 Hs_SOCS1_5 900029-8-B NM_003819 ACGGAAATTTGAACAGTTGAA SI02651474 Hs_PABPC4_7 900029-8-B NM_003939 NM_ CACGTTGATTCACCATTGTGA SI03061807 Hs_BTRC_11 900029-8-B NM_004702 NM_ AAGAAGAGTATTAAATATATA SI02653035 Hs_CCNE2_7 900029-8-B NM_003257 NM_ AAGGATCCATATCCCGAGGAA SI03034983 Hs_TJP1_8 900029-8-B NM_003290 TTGCATATTTCCTTCATTCTA SI00750148 Hs_TPM4_4 900029-8-B NM_006003 ATGCTCAGTCATACACGCGAA SI03152765 Hs_UQCRFS1_5 900029-8-B NM_003404 NM_ CAGCAATATGTTCACTATGTT SI02631104 Hs_YWHAB_5 900029-8-B NM_006009 TCCAACCTATACTAACCTGAA SI00753305 Hs_TUBA3_3 900029-8-B NM_001004720 N GACACTAATACAGATGATTAA SI02624993 Hs_NCK2_9 900029-8-B NM_001037494 N CACACCCAGTGATCCATCCAA SI03158939 Hs_DYNLL1_2 900029-8-B NM_003852 NM_ CCGAGACTTATCTAAACCAGA SI00056805 Hs_TIF1_4 900029-8-B NM_003941 CAGATACGACAGGGTATCCAA SI02664263 Hs_WASL_6 900029-8-B NM_004747 TTGCCTGTTTGTCGACTATAA SI00067872 Hs_DLG5_3 900029-8-B NM_005078 CCCGGGCAGCCGGGATTTAAA SI00745689 Hs_TLE3_3 900029-8-B NM_003292 GAGGGTGAAGATAGTAATGAA SI00750232 Hs_TPR_4 900029-8-B NM_005428 GTCGAGGTCAAGCACATTAAA SI00077021 Hs_VAV1_4 900029-8-B NM_006761 AAGCATCTAAGAGAGAGGTTA SI03033023 Hs_YWHAE_7 900029-8-B NM_001013836 N CACGAGCAGCAGATTAAGGAT SI03059791 Hs_MAD1L1_6 900029-8-B NM_003619 AAGCGGATCATTGGTGGGAAA SI00053823 Hs_PRSS12_3 900029-8-B NM_003749 TCGCTATAGAATAATGCATTA SI02662037 Hs_IRS2_5 900029-8-B NM_004664 TTCGAGAGGTGTATCAATATA SI00066815 Hs_LIN7A_2 900029-8-B NM_003954 CACATGCATGTGACTCCTCAA SI02632336 Hs_MAP3K14_5 900029-8-B NM_004755 NM_ AAGCCAGTCATTCGAGATGAA SI02225433 Hs_RPS6KA5_8 900029-8-B NM_006289 TGGGAAAGCTTTGGACTACTA SI00086982 Hs_TLN1_4 900029-8-B NM_003299 AAGTTGATGTGGATGGTACAT SI02655177 Hs_TRA1_8 900029-8-B NM_003371 TTGGCGATGTACATCAATGAA SI02662380 Hs_VAV2_5 900029-8-B NM_003406 NM_ CAGGTTTATGTTACTTCTATT SI00764813 Hs_YWHAZ_3 900029-8-B NM_003557 CAGCCTCTTGATGTCAATCCA SI02223256 Hs_PIP5K1A_5 900029-8-B NM_003629 CAGGGCTGTAGTATTCAGTAA SI02777439 Hs_PIK3R3_8 900029-8-B NM_001037283 N CAGGTTGAACATGGAAATAAA SI00377839 Hs_EIF3S9_3 900029-8-B NM_003870 TCCTATGGTTGTGGTCCGAAA SI03115770 Hs_IQGAP1_6 900029-8-B NM_003955 CAGAAGAGCCTATTACATCTA SI03062997 Hs_SOCS3_7 900029-8-B NM_005451 NM_ AGGCACCGAGTTCATGCAAGA SI03044979 Hs_PDLIM7_9 900029-8-B NM_001001723 N CTGGTTAATAGTGATAGTTGA SI03099999 Hs_TMEM1_7 900029-8-B NM_003302 TGGGCTGCTTTGTATGTTCTA SI02630866 Hs_TRIP6_4 900029-8-B NM_005429 CACGGCTTATGCAAGCAAAGA SI03060939 Hs_VEGFC_7 900029-8-B NM_001079 NM_ CCGCAACGTCCTGCTGGTTAA SI00021672 Hs_ZAP70_3 900029-8-B NM_003558 TACACTCTATTCAAACAGCAA SI02660273 Hs_PIP5K1B_5 900029-8-B NM_003639 CTCCTCTAGTTCAGAGACATA SI02223333 Hs_IKBKG_5 900029-8-B NM_003794 AGGCGACGGATTGGTTTAGAA SI03045168 Hs_SNX4_9 900029-8-B NM_003904 CAGCTTGTGATGCAAGTGTGA SI03173331 Hs_ZNF259_7 900029-8-B NM_003974 NM_ TTGGGCTGCTTGGCTATGCAA SI03025344 Hs_DOK2_5 900029-8-B NM_004759 NM_ CGCCATCATCGATGACTACAA SI00288246 Hs_MAPKAPK2_6 900029-9-A NM_004238 CAGATGTTTCATCATTTGAAA SI04023145 Hs_TRIP12_8 900029-9-A NM_014567 AAGCAGTTTGAACGACTGGAA SI02757741 Hs_BCAR1_6 900029-9-A NM_014776 NM_ CCCGTTGATTATGCAAGGCAA SI02660420 Hs_GIT2_6 900029-9-A NM_005489 NM_ TAGGATACTGGGCGTTACCAA SI03111717 Hs_SH2D3C_6 900029-9-A NM_001010938 N CGGCAGTCAGATCCTGCATAA SI02622151 Hs_TNK2_6 900029-9-A NM_005864 NM_ CAGCACTGCACTGTTAGCTGA SI03169929 Hs_EFS_6 900029-9-A NM_006471 CGGGACTTTCTATTAATATCA SI00647976 Hs_MRCL3_4 900029-9-A NM_006826 TCGGGAGAAAGTGGAGTCCGA SI03117030 Hs_YWHAQ_8 900029-9-A NM_022105 NM_ TAGCGAAGACCAAGGGATAAA SI03111185 Hs_DIDO1_2 900029-9-A NM_014614 TAGGATTAAATTGGTTTCCTA SI00695128 Hs_PSME4_4 900029-9-A NM_000978 TCCCAGTGTCCTTTGAATCGA SI03231389 Hs_RPL23_7 900029-9-A NM_004907 CGCCGTCGAGTCGCCATGGAA SI03194079 Hs_IER2_6 900029-9-A NM_012296 NM_ CACTTGGCTACCCATCAACAA SI03062570 Hs_GAB2_8 900029-9-A NM_005490 GCCGTGATTTCTAGCAGTTGA SI03105074 Hs_SH2D3A_7 900029-9-A NM_005831 CAGGGACTGAACAAATGGAAA SI00656040 Hs_NDP52_4 900029-9-A NM_006082 CAGCTTAACTGACAGACGTTA SI02636634 Hs_K-ALPHA-1_6 900029-9-A NM_006472 AAGAGCCAATTTAACAAACTA SI03648827 Hs_TXNIP_8 900029-9-A NM_006837 CTGGACTAAGGATCACCATTA SI03096905 Hs_COPS5_7 900029-9-A NM_001042600 N TACGTGGGTGTACTCCATCAA SI02224257 Hs_MAP4K1_6 900029-9-A NM_015192 NM_ CAGAGATGATCCGGTCATATA SI02781184 Hs_PLCB1_6 900029-9-A NM_004810 CACAGTTAATGGATCTGTAAA SI00068705 Hs_GRAP2_4 900029-9-A NM_004295 NM_ CCGGAGCTGGAAGTACAAGTA SI02665159 Hs_TRAF4_8 900029-9-A NM_005112 NM_ AAAGTGCGTCATCCTAAGGAA SI03122448 Hs_WDR1_5 900029-9-A NM_005721 ATCGATGTTGGTTATGAGAGA SI02664305 Hs_ACTR3_8 900029-9-A NM_005840 CTGAAGGGAGAAGCTGAGCAA SI03206063 Hs_SPRY3_5 900029-9-A NM_006097 NM_ CACATCCAATGTCTTCGCAAT SI03159926 Hs_MYL9_5 900029-9-A NM_006576 CAGGAAATAATTTATCCACCA SI00308490 Hs_AVIL_4 900029-9-A NM_007007 ACCGTCATGACGATTATTACA SI03139563 Hs_CPSF6_5 900029-9-A NM_012250 AACAGTTAGCACGGCAGCTTA SI02662870 Hs_RRAS2_6 900029-9-A NM_012243 TCCCACTAAAGCATAGTTGTA SI03231270 Hs_SLC35A3_5 900029-9-A NM_001039583 N CACCTCGGCGGCCTTTATTTA SI02660350 Hs_PRKCABP_7 900029-9-A NM_014649 GCGGACGGTCGTGATGGATAA SI03220441 Hs_SAFB2_5 900029-9-A NM_005465 NM_ ACCAGAGGTGTTAGAAGATAA SI02757762 Hs_AKT3_12 900029-9-A NM_005749 CCAGCCTGTTATGGCTAACTA SI02663248 Hs_TOB1_7 900029-9-A NM_005841 NM_ AAGCATGAAAGGACTCATGAA SI03033030 Hs_SPRY1_8 900029-9-A NM_006098 ACCAGGGATGAGACCAACTAT SI03038651 Hs_GNB2L1_7 900029-9-A NM_006613 XM_ TGGCTTCTTCCCACGGAGTTA SI03238564 Hs_GRAP_8 900029-9-A NM_007011 NM_ TTCGTTGACTACGCCCAGAAA SI03242806 Hs_ABHD2_6 900029-9-A NM_007368 AACCTGAAGTTTGGAGATGAA SI00698768 Hs_RASA3_4 900029-9-A NM_014299 NM_ TGGCGTTTCCACGGTACCAAA SI03238361 Hs_BRD4_7 900029-9-A NM_004845 CTCAACTCGTTTATAAATAAA SI00681044 Hs_PCYT1B_4 900029-9-A NM_014715 CCTGATGAATCTACTGCTAAA SI00107702 Hs_RICS_4 900029-9-A NM_001012750 N CTAGTGTTGCTTATCAAATAA SI02655338 Hs_ABI1_5 900029-9-A NM_005760 TGGATCGATTTGTATACCGAA SI03237710 Hs_CEBPZ_7 900029-9-A NM_005842 CAGGTCCATTCTTCTGCACGA SI03071943 Hs_SPRY2_7 900029-9-A NM_001039619 N AAGAGGGAGTTCATTCAGGAA SI02657067 Hs_SKB1_6 900029-9-A NM_006614 ACCCAAGGAAATGATTATAAA SI03138058 Hs_CHL1_5 900029-9-A NM_007013 CAGTTCTATTTAACTGAATTA SI03179001 Hs_WWP1_5 900029-9-A NM_015001 CCCGATCACGCCGCAAGCGAA SI03077697 Hs_SPEN_8 900029-9-A NM_012120 TAGCAAGTCTTGTACAACGAA SI03110884 Hs_CD2AP_8 900029-9-A NM_004883 NM_ CAGCCTCAAGTCAGTGCAGGA SI03066483 Hs_NRG2_6 900029-9-A NM_014740 CCGCATCTTGGTGAAACGTGA SI02663794 Hs_DDX48_5 900029-9-A NM_006044 CACTTCGAAGCGAAATATTAA SI02757769 Hs_HDAC6_6 900029-9-A NM_001018003 N TACGTGCAGGTGTCTCGTGAA SI03225971 Hs_SORBS3_4 900029-9-A NM_005861 TACGCGAACGCCCACCCTTAA SI03109659 Hs_STUB1_5 900029-9-A NM_006113 CACGACTTTCTCGAACACCTA SI02781233 Hs_VAV3_5 900029-9-A NM_006666 CCAGGACGCCTTCCTCTTCAA SI00709268 Hs_RUVBL2_4 900029-9-A NM_007014 NM_ TACCCGCACCACCACCTTTAA SI03108826 Hs_WWP2_9 900029-9-A NM_012307 CTGCACGTTCATAACCAACAA SI03207491 Hs_EPB41L3_5 900029-9-A NM_012116 CTCACCTATGATGAGGTCCAA SI03088414 Hs_CBLC_6 900029-9-B NM_004238 CAGTGCTAGTCCAGACTACAA SI03073182 Hs_TRIP12_7 900029-9-B NM_014567 CTGGATGGAGGACTATGACTA SI02757734 Hs_BCAR1_5 900029-9-B NM_014776 NM_ CAGCGTTGAGAGTCAAGACAA SI02660413 Hs_GIT2_5 900029-9-B NM_005489 NM_ CCGGCGCTATGAGAAGTTCGA SI03082198 Hs_SH2D3C_5 900029-9-B NM_001010938 N ACGCAAGTCGTGGATGAGTAA SI02622144 Hs_TNK2_5 900029-9-B NM_005864 NM_ ACGAGCGTCAGCCTTACTCAA SI03140431 Hs_EFS_5 900029-9-B NM_006471 TTGGGCATATGTATCTTTATA SI00647969 Hs_MRCL3_3 900029-9-B NM_006826 CTGCATGAAGGCAGTGACCGA SI03094581 Hs_YWHAQ_7 900029-9-B NM_022105 NM_ CCGACTCGGTGTACTGCAGTA SI03080042 Hs_DIDO1_1 900029-9-B NM_014614 CACGTGTAGTTCTTTATTATA SI00695121 Hs_PSME4_3 900029-9-B NM_000978 GGCGTTAAAGTTCATATCCCA SI03221211 Hs_RPL23_6 900029-9-B NM_004907 AGCAAGAAAGCCCGTCTGGAA SI03143000 Hs_IER2_5 900029-9-B NM_012296 NM_ CACCAATTCTGAAGACAACTA SI02639301 Hs_GAB2_6 900029-9-B NM_005490 CAGGTGCCACAGGATGGAGAA SI03072167 Hs_SH2D3A_6 900029-9-B NM_005831 CAGCAGGAAGTCCAATTCAAA SI00656033 Hs_NDP52_3 900029-9-B NM_006082 CCCGCCCTAGTGCGTTACTTA SI02636627 Hs_K-ALPHA-1_5 900029-9-B NM_006472 TGCAACATCCTTCGAGTTGAA SI03117723 Hs_TXNIP_7 900029-9-B NM_006837 ATGCAATCGGGTGGTATCATA SI03049774 Hs_COPS5_6 900029-9-B NM_001042600 N CTGACTAAGAGTCCCAAGAAA SI02224250 Hs_MAP4K1_5 900029-9-B NM_015192 NM_ TCGAGATTACATGGATGTTAA SI02780939 Hs_PLCB1_5 900029-9-B NM_004810 CTGGTAATTAGTTGATGCAAA SI00068698 Hs_GRAP2_3 900029-9-B NM_004295 NM_ CTGCAGGAGTTCCTCAGTGAA SI02665152 Hs_TRAF4_7 900029-9-B NM_005112 NM_ CAGTAACAGTTTGCACATGAA SI00761712 Hs_WDR1_4 900029-9-B NM_005721 CCGGCTGAAATTAAGTGAGGA SI02664298 Hs_ACTR3_7 900029-9-B NM_005840 CAGGGTAGTATGAGTAAGGAA SI00732620 Hs_SPRY3_4 900029-9-B NM_006097 NM_ CGCCAAGGATAAAGACGACTA SI00653072 Hs_MYL9_4 900029-9-B NM_006576 CTGGACCAAAGTGGAACCAAA SI00308483 Hs_AVIL_3 900029-9-B NM_007007 TAGATGTAGTGTTGTAATAAA SI00353227 Hs_CPSF6_3 900029-9-B NM_012250 TAGTCCTTTCTGTGAAGCTAA SI03112340 Hs_RRAS2_9 900029-9-B NM_012243 GAGAATAAATATCAAATCTAA SI00723464 Hs_SLC35A3_4 900029-9-B NM_001039583 N TCGCCTCACCATCAAGAAGTA SI00287574 Hs_PRKCABP_5 900029-9-B NM_014649 CCGGACCTACAAATCGGTCTA SI00710080 Hs_SAFB2_4 900029-9-B NM_181690 CAGCAGGCACGTTAACTCGAA SI02622494 Hs_AKT3_8 900029-9-B NM_005749 ACCAAGTTCGGCTCTACCAAA SI03038322 Hs_TOB1_8 900029-9-B NM_005841 NM_ TTGGATAGCCGTCAGAGATTA SI03024805 Hs_SPRY1_7 900029-9-B NM_006098 TTGGCACACGCTAGAAGTTTA SI02636662 Hs_GNB2L1_5 900029-9-B NM_006613 XM_ CCGCCGTGGCGACATCATTGA SI03189088 Hs_GRAP_7 900029-9-B NM_007011 NM_ ACGATCCGTTGGTGCATGAAA SI03140557 Hs_ABHD2_5 900029-9-B NM_007368 TAGGAACTTTCTTGTCACAAA SI00698761 Hs_RASA3_3 900029-9-B NM_014299 NM_ CCGGCCTGTGAAACCTCCAAA SI03190845 Hs_BRD4_6 900029-9-B NM_004845 CCGGGTGTATCCCATGTGCAA SI00681037 Hs_PCYT1B_3 900029-9-B NM_014715 TAGGCAGTTCTGTGAGTCAAA SI00107695 Hs_RICS_3 900029-9-B NM_001012750 N GAGGGCGCTGATCGAGAGTTA SI03218754 Hs_ABI1_6 900029-9-B NM_005760 CAGTACCACACCGAAAGTAAA SI03178007 Hs_CEBPZ_6 900029-9-B NM_005842 AACCAACATAGCATCATTAAT SI02636151 Hs_SPRY2_6 900029-9-B NM_001039619 N TGGGCAAGGGATTATAATTAA SI02657060 Hs_SKB1_5 900029-9-B NM_006614 CCCAGAGATGGTCATATTTAA SI00345954 Hs_CHL1_4 900029-9-B NM_007013 AAGGATTCATTGAGCAGCATA SI00763784 Hs_WWP1_4 900029-9-B NM_015001 CAGAACTGCCTTTGCACTAAA SI02641128 Hs_SPEN_7 900029-9-B NM_012120 AAGCGTCAGTGTAAAGTTCTT SI03033681 Hs_CD2AP_7 900029-9-B NM_004883 NM_ CAGAAAGAACTCACGACTACA SI03062682 Hs_NRG2_5 900029-9-B NM_014740 ATGATTCGTCGCAGAAGCCTA SI03049676 Hs_DDX48_6 900029-9-B NM_006044 CACCGTCAACGTGGCATGGAA SI02663808 Hs_HDAC6_5 900029-9-B NM_001018003 N CGGAACGTTCCCTGGAAATTA SI03195248 Hs_SORBS3_3 900029-9-B NM_005861 CCCGAGCGCGCAGGAGCTCAA SI00081977 Hs_STUB1_3 900029-9-B NM_001079874 N ATGGACTGCGAAGAACTCCTA SI03050733 Hs_VAV3_6 900029-9-B NM_006666 AACCGTTACAGCCACAACCAA SI00709261 Hs_RUVBL2_3 900029-9-B NM_007014 NM_ CTGCGCTACTTTGACGAGAAA SI03095344 Hs_WWP2_8 900029-9-B NM_012307 TAACCTTATATTTACAATAAA SI00380282 Hs_EPB41L3_4 900029-9-B NM_012116 ATGGCCAACACTCCTCAAGAA SI03051349 Hs_CBLC_5 900029-10-A NM_012399 CACGTCGGCTGCTGATGTCTA SI03165050 Hs_PITPNB_8 900029-10-A NM_012428 NM_ CAGACTGGATATGGCGCAAGA SI03063739 Hs_NPTN_1 900029-10-A NM_001024666 N TAGCTTATATATGACGGTATA SI00287903 Hs_SH3KBP1_6 900029-10-A NM_016135 CAGCTGCTCCTTGATACCCGA SI03068387 Hs_ETV7_6 900029-10-A NM_019074 CCGGGTCATCTGCAGTGACAA SI03082653 Hs_DLL4_6 900029-10-A NM_001006600 N CAAGATGTTATCAATTGGTTA SI02778195 Hs_ERBB2IP_11 900029-10-A NM_020801 CAGAATTACACTGAAGAAGTA SI03167220 Hs_ARRDC3_5 900029-10-A NM_022165 CTCGAGGTTGAAACCACAGAT SI03091116 Hs_LIN7B_7 900029-10-A NM_024665 AAGGAGCTATCTGTTTATGTA SI00136808 Hs_TBL1XR1_1 900029-10-A NM_030637 CTGACAAAGTACGAGGTTTAA SI03206238 Hs_DDH D1_5 900029-10-A XM_001129272 X TTCGGATCGGTTTGTAATTAA SI02825263 Hs_SHC2_7 900029-10-A NM_005618 AAGGATGAGTGCGTCATAGCA SI03132836 Hs_DLL1_5 900029-10-A NM_018482 CACCTTGGATTCTTTGTTAAA SI00360598 Hs_DDEF1_4 900029-10-A NM_015878 NM_ ACACTCGCAGTTAATATCATA SI03037622 Hs_AZIN1_1 900029-10-A NM_017672 CTGCTAGCGTATATTCATAAA SI03095806 Hs_TRPM7_8 900029-10-A NM_019619 TAGGTATAGCTGACGAGACTA SI03228932 Hs_PARD3_6 900029-10-A NM_021235 TACCTCGGATCCATTCACGAA SI03109176 Hs_EPS15L1_7 900029-10-A NM_022452 CCAAGGAATCTGTGCGGGTAA SI03179960 Hs_FBS1_5 900029-10-A NM_024745 CAAGATATCCATGGTGAATAA SI00717864 Hs_SHCBP1_4 900029-10-A NM_030964 CACGAACAGCGTCATCTGCAA SI00732648 Hs_SPRY4_4 900029-10-A NM_012319 CACGAGCATCACTCTGACCAT SI03059805 Hs_SLC39A6_8 900029-10-A NM_014030 GCCGCTGAGGATGTCCCGAAA SI02622340 Hs_GIT1_6 900029-10-A NM_001037281 N CCAGGTTTCCTCAGTCATAGA SI02664340 Hs_PARD6A_5 900029-10-A NM_015975 CAGAGTATGAACCAAGGGTTA SI03168480 Hs_TAF9B_1 900029-10-A NM_017741 AAGGAAACAACTCGTACTGAA SI00397250 Hs_FLJ20280_4 900029-10-A NM_020064 AAGTGTATATGAAGTTATTTA SI00310338 Hs_BARHL1_4 900029-10-A NM_021249 NM_ CCGCGGACTTAAAGCAATAAA SI02778538 Hs_SNX6_9 900029-10-A NM_022765 CTACAGCTCGTTGACAAGAAA SI00658644 Hs_NICAL_4 900029-10-A NM_024940 AACATCCTAGACCCTGACGAA SI03123645 Hs_DOCK5_5 900029-10-A NM_031308 AGGCTTCATCATCGACCCAAA SI00380730 Hs_EPPK1_4 900029-10-A NM_001042635 N CGGGAGAAGAAGCGTCTAGAA SI00318598 Hs_C14orf120_4 900029-10-A NM_013275 CCCTCGGAGCACGAATATATA SI03186925 Hs_ANKRD11_6 900029-10-A NM_015965 CGCGGTCGGATAGTTACACTA SI00430941 Hs_GRIM19_4 900029-10-A NM_016084 GAGGGTGGATTTATCTTCTCA SI03104115 Hs_RASD1_6 900029-10-A NM_018227 AAGGGAAACATCAGTAAGAAA SI00389942 Hs_FLJ10808_4 900029-10-A NM_020066 XM_ CTGGACCAGGATTCAACTACA SI03210186 Hs_FMN2_8 900029-10-A NM_001037126 N TAGCCGAGTTGTGCAGCGTAA SI03227595 Hs_EXOC4_1 900029-10-A NM_022842 NM_ AACCCTGATGTCTGCCAACTA SI00341446 Hs_CDCP1_4 900029-10-A NM_025146 CGGCGTTGATATCGGTGGTAA SI03196508 Hs_NAT13_1 900029-10-A NM_031483 TGCCGCCGACAAATACAAATA SI03118437 Hs_ITCH_6 900029-10-A NM_015678 AAGAAATAAATTCACCAACAA SI00655480 Hs_NBEA_4 900029-10-A NM_013277 CTGGTAGATAGAAGAGCTAAA SI02639840 Hs_RACGAP1_5 900029-10-A NM_016263 CGGGTCGATCTTCCACATTCA SI00114905 Hs_FZR1_1 900029-10-A NM_016848 CTCCAAACAGATCATAGCGAA SI03199805 Hs_SHC3_5 900029-10-A NM_018362 TCAACCGTACATCAAATTATA SI02778048 Hs_LIN7C_6 900029-10-A NM_020148 TACGTGGGCTATACTGTATTA SI03226027 Hs_SPIRE1_8 900029-10-A NM_022090 AAAGAGATACCTCATATCGTA SI03121783 Hs_LOC63920_5 900029-10-A NM_024045 AAGAAATCAAGAAACAATTAA SI00361662 Hs_DDX50_4 900029-10-A XM_001130728 X TCCCAATTAGTCTGTATCTAT SI03020038 Hs_C20orf119_4 900029-10-A NM_032704 CTGTAAATGTCTATTGCCGTA SI02654071 Hs_TUBA6_3 900029-10-A NM_002568 TTAAAGCATTCCTTTCTTTAA SI03240111 Hs_PABPC1_6 900029-10-A NM_013333 CCGGAAGACGCCGGAGTCATT SI00380618 Hs_EPN1_4 900029-10-A NM_016356 AAAGTCATATAGAAATATTAA SI00360066 Hs_DCDC2_4 900029-10-A NM_018948 AACCAATTAGTTACTATCGTA SI00645792 Hs_MIG-6_4 900029-10-A NM_018440 CTGCTTGTATGAAACTGTGAA SI02643305 Hs_PAG_8 900029-10-A NM_020673 AAGGCCTATCAGCCAATTAAA SI02662737 Hs_RAB22A_6 900029-10-A NM_022101 TAGACTAGAGGCAAGCATTTA SI03226818 Hs_CXorf56_2 900029-10-A NM_024108 TGGCGGTGTTCCAGAAGCAGA SI03238319 Hs_TRAPPC6A_2 900029-10-A NM_025248 TCGCATCATCGCAGAGCTAGA SI03233727 Hs_SNIP_5 900029-10-A NM_032832 AAACATGATTCCTTTAATAAA SI00623644 Hs_LRP11_4 900029-10-B NM_012399 AAGGGACAGTATACGCACAAA SI03133788 Hs_PITPNB_7 900029-10-B NM_012428 NM_ CTGGTACATAAAGATGAGTAA SI02639672 Hs_SDFR1_9 900029-10-B NM_001024666 N CTCTGAGATCTCAATGCGAAA SI00287896 Hs_SH3KBP1_5 900029-10-B NM_016135 CACGTGCAAGCCAGATGTGAA SI03061590 Hs_ETV7_5 900029-10-B NM_019074 TTCGGGCTGTCATGAACAGAA SI03023076 Hs_DLL4_5 900029-10-B NM_001006600 N CCCGAAGAGCCAAATATAATA SI02778188 Hs_ERBB2IP_10 900029-10-B NM_020801 CACGAAAGAGATGATGATAAT SI00304598 Hs_ARRDC3_4 900029-10-B NM_022165 CTCCGCTATCCGAGAGGTGTA SI03090066 Hs_LIN7B_6 900029-10-B NM_024665 TAGCACCTTAGGGCAGCATAA SI03110905 Hs_TBL1XR1_11 900029-10-B NM_030637 CCAGGAAATACTGGAAGTCAA SI00360682 Hs_DDHD1_4 900029-10-B XM_001129272 X ACGGAACCATTTCGCCTTTAA SI02825256 Hs_SHC2_6 900029-10-B NM_005618 CCGCGTGTGCCTCAAGCACTA SI00369719 Hs_DLL1_3 900029-10-B NM_018482 CACCTTCAAGTCAATTCATAA SI00360591 Hs_DDEF1_3 900029-10-B NM_015878 NM_ CGGATTTGCTTGTTCCAGTAA SI00112322 Hs_OAZIN_4 900029-10-B NM_017672 CCTGTAAGATCTATCGTTCAA SI03083549 Hs_TRPM7_7 900029-10-B NM_019619 CAGCTTAAGAAAGGTACAGAA SI03173121 Hs_PARD3_5 900029-10-B NM_021235 CACCGCCTAAATTTCACGACA SI03058398 Hs_EPS15L1_6 900029-10-B NM_022452 CAGGCTAAGGGTGGCCAGAGA SI00385210 Hs_FBS1_4 900029-10-B NM_024745 TTGCATAATACTTGTCTTAAA SI00717857 Hs_SHCBP1_3 900029-10-B NM_030964 CTGAATGTACTGATTTAGAAA SI00732641 Hs_SPRY4_3 900029-10-B NM_012319 CTAGTTAAGGTTTAAATGCTA SI02639371 Hs_SLC39A6_6 900029-10-B NM_014030 CAGCCTTGACTTATCCGAATT SI02224467 Hs_GIT1_5 900029-10-B NM_001037281 N ATCGTCGAGGTGAAGAGCAAA SI03048619 Hs_PARD6A_6 900029-10-B NM_015975 CAGAAGTTTCATCTTAGGATA SI00739081 Hs_TAF9L_3 900029-10-B NM_017741 CAGCAAGAGTCCTAACATCTA SI00397243 Hs_FLJ20280_3 900029-10-B NM_020064 CAGGACTAAATGGAAGCGACA SI00310331 Hs_BARHL1_3 900029-10-B NM_021249 NM_ CAGGCCGAAACTTCCCAACAA SI03070424 Hs_SNX6_11 900029-10-B NM_022765 CCAGCGGTTGTCCTCCCTTAA SI00658637 Hs_NICAL_3 900029-10-B NM_024940 CACATTCAGCTTATAATGGAA SI00372666 Hs_DOCK5_4 900029-10-B NM_031308 AAGCAGGAAACCAGCAACAAA SI00380723 Hs_EPPK1_3 900029-10-B NM_001042635 N CTCTGTCATTCGTGAACTTAA SI00318591 Hs_C14orf120_3 900029-10-B NM_013275 CACGAGAGCCTTCTAATGCCA SI03163370 Hs_ANKRD11_5 900029-10-B NM_015965 AGGGATTGGAACCCTGATCTA SI00430934 Hs_GRIM19_3 900029-10-B NM_016084 CCGCAAGGTCTCGGTGCAGTA SI03080483 Hs_RASD1_5 900029-10-B NM_018227 ATGGATCTATACAACAAATAA SI00389935 Hs_FLJ10808_3 900029-10-B NM_020066 XM_ CTGATACTATCTCAAAGACGA SI03206952 Hs_FMN2_7 900029-10-B NM_001037126 N CAGCAAGAAGATGAACCTTCA SI00714301 Hs_SEC8L1_3 900029-10-B NM_022842 NM_ AAGATGCAAGAAGGAGTGAAA SI00341439 Hs_CDCP1_3 900029-10-B NM_025146 TTGGTGCAGTTAAGAATTAAA SI00627200 Hs_MAK3_4 900029-10-B NM_031483 ATGGGTAGCCTCACCATGAAA SI03051839 Hs_ITCH_5 900029-10-B NM_015678 CGGGATGTGGATGATAGCAAA SI00655473 Hs_NBEA_3 900029-10-B NM_013277 CAGGTGGATGTAGAGATCAAA SI00101178 Hs_RACGAP1_3 900029-10-B NM_016263 TGCAGTGACGCTGTCATTAAA SI00114912 Hs_FZR1_2 900029-10-B NM_016848 CAGCAAACACCTTTAAGGCAA SI00717836 Hs_SHC3_4 900029-10-B NM_018362 TGGCATATTGACCCTATATAA SI02778041 Hs_LIN7C_5 900029-10-B NM_020148 TACGAGAATCAGTCTAACAGA SI03225355 Hs_SPIRE1_7 900029-10-B NM_022090 AAGCACTAGAATATCCAGCTA SI00620284 Hs_LOC63920_4 900029-10-B NM_024045 CACAAGAATGGAACAAATCTA SI00361655 Hs_DDX50_3 900029-10-B XM_001130728 X TCCATTGACAACAAGGCTTTA SI03020031 Hs_C20orf119_3 900029-10-B NM_032704 ATTGCCGTAAATTGTTAATAA SI02653777 Hs_TUBA6_2 900029-10-B NM_002568 ATGCCAGGTCTAGCAAACATA SI03152352 Hs_PABPC1_5 900029-10-B NM_013333 CCCGACGAGTTCTCTGACTTT SI00380611 Hs_EPN1_3 900029-10-B NM_016356 AAGCACATAGTTATTGCTGAA SI00360059 Hs_DCDC2_3 900029-10-B NM_018948 TAGACTGTATTAATAAACATA SI00645785 Hs_MIG-6_3 900029-10-B NM_018440 AACAGAGAGCCTTAATCTTTA SI02643298 Hs_PAG_7 900029-10-B NM_020673 CAGGTTTAATTTGATGGTCTA SI02662184 Hs_RAB22A_5 900029-10-B NM_022101 CGGATTCCTATTTATGCCCTA SI03195731 Hs_CXorf56_1 900029-10-B NM_024108 CAGGAAGTGGGTATCAAATTG SI03173653 Hs_TRAPPC6A_1 900029-10-B NM_025248 CAGGCCACTAAACCATCTAAA SI00728161 Hs_SNIP_3 900029-10-B NM_032832 CAGCAACTCATTTATATATAT SI00623637 Hs_LRP11_3 900029-11-A NM_032876 NM_ CCCAAAGATCATGATATTCCA SI00450093 Hs_JUB_4 900029-11-A NM_001080457 X GAGCAAGAACCTGGTGCGCAA SI03102869 Hs_LRRC4B_5 900029-11-A NM_001011724 N TAGGACATGCTCCAAAGAAGA SI03228127 Hs_RP11-78J21.1_4 900029-11-A XM_209178 XM_ CCGCACCAAGCTGCAGAACAA SI02779532 Hs_LOC284393_5 900029-11-A XM_936114 GAGATGGTCTATCCTAACCAA SI02795142 Hs_LOC642045_4 900029-11-A XM_944239 XM_9 TTCAACAAAGCTACAGAGTTA SI03240524 Hs_LOC648695_4 900029-11-A XM_001130021 CACGATGGGAGGACAAGTTCA SI03533467 Hs_LOC731292_4 900029-11-A NM_001001870 N CTGGATGACAGTTGGGTGATA SI03211068 Hs_MGC14376_6 900029-11-A NM_033546 CAGGGCCAATCAATTTCACCA SI03176495 Hs_MRLC2_5 900029-11-A NM_173354 TCCACACATCATAAAGCTTTA SI02660490 Hs_SNF1LK_6 900029-11-A NM_173086 CAGGCTGAATGGCGAAGGCAT SI03175949 Hs_KRT6E_7 900029-11-A XM_931847 XM_ TTCAACAAAGCTACAGAGTTA SI03240517 Hs_LOC642954_4 900029-11-A XM_939418 CCAAGTCTGAGTGGTTGGATA SI03180002 Hs_LOC650332_4 900029-11-A XM_001129414 CAGGATACTGTTTCCTTACTA SI03528063 Hs_LOC731751_4 900029-11-A NM_031922 AACGCTCTTCAAGCTCACAAA SI03125871 Hs_REPS1_5 900029-11-A NM_153207 CTGGATGCGATAAGACATCGA SI03211145 Hs_AEBP2_5 900029-11-A NM_174907 CAAGGAGAAACTATACAGGAA SI00691628 Hs_PPP4R2_4 900029-11-A NM_020063 CTCCCTGTTCGGAGATTGATA SI03200540 Hs_BARHL2_5 900029-11-A XM_928854 XM_ TGGAGTGTTCTGCACTTACAA SI03237640 Hs_LOC643751_4 900029-11-A XM_001126093 X CCCGGCCTTCAACGAGTTCTA SI03528147 Hs_LOC649768_4 900029-11-A NM_001037954 N AACTACCGAGATTATTTGATA SI03126746 Hs_DIXDC1_5 900029-11-A NM_198450 TAGTTAAATTAGAATGGTGTA SI03229394 Hs_FAM121A_2 900029-11-A NM_001005463 AAAGTTGTAGCTAAATATTTA SI03122511 Hs_EBF3_1 900029-11-A XM_370726 XM_ ATGAAGCTCCAGGAACTTTAA SI00510405 Hs_LOC387927_4 900029-11-A XM_001129413 X CTAGAGTATGCAGCTGGTAAA SI03198174 Hs_LOC643752_4 900029-11-A XM_001128002 X CCCGGCAGGGTTGTTTCTTAA SI03515610 Hs_LOC728153_4 900029-11-A NM_033284 NM_ TTCGCTCTGAAATGGAACAAA SI03242407 Hs_TBL1Y_5 900029-11-A NM_080677 CTGCATGGACTGTATACTCGA SI00369390 Hs_Dlc2_4 900029-11-A NM_001013442 X TTGGATTACTATTAAGTGGTT SI03245004 Hs_UNQ3072_4 900029-11-A XM_371781 XM_ CCGCCTGTTGTTACCGGTATT SI03189249 Hs_LOC389342_7 900029-11-A XM_292963 CCAAGTCTGAGTGGTTGGATA SI02792762 Hs_LOC643997_4 900029-11-A XM_001126120 CAGAGTATGAACCAAGGGTTA SI03499167 Hs_LOC728198_4 900029-11-A NM_001033553 N CCAAATGTCGATGGAACATCA SI03179883 Hs_SPECC1_1 900029-11-A NM_080746 CCAGAAGATTCATATCTCCAA SI00705572 Hs_RPL10L_4 900029-11-A NM_173598 AAGGAAATCCATTACTTCAAA SI02665551 Hs_KSR2_6 900029-11-A XM_001130327 X CAAGATGAAAGAAGGCATAAA SI00529053 Hs_LOC390006_4 900029-11-A XM_928701 XM_ CATGGAATTATTGGTTATAAA SI03179596 Hs_LOC645691_4 900029-11-A XM_001129715 CACAGAAGACGAAGAGACTAT SI03530506 Hs_LOC731173_4 900029-11-B NM_032876 NM_ CTGCTAGGCAACCAAATTTAA SI00450086 Hs_JUB_3 900029-11-B NM_001080457 X CACCTCCATGACCTCCGTCAA SI00624288 Hs_LRRC4B_4 900029-11-B NM_001011724 N ATGAAGCAGCTTCATATCTAA SI03151204 Hs_RP11-78J21.1_3 900029-11-B XM_209178 XM_ TCCCTTCAGTGTGCCACTGAA SI03114790 Hs_LOC284393_8 900029-11-B XM_936114 CAGAGAAGCGCCTATTAACAA SI02795135 Hs_LOC642045_3 900029-11-B XM_939603 XM_ GACCGAATGTCTAGGATTTAA SI03216171 Hs_LOC648695_3 900029-11-B XM_001130021 ACGAACTGGTATAATGATTTA SI03533460 Hs_LOC731292_3 900029-11-B NM_001001870 N AGGAGTAGAAGGCTCAAACAA SI03145779 Hs_MGC14376_5 900029-11-B NM_033546 ACTGAAAGAACTTTAGCTAAA SI00648025 Hs_MRLC2_3 900029-11-B NM_173354 TACCTCGGACGTCTACGGAAA SI03109162 Hs_SNF1LK_9 900029-11-B NM_173086 CAGCCCTCTCATCTCCTGGAA SI03171028 Hs_KRT6E_6 900029-11-B XM_927104 XM_ GACCGAATGTCTAGGATTTAA SI03216164 Hs_LOC642954_3 900029-11-B XM_939418 CAGGTCCTGGCATATTGTCCA SI03177258 Hs_LOC650332_3 900029-11-B XM_001129414 CAACGTGTCAAGCTACTTAAA SI03528056 Hs_LOC731751_3 900029-11-B NM_031922 ATGGCTATGATTTACCAGAAA SI00701288 Hs_REPS1_4 900029-11-B NM_153207 AAGCACCTTCTTTAACAATAA SI00292880 Hs_AEBP2_4 900029-11-8 NM_174907 AAGAGGCAAATTTGCAGCAAA SI00691621 Hs_PPP4R2_3 900029-11-B NM_020063 TCCGACCACCAGCTCAATCAA SI00310366 Hs_BARHL2_4 900029-11-B XM_928854 XM_ GGCGATGGTGCTGTTAGTAAA SI03221078 Hs_LOC643751_3 900029-11-B XM_001126093 X CCCGATGGGTTTCCTAAATTT SI03528140 Hs_LOC649768_3 900029-11-B NM_001037954 N CTGCTGAAATGTAAACAAGAA SI00364259 Hs_DIXDC1_3 900029-11-B NM_198450 AAGAGTCACTCCCTAAACCTA SI03128951 Hs_FAM121A_1 900029-11-B NM_001005463 TACACTACAATTGTTAATAAA SI00368039 Hs_DKFZp667B021 900029-11-B XM_370726 XM_9 TTGGAGAATATTTCTACTACA SI00510398 Hs_LOC387927_3 900029-11-B XM_001129413 X CGCCCAGATTCAGGCGTGTAA SI03193708 Hs_LOC643752_3 900029-11-B XM_001128002 X AAAGGTAAATAAGCTCCCTAA SI03515603 Hs_LOC728153_3 900029-11-B NM_033284 NW_ CAGGAGTGTATATGTTTCATA SI00740460 Hs_TBL1Y_4 900029-11-B NM_080677 TTGACAAGAAATATAACCCTA SI00369383 Hs_Dlc2_3 900029-11-B NM_001013442 CTGCTATATAAGAAAGAGGTA SI03209052 Hs_UNQ3072_3 900029-11-B XM_371781 XM_ CACCAATAAATTCTACTAACT SI03160570 Hs_LOC389342_5 900029-11-B XM_292963 CAGGTCCTGGCATATTGTCCA SI02792755 Hs_LOC643997_3 900029-11-B XM_001126120 CAGAAGTTTCATCTTAGGATA SI03499160 Hs_LOC728198_3 900029-11-B NM_001033553 N CAGCAACAAATGGTACAGGAA SI00434777 Hs_HCMOGT-1_4 900029-11-B NM_080746 CCGTATTTGTGCCAACAAATA SI00705565 Hs_RPL10L_3 900029-11-B NM_173598 CAGGCTTACCGTGGACGCCTA SI02665544 Hs_KSR2_5 900029-11-B XM_001130327 X TTCTTCAACATTGCCATCAAT SI00529046 Hs_LOC390006_3 900029-11-B XM_928701 XM_9 ATCCTATGCAATATATCTAAA SI03149713 Hs_LOC645691_3 900029-11-B XM_001129715 TTGAACTACAGTACAGAAAGA SI03283343 Hs_LOC731173_3 indicates data missing or illegible when filed

Claims

1-30. (canceled)

31. A method for determining whether a patient will respond to EGFR/MEK-1 targeting therapy, comprising

a) isolating cancer cells from said patient;
b) determining expression levels of biomarkers listed in Table 2;
c) contacting said cells with an agent that targets EGFR/MEKL-1; and
d) determining whether said agent is effective to alter the biomarker expression levels determined in step b).

32. The method of claim 31, wherein said cancer is selected from the group consisting of colorectal cancer, HNSCC, lung cancer, pancreatic cancer, glioma, breast cancer and ovarian cancer.

33. The method of claim 31, wherein said biomarkers comprise one or more markers selected from the group consisting of ANXA6, ARF4, ARF5, ASCL2, CD59, DIXDC1, DUSP4, DUSP6, DUSP7, FER, MATK, NEDD9, PRIAP19/SLP1, PRKACB, RAPGEF1, SC4MOL and SH2DC3.

34. The method of claim 31, wherein said agent causes a cellular phenotype selected from the group consisting of morphological alterations, altered migratory properties, altered levels of apoptosis, altered angiogenic properties, and altered chromosomal or DNA integrity.

Patent History
Publication number: 20130331294
Type: Application
Filed: Jul 15, 2013
Publication Date: Dec 12, 2013
Applicant: Fox Chase Cancer Center (Jenkintown, PA)
Inventors: Igor Astsaturov (Philadelphia, PA), Erica A. Golemis (Oreland, PA), Ilya G. Serebriiskii (Rockledge, PA), Louis M. Weiner (Washington, DC)
Application Number: 13/942,032
Classifications
Current U.S. Class: By Measuring The Effect On A Living Organism, Tissue, Or Cell (506/10)
International Classification: G01N 33/50 (20060101);