HEPATITIS B VIRAL VARIANTS WITH REDUCED SUSCEPTIBILITY TO NUCLEOSIDE ANALOGS AND USES THEREOF

Info

Publication number: 20140296504
Type: Application
Filed: Nov 26, 2013
Publication Date: Oct 2, 2014
Patent Grant number: 9702005
Applicant: ABL SA (Luxembourg Ville)
Inventors: Angeline Ingrid Bartholomeusz (Carnegie), Stephen Alister Locarnini (Balaclava), Anna Ayres (Brunswick West), Danielle Colledge (Bundoora), Joseph Sasadeusz (Camberwell), Peter William Angus (East Ivanhoe), William Sievert (Canterbury)
Application Number: 14/090,808

Abstract

The present invention relates generally to viral variants exhibiting reduced sensitivity to particular agents and/or reduced interactivity with immunological reagents. More particularly, the present invention is directed to hepatitis B virus (HBV) variants exhibiting complete or partial resistance to nucleoside or nucleotide analogs and/or reduced interactivity with antibodies to viral surface components including reduced sensitivity to these antibodies. The present invention further contemplates assays for detecting such viral variants, which assays are useful in monitoring anti-viral therapeutic regimens and in developing new or modified vaccines directed against viral agents and in particular HBV variants. The present invention also contemplates the use of the viral variants to screen for and/or develop or design agents capable of inhibiting infection, replication and/or release of the virus.

Description

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a continuation under 35 USC 120 of U.S. patent application Ser. No. 12/791,621 filed Jun. 1, 2010, which is a continuation under 35 USC 120 of U.S. patent application Ser. No. 11/860,727 filed on Sep. 25, 2007 and issued as U.S. Pat. No. 7,745,130 on Jun. 29, 2010, which is a continuation under 35 USC 120 of U.S. patent application Ser. No. 11/166,004 filed on Jun. 24, 2005 and issued as U.S. Pat. No. 7,384,747 on Jun. 10, 2008, which is a continuation under 35 USC 120 of U.S. patent application Ser. No. 10/963,333 filed on Oct. 12, 2004, now abandoned, which is a continuation under 35 USC 120 of International Patent Application No. PCT/AU03/00432 filed on Apr. 11, 2003, which in turn claims priority of Australian Patent Application No. PS 1710/02 filed Apr. 12, 2002 and Australian Patent Application No. PS 3224/02 filed on Jun. 26, 2002. The disclosures of all such applications are hereby incorporated herein by reference in their respective entireties, for all purposes.

BACKGROUND OF THE INVENTION

1. Field of the Invention

The present invention relates generally to viral variants exhibiting reduced sensitivity to particular agents and/or reduced interactivity with immunological reagents. More particularly, the present invention is directed to hepatitis B virus (HBV) variants exhibiting complete or partial resistance to nucleoside or nucleotide analogs and/or reduced interactivity with antibodies to viral surface components including reduced sensitivity to these antibodies. The present invention further contemplates assays for detecting such viral variants, which assays are useful in monitoring anti-viral therapeutic regimens and in developing new or modified vaccines directed against viral agents and in particular HBV variants. The present invention also contemplates the use of the viral variants to screen for and/or develop or design agents capable of inhibiting infection, replication and/or release of the virus.

2. Description of the Prior Art

Bibliographic details of the publications referred to in this specification are also collected at the end of the description.

The reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that that prior art fowls part of the common general knowledge in any country.

Hepatitis B virus (HBV) can cause debilitating disease conditions and can lead to acute liver failure. HBV is a DNA virus which replicates via an RNA intermediate and utilizes reverse transcription in its replication strategy (Summers and Mason, Cell 29: 403-415, 1982). The HBV genome is of a complex nature having a partially double-stranded DNA structure with overlapping open reading frames encoding surface, core, polymerase and X genes. The complex nature of the HBV genome is represented in FIG. 1. The polymerase consists of four functional regions, the terminal protein (TP), spacer, reverse transcriptase (rt) and ribonuclease (RNAse).

The polymerase gene of RSV overlaps the envelope gene, mutations in the catalytic domain of the polymerase gene can also affect the nucleotide and the deduced amino acid sequence of the envelope protein and vice versa. In particular, the genetic sequence for the neutralization domain of HBV known as the ‘a’ determinant, which is found within the HBsAg and located between amino acids 99 and 169, actually overlaps the major catalytic regions of the viral polymerase protein and in particular domains A and B.

The presence of an HBV DNA polymerase has led to the proposition that nucleoside or nucleotide analogs could act as effective anti-viral agents. Examples of nucleoside analogs currently being tested are penciclovir and its oral form (FCV) [Vere Hodge, Antiviral Chem Chemother 4: 67-84, 1993; Boyd et al., Antiviral Chem Chemother. 32: 358-363, 1987; Kruger et al., Hepatology 22: 219A, 1994; Main et al., J. Viral Hepatitis 3: 211-215, 1996], Lamivudine[(−)-.beta.-2′-deoxy-3′-thiacytidine]; (3TC or LMV) [Severin et al., Antimicrobial Agents Chemother. 39: 430-435, 1995; Dienstag et al., New England J Med 333: 1657-1661, 1995]. New nucleoside or nucleotide analogs which have already progressed to clinical trials include the pyrimidines Emtricitabine, ((−)-(.beta.-L-2′-3′-dideoxy-5-fluoro-3′-thiacydidine; FTC), the 5-fluoro derivative of 3TC, and Clevudine (1-(2-fluoro-5-methyl-(1-L-arabino-furanosyl) uracil; L-FMAU), a thymidine analog: Like 3TC, these are pyrimidine derivatives with an unnatural “L”-configuration. Several purine derivatives have also progressed to clinical trials; they include Entecavir (BMS-200, 475; ETV), a carbocyclic deoxyguanosine analog, diaminopurine dioxolane (DAPD), an oral pro-drug for dioxolane guanine ((−)-3-D-2-aminopurine dioxolane; DXG) and Adefovir dipivoxil, an oral prodrug for the acyclic deoxyadenosine monophosphate nucleoside analog Adefovir (9-[phosphonyl-methoxyethyl]adenine; PMEA). Other drugs in pre-clincial and clinical trials include FLG [Medivir], ACH-126,443 (L-d4C) [Archillion Pharmaceuticals], ICN 2001-3 (ICN) and Racivir (RCV) [Pharmassett]. Whilst these agents are highly effective in inhibiting HBV DNA synthesis, there is the potential for resistant mutants of HBV to emerge during long term antiviral chemotherapy. In patients on prolonged LMV therapy, key resistance mutations are selected in the rt domain within the polymerase at rtM204I/V+/−rtL180M as well as other mutations. The nomenclature used for the polymerase mutations is in accordance with that proposed by Stuyver et al., 2001, supra. LMV is a nucleoside analog that has been approved for use against chronic HBV infection. LMV is a particularly potent inhibitor of HBV replication and reduces HBV DNA titres in the sera of chronically infected patients after orthotopic liver transplantation (OLT) by inhibiting viral DNA synthesis. LMV monotherapy seems unlikely to be able to control HBV replication in the longer term. This is because emergence of LMV-resistant strains of HBV seems almost inevitable during monotherapy.

Adefovir dipivoxil (ADV: formerly, bis-pom PMEA) is an orally available prodrug of the acyclic deoxyadenosine monophosphate analog adefovir (formerly, PMEA) (FIG. 2). ADV is also a potent inhibitor of HBV replication and has recently been given FDA approval for use against chronic HBV infection. Adefovir dipivoxil differs from other agents in this class in that it is a nucleotide (vs. nucleoside) analog and as such bypasses the first phosphorylation reaction during drug activation. This step is often rate-limiting. Adefovir dipivoxil has demonstrated clinical activity against both wild-type and lamivudine-resistant strains of HBV and is currently in phase III clinical Testing (Gilson et al, J Viral Hepat 6: 387-395, 1999; Perrino et al., Hepatology 32: 129-134, 2000; Peters et al., Transplantation 68: 1912-1914, 1999; Benhamou et al., Lancet 358: 718-723, 2001). During phase II studies a 30 mg daily dose of adefovir dipivoxil resulted in a mean 4 log₁₀decrease in viremia over 12 weeks (Heathcote et al., Hepatology 28: A620, 1998).

ADV is a substituted acyclic nucleoside phosphonate. This class of compounds also includes tenofovir disoproxil fumarate (also referred to as tenofovir DF, or tenofovir, or (TFV) or 9-R-(2-phosphonomethoxypropyl)adenine (PMPA) and is marketed as Viread by Gilead sciences).

TFV has antiviral activity against both HBV and HIV (Ying et al., J Viral Hepat. 7(2): 161-165, 2000; Ying et al., J. Viral Hepat. 7(1): 79-83, 2000; Suo et al., J Biol Chem. 273(42): 27250-27258. 1998).

FTC has activity against HBV and HIV (Frick et al., Antimicrob Agents Chemother 37: 2285-2292, 1993).

Nucleoside or nucleotide analog therapy may be administered as monotherapy or combination therapy where two or more nucleoside or nucleotide analogs may be administered. The nucleoside or nucleotide analogs may also be administered in combination with other antiviral agents such as interferon or hepatitis B immunoglobulin (HBIG).

There is a need to monitor for the emergence of nucleoside/nucleotide-analog- or antibody-resistant strains of HBV and to develop diagnostic protocols to detect these resistant viruses and/or to use them to screen for and/or develop or design agents having properties making them useful as anti-viral agents. Defective forms of these resistant strains or antigenic components therefrom are also proposed to be useful in the development of therapeutic vaccine compositions as are antibodies directed to viral surface components.

SUMMARY OF THE INVENTION

Throughout this specification, unless the context requires otherwise, the word “comprise”, or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO:). The SEQ ID NOs: correspond numerically to the sequence identifiers <400>1 (SEQ ID NO:1), <400>2 (SEQ ID NO:2), etc. A summary of the sequence identifiers is provided in Table 1. A sequence listing is provided after the claims.

Specific mutations in an amino acid sequence are represented herein as “Xaa₁nXaa₂” where Xaa₁is the original amino acid residue before mutation, n is the residue number and Xaa₂is the mutant amino acid. The abbreviation “Xaa” may be the three letter or single letter (i.e. “X”) code. An “rt” before “Xaa₁nXaa₂” means “reverse transcriptase”. An “s” means an envelope gene. The amino acid residues for HBV DNA polymerase are numbered with the residue methionine in the motif Tyr Met Asp Asp (YMDD) being residue number 204 (Stuyver et al., Hepatology 33: 751-757, 2001). The amino acid residues for hepatitis B virus surface antigen are number according to Norder et al. (J. Gen. Virol. 74: 341-1348, 1993). Both single and three letter abbreviations are used to define amino acid residues and these are summarized in Table 2.

In accordance with the present invention, the selection of HBV variants is identified in patients (Patient A, C and D) with chronic HBV infection treated with ADV and liver transplant patients (Patients B and E) treated with both ADV and LMV post-OLT or ADV post-transplant. HBV variants from Patients F, G and H were also identified following similar treatments. Variants of HBV are identified during ADV or combination ADV and LMV treatment with mutations in the HBV DNA polymerase gene which reduce the sensitivity of HBV to this nucleoside analog. Consequently, HBV rt variants are contemplated which are resistant to, or which exhibit reduced sensitivity to, ADV, LMV, TFV, FTC, ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combinations thereof. Corresponding mutations in the surface antigen also occur. The identification of these HBV variants is important for the development of assays to monitor ADV, LMV, FTC and/or TFV resistance and/or resistance to other nucleoside or nucleotide analogs or other anti-HBV agents or combinations thereof and to screen for agents which are useful as alternative therapeutic agents.

Reference herein to “anti-HBV agents” includes nucleoside and nucleotide analogs as well as immunological reagents (e.g. antibodies to HBV surface components) and chemical, proteinaceous and nucleic acid agents which inhibit or otherwise interfere with viral replication, maintenance, infection, assembly or release.

The detection of such HBV variants is particularly important in the management of therapeutic protocols including the selection of appropriate agents for treating HBV infection. The method of this aspect of the present invention is predicated in part on monitoring the development in a subject of an increased HBV load in the presence of a nucleoside or nucleotide analog or other anti-HBV agents or combinations thereof. The clinician is then able to modify an existing treatment protocol or select an appropriate treatment protocol accordingly.

Accordingly, one aspect of the present invention is directed to an isolated HBV variant comprising a nucleotide mutation in a gene encoding a DNA polymerase resulting in at least one amino acid addition, substitution and/or deletion to the DNA polymerase and which exhibits decreased sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combinations thereof. The variant HBV comprises a mutation in an overlapping open reading frame in its genome in a region defined by one or more of domains F and G and domain A through to E of HBV DNA polymerase.

Another aspect of the present invention provides an isolated HBV variant comprising a nucleotide mutation in the S gene resulting in at least one amino acid addition, substitution and/or deletion to the surface antigen and which exhibits decreased sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, or ADV and FTC and LMV and TFV, ADV and LMV and FTC, and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combinations thereof.

Useful mutants in the rt region include, in one embodiment, rtS21A, rtL122F, rtN124H, rtH126R, rtT28N, rtP130Q, rtD131N and rtY135C; in another embodiment, rt/N/S/T/I/V53D, rtY126Q, rtL180M, rtS202G, rtI204V and rtI235UM; in a further embodiment, rtN53D, rtY54H, rtS57P, rtL91I, rtS116P, rtF122L, rtY124H, rtV134D, rtY141Y/F, rtL145M, rtF151F/Y, rtA181T, rtK212R, rtL217R, rtS219A, rtN236T and rtN238D; in yet another embodiment, rtS78T, rtV84M, rtY126C, rtV191I, rtM204I and rtV214A; and in yet another embodiment, rtH90D and rtL/F108L; and in still a further embodiment, rtL157L/M, rtA181V and rtV207I and in yet a further embodiment, rtL80V, rtP109S, rtI163V, rtL229M and rtN/H/A/S/Q238K; and in another embodiment, rtS78S/T, rtN118N/S, rtN139N/K, rtV142E, rtA181A/T, rtI204M, rtQ/P/S/Stop215Q, rtE218K/E and rtN238N/H or a combination thereof or an equivalent mutation.

Other HBV variants are also contemplated with mutations in rt at rtK32, rtN33, rtP34, rtH35 and rtT37 (these are upstream of the F domain of the DNA polymerase), rtP59, rtK60, rtF61, rtA62 and rtV63 (these are located between the F and A domains), rtD83, rtV84, rtS85, rtA86, rtY89, rtH90 and rtI/L91 (these are located within the A domain and the region immediately prior to and following), rtP177, rtF178, rtL179, rtL180, rtA181, rtQ182, rtF183 and rtT184 (these are located in the B domain), rtM204 and rtY203 (these are located in the C domain), rt235, rt236, rt237, rt238 and rt239 (these are located in the D domain) and rt247, rt248, rt249, rt250 and rt251 (these are located in the E domain) or a combination thereof or an equivalent mutation.

Useful mutants are provided below (see also Tables 16 and 17):

K32M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion;

N33D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion;

P34S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion;

H35I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion;

T37W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion;

P59S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion;

K60M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion;

F61P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion;

A62R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion;

V63A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion;

D83C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/deletion;

V84A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion;

S85T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/deletion;

A86R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion;

Y89V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/deletion;

H90I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion;

I/L91K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/deletion;

P177S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion;

F178P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion;

L179K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion;

L180K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion;

A181R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion;

Q183E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/deletion;

F183P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion;

T184W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion;

Y203V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/deletion;

M204F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/deletion;

L235K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion;

N236D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion;

T237W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion;

P237S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion;

N238D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion;

H238I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion;

A238R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion;

S239T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/deletion;

Q238E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/deletion;

K239M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion;

L247K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion;

N248D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion;

H248I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion;

F249P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion;

M250F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/deletion;

G251H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/deletion; and

V251A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion.

Reference above to “deletion” means that the first mentioned amino acid before the residue number has been deleted.

Useful mutations in the S gene include, in one embodiment, sP120T, sM125T and sT127A; in another embodiment, T118R, sM133T, sF134V sI195M, sS207R and sY225Y/C; in a further embodiment, sS126T, sM133L/M, sS143S/T, sD144A sG145A and sW172Stop; in yet a further embodiment, sN40S, sC69 Stop, sM75I, sL88P, sT118A, sW182stop, sW196L, sY206H and sY225F; and in yet another embodiment, sI81M and sP214Q; and in still another embodiment, sF83S, sL173F and sW199L; and in still yet another embodiment, sI126T, sK160R, sS174N, sA184V, sW196L, sS210N, sF/C220L and sY221C; and in yet another embodiment, sC69 Stop/C, sC76Y sI110V/I, sY134N, sW172Stop/W, sW196Stop and sS207R or a combination thereof or an equivalent mutation.

The present invention further contemplates a method for determining the potential for an HBV to exhibit reduced sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combination thereof by isolating DNA or corresponding mRNA from the HBV and screening for a mutation in the nucleotide sequence encoding HBV DNA polymerase resulting in at least one amino acid substitution, deletion and/or addition in any one or more of domains F and G and domains A through to E or a region proximal thereto of the DNA polymerase and associated with resistance or decreased sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combination thereof. The presence of such a mutation is an indication of the likelihood of resistance to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combination thereof.

The present invention also provides a composition comprising a variant HBV resistant to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, or ADV and FTC and LMV and TFV, ADV and LMV and FTC, and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combination thereof or an HBV surface antigen from the variant HBV or a recombinant or derivative form thereof or its chemical equivalent and one or more pharmaceutically acceptable carriers and/or diluents.

Yet another aspect of the present invention provides a use of the aforementioned composition or a variant HBV comprising a nucleotide mutation in a gene encoding a DNA polymerase resulting in at least one amino acid addition, substitution and/or deletion to the DNA polymerase and a decreased sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combination thereof in the manufacture of a medicament for the treatment and/or prophylaxis of hepatitis B virus infection.

The present invention also contemplates a method for determining whether an HBV strain exhibits reduced sensitivity to a nucleoside or nucleotide analog or other anti-HBV agents or by isolating DNA or corresponding mRNA from the HBV and screening for a mutation in the nucleotide sequence encoding the DNA polymerase wherein the presence of the following mutations in the rt region: in one embodiment, rtS21A, rtL122F, rtN124H, rtH126R, rtT28N, rtP130Q, rtD131N and rtY135C; in another embodiment, rt/N/S/T/1/V53D, rtY126Q, rtL180M, rtS202G, rtI204V and rtI235I/M; in a further embodiment, rtN53D, rtY54H, rtS57P, rtL91I, rtS116P, rtF122L, rtY124H, rtV134D, rtY141Y/F, rtL145M, rtF151F/Y, rtA181T, rtL212R, rtL217R, rtS219A, rtN236T and rtN238D; in yet another embodiment, rtS78T, rtV84M, rtY126C, rtV191I, rtM204I and rtV214A; in still another embodiment, rtH90D and rtL/F108L, in even yet another embodiment, rtL157L/M, rtA181V and rtV207I; in still yet another embodiment, rtL80V, rtP109S, rtI163V, rtL229M and rtN/H/A/S/Q238K; in another embodiment, rtS78S/T, rtN118N/S, rtN139N/K, rtV142E, rtA181A/T, rtI204M, rtQ/P/S/Stop215Q, rtE218K/E and rtN238N/H; in a further embodiment, rtK32, rtN33, rtP34, rtH35 and rtT37; in yet another embodiment, rtP59, rtK60, rtF61, rtA62 and rtV63; in still another embodiment, rtD83, rtV84, rtS85, rtA86, rtY89, rtH90 and rtI/L91; in even yet another embodiment, rtP177, rtF178, rtL179, rtL180, rtA181, rtQ182, rtF183 and rtT184; in still yet another embodiment, rtM204 and rtY203; in another embodiment, rt235, rt236, rt237, rt238 and rt239; in a further embodiment, rt247, rt248, rt249, rt250 and rt251 or combinations thereof or an equivalent one or more other mutation is indicative of a variant which exhibits a decreased sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combination thereof.

Still a further methodology comprises screening for a mutation in the nucleotide sequence encoding the envelope genes (s) wherein the presence of the following mutations in the S gene: in one embodiment, sP120T, sM125T and sT127A; in another embodiment, sT118R, sM133T, SF134V, sI195M, sS207R and sY225Y/C; in a further embodiment, sS126T, sM133L/M, sS143S/T, sD144A, sG145A and sW172Stop in yet another embodiment, sN40S, sC69Stop, sM75I, sL88P, sT118A, sW182Stop, sW196L, sY206H and sY225F; in still yet another embodiment, s181M and sP214Q; in another embodiment, sF83S, sL173F and sW199L; in a further aspect, sI126T, sK160R, sS174N, sA184V, sW196L, sS210N, sF/C220L and sY221C; in a further embodiment, sC69Stop/C, sC76Y, sI110V/I, sY134N, sW172Stop/W, sW196Stop and sS207R or combinations thereof or an equivalent one or more other mutation is indicative of a variant which exhibits a decreased sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV, and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combination thereof.

Preferably, the variants are in an isolated form such that they have undergone at least one purification step away from naturally occurring body fluid. Alternatively, the variants may be maintained in isolated body fluid or may be in DNA form. The present invention also contemplates infectious molecular clones comprising the genome or parts thereof from a variant HBV. The detection of HBV or its components in cells, cell lysates, cultured supernatant fluid and bodily fluid may be by any convenient means including any nucleic acid-based detection means, for example, by nucleic acid hybridization techniques or via one or more polymerase chain reactions (PCBs). The term “bodily fluid” includes any fluid derived from the blood, lymph, tissue or organ systems including serum, whole blood, biopsy and biopsy fluid, organ explants and organ suspension such as liver suspensions.

Another aspect of the present invention is directed to a variant HBV comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or a truncation compared to a surface antigen from a reference or wild type HBV and wherein an antibody generated to the reference or wild type surface antigen exhibits an altered immunological profile relative to the HBV variant. One altered profile includes a reduced capacity for neutralizing the HBV. More particularly, the surface antigen of the variant HBV exhibits an altered immunological profile compared to a pre-treatment HBV where the variant HBV is selected for by a nucleoside or nucleotide analog or other anti-HBV agents of the HBV DNA polymerase. The variant HBV of this aspect of the invention may also comprise a nucleotide sequence comprising a single or multiple nucleotide substitution, addition and/or deletion compared to a pre-treatment HBV.

The present invention extends to an isolated HBsAg or a recombinant form thereof or derivative or chemical equivalent thereof corresponding to the variant HBV. Generally, the HBsAg or its recombinant or derivative form or its chemical equivalent comprises an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or a truncation compared to an HBsAg from a reference HBV and wherein an antibody directed to a reference HBV exhibits an altered immunological profile to an HBV carrying said variant HBsAg. In one embodiment, the altered immunological profile comprises a reduction in the ability to neutralize the variant HBV.

Another aspect of the present invention contemplates a method for detecting an agent which exhibits inhibitory activity to an HBV by generating a genetic construct comprising a replication competent-effective amount of the genome from the HBV contained in a plasmid vector and then transfecting said cells with said construct, contacting the cells, before, during and/or after transfection, with the agent to be tested, culturing the cells for a time and under conditions sufficient for the HBV to replicate, express genetic sequences and/or assemble and/or release virus or virus-like particles if resistant to said agents; and the subjecting the cells, cell lysates or culture supernatant fluid to viral- or viral-component-detection means to determine whether or not the virus has replicated, expressed genetic material and/or assembled and/or been released in the presence of the agent. In a preferred embodiment, the plasmid vector in a baculovirus vector and the method comprises generating a genetic construct comprising a replication competent-effective amount of the genome from the HBV contained in or fused to an amount of a baculovirus genome effective to infect cells and then infecting said cells with said construct, contacting the cells, before, during and/or after infection, with the agent to be tested, culturing the cells for a time and under conditions sufficient for the HBV to replicate, express genetic sequences and/or assemble and/or release virus or virus-like particles if resistant to said agent and then subjecting the cells, cell lysates or culture supernatant fluid to viral- or viral-component-detection means to determine whether or not the virus has replicated, expressed genetic material and/or assembled and/or been released in the presence of the agent.

In connection with these methods, the plasmid vector may include genes encoding part or all of other viral vectors such as baculovirus vectors or adenovirus vectors (see Ren and Nassal, J. Virol. 75(3): 1104-1116, 2001).

In an alternative embodiment, the method comprises generating a continuous cell line comprising an infectious copy of the genome of the HBV in a replication competent effective amount such that said infectious HBV genome is stably integrated into said continuous cell line such as but not limited to the 2.2.15 or AD cell line, contacting the cells with the agent to be tested, culturing the cells for a time and under conditions sufficient for the HBV to replicate, express genetic sequences and/or assemble and/or release virus or virus-like particles if resistant to the agent and then subjecting the cells, cell lysates or culture supernatant fluid to viral- or viral-component-detection means to determine whether or not the virus has replicated, expressed genetic material and/or assembled and/or been released in the presence of the agent.

In an alternative embodiment, the present invention also contemplates a method for detecting an agent which exhibits inhibitory activity to an HBV polymerase in an in vitro polymerase assay. The HBV polymerase activity can be examined using established assays (Gaillard et al., Antimicrob Agents Chemother. 46(4): 1005-1013, 2002; Xiong et al., Hepatology. 28(6): 1669-73, 1998). The HBV polymerase may be a wild-type or reference HBV polymerase or mutant HBV polymerase.

The identification of viral variants enables the production of vaccines comprising particular recombinant viral components such as polymerases or envelope genes PreS 1, PreS2, S encoding for L, M, S proteins as well as therapeutic vaccines comprising defective HBV variants. Rational drug design may also be employed to identify or generate therapeutic molecules capable of interacting with a polymerase or envelope genes PreS1, PreS2, S encoding for L, M, S proteins or other component of the HBV. Such drugs may also have diagnostic potential. In addition, defective HBV variants may also be used as therapeutic compositions to generate an immune response against the same, similar or homologous viruses. Alternatively, antibodies generated to the HBV variants or surface components thereof may be used in passive immunization of subjects against infection by HBV variants or similar or homologous viruses. Furthermore, agents such as nucleoside or nucleotide analogs, RNAi or siRNA molecules, antisense or sense oligonucleotides, chemical or proteinaceous molecules having an ability to down-regulate the activity of a component of HBV and inhibit replication, maintenance, infection, assembly or release are contemplated by the present invention.

A summary of the abbreviations used throughout the subject specification are provided in Table 3.

A summary of sequence identifiers used throughout the subject specification is provided in Table 1.

TABLE 1 Summary of sequence identifiers SEQUENCE ID NO: DESCRIPTION 1 Formula I 2 Formula II 3 OS1 primer 4 TTA3 primer 5 JM primer 6 TTA4 primer 7 OS2 primer 8 sense primer 9 antisense primer 10 internal regions primer 11 internal regions primer 12 PC1 forward primer 13 PC2 reverse primer 14 HBV-specific molecular beacon primer 15 ILA 1 F, A-E (FIG. 4) 16 ILA 2 F, A-E (FIG. 4) 17 ILA 3 F, A-E (FIG. 4) 18 ILA 4 F, A-E (FIG. 4) 19 Pol Trans Pre 1 (FIG. 5) 20 Pol Trans 2 (FIG. 5) 21 Pol Trans 3 (FIG. 5) 22 Pol Trans 4 (FIG. 5) 23 HBsAg Trans of Pre 1 (FIG. 6) 24 HBsAg Trans of 2 (FIG. 6) 25 HBsAg Trans of 3 (FIG. 6) 26 HBsAg Trans of 4 (FIG. 6) 27 S0 (FIG. 7) 28 S6 (FIG. 7) 29 S8 (FIG. 7) 30 S12 (FIG. 7) 31 S15 (FIG. 7) 32 Pol Trans S0 (FIG. 8) 33 Pol Trans S6 (FIG. 8) 34 Pol Trans S8 (FIG. 8) 35 Pol Trans S12 (FIG. 8) 36 Pol Trans S15 (FIG. 8) 37 HBsAg Trans of S0 (FIG. 9) 38 HBsAg Trans of S6 (FIG. 9) 39 HBsAg Trans of S8 (FIG. 9) 40 HBsAg Trans of S12 (FIG. 9) 41 HBsAg Trans of S15 (FIG. 9) 42 Nucleotide sequence Patient C (FIG. 10) 43 POL Trans of Patient C (FIG. 11) 44 HBsAg Trans of Patient C ( FIG. 12) 45 Nucleotide sequence of Patient D (FIG. 13) 46 Pol Trans of Patient D (FIG. 14) 47 HBsAg Trans of Patient D (FIG. 15) 48 Nucleotide sequence of Patient E (FIG. 16) 49 Pol Trans of Patient E (FIG. 17) 50 HBsAg Trans of Patient E (FIG. 18) 51 Nucleotide sequence of Patient F (FIG. 20) 52 Deduced sequence of DNA polymerase of Patient F (FIG. 21) 53 HBsAg Trans of Patient F (FIG. 22) 54 Nucleotide sequence of Patient G (FIG. 23) 55 Deduced sequence of DNA polymerase of Patient G (FIG. 24) 56 HBsAg Trans of Patient G (FIG. 25) 57 Nucleotide sequence of Patient H (FIG. 26) 58 Deduced sequence of DNA polymerase of Patient H (FIG. 27) 59 HBsAg Trans of Patient H (FIG. 28)

TABLE 2 Single and three letter amino acid abbreviations Amino Three-letter One-letter Acid Abbreviation symbol Alanine Ala A Arginine Arg R Asparagine Asn N Aspartic acid Asp D Cysteine Cys C Glutamine Gln Q Glutamic acid Glu E Glycine Gly G Histidine His H Isoleucine Ile I Leucine Leu L Lysine Lys K Methionine Met M Phenylalanine Phe F Proline Pro P Serine Ser S Threonine The T Tryptophan Trp W Tyrosine Tyr Y Valine Val V Any residue Xaa X

A list of abbreviations used throughout the subject specification are provided in Table 3.

TABLE 3 Abbreviations ABBREVIATION DESCRIPTION 3TC (LMV); (-)-β-2'-deoxy-3'-thiacytidine ADV adefovir dipivoxil DAPD diaminopurine dioxalone DXG dioxolane guanine ETV entecavir FAM famciclovir FCV famciclovir FTC emtricitabine HBIG hepatitis B immunoglobulin HBsAg hepatitis B surface antigen HBV hepatitis B virus LMV lamividuine PMEA 9-[phosphonyl-methoxyethyl]-adenine; adefovir PMPA 9-R-(2-phosphonomethoxypropyl)adenine RNase ribonuclease rt (“rt” before reverse transcriptase “Xaa₁nXaa₂” means reverse transcriptase) s (as used in a mutation, envelope gene e.g. sF134V) TFV tenofovir disoproxil fumarate YMDD Tyr Met Asp Asp-a motif in the polymerase protein; where the Met residue is designated residue number 204 of the reverse transcriptase

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is a diagrammatic representation showing the partially double stranded DNA HBV genome showing the overlapping open reading frames encoding surface (S), core (C), polymerase (P) and X gene.

FIG. 2 is a diagrammatic representation of the chemical structure of ADV.

FIG. 3 is a diagrammatic representation of a computer system for determining the potency value (P_A) of a variant HBV.

FIG. 4 is a representation showing comparison of the HBV nucleotide sequence encoding the catalytic region of the polymerase gene in sequential samples from Patient A during ADV treatment.

FIG. 5 is a representation showing comparison of the deduced amino acid sequence of the catalytic region of the polymerase gene in sequential samples from Patient A during ADV therapy.

FIG. 6 is a representation showing comparison of the deduced amino acid sequence of the envelope gene in sequential samples from Patient A during ADV therapy.

FIG. 7 is a representation showing comparison of the HBV nucleotide sequence encoding the catalytic region of the polymerase gene in sequential samples from Patient B during ADV and LMV treatment.

FIG. 8 is a representation showing comparison of the deduced amino acid sequence of the catalytic region of the polymerase gene in sequential samples from Patient B during ADV and LMV therapy.

FIG. 9 is a representation showing comparison of the deduced amino acid sequence of the envelope gene in sequential samples from Patient B during ADV and LMV therapy.

FIG. 10 is a representation showing comparison of the HBV nucleotide sequence encoding the catalytic region of the polymerase gene in sequential samples from Patient C during ADV treatment.

FIG. 11 is a representation showing comparison of the deduced amino acid sequence of the catalytic region of the polymerase gene in sequential samples from Patient C during ADV therapy.

FIG. 12 is a representation showing comparison of the deduced amino acid sequence of the envelope gene in sequential samples from Patient C during ADV therapy.

FIG. 13 is a representation showing comparison of the HBV nucleotide sequence encoding the catalytic region of the polymerase gene in sequential samples from Patient D during ADV treatment.

FIG. 14 is a representation showing comparison of the deduced amino acid sequence of the catalytic region of the polymerase gene in sequential samples from Patient D during ADV therapy.

FIG. 15 is a representation showing comparison of the deduced amino acid sequence of the envelope gene in sequential samples from Patient D during ADV therapy.

FIG. 16 is a representation showing comparison of the HBV nucleotide sequence encoding the catalytic region of the polymerase gene in sequential samples from Patient E during ADV treatment.

FIG. 17 is a representation showing comparison of the deduced amino acid sequence of the catalytic region of the polymerase gene in sequential samples from Patient E during ADV therapy.

FIG. 18 is a representation showing comparison of the deduced amino acid sequence of the envelope gene in sequential samples from Patient E during ADV therapy.

FIG. 19 is a diagrammatic representation of a system used to carry out the instructions encoded by the storage medium.

FIG. 20 is a representation showing the nucleotide sequence of envelope/rt region of an HBV isolated from Patient F having ADV therapy.

FIG. 21 is a representation showing the deduced amino acid sequence of DNA polymerase encoded by the nucleotide sequence shown in FIG. 20.

FIG. 22 is a representation showing the deduced amino acid sequence of HBsAg encoded by the nucleotide sequence shown in FIG. 20.

FIG. 23 is a representation showing the nucleotide sequence of envelope/rt region of an HBV isolated from Patient G having ADV therapy.

FIG. 24 is a representation showing the deduced amino acid sequence of DNA polymerase encoded by the nucleotide sequence shown in FIG. 23.

FIG. 25 is a representation showing the deduced amino acid sequence of HBsAg encoded by the nucleotide sequence shown in FIG. 23.

FIG. 26 is a representation showing the nucleotide sequence of envelope/rt region of an HBV isolated from Patient H having ADV therapy.

FIG. 27 is a representation showing the deduced amino acid sequence of DNA polymerase encoded by the nucleotide sequence shown in FIG. 26.

FIG. 28 is a representation showing the deduced amino acid sequence of HBsAg encoded by the nucleotide sequence shown in FIG. 26.

DETAILED DESCRIPTION OF THE INVENTION

The present invention is predicated in part on the identification and isolation of nucleoside or nucleotide analog-resistant variants of HBV following treatment of patients with either ADV or LMV or more particularly ADV and LMV, or optionally other nucleoside analogs or nucleotide analogs or other anti-HBV agents such as TFV or FTC. In particular, ADV or ADV and LMV treated patients gave rise to variants of HBV exhibiting decreased or reduced sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV. Reference herein to “decreased” or “reduced” in relation to sensitivity to ADV and/or LMV and/or FTC and/or TFV includes and encompasses a complete or substantial resistance to the nucleoside or nucleotide analog or other anti-HBV agents as well as partial resistance and includes a replication rate or replication efficiency which is more than a wild-type in the presence of a nucleoside or nucleotide analog or other anti-HBV agents. In one aspect, this is conveniently measured by an increase in viral load during treatment, or alternatively, there is no substantial decrease in HBV DNA viral load from pre-treatment HBV DNA levels during treatment (i.e., non-response to treatment).

Before describing the present invention in detail, it is to be understood that unless otherwise indicated, the subject invention is not limited to specific formulations of components, manufacturing methods, dosage regimens, or the like, as such may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

It must be noted that, as used in the subject specification, the singular forms “a”, “an” and “the” include plural aspects unless the context clearly dictates otherwise. Thus, for example, reference to “a nucleoside or nucleotide analog” includes a single analog, as well as two or more analogs; reference to “an HBV variant” includes reference to two or more HBV variants; and so forth.

In describing and claiming the present invention, the following terminology is used in accordance with the definitions set forth below.

The terms “analog”, “compound”, “active agent”, “pharmacologically active agent”, “medicament”, “active” and “drug” are used interchangeably herein to refer to a chemical compound that induces a desired effect such as inhibit viral replication, infection, maintenance, assembly and/or the function of an enzyme such as HBV DNA polymerase. The terms also encompass pharmaceutically acceptable and pharmacologically active ingredients of those active agents specifically mentioned herein including but not limited to salts, esters, amides, prodrugs, active metabolites, analogs and the like. When the terms “analog”, “compound”, “active agent”, “pharmacologically active agent”, “medicament”, “active” and “drug” are used, then it is to be understood that this includes the active agent per se as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, prodrugs, metabolites, analogs, etc.

The present invention contemplates, therefore, compounds useful in inhibiting HBV replication, infection, maintenance, assembly and/or the function of an enzyme such as HBV DNA polymerase. Reference to an “analog”, “compound”, “active agent”, “pharmacologically active agent”, “medicament”, “active” and “drug” such as ADV, LMV, FTC and/or TFV includes combinations of two or more actives such as ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV. A “combination” also includes a two-part or more such as a multi-part anti-HBV therapeutic composition where the agents are provided separately and given or dispensed separately or admixed together prior to dispensation.

The terms “effective amount” and “therapeutically effective amount” of an agent as used herein mean a sufficient amount of the agent to provide the desired therapeutic or physiological effect of inhibiting HBV replication, infection, maintenance, assembly and/or the function of an enzyme such as HBV DNA polymerase. Furthermore, an “effective HBV-inhibiting amount” or “effective symptom-ameloriating amount” of an agent is a sufficient amount of the agent to directly or indirectly inhibit replication, infection, maintenance, assembly and/or the function of an enzyme such as HBV DNA polymerase. Undesirable effects, e.g. side effects, are sometimes manifested along with the desired therapeutic effect; hence, a practitioner balances the potential benefits against the potential risks in determining what is an appropriate “effective amount”. The exact amount required will vary from subject to subject, depending on the species, age and general condition of the subject, mode of administration and the like. Thus, it may not be possible to specify an exact “effective amount”. However, an appropriate “effective amount” in any individual case may be determined by one of ordinary skill in the art using only routine experimentation.

By “pharmaceutically acceptable” carrier, excipient or diluent is meant a pharmaceutical vehicle comprised of a material that is not biologically or otherwise undesirable, i.e. the material may be administered to a subject along with the selected active agent without causing any or a substantial adverse reaction. Carriers may include excipients and other additives such as diluents, detergents, coloring agents, wetting or emulsifying agents, pH buffering agents, preservatives, and the like.

Similarly, a “pharmacologically acceptable” salt, ester, emide, prodrug or derivative of a compound as provided herein is a salt, ester, amide, prodrug or derivative that this not biologically or otherwise undesirable.

The terms “treating” and “treatment” as used herein refer to reduction in severity and/or frequency of symptoms, elimination of symptoms and/or underlying cause, prevention of the occurrence of symptoms and/or their underlying cause, and improvement or remediation of damage in relation to HBV infection. Thus, for example, “treating” a patient involves prevention of HBV infection as well as treatment of a clinically HBV symptomatic individual by inhibiting HBV replication, infection, maintenance, assembly and/or the function of an enzyme such as HBV DNA polymerase. Thus, for example, the present method of “treating” a patient with HBV infection or with a propensity for one to develop encompasses both prevention of HBV infection as well as treating HBV infection or symptoms thereof. In any event, the present invention contemplates the treatment or prophylaxis of HBV infection.

“Patient” as used herein refers to an animal, preferably a mammal and more preferably a primate including a lower primate and even more preferably, a human who can benefit from the formulations and methods of the present invention. A patient regardless of whether a human or non-human animal may be referred to as an individual, subject, animal, host or recipient. The compounds and methods of the present invention have applications in human medicine, veterinary medicine as well as in general, domestic or wild animal husbandry. For convenience, an “animal” includes an avian species such as a poultry bird (including ducks, chicken, turkeys and geese), an aviary bird or game bird. The condition in a non-human animal may not be a naturally occurring HBV infection but HBV-like infection may be induced.

As indicated above, the preferred animals are humans, non-human primates such as marmosets, baboons, orangutans, lower primates such as tupia, livestock animals, laboratory test animals, companion animals or captive wild animals. A human is the most preferred target. However, non-human animal models may be used.

Examples of laboratory test animals include mice, rats, rabbits, guinea pigs and hamsters. Rabbits and rodent animals, such as rats and mice, provide a convenient test system or animal model as do primates and lower primates. Livestock animals include sheep, cows, pigs, goats, horses and donkeys. Non-mammalian animals such as avian species, zebrafish, amphibians (including cane toads) and Drosophila species such as Drosophila melanogaster are also contemplated. Instead of a live animal model, a test system may also comprise a tissue culture system.

Accordingly, one aspect of the present invention is directed to an isolated HBV variant wherein said variant comprises a nucleotide mutation in a gene encoding a DNA polymerase resulting in at least one amino acid addition, substitution and/or deletion to said DNA polymerase and wherein said variant exhibits decreased sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, or ADV and LMV and FTC, ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combination thereof.

HBV is a member of the Hepadnaviridae that includes also avian hepatitis viruses such as Duck hepatitis B virus (DHBV) and hepatitis viruses from mammals such as woodchuck hepatitis virus (WHV). These viruses have similarity to HBV and may be used in in vitro and in vivo or animal model systems to investigate the equivalent HBV mutants and anti-viral sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV,

An “anti-HBV agent” includes a nucleoside or nucleotide analog, protein, chemical compound, RNA or DNA or RNAi or siRNA oligonucleotide.

Preferably, the decreased sensitivity is in respect of ADV. Alternatively, the decreased sensitivity is in respect of LMV. Alternatively, the decreased sensitivity is in respect of TFV. Alternatively, the decreased sensitivity is in respect of FTC. Alternatively, the decreased sensitivity is in respect of ADV and LMV. Alternatively, the decreased sensitivity is in respect of ADV and TFV. Alternatively, the decreased sensitivity is in respect of LMV and TFV. Alternatively, the decreased sensitivity is in respect of ADV and FTC. Alternatively, the decreased sensitivity is in respect to FTC and TFV. Alternatively, the decreased sensitivity is in respect of FTC and LMV. Alternatively, the decreased sensitivity is in respect of ADV and LMV and TFV. Alternatively, the decreased sensitivity is in respect to ADV and TFV and FTC. Alternatively, the decreased sensitivity is in respect to LMV and TFV and FTC. Alternatively, the decrease sensitivity is in respect of ADV and LMV and FTC. Alternatively, the decreased sensitivity is in respect of ADV and FTC and TFV and LMV.

Reference herein to “anti-HBV agents” includes nucleoside and nucleotide analogs as well as immunological reagents (e.g. antibodies to HBV surface components) and chemical, proteinaceous and nucleic acid agents which inhibit or otherwise interfere with viral replication, maintenance, infection, assembly or release. Reference herein to “nucleic acid” includes reference to a sense or antisense molecule, RNA or DNA, oligonucleotides and RNAi and siRNA molecules and complexes containing same.

In addition to a mutation in the gene encoding DNA polymerase, due to the overlapping nature of the HBV genome (FIG. 1), a corresponding mutation may also occur in the gene encoding the S gene encoding the surface antigen (HBsAg) resulting in reduced interactivity of immunological reagents such as antibodies and immune cells to HBsAg. The reduction in the interactivity of immunological reagents to a viral surface component generally includes the absence of immunological memory to recognize or substantially recognize the viral surface component. The present invention extends, therefore, to an HBV variant exhibiting decreased sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, and/or ADV and FTC and LMV and TFV or a reduced interactivity of an immunological reagent to HBsAg wherein the variant is selected for following ADV and/or LMV combination or sequential treatment. The term “sequential” in this respect means ADV followed by LMV and/or TFV, and/or FTC, LMV followed by ADV and/or TFV, and/or FTC, or multiple sequential administrations of each of ADV, LMV and/or TFV, and/or FTC.

A viral variant may, therefore, carry mutation only in the DNA polymerase gene or both in the DNA polymerase gene and the S gene. The term “mutation” is to be read in its broadest context and includes multiple mutations.

The present invention extends to a Mutation and any domain of the HBV DNA polymerase and in particular regions F and G, and domains A through to E provided said mutation leads to decreased sensitivity to ADV and/or LMV and/or TFV or combinations thereof. Regions F and G of the HBV DNA polymerase is defined by the amino acid sequence set forth in Formula I below [SEQ ID NO:1]:

FORMULA I L, X₁, X₂, D, W, G, P, C, X₃, X₄, H, G, X₅, H, X₆, I, R, B₇, P, R, T, P, X₈, R, V, X₉, G, G, V, F, L, V, D, K, N, P, H, N, T, X₁₀, E, S, X₁₁, L, X₁₂, V, D, F, S, Q, F, S, R, G, X₁₃, X₁₄, X₁₅, V, P, K, F, A, V, P, N, L, X₁₆, S, L, T, N, L, L, S*

wherein:

X₁is L, or R, or I

X₂is E, or D

X₃is T, or D, or A, or N, or Y

X₄is E, or D

X₅is E, or K, or Q

X is H, or R, or N,

X₇is I, or T

X₂is A, or S

X₉is T or R

X₁₀is A, or T, or S

X₁₁is R, or T

X₁₂is V, or G

X₁₃is S, or I, or T, or N, or V

X₁₄is T, or S, or H, or Y

X₁₅is R, or H, or K, or Q

X₁₆is Q, or P;

and wherein S* is designated as amino acid 74.

In this specification, reference is particularly made to the conserved regions of the DNA polymerase as defined by domains A to E. Regions A to E are defined by the amino acid sequence set forth in Formula II below [SEQ ID NO:2] (and in Australian Patent No. 734831):

FORMULA II S X₁ L S W L S L D V S A A F Y H X₂ P L H P A A M P H L L X₃ G S S G L X₄ R Y V A R L S S X₅ S X₆ X₇ X N X₈ Q X₉ X₁₀ X X X X₁₁ L H X₁₂ X₁₃ C S R X₁₄ L Y V S L X₁₅ L L Y X₁₆ T X₁₇ G X₁₈ K L H L X₁₉ X₂₀ H P I X₂₁ L G F R K X₂₂ P M G X₂₃ G L S P F L L A Q F T S A I X₂₄ X₂₅ X₂₆ X₂₇ X₂₈ R A F X₂₉ H C X₃₀ X₃₁ F X₃₂ Y M* D D X₃₃ V L G A X₃₄ X₃₅ X₃₆ X₃₇ H X₃₈ E X₃₉ L X₄₀ X₄₁ X₄₂ X₄₃ X₄₄ X₄₅ X₄₆ L L X₄₇ X₄₈ G I H L N P X₄₉ K T K R W G Y S L N F M G Y X₅₀ I G

wherein: X is any amino acid

X₁is N or D;

X₂is 1 or 1′;

X₃is I or V;

X₄is S or D;

X₅is T or N;

X₆is R or N;

X₇is N or I;

X₈is N or Y or H;

X₉is H or Y;

X₁₀is G or R;

X₁₁is D or N;

X₁₂is D or N;

X₁₃is S or Y;

X₁₄is N or Q;

X₁₅is L or M;

X₁₆is K or Q;

X₁₇is Y or F;

X₁₈is R or W;

X₁₉is Y or L;

X₂₀is or A;

X₂₁is I or V;

X₂₂is I or L;

X₂₃is V or G;

X₂₄is C or L;

X₂₅is A or S;

X₂₆is V or M;

X₂₇is V or T;

X₂₈is R or C;

X₂₉is F or P;

X₃₀is L or V;

X₃₁is A or V;

X₃₂is S or A;

X₃₃is V or L or M;

X₃₄is K or R;

X₃₅is S or T;

X₃₆is V or G;

X₃₇is Q or E;

X₃₈is L or S or R;

X₃₉is S or F;

X₄₀is F or Y;

X₄₁is T or A;

X₄₂is A or S;

X₄₃is V or I;

X₄₄is T or C;

X₄₅is N or S;

X₄₆is F or V;

X₄₇is S or D;

X₄₈is L or V;

X₄₉is N or Q;

X₅₀is V or I; and

M* is amino acid 204; and wherein the first S is designated as amino acid 75.

Preferably, the mutation results in an altered amino acid sequence in any one or more of domains F and G, and domains A through to E or regions proximal thereto of the HBV DNA polymerase.

Another aspect of the present invention provides an HBV variant comprising a mutation in an overlapping open reading frame in its genome wherein said mutation is in a region defined by one or more of domains F and G, and domains A through to E of HBV DNA polymerase and wherein said variant exhibits decreased sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents.

In a related embodiment, there is provided an HBV variant comprising a mutation in the nucleotide sequence encoding a DNA polymerase resulting in an amino acid addition, substitution and/or deletion in said DNA polymerase in one or more amino acids as set forth in Formula I [SEQ ID NO:1] and/or Formula II [SEQ ID NO:2]:

FORMULA I L, X₁, X₂, D, W, G, P, C, X₃, X₄, H, G, X₅, H, X₆, I, R, X₇, P, R, T, P, X₈, R, V, X₉, G, G, V, F, L, V, D, K, N, P, H, N, T, X₁₀, E, S, X₁₁, L, X₁₂, V, D, F, S, Q, F, S, R, G, X₁₃, X₁₄, X₁₅, V, S, W, P, K, F, A, V, P, N, L, X₁₆, S, L, T, N, L, L, S*

wherein:

X₁is L, or R, or I

X₂is E, or D

X₃is T, or D, or A, or N, or Y

X₄is E, or D

X₅is E, or K, or Q

X₆is H, or R, or N,

X₇is I, or T

X₈, is A, or S

X₉is T or R

X₁₀is A, or T, or S

X₁₁is R, or T

X₁₂is V, or G

X₁₃is S, or I, or T, or N, or V

X₁₄is T, or S, or H, or Y

X₁₅is R, or H, or K, or Q

X₁₆is Q, or P;

and

FORMULA II S X₁ L S W L S L D V S A A F Y H X₂ P L H P A A M P H L L X₃ G S S G L X₄ R Y V A R L S S X₅ X₆ X₇ X N X₈ Q X₉ X₁₀ X X X X₁₁ L H X₁₂ X₁₃ C S R X₁₄ L Y V S L X₁₅ L L Y X₁₆ T X₁₇ N G X₁₈ K L H L X₁₉ X₂₀ H P I X₂₁ L G F R K X₂₂ P M G X₂₃ G L S P F L L A Q F T S A I X₂₄ X₂₅ X₂₆ X₂₇ X₂₈ R A F X₂₉ H C X₃₀ X₃₁ F X₃₂ Y M* D D X₃₃ V L G A X₃₄ X₃₅ X₃₆ X₃₇ H X₃₈ X₃₉ L X₄₀ X₄₁ X₄₂ X₄₃ X₄₄ X₄₅ X₄₆ L L X₄₇ X₄₈ G I H L N P X₄₉ K T K R W G Y S L N F M G Y X₅₀ I G

wherein: X is any amino acid

X₁is N or D;

X₂is I or P;

X₃is or V;

X₄is S or D;

X₅is T or N;

X₆is R or N;

X₇is N or I;

X₈is N or Y or H;

X₉is H or Y;

X₁₀is G or R;

X₁₁is D or N;

X₁₂is D or N;

X₁₃is S or Y;

X₁₄is N or Q;

X₁₅is L or M;

X₁₆is K or Q;

X₁₇is Y or F;

X₁₆is R or W;

X₁₉is Y or L;

X₂₀is S or A;

X₂₁is I or V;

X₂₂is I or L;

X₂₃is V or G;

X₂₄is C or L;

X₂₅is A or S;

X₂₆is V or M;

X₂₇is V or T;

X₂₈is R or C;

X₂₉is F or P;

X₃₀is L or V;

X₃₁is A or V;

X₃₂is S or A;

X₃₃is V or L or M;

X₃₄is K or R;

X₃₅is S or T;

X₃₆is V or G;

X₃₇is Q or E;

X₃₈is L or S or R;

X₃₉is S or F;

X₄₀is F or Y;

X₄₁is T or A;

X₄₂is A or S;

X₄₃is V or I;

X₄₄is T or C;

X₄₅is N or S;

X₄₆is F or V;

X₄₇is S or D;

X₄₈is L or V;

X₄₉is N or Q;

X₅₀is V or I; and

M* is amino acid 204; and wherein S* in Formula I is designated as amino acid 74 and the first S in Formula II is designated as amino acid 75; and wherein said variant exhibits decreased sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combination thereof. Preferably, the decreased sensitivity is to ADV or to both ADV and LMV or to one or both of ADV and/or LMV and/or TFV and for FTC.

Another preferred aspect of the present invention contemplates an HBV variant comprising a mutation in the nucleotide sequence encoding HBsAg resulting in an amino acid addition, substitution and/or deletion in said HBsAg in a region corresponding to the amino acid sequence set forth in Formulae I and II wherein said variant exhibits decreased sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combination thereof.

More particularly, the present invention provides a variant HBV comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or a truncation compared to a surface antigen from a reference or wild-type HBV and wherein an antibody generated to the reference or wild-type surface antigen exhibits reduced capacity for neutralizing said HBV variant, said variant selected by exposure of a subject to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combination thereof.

The term “combination therapy” means that both combinations of ADV, LMV, FTC and/or TFV are co-administered in the same composition or simultaneously in separate compositions. The term “sequential therapy” means that the two agents are administered within seconds, minutes, hours, days or weeks of each other and in either order. Sequential therapy also encompasses completing a therapeutic course with one or other of ADV, LMV, FTC or TFV and then completing a second or third or subsequent therapeutic courses with the other of ADV, LMV, FTC or TFV.

Accordingly, another aspect of the present invention contemplates an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the pretreatment HBV and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the pretreatment HBV where the said variant HBV is selected for by exposure of a subject to ADV therapy or therapy by one or more other nucleoside or nucleotide analogs or other anti-HBV agents.

Another aspect of the present invention contemplates an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the pretreatment HBV and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the pretreatment HBV where the said variant HBV is selected for by exposure of a subject to LMV therapy or therapy by one or more other nucleoside or nucleotide analogs or other anti-HBV agents.

Yet another aspect of the present invention contemplates an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the pretreatment HBV and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the pretreatment HBV where the said variant HBV is selected for by exposure of a subject to FTC therapy or therapy by one or more other nucleoside or nucleotide analogs or other anti-HBV agents.

Still another aspect of the present invention contemplates an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the pretreatment HBV and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the pretreatment HBV where the said variant HBV is selected for by exposure of a subject to TFV therapy or therapy by one or more other nucleoside or nucleotide analogs or other anti-HBV agents.

Even yet another aspect of the present invention contemplates an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the pretreatment HBV and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the pretreatment HBV where the said variant HBV is selected for by exposure of a subject to ADV and LMV therapy or therapy by one or more other nucleoside or nucleotide analogs or other anti-HBV agents.

Even still another aspect of the present invention contemplates an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the pretreatment HBV and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the pretreatment HBV where the said variant HBV is selected for by exposure of a subject to ADV and TFV therapy or therapy by one or more other nucleoside or nucleotide analogs or other anti-HBV agents.

A further aspect of the present invention contemplates an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the pretreatment HBV and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the pretreatment HBV where the said variant HBV is selected for by exposure of a subject to LMV and TFV therapy or therapy by one or more other nucleoside or nucleotide analogs or other anti-HBV agents.

Another aspect of the present invention contemplates an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the pretreatment HBV and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the pretreatment HBV where the said variant HBV is selected for by exposure of a subject to ADV and FTC therapy or therapy by one or more other nucleoside or nucleotide analogs or other anti-HBV agents.

Yet another aspect of the present invention contemplates an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the pretreatment HBV and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the pretreatment HBV where the said variant HBV is selected for by exposure of a subject to TFV and FTC therapy or therapy by one or more other nucleoside or nucleotide analogs or other anti-HBV agents.

Still another aspect of the present invention contemplates an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the pretreatment HBV and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the pretreatment HBV where the said variant HBV is selected for by exposure of a subject to FTC and LMV therapy or therapy by one or more other nucleoside or nucleotide analogs or other anti-HBV agents.

Even yet another aspect of the present invention contemplates an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the pretreatment HBV and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the pretreatment HBV where the said variant HBV is selected for by exposure of a subject to ADV, LMV and TFV therapy or therapy by one or more other nucleoside or nucleotide analogs or other anti-HBV agents.

Even still another aspect of the present invention contemplates an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the pretreatment HBV and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the pretreatment HBV where the said variant HBV is selected for by exposure of a subject to ADV, LMV and TFV therapy or therapy by one or more other nucleoside or nucleotide analogs or other anti-HBV agents.

A further aspect of the present invention contemplates an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the pretreatment HBV and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the pretreatment HBV where the said variant HBV is selected for by exposure of a subject to ADV, LMV and FTC therapy or therapy by one or more other nucleoside or nucleotide analogs or other anti-HBV agents.

Another aspect of the present invention contemplates an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the pretreatment HBV and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the pretreatment HBV where the said variant HBV is selected for by exposure of a subject to FTC, LMV and TFV therapy or therapy by one or more other nucleoside or nucleotide analogs or other anti-HBV agents.

Yet another aspect of the present invention contemplates an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the pretreatment HBV and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the pretreatment HBV where the said variant HBV is selected for by exposure of a subject to ADV, FTC and TFV therapy or therapy by one or more other nucleoside or nucleotide analogs or other anti-HBV agents.

Still yet another aspect of the present invention contemplates an HBV variant comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the pretreatment HBV and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the pretreatment HBV where the said variant HBV is selected for by exposure of a subject to ADV, LMV, FTC and TFV therapy or therapy by one or more other nucleoside or nucleotide analogs or other anti-HBV agents.

Preferably, the variants are in isolated form such that they have undergone at least one purification step away from naturally occurring body fluid. Alternatively, the variants may be maintained in isolated body fluid or may be in DNA form. The present invention also contemplates infectious molecular clones comprising the genome or parts thereof from a variant HBV. Furthermore, the present invention provides isolated components from the variant HBVs such as but not limited to an isolated HBsAg. Accordingly, the present invention provides an isolated HBsAg or a recombinant form thereof or derivative or chemical equivalent thereof, said HBsAg being from a variant HBV selected by exposure of a subject to one or more of ADV, LMV, FTC and/or TFV or optionally one or more nucleoside or nucleotide analogs or other anti-HBV agents.

More particularly, yet another aspect of the present invention is directed to an isolated variant HBsAg or a recombinant or derivative form thereof or a chemical equivalent thereof wherein said HBsAg or its recombinant or derivative form or its chemical equivalent exhibits an altered immunological profile compared to an HBsAg from a reference HBV, said HBsAg being from a variant HBV selected by exposure of a subject to one or more of ADV, LMV, FTC and/or TFV or optionally one or more nucleoside or nucleotide analogs or other anti-HBV agents.

Even more particularly, the present invention provides an isolated variant HBsAg or a recombinant or derivative form thereof or a chemical equivalent thereof wherein said HBsAg or its recombinant or derivative form or its chemical equivalent comprises an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or a truncation compared to an HBsAg from a reference HBV and wherein a neutralizing antibody directed to a reference HBV exhibits no or reduced neutralizing activity to an HBV carrying said variant HBsAg, said HBsAg being from a variant HBV selected by exposure of a subject to one or more of ADV, LMV, FTC and/or TFV or optionally one or more nucleoside or nucleotide analogs or other anti-HBV agents.

Preferred mutations in the HBV DNA polymerase include variants selected from patients with HBV recurrence following ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV treatment. Nucleoside or nucleotide analog or other anti-HBV agents treatment may occur in relation to a transplantation procedure (e.g. bone marrow transplantation (BMT) or OLT) or following treatment of patients diagnosed with hepatitis. Following selection of variants, viral loads are obtainable at levels similar to pre-treatment levels or are increasing while on therapy.

Preferred mutations include, in one embodiment, rtS21A, rtL122F, rtN124H, rtH126R, rtT28N, rtP130Q, rtD131N and rtY135C; in another embodiment, rt/N/S/T/I/V53D, rtY126Q, rtL180M, rtS202G, rtI204V and rtI235I/M; in a further embodiment, rtN53D, rtY54H, rtS57P, rtL91I, rtS116P, rtF122L, rtY124H, rtV134D, rtY141Y/F, rtL145M, rtF151F/Y, rtA181T, rtK212R, rtL217R, rtS219A, rtN236T and rtN238D; in yet another embodiment, rtS78T, rtV84M, rtY126C, rtV191I, rtM204I and rtV214A; in still another embodiment, rtH90D, and rtL/F108L; in even yet another embodiment, rtL157L/M, rtA181V and rtV207I; in still yet another embodiment, rtL80V, rtP109S, rtI163V, rtL229M and rtN/H/A/S/Q238K; in another embodiment, rtS78S/T, rtN118N/S, rtN139N/K, rtV142E, rtA181A/T, rtI204M, rtQ/F/S/Stop215Q, rtE218K/E and rtN238N/H; in a further embodiment, rtK32, rtN33, rtP34, rtH35 and rtT37; in yet another embodiment, rtP59, rtK60, rtF61, rtA62 and rtV63; in still another embodiment, rtD83, rtV84, rtS85, rtA86, rtY89, rtH90 and rtI/L91; in even yet another embodiment, rtP177, rtF178, rtL179, rtL180, rtA181, rtQ182, rtF183 and rtT184; in still yet another embodiment, rtM204 and rtY203; in another embodiment, rt235, rt236, rt237, rt238 and rt239; in a further embodiment, rt247, rt248, rt249, rt250 and rt251; in yet another embodiment.

K32M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion;

N33D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion;

P34S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion;

H35I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion;

T37W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion;

P59S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion;

K60M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion;

F61P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion;

A62R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion;

V63A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion;

D83C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/deletion;

V84A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion;

S85T/W/Y/V/N/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/deletion;

A86R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion;

Y89V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/deletion;

H90I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion;

I/L91K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/deletion;

P177S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion;

F178P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion;

L179K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion;

L180K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion;

A181R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion;

Q183E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/deletion;

F183P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion;

T184W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion;

Y203V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/deletion;

M204F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/deletion;

L235K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion;

N236D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion;

T237W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion;

P237S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion;

N238D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion;

H238I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion;

A238R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion;

S239T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/deletion;

Q238E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/deletion;

K239M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion;

L247K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion;

N248D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion;

H248I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion;

F249P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion;

M250F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/deletion;

G251H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E; and

V251A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y.

Reference above to “deletion” means that the first mentioned amino acid before the residue number has been deleted.

Such HBV variants are proposed to exhibit a decreased sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combination thereof. It should be noted that the nomenclature system for amino acid positions is based on the methionine residues in the YMDD motif being designated codon rtM204. This numbering system is different to that iii Australian Patent No. 734831 where the methionine residue in the YMDD motif within the polymerase gene is designated codon 550. In this regard, rtL180M and rtM204V correspond to L526M and M550V, respectively, in Australian Patent No. 734831. Corresponding mutations may also occur in envelope genes such as in one or more of PreS1, PreS2 and S. The mutations in S gene encoding HBsAg at sT118R, sP120T, sS143S/T, sD144A or sI195M also result in mutation in the in the polymerase gene rtY126C, rtT128N, rtF151S/F or rtM204V respectively.

Another potential mode of action of ADV and other acyclic nucleoside phosphonates is that of immune stimulation (Calio et al., Antiviral Res. 23: 77-89, 1994). A number of mutations resulted in changes in the envelope gene detected in HBV variants which may be associated with immune escape. These changes include sT118R, sP120T, sS126T, sM133T, sM133L/M, sF134V, sS143S/T, sD144A, sG145A and/or sW172STOP.

HBV encoding the mutation at codon sG145R is a well characterized vaccine escape mutant, although the envelope protein from HBV encoding the mutation at sG145A does not have the same antigen/antibody binding characteristics as the sG145R. This mutation was detected in HBV isolated from patient C in conjunction with mutations at codons 143 and 144.

The identification of the variants of the present invention permits the generation of a range of assays to detect such variants. The detection of such variants may be important in identifying resistant variants to determine the appropriate form of chemotherapy and/or to monitor vaccination protocols, or develop new or modified vaccine preparations.

Still another aspect of the present invention contemplates a method for determining the potential for an HBV to exhibit reduced sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents, said method comprising isolating DNA or corresponding mRNA from said HBV and screening for a mutation in the nucleotide sequence encoding HBV DNA polymerase resulting in at least one amino acid substitution, deletion and/or addition in any one or more of domains F and G, and A domains through to E or a region proximal thereto of said DNA polymerase and associated with resistance or decreased sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents wherein the presence of such a mutation is an indication of the likelihood of resistance to said ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents.

Preferably, the assay detects one or more of the following mutations: in one embodiment, rtS21A, rtL122F, rtN124H, rtH126R, rtT28N, rtP130Q, rtD131N and rtY135C; in another embodiment, rt/N/S/T/I/V53D, rtY126Q, rtL180M, rtS202G, rtI204V and rtI235I/M; in a further embodiment, rtN53D, rtY54H, rtS57P, rtL91I, rtS116P, rtF122L, rtY124H, rtV134D, rtY141Y/F, rtL145M, rtF151F/Y, rtA181T, rtK212R, rtL217R, rtS219A, rtN236T and rtN238D; in yet another embodiment, rtS78T, rtV84M, rtY126C, rtV191I, rtM204I and rtV214A; in still another embodiment, rtH90D and rtL/F108L; in even yet another embodiment, sP120T, sM125T and sT127A; in still yet another embodiment, sT118R, sM133T, SF134V, sI195M, sS207R and sY225Y/C; in another embodiment, sS126T, sM133L/M, sS143S/T, sD144A, sG145A and sW172Stop; in a further embodiment, sN40S, sC69STOP, sM75I, sL88P, sT118A, sW182Stop, sW196L, sY206H and sY225F; in yet another embodiment, s181M and sP214Q; in still another embodiment, sF83S, sL173F and sW199L; in yet another embodiment, sI126T, sK160R, sS174N, sA184V, sW196L, sS210N, sF/C220L and sY221C; in still another embodiment, sC69Stop/C, sC76Y, sI110V/I, sY134N, sW172Stop/W, sW196Stop, sS207R; in even still another embodiment, rtK32, rtN33, rtP34, rtH35 and rtT37); in another embodiment, rtP59, rtK60, rtF61, rtA62 and rtV63); in a further embodiment, rtD83, rtV84, rtS85, rtA86, rtY89, rtH90 and rtI/L91); in yet another embodiment, rtP177, rtF178, rtL179, rtL180, rtA181, rtQ182, rtF183 and rtT184; in still another embodiment, rtM204 and rtY203; in even yet another embodiment, rt235, rt236, rt237, rt238 and rt239 and in even still another embodiment, rt247, rt248, rt249, rt250 and rt251 and in another embodiment,

K32M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion;

N33D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion;

P34S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M//deletionF;

H35I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion;

T37W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion;

P59S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion;

K60M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion;

F61P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion;

A62R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion;

V63A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion;

D83C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/deletion;

V84A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion;

S85T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/deletion;

A86R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion;

Y89V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/deletion;

H90I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion;

I/L91K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/deletion;

P177S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion;

F178P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion;

L179K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion;

L180K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion;

A181R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion;

Q183E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/deletion;

F183P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion;

T184W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion;

Y203V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/deletion;

M204F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/deletion;

L235K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion;

N236D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion;

T237W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion;

P237S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion;

N238D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion;

H23SI/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion;

A238R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion;

S239T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/deletion;

Q238E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/deletion;

K239M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion;

L247K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion;

N248D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion;

H248I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion;

F249P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion;

M250F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/deletion;

G251H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/deletion; and

V251A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion

or combinations thereof or an equivalent one or more other mutation is indicative of a variant wherein said variant exhibits a decreased sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combination thereof.

Accordingly, another aspect of the present invention produces a method for determining whether an HBV strain exhibits reduced sensitivity to a nucleoside or nucleotide analog or other anti-HBV agents, said method comprising isolating DNA or corresponding mRNA from said HBV and screening for a mutation in the nucleotide sequence encoding the DNA polymerase and/or a corresponding region of the S gene, wherein the presence of a mutation selected from, in one embodiment, rtS21A, rtL122F, rtN124H, rtH126R, rtT28N, rtP130Q, rtD131N and rtY135C; in another embodiment, rt/N/S/T/I/V53D, rtY126Q, rtL180M, rtS202G, rtI204V and rtI235I/M; in a further embodiment, rtN53D, rtY54H, rtS57P, rtL91I, rtS116P, rtF122L, rtY124H, rtV134D, rtY141Y/F, rtL145M, rtF151F/Y, rtA181T, rt212R, rtL217R, rtS219A, rtN236T and rtN238D; in yet another embodiment, rtS78T, rtV84M, rtY126C, rtV191I, rtM204I and rtV214A; in still another embodiment, rtH90D and rtL/F108L; in even yet another embodiment, sP120T, sM125T and sT127A; in still yet another embodiment, sT118R, sM133T, SF134V, sI195M, sS207R and sY225Y/C; in another embodiment, sS126T, sM133L/M, sS143S/T, sD144A, sG145A and sW172Stop; in a further embodiment, sN40S, sC69STOP, sM75I, sL88P, sT118A, sW182Stop, sW196L, sY206H and sY225F; in yet another embodiment, s181M and sP214Q; in still another embodiment, sF83S, sL173F and sW199L; in yet another embodiment, sI126T, sK160R, sS174N, sA184V, sW196L, sS210N, sF/C220L and sY221C; in still another embodiment, sC69Stop/C, sC76Y, sI110V/I, sY134N, sW172Stop/W, sW196Stop, sS207R; in even still another embodiment, rtK32, rtN33, rtP34, rtH35 and rtT37); in another embodiment, rtP59, rtK60, rtF61, rtA62 and rtV63); in a further embodiment, rtD83, rtV84, rtS85, rtA86, rtY89, rtH90 and rtI/L91); in yet another embodiment, rtP177, rtF178, rtL179, rtL180, rtA181, rtQ182, rtF183 and rtT184; in still another embodiment, rtM204 and rtY203; in even yet another embodiment, rt235, rt236, rt237, rt238 and rt239 and in even still another embodiment, rt247, rt248, rt249, rt250 and rt251; and in another embodiment,

K32M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion; N33D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; P34S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; H35I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; T37W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion; P59S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; K60M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion; F61P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; A62R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; V63A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion; D83C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/deletion; V84A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion; S85T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/deletion; A86R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; Y89V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/deletion; H90I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; I/L91K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/deletion; P177S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; F178P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; L179K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; L180K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; A181R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; Q183E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/deletion; F183P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; T184W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion; Y203V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/deletion; M204F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/deletion; L235K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; N236D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; T237W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion; P237S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; N238D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; H238I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; A238R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; S239T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/deletion; Q238E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/deletion; K239M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion; L247K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; N248D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; H248I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; F249P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; M250F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/deletion; G251H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/deletion; and V251A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion

or combinations thereof or an equivalent one or more other mutation is indicative of a variant which exhibits a decreased sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combination thereof.

A further aspect of the present invention produces a method for determining whether an HBV strain exhibits reduced sensitivity to a nucleoside or nucleotide analog or other anti-HBV agents, said method comprising isolating DNA or corresponding mRNA from said HBV and screening for a mutation in the nucleotide sequence encoding the DNA polymerase and/or a corresponding region of the S gene, wherein the presence of a mutation selected from, in one embodiment, rtS21A, rtL122F, rtN124H, rtH126R, rtT28N, rtP130Q, rtD131N and rtY135C; in another embodiment, rt/N/S/T/I/V53D, rtY126Q, rtL180M, rtS202G, rtI204V and rtI235I/M; in a further embodiment, rtN53D, rtY54H, rtS57P, rtL91I, rtS116P, rtF122L, rtY124H, rtV134D, rtY141Y/F, rtL145M, rtF151F/Y, rtA181T, rtK212R, rtL217R, rtS219A, rtN236T and rtN238D; in yet another embodiment, rtS78T, rtV84M, rtY126C, rtV191I, rtM204I and rtV214A; in still another embodiment, rtH90D and rtL/F108L; in even yet another embodiment, sP120T, sM125T and sT127A; in still yet another embodiment, sT118R, sM133T, SF134V, sI195M, sS207R and sY225Y/C; in another embodiment, sS126T, sM133L/M, sS143S/T, sD144A, sG145A and sW172Stop; in a further embodiment, sN40S, sC69STOP, sM75I, sL88P, sT118A, sW182Stop, sW196L, sY206H and sY225F; in yet another embodiment, s181M and sP214Q; in still another embodiment, sF83S, sL173F and sW199L; in yet another embodiment, sI126T, sK160R, sS174N, sA184V, sW196L, sS210N, sF/C220L and sY221C; in still another embodiment, sC69Stop/C, sC76Y, sI110V/I, sY134N, sW172Stop/W, sW196Stop, sS207R; in even still another embodiment, rtK32, rtN33, rtP34, rtH35 and rtT37); in another embodiment, rtP59, rtK60, rtF61, rtA62 and rtV63); in a further embodiment, rtD83, rtV84, rtS85, rtA86, rtY89, rtH90 and rtI/L91); in yet another embodiment, rtP177, rtF178, rtL179, rtL180, rtA181, rtQ182, rtF183 and rtT184; in still another embodiment, rtM204 and rtY203; in even yet another embodiment, rt235, rt236, rt237, rt238 and rt239 and in even still another embodiment, rt247, rt248, rt249, rt250 and rt251; and in another embodiment,

K32M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion; N33D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; P34S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; H35I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; T37W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion; P59S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; K60M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion; F61P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; A62R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; V63A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion; D83C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/deletion; V84A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion; S85T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/deletion; A86R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; Y89V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/deletion; H90I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; I/L91K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/deletion; P177S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; F178P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; L179K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; L180K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; A181R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; Q183E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/deletion; F183P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; T184W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion; Y203V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/deletion; M204F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/deletion; L235K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; N236D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; T237W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion; P237S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; N238D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; H238I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; A238R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; S239T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/deletion; Q238E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/deletion; K239M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion; L247K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; N248D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; H248I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; F249P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; M250F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/deletion; G251H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/deletion; and V251A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion

or combinations thereof or an equivalent one or more other mutation is indicative of a variant which exhibits a decreased sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combination thereof.

The detection of HBV or its components in cells, cell lysates, cultured supernatant fluid and bodily fluid may be by any convenient means including any nucleic acid-based detection means, for example, by nucleic acid hybridization techniques or via one or more polymerase chain reactions (PCRs). The term “bodily fluid” includes any fluid derived from the blood, lymph, tissue or organ systems including serum, whole blood, biopsy and biopsy fluid, organ explants and organ suspension such as liver suspensions. The invention further encompasses the use of different assay formats of said nucleic acid-based detection means, including restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), single-strand chain polymorphism (SSCP), amplification and mismatch detection (AMD), interspersed repetitive sequence polymerase chain reaction (IRS-PCR), inverse polymerase chain reaction (iPCR) and reverse transcription polymerase chain reaction (RT-PCR), amongst others. Other forms of detection include Northern blots, Southern blots, PCR sequencing, antibody procedures such as ELISA, Western blot and immunohistochemistry. A particularly useful assay includes the reagents and components required for immobilized oligonucleotide- or oligopeptide-mediated detection systems.

One particularly useful nucleic acid detection system is the reverse hybridization technique. In this technique, DNA from an HBV sample is amplified using a biotin or other ligand-labeled primer to generate a labeled amplificon. Oligonucleotides immobilized to a solid support such as a nitrocellulose film are then used to capture amplified DNA by hybridization. Specific nucleic acid fragments are identified via biotin or the ligand. Generally, the labeled primer is specific for a particular nucleotide variation to be detected. Amplification occurs only if the variation to be detected is present. There are many forms of the reverse hybridization assay and all are encompassed by the present invention.

Detecting HBV replication in cell culture is particularly useful.

This and other aspects of the present invention is particularly amenable to microarray analysis such as to identify oligonucleotides including sense and antisense molecules, RNAi or siRNA molecules or DNA or RNA-binding molecules which down-regulate genomic sequences or transcripts of HBV. Microarray analysis may also be used to identify particular mutations in the HBV genome such as within the HBV DNA polymerase-coding region or the HBsAg-coding region.

Another aspect of the present invention contemplates a method for detecting an agent which exhibits inhibitory activity to an HBV by:

generating a genetic construct comprising a replication competent-effective amount of the genome from the HBV contained in a plasmid vector and then transfecting said cells with said construct;

contacting the cells, before, during and/or after transfection, with the agent to be tested;

culturing the cells for a time and under conditions sufficient for the HBV to replicate, express genetic sequences and/or assemble and/or release virus or virus-like particles if resistant to said agents; and

then subjecting the cells, cell lysates or culture supernatant fluid to viral- or viral-component-detection means to determine whether or not the virus has replicated, expressed genetic material and/or assembled and/or been released in the presence of the agent.

In a preferred embodiment, the plasmid vector may include genes encoding part or all of other viral vectors such as baculovirus or adenovirus (Ren and Nassal, 2001, supra) and the method comprises:

generating a genetic construct comprising a replication competent-effective amount of the genome from the HBV contained in or fused to an amount of a baculovirus genome or adenovirus genome effective to infect cells and then infecting said cells with said construct;

contacting the cells, before, during and/or after infection, with the agent to be tested;

culturing the cells for a time and under conditions sufficient for the HBV to replicate, express genetic sequences and/or assemble and/or release virus or virus-like particles if resistant to said agent; and

then subjecting the cells, cell lysates or culture supernatant fluid to viral- or viral-component-detection means to determine whether or not the virus has replicated, expressed genetic material and/or assembled and/or been released in the presence of the agent.

In an alternative embodiment, the method comprises:

generating a continuous cell line comprising an infectious copy of the genome of the HBV in a replication competent effective amount such that said infectious HBV genome is stably integrated into said continuous cell line such as but not limited to 2.2.15 or AD;

contacting the cells with the agent to be tested;

culturing the cells for a time and under conditions sufficient for the HBV to replicate, express genetic sequences and/or assemble and/or release virus or virus-like particles if resistant to the agent; and

then subjecting the cells, cell lysates or culture supernatant fluid to viral- or viral-component-detection means to determine whether or not the virus has replicated, expressed genetic material and/or assembled and/or been released in the presence of the agent.

The above-mentioned methods are particularly useful in identifying or developing agents against HBV variants such as those carrying mutations, in one embodiment, rtS21A, rtL122F, rtN124H, rtH126R, rtT28N, rtP130Q, rtD131N and rtY135C; in another embodiment, rt/N/S/T/I/V53D, rtY126Q, rtL180M, rtS202G, rtI204V and rtI235UM; in a further embodiment, rtN53D, rtY54H, rtS57P, rtL91I, rtS116P, rtF122L, rtY124H, rtV134D, rtY141Y/F, rtL145M, rtF151F/Y, rtA181T, rtK212R, rtL217R, rtS219A, rtN236T and rtN238D; in yet another embodiment, rtS78T, rtV84M, rtY126C, rtV191I, rtM204I and rtV214A; in still another embodiment rtH90D and rtL/F108L; in even yet another embodiment, rtL157L/M, rtA181V and rtV207I; in even still another embodiment, rtL80V, rtP109S, rtI163V, rtL229M and rtN/H/A/S/Q238K; in another embodiment, rtS78S/T, rtN118N/S, rtN139N/K, rtV142E, rtA181A/T, rtI204M, rtQ/P/S/Stop215Q, rtE218K/E and rtN238N/H; in a further embodiment, sP120T, sM125T and sT127A; in yet another embodiment, sT118R, sM133T, SF134V, sI195M, sS207R and sY225Y/C; in still another embodiment, sS126T, sM133L/M, sS143S/T, sD144A, sG145A and sW172Stop; in even yet another embodiment, sN40S, sC69Stop, sM75I, sL88P, sT118A, sW182STOP, sW196L, sY206H and sY225F; in even still another embodiment, s181M and sP214Q; in another embodiment, sF83S, sL173F and sW199L; in a further embodiment, sI126T, sK160R, sS174N, sA184V, sW196L, sS210N, sF/C220L and sY221C; in yet another embodiment, sC69Stop/C, sC76Y sI110V/I, sY134N, sW172Stop/W, sW196Stop and sS207R; in still another embodiment, rtK32, rtN33, rtP34, rtH35 and rtT37; in even yet another embodiment, rtP59, rtK60, rtF61, rtA62 and rtV63; in even still another embodiment, rtD83, rtV84, rtS85, rtA86, rtY89, rtH90 and rtI/L91; in another embodiment, rtP177, rtF178, rtL179, rtL180, rtA181, rtQ182, rtF183 and rtT184; in a further embodiment, rtM204 and rtY203; in yet another embodiment, rt235, rt236, rt237, rt238 and rt239 in still another embodiment, rt247, rt248, rt249, rt250 and rt251; and in even yet another embodiment,

K32M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion; N33D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; P34S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; H35I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; T37W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion; P59S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; K60M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion; F61P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; A62R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; V63A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion; D83C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/deletion; V84A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion; S85T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/deletion; A86R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; Y89V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/deletion; H90I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; I/L91K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/deletion; P177S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; F178P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; L179K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; L180K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; A181R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; Q183E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/deletion; F183P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; T184W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion; Y203V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/deletion; M204F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/deletion; L235K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; N236D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; T237W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion; P237S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; N238D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; H238I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; A238R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; S239T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/deletion; Q238E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/deletion; K239M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion; L247K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; N248D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; H248I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; F249P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; M250F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/deletion; G251H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/deletion; and V251A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion.

Accordingly, another aspect of the present invention contemplates a method for determining whether an HBV strain exhibits reduced sensitivity to a nucleoside or nucleotide analog or other potential anti-HBV agent, said method comprising isolating DNA or corresponding mRNA from said HBV and screening for a mutation in the nucleotide sequence of the envelope genes or DNA polymerase gene selected from, in one embodiment, rtS21A, rtL122F, rtN124H, rtH126R, rtT28N, rtP130Q, rtD131N and rtY135C; in another embodiment, rt/N/S/T/I/V53D, rtY126Q, rtL180M, rtS202G, rtI204V and rtI235I/M; in a further embodiment, rtN53D, rtY54H, rtS57P, rtL91I, rtS116P, rtF122L, rtY124H, rtV134D, rtY141Y/F, rtL145M, rtF151F/Y, rtA181T, rtK212R, rtL217R, rtS219A, rtN236T and rtN238D; in yet another embodiment, rtS78T, rtV84M, rtY126C, rtV191I, rtM204I and rtV214A; in still another embodiment rtH90D and rtL/F108L; in even yet another embodiment, rtL157L/M, rtA181V and rtV207I; in even still another embodiment, rtL80V, rtP109S, rtI163V, rtL229M and rtN/H/A/S/Q238K; in another embodiment, rtS78S/T, rtN118N/S, rtN139N/K, rtV142E, rtA181A/T, rtI204M, rtQ/P/S/Stop215Q, rtE218K/E and rtN238N/H; in a further embodiment, sP120T, sM125T and sT127A; in yet another embodiment, sT118R, sM133T, SF134V, s1195M, sS207R and sY225Y/C; in still another embodiment, sS126T, sM133L/M, sS143S/T, sD144A, sG145A and sW172Stop; in even yet another embodiment, sN40S, sC69Stop, sM75I, sL88P, sT118A, sW182STOP, sW196L, sY206H and sY225F; in even still another embodiment, s181M and sP214Q; in another embodiment, sF83S, sL173F and sW199L; in a further embodiment, sI126T, sK160R, sS174N, sA184V, sW196L, sS210N, sF/C220L and sY221C; in yet another embodiment, sC69Stop/C, sC76Y sI110V/I, sY134N, sW172Stop/W, sW196Stop and sS207R; in still another embodiment, rtK32, rtN33, rtP34, rtH35 and rtT37; in even yet another embodiment, rtP59, rtK60, rtF61, rtA62 and rtV63; in even still another embodiment, rtD83, rtV84, rtS85, rtA86, rtY89, rtH90 and rtI/L91; in another embodiment, rtP177, rtF178, rtL179, rtL180, rtA181, rtQ182, rtF183 and rtT184; in a further embodiment, rtM204 and rtY203; in yet another embodiment, rt235, rt236, rt237, rt238 and rt239 in still another embodiment, rt247, rt248, rt249, rt250 and 11251; and in even yet another embodiment,

K32M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion; N33D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; P34S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; H35I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; T37W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion; P59S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; K60M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion; F61P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; A62R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; V63A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion; D83C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/deletion; V84A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion; S85T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/deletion; A86R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; Y89V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/deletion; H90I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; I/L91K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/deletion; P177S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; F178P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; L179K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; L180K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; A181R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; Q183E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/deletion; F183P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; T184W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion; Y203V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/deletion; M204F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/deletion; L235K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; N236D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; T237W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion; P237 S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; N238D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; H238I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; A238R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; S239T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/deletion; Q238E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C; K239M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L; L247K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I; N248D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R; H248I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G; F249P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M; M250F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K; G251H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/QE; and V251A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion

or combinations thereof or an equivalent one or more other mutation is indicative of a variant wherein said variant exhibits a decreased sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combination thereof.

The detection of amino acid variants of DNA polymerase is conveniently accomplished by reference to the amino acid sequence shown in Formulae I and II. The polymorphisms shown represent the variations shown in various databases for active pathogenic HBV strains. Where an HBV variant comprises an amino acid different to what is represented, then such an isolate is considered a putative HBV variant having an altered DNA polymerase activity.

The present invention further contemplates agents which inhibit ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV resistant HBV variants. Such agents are particularly useful if long term treatment by ADV, LMV, FTC and/or TFV and/or optionally other nucleoside analogs or nucleotide analogs such as TFV is contemplated by the clinician. The agents may be DNA or RNA or proteinaceous or non-proteinaceous chemical molecules. Natural product screening such as from plants, coral and microorganisms is also contemplated as a useful potential source of masking agents as is the screening of combinatorial or chemical libraries. The agents may be in isolated fowl or in the form of a pharmaceutical composition or formulation and may be administered in place of or sequentially or simultaneously with a nucleoside or nucleotide analog. Furthermore, rationale drug design is contemplated including solving the crystal or NMR structure of, for example, HBV DNA polymerase and designing agents which can bind to the enzyme's active site. This approach may also be adapted to other HBV components.

Accordingly, another aspect of the present invention contemplates a method for detecting an agent which exhibits inhibitory activity to an HBV which exhibits resistance or decreased sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combination thereof, said method comprising:

generating a genetic construct comprising a replication competent-effective amount of the genome from said HBV contained in a plasmid vector and then transfecting said cells with said construct;

contacting said cells, before, during and/or after transfection, with the agent to be tested;

culturing said cells for a time and under conditions sufficient for the HBV to replicate, express genetic sequences and/or assemble and/or release virus or virus-like particles if resistant to said agent; and

subjecting the cells, cell lysates or culture supernatant fluid to viral- or viral-component-detection means to determine whether or not the virus has replicated, expressed genetic material and/or assembled and/or been released in the presence of said agent.

Still another aspect of the present invention provides a method for detecting an agent which exhibits inhibitory activity to an HBV which exhibits resistance or decreased sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combination thereof, said method comprising:

generating a genetic construct comprising a replication competent-effective amount of the genome from said HBV contained in or fused to an amount of a baculovirus genome effective to infect cells and then infecting said cells with said construct;

contacting said cells, before, during and/or after infection, with the agent to be tested;

culturing said cells for a time and under conditions sufficient for the HBV to replicate, express genetic sequences and/or assemble and/or release virus or virus-like particles if resistant to said agent;

subjecting the cells, cell lysates or culture supernatant fluid to viral- or viral-component-detection means to determine whether or not the virus has replicated, expressed genetic material and/or assembled and/or been released in the presence of said agent.

Preferably, the HBV genome is stably integrated into the cells' genome.

Particularly useful cells are 2.2.15 cells (Price et al., Proc. Natl. Acad. Sci, USA 86(21): 8541-8544, 1989 or AD cells (also known as HepAD32 cells or HepAD79 cells [Ying et al., Viral Hepat. 7(2): 161-165, 2000.

Whilst the baculovirus vector is a particularly useful in the practice of the present invention, the subject invention extends to a range of other vectors such as but not limited to adenoviral vectors.

The present invention further extends to cell lines (e.g. 2.2.15 or AD cells) carrying genetic constructs comprising all or a portion of an HBV genome or a gene or part of a gene therefrom.

The present invention also provides for the use of the subject HBV variants to screen for anti-viral agents. These anti-viral agents inhibit the virus. The term “inhibit” includes antagonizing or otherwise preventing infection, replication, assembly and/or release or any intermediate step. Preferred anti-viral agents include nucleoside or nucleotide analogs or anti-HBV agents, however, the present invention extends to non-nucleoside molecules.

In addition, rational drug design is also contemplated to identify or generate chemical molecules which either mimic a nucleoside or which interact with a particular nucleotide sequence or a particular nucleotide. Combinatorial chemistry and two hybrid screening are some of a number of techniques which can be employed to identify potential therapeutic or diagnostic agents.

In one example, the crystal structure or the NMR structure of polymerase or the surface antigen is used to rationally design small chemical molecules likely to interact with key regions of the molecule required for function and/or antigenicity. Such agents may be useful as inhibitors of polymerase activity and/or may alter an epitope on the surface antigen.

Several models of the HBV polymerase have been prepared due to the similarity with reverse transcriptase from HIV (Das et al., J. Virol. 75(10): 4771-4779, 2001; Bartholomeusz et al., Intervirology 40(5-6): 337-342 1997; Allen et al., Hepatology 27(6): 1670-1677, 1998). The models of the HBV polymerase can be used for the rational drug design of new agents effective against HBV encoding the resistant mutations as well as wild type virus. The rational drug that is designed may be based on a modification of an existing antiviral agent such as the agent used in the selection of the HBV encoding the mutations associated with resistance. Viruses or clones expressing HBV genomic material encoding the mutations may also be used to screen for new antiviral agents.

In an alternative embodiment, the present invention also contemplates a method for detecting an agent which exhibits inhibitory activity to an HBV polymerase in an in vitro polymerase assay. The HBV polymerase activity can be examined using established assays (Gaillard et al., Antimicrob Agents Chemother. 46(4): 1005-1013, 2002; Xiong et al., Hepatology 28(6): 1669-1673, 1998).

As indicated above, microarray technology is also a useful means of identifying agents which are capable of interacting with defined HBV internal or external components. For example, arrays of HBV DNA polymerase or peptide fragments thereof carrying different amino acid variants may be used to screen for agents which are capable of binding or otherwise interacting with these molecules. This is a convenient way of determining the differential binding patterns of agents between HBV variants. Arrays of antibodies may also be used to screen for altered HBsAg molecules. Microarrays are also useful in proteomic analysis to identify molecules such as antibodies, interferons or cytokines which have an ability to interact with an HBV component. Microarrays of DNA and RNA molecules may also be employed to identify sense and antisense molecules for genetic regions on the HBV genome or transcripts thereof.

The above methods are particularly useful in identifying an inhibitor of an HBV resistant to or exhibiting reduced sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combination thereof. The present invention extends, therefore, to compositions of the inhibitors. The inhibitors may also be in the form of antibodies or genetic molecules such as ribozymes, antisense molecules and/or sense molecules for co-suppression or the induction of RNAi or may be other nucleoside or nucleotide analogs or other anti-HBV agents or derivatives of known analogs. Reference to RNAi includes reference to short, interfering RNAs (siRNA).

The term “composition” includes a “pharmaceutical composition” or a formulation.

The inhibitor is referred to below as an “active ingredient” or “active compound” and may be selected from the list of inhibitors given above.

The composition may include an antigenic component of the HBV, a defective HBV variant or an agent identified through natural product screening or rational drug design (including combinatorial chemistry).

Pharmaceutically acceptable carriers and/or diluents include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient; use thereof in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

The pharmaceutical composition may also comprise genetic molecules such as a vector capable of transfecting target cells where the vector carries a nucleic acid molecule capable of encoding an aspartyl protease inhibitor. The vector may, for example, be a viral vector.

Pharmaceutical forms suitable for injectable use include sterile aqueous solutions (where water soluble) and sterile powders for the extemporaneous preparation of sterile injectable solutions. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dilution medium comprising, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof and vegetable oils. The proper fluidity can be maintained, for example, by the use of superfactants. The preventions of the action of microorganisms can be brought about by various antibacterial and anti-fungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thirmerosal and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminium monostearate and gelatin.

Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with the active ingredient and optionally other active ingredients as required, followed by filtered sterilization or other appropriate means of sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, suitable methods of preparation include vacuum drying and the freeze-drying technique which yield a powder of active ingredient plus any additionally desired ingredient.

When the active ingredient is suitably protected, it may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard or soft shell gelatin capsule, or it may be compressed into tablets. For oral therapeutic administration, the active ingredient may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers and the like. Such compositions and preparations should contain at least 1% by weight of active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 5 to about 80% of the weight of the unit. The amount of active compound in such therapeutically useful compositions is such that a suitable dosage will be obtained. Preferred compositions or preparations according to the present invention are prepared so that an oral dosage unit form contains between about 0.1 μg and 200 mg of active compound. Alternative dosage amounts include from about 1 μg to about 1000 mg and from about 10 μg to about 500 mg. These dosages may be per individual or per kg body weight. Administration may be per hour, day, week, month or year.

The tablets, troches, pills, capsules and the like may also contain the components as listed hereafter. A binder such as gum, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose or saccharin may be added or a flavouring agent such as peppermint, oil of wintergreen or cherry flavouring. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills or capsules may be coated with shellac, sugar or both. A syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and a flavouring. Of course, any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts employed. In addition, the active compound(s) may be incorporated into sustained-release preparations and formulations.

As stated above, the present invention further extends to an isolated HBsAg from the HBV variants herein described. More particularly, the present invention provides an HBsAg or a recombinant form thereof or derivative or chemical equivalent thereof. The isolated surface component and, more particularly, isolated surface antigen or its recombinant, derivative or chemical equivalents are useful in the development of biological compositions such as vaccine formulations.

Yet another aspect of the present invention provides a composition comprising a variant HBV resistant to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or an HBV surface antigen from said variant HBV or a recombinant or derivative form thereof or its chemical equivalent and one or more pharmaceutically acceptable carriers and/or diluents. Such a composition may be regarded as a therapeutic composition and is useful in generating an immune response including a humoral response. Generally, the HBV variants are “defective” and in themselves are unable to cause a sustained infection in a subject.

As indicated above, antibodies may be generated to the mutant HBV agents and used for passive or direct vaccination against infection by these viruses. The antibodies may be generated in humans or non-human animals. In the case of the latter, the non-human antibodies may need to be deimmunized or more specifically humanized prior to use. Deimmunized may include, for example, grafting complementarity determining regions (CDRs) from the variable region of a murine or non-human animal anti-HBV antibody onto a human consensus fragment antibody binding (Fab) polypeptide. Alternatively, amino acids defining epitopes in the variable region of the antibody may be mutated so that the epitopes are no longer recognized by the human MHC H complex.

Insofar as ribozyme, antisense or co-suppression (RNAi) or siRNA or complexes thereof repression is concerned, this is conveniently aimed at post-transcription gene silencing. DNA or RNA may be administered or a complex comprising RNAi or a chemical analog thereof specific for HBV mRNA may be employed.

All such molecules may be incorporated into pharmaceutical compositions.

In another embodiment, the present invention provides a biological composition comprising a variant HBV or an HBsAg or L, M or S proteins from said variant HBV or a recombinant or derivative form thereof or its chemical equivalent.

Generally, if an HBV is used, it is first attenuated. The biological composition according to this aspect of the present invention generally further comprises one or more pharmaceutically acceptable carriers and/or diluents.

The biological composition may comprise HBsAg or like molecule from one HBV variant or the composition may be a cocktail of HbsAgs or L, M or S proteins or like molecules from a range of ADV- and/or LMV- and/or, FTC- and/or TFV-resistant HBV variants. Similar inclusions apply where the composition comprises an HBV.

The present invention is further directed to the use of defective HBV variants in the manufacture of therapeutic vaccines to vaccinate individuals against infection by HBV strains having a particular nucleotide sequence or encoding a particular polymerase or surface antigen or L, M or S proteins.

Examples of suitable vaccine candidates are defective forms of HBV variants comprising a mutation selected from, in one embodiment, rtS21A, rtL122F, rtN124H, rtH126R, rtT28N, rtP130Q, rtD131N and rtY135C; in another embodiment, rt/N/S/T/I/V53D, rtY126Q, rtL180M, rtS202G, rtI204V and rtI235I/M; in a further embodiment, rtN53D, rtY54H, rtS57P, rtL91I, rtS116P, rtF122L, rtY1241-1, rtV134D, rtY141Y/F, rtL145M, rtF151F/Y, rtA181T, rtK212R, rtL217R, rtS219A, rtN236T and rtN238D; in yet another embodiment, rtS78T, rtV84M, rtY126C, rtV191I, rtM2041 and rtV214A; in still another embodiment rtH90D and rtL/F108L; in even yet another embodiment, rtL157L/M, rtA181V and rtV207I; in even still another embodiment, rtL80V, rtP109S, rtI163V, rtL229M and rtN/H/A/S/Q238K; in another embodiment, rtS78S/T, rtN118N/S, rtN139N/K, rtV142E, rtA181A/T, rtI204M, rtQ/P/S/Stop215Q, rtE218K/E and rtN238N/H; in a further embodiment, sP120T, sM125T and sT127A; in yet another embodiment, sT118R, sM133T, SF134V, sI195M, sS207R and sY225Y/C; in still another embodiment, sS126T, sM133L/M, sS143S/T, sD144A, sG145A and sW172Stop; in even yet another embodiment, sN40S, sC69Stop, sM75I, sL88P, sT118A, sW182STOP, sW196L, sY206H and sY225F; in even still another embodiment, s181M and sP214Q; in another embodiment, sF83S, sL173F and sW199L; in a further embodiment, sI126T, sK160R, sS174N, sA184V, sW196L, sS210N, sF/C220L and sY221C; in yet another embodiment, sC69Stop/C, sC76Y sI110V/I, sY134N, sW172Stop/W, sW196Stop and sS207R; in still another embodiment, rtK32, rtN33, rtP34, rtH35 and rtT37; in even yet another embodiment, rtP59, rtK60, rtF61, rtA62 and rtV63; in even still another embodiment, rtD83, rtV84, rtS85, rtA86, rtY89, rtH90 and rtI/L91; in another embodiment, rtP177, rtF178, rtL179, rtL180, rtA181, rtQ182, rtF183 and rtT184; in a further embodiment, rtM204 and rtY203; in yet another embodiment, rt235, rt236, rt237, rt238 and rt239 in still another embodiment, rt247, rt248, rt249, rt250 and rt251; and in even yet another embodiment,

K32M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion; N33D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; P34S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; H35I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; T37W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion; P59S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; K60M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion; F61P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; A62R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; V63A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion; D83C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/deletion; V84A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion; S85T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/deletion; A86R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; Y89V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/deletion; H90I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; I/L91K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/deletion; P177S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; F178P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; L179K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; L180K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; A181R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; Q183E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/deletion; F183P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; T184W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion; Y203V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/deletion; M204F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/deletion; L235K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; N236D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; T237W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion; P237S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; N238D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; H238I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; A238R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; S239T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/deletion; Q238E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/deletion; K239M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion; L247K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; N248D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; H248I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; F249P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; M250F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/deletion; G251H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E; and V251A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion

or a combination of two or more mutations.

In one embodiment, for example, an HBV variant may be identified having a particular mutation in its polymerase conferring resistance or decreased sensitivity to a nucleoside analog. This variant may then be mutated to render it defective, i.e. attenuated or unable to cause infection. Such a defective, nucleoside analog-resistant virus may then be used as a therapeutic vaccine against virulent viruses having the same mutation in its polymerase.

The subject invention extends to kits for assays for variant HBV resistant to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV ADV and LMV and FTC, or ADV and FTC and LMV and TFV. Such kits may, for example, contain the reagents from PCR or other nucleic acid hybridization technology or reagents for immunologically based detection techniques. A particularly useful assay includes the reagents and components required for immobilized oligonucleotide- or oligopeptide-mediated detection systems.

Still another aspect of the present invention contemplates a method for determining the potential for an HBV to exhibit reduced sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV and/or optionally other nucleoside or nucleotide analogs or other anti-HBV agents or combination thereof, said method comprising isolating DNA or corresponding mRNA from said HBV and screening for a mutation in the nucleotide sequence encoding HBV DNA polymerase resulting in at least one amino acid substitution, deletion and/or addition in any one or more of domains F and G, and domains A through to E or a region proximal thereto of said DNA polymerase and associated with resistance or decreased sensitivity to ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV, wherein the presence of such a mutation is an indication of the likelihood of resistance to said ADV, LMV, TFV, or FTC, or ADV and LMV, ADV and TFV, LMV and TFV, FTC and ADV, FTC and TFV, FTC and LMV, or ADV and LMV and TFV, or ADV and FTC and TFV, TFV and FTC and LMV, ADV and LMV and FTC, or ADV and FTC and LMV and TFV.

An assessment of a potential viral variant is important for selection of an appropriate therapeutic protocol. Such an assessment is suitably facilitated with the assistance of a computer programmed with software, which inter alia adds index values (I_Vs) for at least two features associated with the viral variants to provide a potency value (P_A) corresponding to the resistance or sensitivity of a viral variant to a particular chemical compound or immunological agent. The I_Vs can be selected from (a) the ability to exhibit resistance for reduced sensitivity to a particular compound or immunological agent; (b) an altered DNA polymerase from wild-type HBV; (c) an altered surface antigen from wild-type HBV; or (d) morbidity or recovery potential of a patient. Thus, in accordance with the present invention, I_Vs for such features are stored in a machine-readable storage medium, which is capable of processing the data to provide a P_Afor a particular viral variant or a biological specimen comprising same.

Thus, in another aspect, the invention contemplates a computer program product for assessing the likely usefulness of a viral variant or biological sample comprising same for determining an appropriate therapeutic protocol in a subject, said product comprising:

(1) code that receives as input I_Vs for at least two features associated with said viral agents or biological sample comprising same, wherein said features are selected from:

(a) the ability to exhibit resistance for reduced sensitivity to a particular compound or immunological agent;

(b) an altered DNA polymerase from wild-type HBV;

(c) an altered surface antigen from wild-type HBV;

(d) morbidity or recovery potential of a patient; or

(e) altered replication capacity (increased or decreased);

(2) code that adds said I_Vs to provide a sum corresponding to a P_Vfor said viral variants or biological samples; and

(3) a computer readable medium that stores the codes.

In a related aspect, the invention extends to a computer for assessing the likely usefulness of a viral variant or biological sample comprising same in a subject, wherein said computer comprises:

(1) a machine-readable data storage medium comprising a data storage material encoded with machine-readable data, wherein said machine-readable data comprise I_Vs for at least two features associated with said viral variant or biological sample; wherein said features are selected from:

(a) the ability to exhibit resistance for reduced sensitivity to a particular compound or immunological agent;

(b) an altered DNA polymerase from wild-type HBV;

(c) an altered surface antigen from wild-type HBV;

(d) morbidity or recovery potential of a patient; or

(e) altered replication capacity (increased or decreased);

(2) a working memory for storing instructions for processing said machine-readable data;

(3) a central-processing unit coupled to said working memory and to said machine-readable data storage medium, for processing said machine readable data to provide a sum of said I_Vs corresponding to a P_Vfor said compound(s); and

(4) an output hardware coupled to said central processing unit, for receiving said P_V.

Any general or special purpose computer system is contemplated by the present invention and includes a processor in electrical communication with both a memory and at least one input/output device, such as a terminal. FIG. 19 shows a generally suitable computer system. Such a system may include, but is not limited, to personal computers, workstations or mainframes. The processor may be a general purpose processor or microprocessor or a specialized processor executing programs located in RAM memory. The programs may be placed in RAM from a storage device, such as a disk or pre-programmed ROM memory. The RAM memory in one embodiment is used both for data storage and program execution. The computer system also embraces systems where the processor and memory reside in different physical entities but which are in electrical communication by means of a network.

In an alternative embodiment, the program screens for a mutation selected from, in one embodiment, rtS21A, rtL122F, rtN124H, rtH126R, rtT28N, rtP130Q, rtD131N and rtY135C; in another embodiment, rt/N/S/T/I/V53D, rtY126Q, rtL180M, rtS202G, rtI204V and rtI235I/M; in a further embodiment, rtN53D, rtY54H, rtS57P, rtL91I, rtS116P, rtF122L, rtY124H, rtV134D, rtY141Y/F, rtL145M, rtF151F/Y, r/A181T, rtK212R, rtL217R, rtS219A, rtN236T and rtN238D; in yet another embodiment, rtS78T, rtV84M, rtY126C, rtV191I, rtM204I and rtV214A; in still another embodiment rtH90D and rtL/F108L; in even yet another embodiment, rtL157L/M, rtA181V and rtV207I; in even still another embodiment, rtL80V, rtP109S, rt1163V, rtL229M and rtN/H/A/S/Q238K; in another embodiment, rtS78S/T, rtN118N/S; rtN139N/K, rtV142E, rtA181A/T, rt1204M, rtQ/P/S/Stop215Q, rtE218K/E and rtN238N/H; in a further embodiment, sP120T, sM125T and sT127A; in yet another embodiment, sT118R, sM133T, SF134V, sI195M, sS207R and sY225Y/C; in still another embodiment, sS126T, sM133L/M, sS143S/T, sD144A, sG145A and sW172Stop; in even yet another embodiment, sN40S, sC69Stop, sM75I, sL88P, sT118A, sW182STOP, sW196L, sY206H and sY225F; in even still another embodiment, s181M and sP214Q; in another embodiment, sF83S, sL173F and SW199L; in a further embodiment, sI126T, sK160R, sS174N, sA184V, sW196L, sS210N, sF/C220L and sY221C; in yet another embodiment, sC69Stop/C, sC76Y sI110V/I, sY134N, sW172Stop/W, sW196Stop and sS207R; in still another embodiment, rtK32, rtN33, rtP34, rtH35 and rtT37; in even yet another embodiment, rtP59, rtK60, rtF61, rtA62 and rtV63; in even still another embodiment, rtD83, rtV84, rtS85, rtA86, rtY89, rtH90 and rtI/L91; in another embodiment, rtP177, rtF178, rtL179, rtL180, rtA181, rtQ182, rtF183 and rtT184; in a further embodiment, rtM204 and rtY203; in yet another embodiment, rt235, rt236, rt237, rt23S and rt239 in still another embodiment, rt247, rt248, rt249, rt250 and rt251; and in even yet another embodiment,

K32M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion; N33D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; P34S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; H35I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; T37W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion; P59S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; K60M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion; F61P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; A62R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; V63A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion; D83C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/deletion; V84A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion; S85T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/deletion; A86R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; Y89V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/deletion; H90I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; I/L91K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/deletion; P177S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; F178P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; L179K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; L180K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; A181R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; Q183E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/deletion; F183P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; T184W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion; Y203V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/deletion; M204F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/deletion; L235K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; N236D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; T237W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/deletion; P237S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/deletion; N238D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; H238I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; A238R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/deletion; S239T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/deletion; Q238E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/deletion; K239M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/deletion; L247K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/deletion; N248D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/deletion; H248I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/deletion; F249P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/deletion; M250F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/deletion; G251H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E; and V251A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/deletion

or a combination of two or more mutations.

The present invention is further described by the following non-limiting Examples.

Example 1 Overlapping Genome of HBV

The overlapping genome of HBV is represented in FIG. 1. The gene encoding DNA polymerase (P), overlaps the viral envelope genes, Pre-S 1 and Pre-S2, and partially overlaps the X and core (C) genes. The HBV envelope comprises small, middle and large proteins HBV surface antigens. The large protein component is referred to as the HBV surface antigen (HBsAg) and is encoded by the S gene sequence. The Pre-S1 and Pre-S2 gene sequences encode the other envelope components.

Example 2 Patients and Treatment

Patient A, a 48 year old Lebanese woman was initially referred for evaluation of thrombocytopenia and hepatosplenomegaly. At this time the patient had abnormal LFT's (ALT 67 U/L, normal <55) and the HBV DNA was 61 pg/ml (231 days prior to the start of treatment). The patient was HBsAg and HBeAg positive. The ALT's fluctuated between 50-70 IU/L from (−231 to −35 days pretreatment). ADV was commenced on Day 0 in a clinical trial on 30 mg/day. HBV DNA levels were reduced with ADV treatment. The ADV treatment was reduced to 10 mg/day (144 days post-treatment). There was a problem with the randomization treatment protocol. The patient was on antiviral treatment for 1 month only during the second year of the treatment period. The study was completed on Day 679 post ADV treatment. The patient was not on ADV treatment until the open label ADV was recommenced on Day 875 from the start of the initial ADV treatment. This second period of ADV treatment was given for 108 days (day 983 post initial ADV treatment). The HBV DNA levels remained at 7-10 pg/ml (1.96×10⁵to 2.8×10⁵copies/ml). At Day 983, ADV treatment was stopped and the patient was treated with LMV.

Patient B is a male liver transplant patient. The patient has been on both sequential and combination antiviral therapy including HBIG, FCV+HBIG, LMV+HBIG, LMV, LMV+GCV, LMV+FCV+GCV, LMV+GCV and finally LMV+ADV. The patient has been on long term ADV+LMV treatment for over 795 days. Patient C, is a 58 year old male. Prior to ADV treatment the patient had abnormal LFT's (ALT 240 IU/L, normal <55) and the HBV DNA was 2×10⁷copies/ml. ADV was commenced on Day 0 in a clinical trial on 10 mg/day for two years. The average ALT during the two year clinical trial period ws 114 IU/L. However, the ALT was rising and at 630 days after the start of ADV treatment the ALT remained high 407 IU/L. Open label ADV was commenced on Day 668 from the start of the initial ADV treatment. This second period of ADV treatment was given for 71′ days. The HBV DNA levels remained high during open label ADV treatment (3.7×10⁶to 1.5 10⁷copies/ml). The peak ALT during open label ADV treatment was 517 IU/L (Day 738). The next day (Day 739), ADV treatment was stopped and the patient was treated with LMV.

Example 3 Detection of Viral Markers

Hepatitis B surface antigen (HBsAg), hepatitis B e antigen (HBeAg), anti-HBe and hepatitis B core antigen (HBcAg) specific IgG and IgM were measured using commercially available immunoassays (Abbott Laboratories, North Chicago, Ill., USA). Hepatitis B viral DNA levels were measured using a capture hybridization assay according to the manufacturer's directions (Digene Hybrid Capture II, Digene Diagnostics Inc., Beltsville, Md.). The manufacturers stated cut-off for detecting HBV viremia in clinical specimens was 0.7×10⁶copies/ml or 2.5 pg/ml, [Hendricks et al., Am J Clin Pathol 104: 537-46, 1995]. HBV DNA levels can also be quantitated using other commercial kits such as Cobas amplification HBV monitor kit (Roche).

Example 4 Sequencing of HBV DNA

HBV DNA was extracted from 100 μl of serum as described previously by Aye et al., J. Hepatol. 26: 1148-1153, 1997. Oligonucleotides were synthesized by Geneworks, Adelaide, Australia. Amplification of the HBV polymerase gene has been described by Aye et al., 1997, supra.

The specific amplified products were purified using PCR purification columns from MO BIO Laboratories Inc (La Jolla, Calif.) and directly sequenced using Big Dye terminator Cycle sequencing Ready Reaction Kit (Perkin Elmer, Cetus Norwalk, Conn.). The PCR primers were used as sequencing primers, OS1 5′-GCC TCA TTT TGT GGG TCA CCA TA-3′ (nt 1408-1430) [SEQ ID NO:3], TTA3 5′-AAA. TTC GCA GTC CCC AAA-3′(nt2128-2145) [SEQ ID NO:4], JM 5′-TTG GGG TGG AGC CCT CAG GCT-3′(nt1676-1696) [SEQ ID NO:5], TTA4 5′-GAA AAT TGG TAA CAG CGG-3′ (nt 2615-2632) [SEQ ID NO:6], OS2 5′ TCT CTG ACA TAC TTT CCA AT 3′ (nt 2798-2817) [SEQ ID NO:7], to sequence the internal regions of the PCR products.

Example 5 Analysis of HBV DNA

Patient A: During ADV treatment, unique HBV mutations were detected by sequencing (Tables 4 and 5) This includes the unique mutation at rtY135C in addition to the mutation at rtT128N that was present prior to ADV treatment. A number of other unique changes were also detected in the polymerase and in the overlapping envelope gene (Table 5, FIGS. 4, 5 and 6). The unique change in the HBsAg include sP120T. These unique changes were compared to reference sequences from each of the seven genotypes A-G as well as a consensus sequence from pretreatment samples to determine unique changes.

Patient B: The HBV mutations prior to ADV treatment and during ADV treatment are listed in Table 6 and 7 and FIGS. 7, 8, and 9. The unique changes in the rt region of the HBV DNA polymerase include rtN/S/T/I/V53D, rtY126Q, rtL180M, rtS202G, rt1204V and rtI235I/M. The unique changes in the HBsAg include sT118R, sM133T, sF134V, sI195M, sS207R, sY225Y/C.

Patient C: The HBV mutations prior to ADV treatment and during ADV treatment are listed in Tables 8 and 9 and FIGS. 10, 11 and 12. The unique changes in the rt region of the HBV DNA polymerase include rtN53D, rtS116P, rtF151F/T, rtN236T and rtN238D. The unique changes in the HBsAg include sG145A and sW172stop.

Patient D: The HBV mutations during ADV treatment is listed in Table 10 and FIGS. 13, 14 and 15. The unique changes in the HBV DNA polymerase include rtS78T, rtV84M, rtY126C, rtV191I, rtM2041 and rtV214A. The unique changes in the surface include sN40S and sC69 Stop. A number of unique changes were detected after the stop codon mutation at codon 69 of the S gene including sM75I, sL88P, sT118A, sW182stop, sW196L, sY206H and sY225F.

Patient E: The HBV mutations during ADV treatment is listed in Table 11 and FIGS. 16, 17 and 18. The unique changes in the HBV DNA polymerase include rtH90D and rtL/F108L. The unique changes in the surface include sI81M and sP214Q. A six nucleotide insertion was also detected resulting in a two amino acid insertion in the HBV polymerase and envelope gene at codons rt131 and s122, respectively. This insertion was previously detected in pre-ADV samples.

Example 6 Adefovir Dipivoxil (ADV)

ADV (formerly Bis-pom PMEA)) is a potent inhibitor of HBV replication. The structure of ADV is shown in FIG. 2 and its synthesis is described by Benzaria et al., J Med. Chem. 39: 4958-4965, 1996).

Example 7 HBV rt Mutants

The HBV polymerase has similarities to other polymerases including HIV. Thus, mutations associated with resistance to antiviral agents may occur within the polymerase in functionally important regions such as the nucleotide triphosphate binding pocket that may also include the interaction between the DNA primer and template strand, magnesium ions and nucleoside triphosphates or nucleoside/nucleotide analogs (and there various phosphroylated forms). Codons which are proposed to be mutated during anti-viral selection pressure are rtK32, rt N33, rtP34, rtH35 and rtT37 (that are upstream from the F domain); rt P59, rtK60, rtF61, rtA62 and rtV63 (between the F and A domains), rtD83, rtVS4, rtS85, rtA86, rt Y89, rt H90 and rtI/L91 (within the A domain and the region immediately prior to and after), rtP177, rtF178, rt L179, rtL180, rtA181, rtQ182, rtF183 and rtT184 (B domain); rtM204 and rtY203 (C Domain), rtL235, rtN236, rtP/T237, rtN/H/A/S/Q238 and rtK239 (D Domain), rLt247, rtN/H248, rtF249, rtM250 and rtG251 (E Domain). The codons are defined in Table 12 and examples of various mutants are given in Tables 13 and 14.

Example 8 Patient F

The HBV mutations during ADV treatment of Patient F are listed in Table 15 and FIGS. 20, 21 and 22. The unique changes in the HBV DNA polymerase includes rtL157L/M, rtA181V, rtV2071, and rtN236T. The unique changes in the surface includes sF83S, sL173F and sW199L.

Example 9 Patient G

The HBV mutations during ADV treatment of Patient G are listed in Table 16 and FIGS. 23, 24 and 25. The unique changes in the HBV DNA polymerase includes rtL80V, rtP109S, rtI163V, rtM2041, rtL229M and rtN/H/A/S/Q238K. The unique changes in the surface includes sI126T, sK160R, sS174N, sA184V, sW196L, sS210N, sF/C220L and sY221C.

Example 10 Patient H

The HBV mutations during ADV treatment in Patient H are listed in Table 17 and FIGS. 26, 27 and 28. The unique changes in the HBV DNA polymerase includes rtS78S/T, rtN118N/S, rtN139N/K, rtV142E, rtA181A/T, rtI204M, rtQ/P/S/Stop215Q, rtE218K/E, and rtN238N/H. The unique changes in the surface include sC69Stop/C, sC76Y sI110V/I, sY134N, sW172Stop/W, sW196Stop and sS207R.

Example 11 In Vitro Analysis of ADV Resistance

The sensitivity/resistance profile of HBV mutants to ADV was examined in vitro using recombinant HBV/baculovirus. The procedure for analyzing the resistance profile is outlined in the following Examples 12-20.

Example 12 Cell Culture

Sf21 insect cells were maintained in supplemented Grace's insect medium further supplemented with 10% v/v heat-inactivated fetal bovine serum (Gibco BRL, Gaithersburg, Md.) in humidified incubator at 28° C. with CO₂. HepG2 cells were maintained in minimal essential medium supplemented with 10% v/v heat-inactivated fetal bovine serum (MEM-FBS). HepG2 cells were grown in humidified 37° C. incubators at 5% v/v CO₂.

Example 13 Preparation of HBV/Baculovirus Transfer Vector with Specific Point Mutations

The recombinant HBV/baculovirus system used for antiviral testing has been previously described (Delaney et al., Antimicrob Agents Chemother 45(6): 17054013, 2001). In brief, the recombinant transfer vector was created by excising a fragment containing the 1.3× HBV genome construct and cloning it into the multiple cloning region of a baculovirus vector pBlueBac4.5 (Invitrogen, Carlsbad, Calif.). Point mutations were created by site directed mutagenesis using the commercial kits according to the manufacturer's specifications (QuikChange, Stratagene). HBV/baculovirus recombinant clones encoding the reverse transcriptase mutations rtA181T/N236T/N238D and rtN236T/N236D in combination with the precore mutation at G1896A (pcW28 stop) or wild-type with respect to codon pcW28, were prepared by site-directed mutagenesis. The nucleotide sequence of the plasmid and the point mutations generated by site directed mutagenesis were confirmed by sequencing using the ABI Prism Big Dye Terminator Cycle Sequencing Ready Reaction Kit according to the manufacturer's specifications (Perkin Elmer, Cetus Norwalk, Conn.).

Example 14 Generation of Recombinant Baculoviruses Containing the 1.3 HBV Construct

Purified recombinant transfer vector and linear AcMNPV baculovirus DNA were co-transfected into Sf21 cells using the BacNBlue transfection kit from Invitrogen (Carlsbad, Calif.); recombinant viruses were isolated by plaque assay according to the manufacturer's instructions. A series of recombinant viruses were amplified from isolated plaques by infecting 100-mm dishes of Sf21 cells. Viral DNA was extracted from amplified viruses using standard procedures. Purified viral DNA was digested with restriction enzymes and then fractionated by electrophoresis in a 1% v/v agarose gel. Southern blotting was performed to deteiuiine which virus isolates contained the intact 1.3 HBV construct. A Boehringer Mannheim Random Prime DNA Labeling kit (Indianapolis, Ind.) was used to generate [P³²]-radiolabeled probes. A full-length double-stranded HBV genome was used as a template for all radiolabeled probes. Viral DNA sequence was confirmed by PCR amplification of the polymerase catalytic region using the sense primer 5′-GCC TCA TTT TGT GGG TCA CCA TA-3′ [SEQ ID NO:8], (nucleotide 1408 to 1430 according to HBV Genebank Accession number M38454) and the antisense primer 5′-TCT CTG ACA TAC TTT CCA AT-3′ [SEQ ID NO:9] (nucleotides 2817 to 2798 according to HBV Genebank Accession number M38454). The following primers were utilized for the sequencing of internal regions 5′-TGC ACG ATT CCT GCT CAA-3′ [SEQ ID NO:10] (nucleotides 2345-2362 according to HBV Genebank Accession number M38454) and 5′-TTT CTC AAA GGT GGA GAC AG-3′ [SEQ ID NO:11] (nucleotides 1790-1810 according to HBV Genebank Accession number M38454).

Example 15 Preparative Baculovirus Amplification and Purification

Baculoviruses were amplified by infecting suspension cultures of Sf21 cells in log phase at a multiplicity of infection (moi) of 0.5 pfu/cell. Infections were allowed to proceed until a majority of the cells in the flasks showed visible signs of infection (four to five days). Virions were concentrated from infected Sf21 medium by centrifugation at 80,000×g and purified through a 20-60% w/v sucrose gradient. Purified virus was titrated in quadruplicate in Sf21 cells by end-point dilution. An aliquot of each high titer stock was used for DNA extraction. The polymerase gene was amplified and sequenced to confirm the presence of the site-directed mutagenesis as in Example 14.

Example 16 Infection of HepG2 Cells with Recombinant HBV Expressing Baculovirus

HepG2 cells were seeded at approximately 20-40% confluency and then were grown for 16-24 hours before infection. On the day of infection, triplicate plates of cells were trypsinized, and viable cell number was determined with a hemocytometer using Trypan blue exclusion. Average cell counts were calculated and used to determine the volume of high-titer viral stock necessary to infect cells at the indicated moi. HepG2 cells were washed one time with serum-free MEM to remove traces of serum. Baculovirus was diluted into MEM without serum to achieve the appropriate moi using volumes of 1.0, 0.5, and 0.25 ml to infect 100-mm, 60 mm, and 35-mm dishes, respectively. Baculovirus was adsorbed to HepG2 cells for one hour at 37° C. with gentle rocking every 15 minutes to ensure that the inoculum was evenly distributed. The inoculum was then aspirated and HepG2 cells were washed two times with phosphate-buffered saline and refed MEM-FBS with or without various concentrations of agents.

Example 17 Detection of Intracellular Replicative Intermediates

HBV core particles were isolated from the cytoplasmic fraction of HepG2 cells lysed in 0.5% w/v NP-40. Cytoplasmic extracts were adjusted to 10 mmol/1 McC12 and unprotected DNA was removed by an incubation to 500 g/ml Proteinase K for 1.5 hours at 37° C. 1113V DNA in the samples were then extracted using commercial DNA extraction kits such as Qiagen (DNA extraction) or in-house methods using sequential phenol and chloroform extractions, and the nucleic acids were recovered by ethanol precipitation. Nucleic acids were resuspended in 50 μl/l TE (10 mmol/1 Tris, 1 mmol/l ethylenediaminetetraacetic acid), normalized by OD260, and digested with 100 g/ml. RNase (Boehringer Mannheim, Indianapolis, Ind.) for one hour at 37° C. before analysis by real-time PCR or electrophoresis and Southern blotting. After southern blot analysis a BioRad GS-670 imaging densitometer and the Molecular Analyst software (BioRad, Hecules Calif.) was used to analyze suitable exposures of Southern blots. Densitometry data was fitted to logistic dose response curves using the TableCurve 2D software package from Jandel Scientific. Logistic dose response equations were used to calculate IC₅₀and IC₉₀values and co-efficients of variation.

Example 18 Real-Time PCR

For the real-time PCR based assay for HBV, HBV DNA was extracted from 200 μl of serum using the QIAamp DNA Mini Kit according to the manufacturer's instructions (QIAGEN GmbH, lindens, Germany). Primers and a molecular beacon were designed for conserved nucleic acid sequences within the precore domain of the HBV genome to amplify and detect a 216-nucleotide product. Amplification was performed in a 50-μl reaction mixture containing 1.0 Taqman buffer A (Applied Biosystems, Foster City, Calif.), 3.0 mM MgCl, 0.4 pmol of each primer per μL, forward primer, PC1 (5′-GGGAGGAGATTAGGTTAA-3′ [SEQ ID NO:12]) and reverse primer, PC2 (5′-GGCAAAAACGAGAGTAACTC-3 ‘ [SEQ ID NO:13]), 0.4 μmol of the HBV-specific molecular beacon per μL, (5’-FAM-CGCGTCCTACTGTTCAAGCCTCCAAGCTGT GACGCG-DABCYL-3′ [SEQ ID NO:14]; where FAM represents fluorophore 6-carboxyfluorescein and DABCYL, 4-dimethylaminophenylazobenzoic acid, a quenching chromophore) and 1.25 U of AmpliTaq Gold DNA polymerase (Perkin-Elmer). PCR was performed using the ABI PRISM 7700 spectrofluorometric thermocycler (Applied Biosystems). The PCR program consisted of an initial cycle (95° C. for 10 minutes) followed by 45 amplification cycles (94° C. for 15 secs, 50° C. for 30 secs, 72° C. for 30 secs). The instrument detected and recorded the fluorescence spectrum of each reaction tube during the annealing phase.

An external standard was constructed by ligation of a 1.3 kB wild-type HBV plasmid (genotype D) into the pBlueBac plasmid vector (Hershey Medical Center, Hershey, Pa.). Quantification of the DNA concentration of the plasmid was determined by spectrophotometry. Duplicates of serial 10-fold dilutions of the plasmid ranging from 10⁸copies/ml to 100 copies/ml were included in each run in order to generate a standard curve.

The copy number in each experimental reaction was determined by interpolation of the derived threshold cycle (C_T).

Example 19 ADV Treatments

ADV was resuspended in sterile water, aliquoted, and frozen at −20° C. to avoid repeated freezing and thawing of the drug. Medium containing ADV was prepared daily as needed using fresh aliquots of 3TC. In experiments in which ADV treatment was initiated after viral infection, HepG2 cells were exposed to the indicated concentration of ADV immediately after infection with HBV baculovirus. In experiments utilizing pretreatment with ADV, cells were fed medium containing ADV 16 hours prior to HBV baculovirus infection, HBV baculovirus infection was also carried out in medium containing ADV, and cells were refed fresh medium containing ADV immediately after completion of the infection and washing procedures.

Example 20 Antiviral Testing Performed with Wild-Type and HBV/Baculovirus Encoding rtA181T/N236T/N238D and rtN236T/N236D

The in vitro antiviral drug cross-resistance testing of the HBV mutants is shown in Table 18. The laboratory reference strain of HBV (genotype D subtype ayw) containing the introduced D domain mutations demonstrated increased IC₅₀values against ADV (Table 18). The rt N236T/N238D mutation was associated with a twenty-three fold increase in IC₅₀against ADV. This was reduced to a five-fold increase when the rtA181T was also present and this triple HBV polymerase mutant was resistant to LMV.

TABLE 4 Clinical, virological and HBV sequencing data summary for Patient A while on open label ADV. Days HBV DNA Key polymerase post-ADV copies/ml ALT Treatment mutations detected by treatment (pg/ml) IU/L protocol sequencing¹ −230 1.7 10⁶(61) 67 U/L pre-therapy rtT/N128T/N rtQ/H/R215Q/stop 875 ADV recommenced 904 1.55 × 10⁶ 932 2.97 × 10⁶ 959 1.76 × 10⁶ 983 1.64 × 10⁶ 65 end ADV rtT128N rtY135C ¹Nomenclature according to Stuyver et al., 2001, supra

TABLE 5 Summary of HBV mutations in patient A treated with ADV Days Sample post-ADV Days Sample post-ADV name treatment Genotype Polymerase* Surface ILA1 −230 D rtA/S21A/S sP120P/T rtT/N128T/N** sI208I/L rtQ/H/R215Q/stop ILA2 904 D rtA/S21S sP/T120P rtF122L sT125M rtR126H sI/1208I/L rtT/N128T/N rtQ130P rtN131D rtQstop/215Q rtH248N ILA3 932 D rtA/S21S sP/T120P rtF122L sT125M rtR126H sI/1208I/L rtT/N128T/N rtQ130P rtN131D rtQstop/215Q rtH248N ILA4 983 D rtS21A sP120T rtL122F sM125T rtN124H sT127A rtH126R rtT128N rtP130Q rtD131N rtY135C *Nomenclature according to Stuyver et al., 2001, supra. **Mutations in bold have not been detected in reference HBV genotypes, mutations not in bold are changes from the previous sample that are present in reference genotypes.

TABLE 6 Clinical, virological and HBV sequencing data summary for Patient B while on open label ADV. Days HBV DN Key polymerase post-ADV copies/ml ALT Treatment mutations detected by treatment (pg/ml) IU/L protocol sequencing¹ −867(S0) 183 298 pre-therapy rtN/S/T/I/V53D rtV153G rtQ/E215S rtN248H −8(S6) 955 427 pre-ADV on rtI/L80L LMV rtY126Q rtL180M rtS202G rtI204V 76(S8) not detected 150 on ADV rtN/S/T/I/V53D (20 mg) rtY126Q and LMV rtL180M rtS202G rtI204V 637(S12) not detected 36 on ADV rtN/S/T/I/V53D (5 mg) rtY126Q and LMV rtL180M rtS202G rtI204V 872(S15) not detected 67 on ADV rtN/S/T/I/V53D (5 mg) rtY126Q and LMV rtL180M rtS202G rtI204V rtI235I/M ¹Nomenclature according to Stuyver et al., 2001, supra

TABLE 7 Summary of HBV mutations in Patient B treated with ADV Days Sample post-ADV name treatment Genotype Polymerase* Surface S0 −867 D rtN/S/T/I/V53D sM/K/L133T rtV153G sF134V rtQ/E215S sS207R rtN248H sL21V/L S6 −8 D rtI/L80L sT118R rtY126Q sM133T rtL180M sF134V rtS202G sI195M rtI204V sS207R S8 76 D rtN/S/T/I/V53D sT118R rtY126Q sM133T rtL180M sF134V rtS202G sI195M rtI204V sS207R S12 637 D rtN/S/T/I/V53D sT118R rtY126Q sM133T rtL180M sF134V rtS202G sI195M I204V sS207R S15 872 D rtN/S/T/I/V53D sT118R rtY126Q sM133T rtL180M sF134V rtS202G sI195M rtI204V sS207R rtI235I/M sY225Y/C *Nomenclature according to Stuyver et al., 2001, supra **Mutations in bold have not been detected in reference HBV genotypes, mutations not in bold are changes from the previous sample that are present in reference genotypes.

TABLE 8 Clinical, virological and HBV sequencing data summary for Patient C while on open label ADV. Days HBV DNA Key polymerase post-ADV copies/ml ALT Treatment mutations detected by treatment (pg/ml) IU/L protocol sequencing¹ −26 2 × 10⁷ pre-therapy rtN53D rtS116P rtD/N/S134V rtN238D 0 240 ADV commenced clinical trial 29 160 630 407 668 Open label ADV 701 1.5 × 10⁷ 226 730 3.7 × 10⁶ 361 rtN53D rtS116P rtF151S/T rtA181T rtN236T rtN238D 738 517 739 end ADV, start LMV ¹Nomenclature according to Stuyver et al., 2001, supra

TABLE 9 Summary of HBV mutations in Patient C treated with ADV Days Sample post-ADV Days Sample post-ADV name treatment Genotype Polymerase* Surface DRJ1299 −26 D rtN53D** T126S rtY54H S204G rtS57P L209V rtL91I S210R rtS116P rtF122L rtY124H rtD/N/S134V rtK212R rtL217R rtS219A rtN238D DRJ1 730 D rtN53D sS126T rtY54H sM133L/M rtS57P sS143S/T rtL91I sD144A rtS116P sG145A rtF122L sW172Stop rtY124H rtV134D rtY141Y/F rtL145M rtF151T/F rtA181T rtK12R rtL217R rtS219A rtN236T rtN238D *Nomenclature according to Stuyver et al., 2001, supra. **Mutations in bold have not been detected in reference HBV genotypes, mutations not in bold are changes from the previous sample that are present in reference genotypes.

TABLE 10 Summary of HBV mutations in Patient D treated with ADV Sample Name Genotype Polymerase* Surface 02575908 D rtS78T sN40S rtV84M sC69stop rtY126C sM75I rtV191I sL88P rtM204I sT118A rtV214A sW182STOP sW196L sY206H sY225F *Nomenclature according to Stuyver et al., 2001, supra. **Mutations in bold have not been detected in reference HBV genotypes, mutations not in bold are changes from the previous sample that are present in reference genotypes.

TABLE 11 Summary of HBV mutations in Patient E treated with ADV Sample Name Genotype Polymerase* Surface 8123/02 A rtH90D sI81M rtI/F108L sY/S100Y 6nt 6nt insertion/ insertion/duplication duplication after after codon codon s122 (aaT & K) rt131(aaQ&N) sP214Q *Nomenclature according to Stuyver et al., 2001, supra. **Mutations in bold have not been detected in reference HBV genotypes, mutations not in bold are changes from the previous sample that are present in reference genotypes.

TABLE 12 Codons where mutations occur following exposure to nucleoside or nucleotide analogs Original amino acid in reverse Region/ transcriptase (rt) Domain and codon position Nucleotide prior to F K32 AAG AAA N33 AAT P34 CCT H35 CAC T37 ACC F TO A P59 CCA K60 AAA F61 TTC A62 GCA V63 GTC A D83 GAT V84 GTG S85 TCT A86 GCG Y89 TAT H90 CAT I/L91 ATT CTT B P177 CCG F178 TTT L179 CTC L180 CTG A181 TTG Q182 CAG F183 TTT T184 ACT C Y203 TAT M204 ATG D L235 TTG TTA N236 AAC AAT T237 ACT ACC P237 CCT CCC N238 AAT AAC H238 CAC A238 GCT S238 TCT Q238 CAG K239 AAA AAG E L247 CTT TTA CTA CTC CTG N248 AAC AAT H248 CAT CAC F249 TTC TTT M250 ATG G251 GGT GGA GGC GGG V251 GTC

TABLE 13 Target amino acid sites in rt with codons and mutations leading to amino acid changes. Amino Amino Amino Amino Amino Amino Amino Title Codon Acid Codon Acid Codon Acid Codon Acid Codon Acid Codon Acid Codon Acid K32 AAG Lys AAG Lys GAG Glu CAG Gln TAG Stop AAG Lys AGG Arg N33 AAT Asn AAT Asn GAT Asp CAT His TAT Tyr AAT Asn AGT Ser P34 CCT Pro ACT Thr GCT Ala CCT Pro TCT Ser CAT His CGT Arg H35 CAC His AAC Asn GAC Asp CAC His TAC Tyr CAC His CGC Arg T37 ACC Thr ACC Thr GCC Ala CCC Pro TCC Ser AAC Asn AGC Ser P59 CCA Pro ACA Thr GCA Ala CCA Pro TCA Ser CAA Gln CGA Arg K60 AAA Lys AAA Lys GAA Glu CAA Gln TAA Stop AAA Lys AGA Arg F61 TTC Phe ATC Ile GTC Val CTC Leu TTC Phe TAC Tyr TGC Cys A62 GCA Ala ACA Thr GCA Ala CCA Pro TCA Ser GAA Glu GGA Gly V63 GTC Val ATC Ile GTC Val CTC Leu TTC Phe GAC Asp GGC Gly D83 GAT Asp AAT Asn GAT Asp CAT His TAT Tyr GAT Asp GGT Gly V84 GTG Val ATG Met GTG Val CTG Leu TTG Leu GAG Glu GGG Gly S85 TCT Ser ACT Thr GCT Ala CCT Pro TCT Ser TAT Tyr TGT Cys A86 GCG Ala ACG Thr GCG Ala CCG Pro TCG Ser GAG Glu GGG Gly Y89 TAT Tyr AAT Asn GAT Asp CAT His TAT Tyr TAT Tyr TGT Cys H90 CAT His AAT Asn GAT Asp CAT His TAT Tyr CAT His CGT Arg I/L91 ATT Ile ATT Ile GTT Val CTT Leu TTT Phe AAT Asn AGT Ser P177 CCG Pro ACG Thr GCG Ala CCG Pro TCG Ser CAG Gln CGG Arg F178 TTT Phe ATT Ile GTT Val CTT Leu TTT Phe TAT Tyr TGT Cys L179 CTC Leu ATC Ile GTC Val CTC Leu TTC Phe CAC His CGC Arg L180 CTG Leu ATG Met GTG Val CTG Leu TTG Leu CAG Gln CGG Arg A181 TTG Leu ATG Met GTG Val CTG Leu TTG Leu TAG Stop TGG Trp Q183 CAG Gln AAG Lys GAG Glu CAG Gln TAG Stop CAG Gln CGG Arg F183 TTT Phe ATT Ile GTT Val CTT Leu TTT Phe TAT Tyr TGT Cys T184 ACT Thr ACT Thr GCT Ala CCT Pro TCT Ser AAT Asn AGT Ser Y203 TAT Tyr AAT Asn GAT Asp CAT His TAT Tyr TAT Tyr TGT Cys M204 ATG Met ATG Met GTG Val CTG Leu TTG Leu AAG Lys AGG Arg L235 TTG Leu ATG Met GTG Val CTG Leu TTG Leu TAG Stop TGG Trp N236 AAC Asn AAC Asn GAC Asp CAC His TAC Tyr AAC Asn AGC Ser T237 ACT Thr ACT Thr GCT Ala CCT Pro TCT Ser AAT Asn AGT Ser P237 CCT Pro ACT Thr GCT Ala CCT Pro TCT Ser CAT His CGT Arg N238 AAT Asn AAT Asn GAT Asp CAT His TAT Tyr AAT Asn AGT Ser H238 CAC His AAC Asn GAC Asp CAC His TAC Tyr CAC His CGC Arg A238 GCT Ala ACT Thr GCT Ala CCT Pro TCT Ser GAT Asp GGT Gly S239 TCT Ser ACT Thr GCT Ala CCT Pro TCT Ser TAT Tyr TGT Cys Q238 CAG Gln AAG Lys GAG Glu CAG Gln TAG Stop CAG Gln CGG Arg K239 AAA Lys AAA Lys GAA Glu CAA Gln TAA Stop AAA Lys AGA Arg L247 CTT Leu ATT Ile GTT Val CTT Leu TTT Phe CAT His CGT Arg N248 AAC Asn AAC Asn GAC Asp CAC His TAC Tyr AAC Asn AGC Ser H248 CAT His AAT Asn GAT Asp CAT His TAT Tyr CAT His CGT Arg F249 TTC Phe ATC Ile GTC Val CTC Leu TTC Phe TAC Tyr TGC Cys M250 ATG Met ATG Met GTG Val CTG Leu TTG Leu AAG Lys AGG Arg G251 GGT Gly AGT Ser GGT Gly CGT Arg TGT Cys GAT Asp GGT Gly V251 GTC Val ATC Ile GTC Val CTC Leu TTC Phe GAC Asp GGC Gly Amino Amino Amino Amino Amino Amino Title Codon Acid Codon Acid Codon Acid Codon Acid Codon Acid Codon Acid K32 ACG Thr ATG Met AAA Lys AAG Lys AAC Asn AAT Asn N33 ACT Thr ATT Ile AAA Lys AAG Lys AAC Asn AAT Asn P34 CCT Pro CTT Leu CCA Pro CCG Pro CCC Pro CCT Pro H35 CCC Pro CTC Leu CAA Gln CAG Gln CAC His CAT His T37 ACC Thr ATC Ile ACA Thr ACG Thr ACC Thr ACT Thr P59 CCA Pro CTA Leu CCA Pro CCG Pro CCC Pro CCT Pro K60 ACA Thr ATA Ile AAA Lys AAG Lys AAC Asn AAT Asn F61 TCC Ser TTC Phe TTA Leu TTG Leu TTC Phe TTT Phe A62 GCA Ala GTA Val GCA Ala GCG Ala GCC Ala GCT Ala V63 GCC Ala GTC Val GTA Val GTG Val GTC Val GTT Val D83 GCT Ala GTT Val GAA Glu GAG Glu GAC Asp GAT Asp V84 GCG Ala GTG Val GTA Val GTG Val GTC Val GTT Val S85 TCT Ser TTT Phe TCA Ser TCG Ser TCC Ser TCT Ser A86 GCG Ala GTG Val GCA Ala GCG Ala GCC Ala GCT Ala Y89 TCT Ser TTT Phe TAA Stop TAG Stop TAC Tyr TAT Tyr H90 CCT Pro CTT Leu CAA Gln CAG Gln CAC His CAT His I/L91 ACT Thr ATT Ile ATA Ile ATG Met ATC Ile ATT Ile P177 CCG Pro CTG Leu CCA Pro CCG Pro CCC Pro CCT Pro F178 TCT Ser TTT Phe TTA Leu TTG Leu TTC Phe TTT Phe L179 CCC Pro CTC Leu CTA Leu CTG Leu CTC Leu CTT Leu L180 CCG Pro CTG Leu CTA Leu CTG Leu CTC Leu CTT Leu A181 TCG Ser TTG Leu TTA Leu TTG Leu TTC Phe TTT Phe Q183 CCG Pro CTG Leu CAA Gln CAG Gln CAC His CAT His F183 TCT Ser TTT Phe TTA Leu TTG Leu TTC Phe TTT Phe T184 ACT Thr ATT Ile ACA Thr ACG Thr ACC Thr ACT Thr Y203 TCT Ser TTT Phe TAA Stop TAG Stop TAC Tyr TAT Tyr M204 ACG Thr ATG Met ATA Ile ATG Met ATC Ile ATT Ile L235 TCG Ser TTG Leu TTA Leu TTG Leu TTC Phe TTT Phe N236 ACC Thr ATC Ile AAA Lys AAG Lys AAC Asn AAT Asn T237 ACT Thr ATT Ile ACA Thr ACG Thr ACC Thr ACT Thr P237 CCT Pro CTT Leu CCA Pro CCG Pro CCC Pro CCT Pro N238 ACT Thr ATT Ile AAA Lys AAG Lys AAC Asn AAT Asn H238 CCC Pro CTC Leu CAA Gln CAG Gln CAC His CAT His A238 GCT Ala GTT Val GCA Ala GCG Ala GCC Ala GCT Ala S239 TCT Ser TTT Phe TCA Ser TCG Ser TCC Ser TCT Ser Q238 CCG Pro CTG Leu CAA Gln CAG Gln CAC His CAT His K239 ACA Thr ATA Ile AAA Lys AAG Lys AAC Asn AAT Asn L247 CCT Pro CTT Leu CTA Leu CTG Leu CTC Leu CTT Leu N248 ACC Thr ATC Ile AAA Lys AAG Lys AAC Asn AAT Asn H248 CCT Pro CTT Leu CAA Gln CAG Gln CAC His CAT His F249 TCC Ser TTC Phe TTA Leu TTG Leu TTC Phe TTT Phe M250 ACG Thr ATG Met ATA Ile ATG Met ATC Ile ATT Ile G251 GCT Ala GTT Val GGA Gly GGG Gly GGC Gly GGT Gly V251 GCC Ala GTC Val GTA Val GTG Val GTC Val GTT Val

TABLE 14 Amino acid mutations at target sites in rt Target Mutation K32 M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L N33 D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R P34 S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F H35 I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G T37 W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S P59 S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F K60 M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L F61 P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M A62 R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V V63 A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y D83 C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N V84 A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y S85 T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P A86 R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V Y89 V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W H90 I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G I/L91 K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H P177 S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F F178 P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M L179 K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I L180 K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I A181 R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V Q183 E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C F183 P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M T184 W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S Y203 V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W M204 F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K L235 K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I N236 D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R T237 W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S P237 S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F N238 D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R H238 I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G A238 R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V S239 T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P Q238 E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C K239 M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L L247 K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I N248 D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y/V/A/R H248 I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G F249 P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K/M M250 F/P/S/T/W/Y/V/A/R/N/D/C/Q/E/G/H/I/L/K G251 H/I/L/K/M/F/P/S/T/W/Y/V/A/R/N/D/C/Q/E V251 A/R/N/D/C/Q/E/G/H/I/L/K/M/F/P/S/T/W/Y

TABLE 15 Summary of HBV mutations in Patient F treated with ADV Sample Name Genotype Polymerase* Surface CAP 01564808 A rtL157L/M sF83S rtA181V sL173F rtV207I sW199L rtN236T *Nomenclature according to Stuyver et al., 2001, supra. **Mutations in bold have not been detected in reference HBV genotypes, mutations not in bold are changes from the previous sample that are present in reference genotypes.

TABLE 16 Summary of HBV mutations in Patient G treated with ADV Sample Name Genotype Polymerase* Surface KAN 02510355 C rtL80V sI126T rtP109S sK160R rtI163V sS174N rtM204I sA184V rtL229M sW196L rtN/H/A/S/Q238K sS210N sF/C220L sY221C *Nomenclature according to Stuyver et al., 2001, supra. **Mutations in bold have not been detected in reference HBV genotypes, mutations not in bold are changes from the previous sample that are present in reference genotypes.

TABLE 17 Summary of HBV mutations in Patient H treated with ADV Sample Name Genotype Polymerase* Surface LAV0303 D rtS78S/T sC69Stop/C rtN118N/S sC76Y rtN139N/K sI110V/I rtV142E sY134N rtA181A/T sW172Stop/W rtI204M sW196Stop rtQ/P/S/Stop215Q sS207R rtE218K/E rtN238N/H *Nomenclature according to Stuyver et al., 2001, supra. **Mutations in bold have not been detected in reference HBV genotypes, mutations not in bold are changes from the previous sample that are present in reference genotypes.

TABLE 18 In vitro drug susceptibility of the HBV reference laboratory strain and patient-derived HBV isolate In vitro Susceptibility IC₅₀(fold change from wild-type) Real-time PCR Southern Blot Mutation Adefovir Adefovir Lamivudine Wild-type (pPC) 1 1 1 rt N236T/N238D 23 NA¹ NA¹ rt A181T/N236T/N238D 5.1 7.3 >100 rt L180M/M204V² NT⁵ 0.9 >2500 ¹NA, not analyzed. ²Data from Delaney et al., 2001, supra

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features

BIBLIOGRAPHY

Allen et al., Hepatology 27(6): 1670-1677, 1998
Aye et al., J. Hepatol. 26: 1148-1153, 1997
Bartholomeusz et al., Intervirology 40(5-6): 337-342 1997
Benhamou et al., Lancet 358: 718-723, 2001
Benzaria et al., J Med Chem. 39: 4958-4965, 1996
Boyd et al., Antiviral Chem Chemother. 32: 358-363, 1987
Calio et al., Antiviral Res. 23: 77-89, 1994
Das et al., J. Virol. 75(10): 4771-4779, 2001
Delaney et al., Antimicrob Agents Chemother 45(6): 1705-1013, 2001
Dienstag et al., New England J Med 333: 1657-1661, 1995
Frick et al., Antimicrob. Agents Chemother. 37: 2285-2292, 1993
Gaillard et al., Antimicrob Agents Chemother. 46(4): 1005-1013, 2002
Gilson et al., J Viral Hepat 6: 387-395, 1999
Heathcote et al., Hepatology 28: A620, 1998
Hendricks et al., Am J Clin Pathol 104: 537-46, 1995
Kruger et al. Hepatology 22: 219A, 1994
Main et al., J. Viral Hepatitis 3: 211-215, 1996
Norder et al., (J. Gen. Virol. 74: 341-1348, 1993
Perrino et al., Hepatology 32: 129-134, 2000
Peters et al., Transplantation 68: 1912-1914, 1999
Price et al., Proc. Natl. Acad. Sci. USA 86(21): 8541-8544, 1989
Ren and Nassal, J. Virol. 75(3): 1104-1116, 2001
Severini et al., Antimicrobial Agents Chemother. 39: 430-435, 1995
Stuyver et al., Hepatology 33: 751-757, 2001
Summers and Mason, Cell 29: 403-415, 1982
Suo et al., J Biol Chem. 273(42): 27250-27258. 1998
Vere Hodge, Antiviral Chem Chemother 4: 67-84, 1993
Xiong et al., Hepatology. 28(6): 1669-73, 1998
Ying et al., J Viral Hepat. 7(2): 161-165, 2000
Ying et al., J. Viral Hepat. 7(1): 79-83, 2000
Ying et al., Viral Hepat. 7(2): 161-165, 2000

Sequence CWU 1 1 59176PRTartificial sequencesynthetic - Formula I 1 Leu Xaa Xaa Asp Trp Gly Pro Cys Xaa Xaa His Gly Xaa His Xaa Ile 1 5 10 15 Arg Xaa Pro Arg Thr Pro Xaa Arg Val Xaa Gly Gly Val Phe Leu Val 20 25 30 Asp Lys Asn Pro His Asn Thr Xaa Glu Ser Xaa Leu Xaa Val Asp Phe 35 40 45 Ser Gln Phe Ser Arg Gly Xaa Xaa Xaa Val Ser Trp Pro Lys Phe Ala 50 55 60 Val Pro Asn Leu Xaa Ser Leu Thr Asn Leu Leu Ser 65 70 75 2181PRTartificial sequencesynthetic - Formula II 2 Ser Xaa Leu Ser Trp Leu Ser Leu Asp Val Ser Ala Ala Phe Tyr His 1 5 10 15 Xaa Pro Leu His Pro Ala Ala Met Pro His Leu Leu Xaa Gly Ser Ser 20 25 30 Gly Leu Xaa Arg Tyr Val Ala Arg Leu Ser Ser Xaa Ser Xaa Xaa Xaa 35 40 45 Asn Xaa Gln Xaa Xaa Xaa Xaa Xaa Xaa Leu His Xaa Xaa Cys Ser Arg 50 55 60 Xaa Leu Tyr Val Ser Leu Xaa Leu Leu Tyr Xaa Thr Xaa Gly Xaa Lys 65 70 75 80 Leu His Leu Xaa Xaa His Pro Ile Xaa Leu Gly Phe Arg Lys Xaa Pro 85 90 95 Met Gly Xaa Gly Leu Ser Pro Phe Leu Leu Ala Gln Phe Thr Ser Ala 100 105 110 Ile Xaa Xaa Xaa Xaa Xaa Arg Ala Phe Xaa His Cys Xaa Xaa Phe Xaa 115 120 125 Tyr Met Asp Asp Xaa Val Leu Gly Ala Xaa Xaa Xaa Xaa His Xaa Glu 130 135 140 Xaa Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Leu Leu Xaa Xaa Gly Ile His 145 150 155 160 Leu Asn Pro Xaa Lys Thr Lys Arg Trp Gly Tyr Ser Leu Asn Phe Met 165 170 175 Gly Tyr Xaa Ile Gly 180 323DNAartificial sequenceOS1 primer 3 gcctcatttt gtgggtcacc ata 23 418DNAartificial sequenceTTA3 primer 4 aaattcgcag tccccaaa 18 521DNAartificial sequenceJM primer 5 ttggggtgga gccctcaggc t 21 618DNAartificial sequenceTTA4 primer 6 gaaaattggt aacagcgg 18 720DNAartificial sequenceOS2 primer 7 tctctgacat actttccaat 20 823DNAartificial sequencesense primer 8 gcctcatttt gtgggtcacc ata 23 920DNAartificial sequenceantisense primer 9 tctctgacat actttccaat 20 1018DNAartificial sequenceinternal regions primer 10 tgcacgattc ctgctcaa 18 1120DNAartificial sequenceinternal regions primer 11 tttctcaaag gtggagacag 20 1218DNAartificial sequencePC1 forward primer 12 gggaggagat taggttaa 18 1320DNAartificial sequencePC2 reverse primer 13 ggcaaaaacg agagtaactc 20 1436DNAartificial sequenceHBV-specific molecular beacon primer 14 cgcgtcctac tgttcaagcc tccaagctgt gacgcg 36 15280DNAartificial sequenceSynthetic oligonucleotide 15 tggctcagtt tactagtgcc atttgttcag tggttcgtag ggctttcccc cactgtttgg 60 ctttcagtta tatggatgat gtggtattgg gggccaagtc tgtayagcay cttgagtccc 120 tttttaccgc tgttaccaat tttcttttgt ctttgggtat acatttaaac cctaacaaaa 180 ctaaaagatg gggttactct ttacatttca tgggntatgt cattggatgt tatgggtcat 240 tgccacaaga tcacatcata cagaaaatca aagatggttt 280 16242DNAartificial sequenceSynthetic oligonucleotide 16 tggctcagtt tactagtgcc atttgttcag tggttcgtag ggctttcccc cactgtttgg 60 ctttcagtta tatggatgat gtggtattgg gggccaagtc tgtacagcat cttgagtccc 120 tttttaccgc tgttaccaat tttcttttgt ctttgggtat acatttaaac cctaacaaaa 180 caaagagatg gggttactct ctaaatttta tgggttatgt cattggatgt tatgggtcct 240 tg 242 17277DNAartificial sequenceSynthetic oligonucleotide 17 tggctcagtt tactagtgcc atttgttcag tggttcgtag ggctttcccc cactgtttgg 60 ctttcagtta tatggatgat gtggtattgg gggccaagtc tgtacagcat cttgagtccc 120 tttttaccgc tgttaccaat tttcttttgt ctttgggtat acatttaaac cctaacaaaa 180 caaagagatg gggttactct ctaaatttta tgggttatgt cattggatgt tatgggtcct 240 tgccacaaga acacatcata caaaaaatca aagaatg 277 18237DNAartificial sequenceSynthetic oligonucleotide 18 tggctcagtt tactagtgcc atttgttcag tggttcgtag ggctttcccc cactgtttgg 60 ctttcagtta tatggatgat gtggtattgg gggccaagtc tgtacagcat cttgagtccc 120 tttttaccgc tgttaccaat tttcttttgt ctttgggcat acatttaaac cctaacaaaa 180 ctaaaagatg ggggtactct ttaaatttca tgggatatgt cattggatgg tatgggg 237 19336PRTartificial sequenceSynthetic polypeptide 19 Lys Leu Ala Ser Lys Ser Ala Ser Ser Ile Xaa Gln Ser Pro Val Arg 1 5 10 15 Xaa Ala Ala Tyr Pro Ala Val Ser Thr Phe Glu Lys His Ser Ser Ser 20 25 30 Gly His Ala Val Glu Xaa His Asn Leu Pro Pro Asn Ser Xaa Arg Ser 35 40 45 Gln Xaa Glu Arg Pro Val Phe Pro Cys Trp Trp Leu Gln Phe Arg Asn 50 55 60 Ser Lys Pro Cys Ser Asp Tyr Cys Leu Ser His Ile Val Asn Leu Leu 65 70 75 80 Glu Asp Trp Gly Pro Cys Ala Glu His Gly Glu His His Ile Arg Ile 85 90 95 Pro Arg Thr Pro Xaa Arg Val Thr Gly Gly Val Phe Leu Val Asp Lys 100 105 110 Asn Pro His Asn Thr Ala Glu Ser Arg Leu Val Val Asp Phe Ser Gln 115 120 125 Phe Ser Arg Gly Asn Tyr Arg Val Ser Trp Pro Lys Phe Ala Val Pro 130 135 140 Asn Leu Gln Ser Leu Thr Asn Leu Leu Ser Ser Asn Leu Ser Trp Leu 145 150 155 160 Ser Leu Asp Val Ser Ala Ala Phe Tyr His Leu Pro Leu His Pro Ala 165 170 175 Ala Met Pro His Leu Leu Val Gly Ser Ser Gly Leu Ser Arg Tyr Val 180 185 190 Ala Arg Leu Ser Ser Asn Ser Arg Ile Phe Asn His Gln Arg Gly Xaa 195 200 205 Met Gln Asn Leu His Asp Tyr Cys Ser Arg Asn Leu Tyr Val Ser Leu 210 215 220 Leu Leu Leu Tyr Gln Thr Phe Gly Arg Lys Leu His Leu Tyr Ser His 225 230 235 240 Pro Ile Ile Leu Gly Phe Arg Lys Ile Pro Met Gly Val Gly Leu Ser 245 250 255 Pro Phe Leu Leu Ala Gln Phe Thr Ser Ala Ile Cys Ser Val Val Arg 260 265 270 Arg Ala Phe Pro His Cys Leu Ala Phe Ser Tyr Met Asp Asp Val Val 275 280 285 Leu Gly Ala Lys Ser Val Xaa His Leu Glu Ser Leu Phe Thr Ala Val 290 295 300 Thr Asn Phe Leu Leu Ser Leu Gly Ile His Leu Asn Pro Asn Lys Thr 305 310 315 320 Lys Arg Trp Gly Tyr Ser Leu His Phe Met Gly Tyr Val Ile Gly Cys 325 330 335 20340PRTartificial sequenceSynthetic polypeptide 20 His Thr Thr Asn Phe Ala Ser Lys Ser Ala Ser Cys Leu His Gln Ser 1 5 10 15 Pro Val Arg Lys Ala Ala Tyr Pro Ala Val Ser Thr Phe Glu Lys His 20 25 30 Ser Ser Ser Gly His Ala Val Glu Phe His Asn Leu Pro Pro Asn Ser 35 40 45 Ala Arg Ser Gln Ser Glu Arg Pro Val Phe Pro Cys Trp Trp Leu Gln 50 55 60 Phe Arg Asn Ser Lys Pro Cys Ser Asp Tyr Cys Leu Ser Leu Ile Val 65 70 75 80 Asn Leu Leu Glu Asp Trp Gly Pro Cys Ala Glu His Gly Glu His His 85 90 95 Ile Arg Ile Pro Arg Thr Pro Ser Arg Val Thr Gly Gly Val Phe Leu 100 105 110 Val Asp Lys Asn Pro His Asn Thr Ala Glu Ser Arg Leu Val Val Asp 115 120 125 Phe Ser Gln Phe Ser Arg Gly Asn Tyr Arg Val Ser Trp Pro Lys Phe 130 135 140 Ala Val Pro Asn Leu Gln Ser Leu Thr Asn Leu Leu Ser Ser Asn Leu 145 150 155 160 Ser Trp Leu Ser Leu Asp Val Ser Ala Ala Phe Tyr His Leu Pro Leu 165 170 175 His Pro Ala Ala Met Pro His Leu Leu Val Gly Ser Ser Gly Leu Ser 180 185 190 Arg Tyr Val Ala Arg Leu Ser Ser Asn Ser Arg Ile Leu Asn Asn Gln 195 200 205 His Gly Thr Met Pro Asp Leu His Asp Tyr Cys Ser Arg Asn Leu Tyr 210 215 220 Val Ser Leu Leu Leu Leu Tyr Gln Thr Phe Gly Arg Lys Leu His Leu 225 230 235 240 Tyr Ser His Pro Ile Ile Leu Gly Phe Arg Lys Ile Pro Met Gly Val 245 250 255 Gly Leu Ser Pro Phe Leu Leu Ala Gln Phe Thr Ser Ala Ile Cys Ser 260 265 270 Val Val Arg Arg Ala Phe Pro His Cys Leu Ala Phe Ser Tyr Met Asp 275 280 285 Asp Val Val Leu Gly Ala Lys Ser Val Gln His Leu Glu Ser Leu Phe 290 295 300 Thr Ala Val Thr Asn Phe Leu Leu Ser Leu Gly Ile His Leu Asn Pro 305 310 315 320 Asn Lys Thr Lys Arg Trp Gly Tyr Ser Leu Asn Phe Met Gly Tyr Val 325 330 335 Ile Gly Cys Tyr 340 21344PRTartificial sequenceSynthetic polypeptide 21 Leu Ala Gln Gly Ile Leu Gln Asn Phe Ala Ser Lys Ser Ala Ser Cys 1 5 10 15 Leu His Gln Ser Pro Val Arg Lys Ala Ala Tyr Pro Ala Val Ser Thr 20 25 30 Phe Glu Lys His Ser Ser Ser Gly His Ala Val Glu Phe His Asn Leu 35 40 45 Pro Pro Asn Ser Ala Arg Ser Gln Ser Glu Arg Pro Val Phe Pro Cys 50 55 60 Trp Trp Leu Gln Phe Arg Asn Ser Lys Pro Cys Ser Asp Tyr Cys Leu 65 70 75 80 Ser Leu Ile Val Asn Leu Leu Glu Asp Trp Gly Pro Cys Ala Glu His 85 90 95 Gly Glu His His Ile Arg Ile Pro Arg Thr Pro Ser Arg Val Thr Gly 100 105 110 Gly Val Phe Leu Val Asp Lys Asn Pro His Asn Thr Ala Glu Ser Arg 115 120 125 Leu Val Val Asp Phe Ser Gln Phe Ser Arg Gly Asn Tyr Arg Val Ser 130 135 140 Trp Pro Lys Phe Ala Val Pro Asn Leu Gln Ser Leu Thr Asn Leu Leu 145 150 155 160 Ser Ser Asn Leu Ser Trp Leu Ser Leu Asp Val Ser Ala Ala Phe Tyr 165 170 175 His Leu Pro Leu His Pro Ala Ala Met Pro His Leu Leu Val Gly Ser 180 185 190 Ser Gly Leu Ser Arg Tyr Val Ala Arg Leu Ser Ser Asn Ser Arg Ile 195 200 205 Leu Asn Asn Gln His Gly Thr Met Pro Asp Leu His Asp Tyr Cys Ser 210 215 220 Arg Asn Leu Tyr Val Ser Leu Leu Leu Leu Tyr Gln Thr Phe Gly Arg 225 230 235 240 Lys Leu His Leu Tyr Ser His Pro Ile Ile Leu Gly Phe Arg Lys Ile 245 250 255 Pro Met Gly Val Gly Leu Ser Pro Phe Leu Leu Ala Gln Phe Thr Ser 260 265 270 Ala Ile Cys Ser Val Val Arg Arg Ala Phe Pro His Cys Leu Ala Phe 275 280 285 Ser Tyr Met Asp Asp Val Val Leu Gly Ala Lys Ser Val Gln His Leu 290 295 300 Glu Ser Leu Phe Thr Ala Val Thr Asn Phe Leu Leu Ser Leu Gly Ile 305 310 315 320 His Leu Asn Pro Asn Lys Thr Lys Arg Trp Gly Tyr Ser Leu Asn Phe 325 330 335 Met Gly Tyr Val Ile Gly Cys Tyr 340 22336PRTartificial sequenceSynthetic polypeptide 22 Ala Ser Lys Ser Ala Ser Ser Ile Tyr Gln Ser Pro Val Gly Thr Ala 1 5 10 15 Ala Tyr Pro Ala Val Ser Thr Xaa Glu Lys His Ser Ser Ser Gly His 20 25 30 Ala Val Glu Leu His Asn Leu Pro Pro Asn Ser Glu Arg Ser Gln Gly 35 40 45 Glu Arg Pro Val Phe Pro Cys Trp Trp Leu Gln Phe Arg Asn Ser Lys 50 55 60 Pro Cys Ser Asp Tyr Cys Leu Ser His Ile Val Asn Leu Leu Glu Asp 65 70 75 80 Trp Gly Pro Cys Ala Glu His Gly Glu His His Ile Arg Ile Pro Arg 85 90 95 Thr Pro Ala Arg Val Thr Gly Gly Val Phe Leu Val Asp Lys Asn Pro 100 105 110 His Asn Thr Ala Glu Ser Arg Leu Val Val Asp Phe Ser Gln Phe Ser 115 120 125 Arg Gly Asn Tyr Arg Val Ser Trp Pro Lys Phe Ala Val Pro Asn Leu 130 135 140 Gln Ser Leu Thr Asn Leu Leu Ser Ser Asn Leu Ser Trp Leu Ser Leu 145 150 155 160 Asp Val Ser Ala Ala Phe Tyr His Leu Pro Leu His Pro Ala Ala Met 165 170 175 Pro His Leu Leu Val Gly Ser Ser Gly Leu Ser Arg Tyr Val Ala Arg 180 185 190 Leu Ser Ser Asn Ser Arg Ile Phe Asn His Gln Arg Gly Asn Met Gln 195 200 205 Asn Leu His Asp Cys Cys Ser Arg Asn Leu Tyr Val Ser Leu Leu Leu 210 215 220 Leu Tyr Gln Thr Phe Gly Arg Lys Leu His Leu Tyr Ser His Pro Ile 225 230 235 240 Ile Leu Gly Phe Arg Lys Ile Pro Met Gly Val Gly Leu Ser Pro Phe 245 250 255 Leu Leu Ala Gln Phe Thr Ser Ala Ile Cys Ser Val Val Arg Arg Ala 260 265 270 Phe Pro His Cys Leu Ala Phe Ser Tyr Met Asp Asp Val Val Leu Gly 275 280 285 Ala Lys Ser Val Gln His Leu Glu Ser Leu Phe Thr Ala Val Thr Asn 290 295 300 Phe Leu Leu Ser Leu Gly Ile His Leu Asn Pro Asn Lys Thr Lys Arg 305 310 315 320 Trp Gly Tyr Ser Leu Asn Phe Met Gly Tyr Val Ile Gly Trp Tyr Gly 325 330 335 23226PRTartificial sequenceSynthetic polypeptide 23 Met Glu Asn Ile Thr Ser Gly Phe Leu Gly Pro Leu Leu Val Leu Gln 1 5 10 15 Ala Gly Phe Phe Leu Leu Thr Arg Ile Leu Thr Ile Pro Gln Ser Leu 20 25 30 Asp Ser Trp Trp Thr Ser Leu Asn Phe Leu Gly Gly Thr Thr Va1 Cys 35 40 45 Leu Gly Gln Asn Ser Gln Ser Pro Thr Ser Asn His Ser Pro Thr Ser 50 55 60 Cys Pro Pro Thr Cys Pro Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe 65 70 75 80 Ile Ile Phe Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe Leu Leu Val 85 90 95 Leu Leu Asp Tyr Gln Gly Met Leu Pro Val Cys Pro Leu Ile Pro Gly 100 105 110 Ser Ser Thr Thr Ser Ala Gly Xaa Cys Arg Thr Cys Thr Thr Thr Ala 115 120 125 Gln Gly Thr Ser Met Tyr Pro Ser Cys Cys Cys Thr Lys Pro Ser Asp 130 135 140 Gly Asn Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala Phe Gly Lys 145 150 155 160 Phe Leu Trp Glu Trp Ala Ser Ala Arg Phe Ser Trp Leu Ser Leu Leu 165 170 175 Val Pro Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr Val Trp Leu 180 185 190 Ser Val Ile Trp Met Met Trp Tyr Trp Gly Pro Ser Leu Tyr Ser Xaa 195 200 205 Leu Ser Pro Phe Leu Pro Leu Leu Pro Ile Phe Phe Cys Leu Trp Val 210 215 220 Tyr Ile 225 24309PRTartificial sequenceSynthetic polypeptide 24 Pro Pro Pro Ala Ser Thr Asn Arg Gln Ser Gly Arg Gln Pro Thr Pro 1 5 10 15 Leu Ser Pro Pro Leu Arg Asn Thr His Pro Gln Ala Met Gln Trp Asn 20 25 30 Ser Thr Thr Phe His Gln Thr Leu Gln Asp Pro Arg Val Arg Gly Leu 35 40 45 Tyr Phe Pro Ala Gly Gly Ser Ser Ser Gly Thr Val Asn Pro Val Leu 50 55 60 Thr Thr Ala Ser Pro Leu Ser Ser Ile Phe Ser Arg Ile Gly Asp Pro 65 70 75 80 Ala Leu Asn Met Glu Asn Ile Thr Ser Gly Phe Leu Gly Pro Leu Leu 85 90 95 Val Leu Gln Ala Gly Phe Phe Leu Leu Thr Arg Ile Leu Thr Ile Pro 100 105 110 Gln Ser Leu Asp Ser Trp Trp Thr Ser Leu Asn Phe Leu Gly Gly Thr 115 120 125 Thr Val Cys Leu Gly Gln Asn Ser Gln Ser Pro Thr Ser Asn His Ser 130 135 140 Pro Thr Ser Cys Pro Pro Thr Cys Pro Gly Tyr Arg Trp Met Cys Leu 145 150 155 160 Arg Arg Phe Ile Ile Phe Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe 165 170 175 Leu Leu Val Leu Leu Asp Tyr Gln Gly Met Leu Pro Val Cys Pro Leu 180 185 190 Ile Pro Gly Ser Ser Thr Thr Ser Thr Gly Pro Cys Arg Thr Cys Met 195 200 205 Thr Thr Ala Gln Gly Thr Ser Met Tyr Pro Ser Cys Cys Cys Thr Lys 210 215 220 Pro Ser Asp Gly Asn Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala 225 230 235 240 Phe Gly Lys Phe Leu Trp Glu Trp Ala Ser Ala Arg Phe Ser Trp Leu 245 250 255 Ser Leu Leu Val Pro Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr 260 265 270 Val Trp Leu Ser Val Ile Trp Met Met Trp Tyr Trp Gly Pro Ser Leu 275 280 285 Tyr Ser Ile Leu Ser Pro Phe Leu Pro Leu Leu Pro Ile Phe Phe Cys 290 295 300 Leu Trp Val Tyr Ile 305 25309PRTartificial sequenceSynthetic polypeptide 25 Pro Pro Pro Ala Ser Thr Asn Arg Gln Ser Gly Arg Gln Pro Thr Pro 1 5 10 15 Leu Ser Pro Pro Leu Arg Asn Thr His Pro Gln Ala Met Gln Trp Asn 20 25 30 Ser Thr Thr Phe His Gln Thr Leu Gln Asp Pro Arg Val Arg Gly Leu 35 40 45 Tyr Phe Pro Ala Gly Gly Ser Ser Ser Gly Thr Val Asn Pro Val Leu 50 55 60 Thr Thr Ala Ser Pro Leu Ser Ser Ile Phe Ser Arg Ile Gly Asp Pro 65 70 75 80 Ala Leu Asn Met Glu Asn Ile Thr Ser Gly Phe Leu Gly Pro Leu Leu 85 90 95 Val Leu Gln Ala Gly Phe Phe Leu Leu Thr Arg Ile Leu Thr Ile Pro 100 105 110 Gln Ser Leu Asp Ser Trp Trp Thr Ser Leu Asn Phe Leu Gly Gly Thr 115 120 125 Thr Val Cys Leu Gly Gln Asn Ser Gln Ser Pro Thr Ser Asn His Ser 130 135 140 Pro Thr Ser Cys Pro Pro Thr Cys Pro Gly Tyr Arg Trp Met Cys Leu 145 150 155 160 Arg Arg Phe Ile Ile Phe Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe 165 170 175 Leu Leu Val Leu Leu Asp Tyr Gln Gly Met Leu Pro Val Cys Pro Leu 180 185 190 Ile Pro Gly Ser Ser Thr Thr Ser Thr Gly Pro Cys Arg Thr Cys Met 195 200 205 Thr Thr Ala Gln Gly Thr Ser Met Tyr Pro Ser Cys Cys Cys Thr Lys 210 215 220 Pro Ser Asp Gly Asn Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala 225 230 235 240 Phe Gly Lys Phe Leu Trp Glu Trp Ala Ser Ala Arg Phe Ser Trp Leu 245 250 255 Ser Leu Leu Val Pro Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr 260 265 270 Val Trp Leu Ser Val Ile Trp Met Met Trp Tyr Trp Gly Pro Ser Leu 275 280 285 Tyr Ser Ile Leu Ser Pro Phe Leu Pro Leu Leu Pro Ile Phe Phe Cys 290 295 300 Leu Trp Val Tyr Ile 305 26309PRTartificial sequenceSynthetic polypeptide 26 Pro Pro Pro Pro Ser Thr Asn Arg Gln Ser Gly Arg Gln Pro Thr Pro 1 5 10 15 Leu Ser Pro Pro Xaa Arg Asn Thr His Pro Gln Ala Met Gln Trp Asn 20 25 30 Ser Thr Thr Phe His Gln Thr Leu Lys Asp Pro Arg Val Xaa Gly Leu 35 40 45 Tyr Phe Pro Ala Gly Gly Ser Ser Ser Gly Thr Val Asn Pro Val Pro 50 55 60 Thr Thr Ala Ser Pro Ile Ser Ser Ile Phe Ser Arg Ile Gly Asp Pro 65 70 75 80 Ala Leu Asn Met Glu Asn Ile Thr Ser Gly Phe Leu Gly Pro Leu Leu 85 90 95 Val Leu Gln Ala Gly Phe Phe Leu Leu Thr Arg Ile Leu Thr Ile Pro 100 105 110 Gln Ser Leu Asp Ser Trp Trp Thr Ser Leu Asn Phe Leu Gly Gly Thr 115 120 125 Thr Val Cys Leu Gly Gln Asn Ser Gln Ser Pro Thr Ser Asn His Ser 130 135 140 Pro Thr Ser Cys Pro Pro Thr Cys Pro Gly Tyr Arg Trp Met Cys Leu 145 150 155 160 Arg Arg Phe Ile Ile Phe Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe 165 170 175 Leu Leu Val Leu Leu Asp Tyr Gln Gly Met Leu Pro Val Cys Pro Leu 180 185 190 Ile Pro Gly Ser Ser Thr Thr Ser Ala Gly Thr Cys Arg Thr Cys Thr 195 200 205 Thr Ala Ala Gln Gly Thr Ser Met Tyr Pro Ser Cys Cys Cys Thr Lys 210 215 220 Pro Ser Asp Gly Asn Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala 225 230 235 240 Phe Gly Lys Phe Leu Trp Glu Trp Ala Ser Ala Arg Phe Ser Trp Leu 245 250 255 Ser Leu Leu Val Pro Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr 260 265 270 Val Trp Leu Ser Val Ile Trp Met Met Trp Tyr Trp Gly Pro Ser Leu 275 280 285 Tyr Ser Ile Leu Ser Pro Phe Leu Pro Leu Leu Pro Ile Phe Phe Cys 290 295 300 Leu Trp Ala Tyr Ile 305 27656DNAartificial sequenceSynthetic oligonucleotide 27 cgcagagtct agactcgtgg tggacttctc tcaattttcg aggggggact accgtgtgtc 60 ttggccaaaa ttcgcagtcc ccaacctcca atcactcacc aacctcctgt cctccaactt 120 gtcctggtta tcgctggatg tgtctgcggc gttttatcat cttcctcttc atcctgctgc 180 tatgcctcat cttcttgttg gttcttctgg actgtcaagg tatgttgccc gtttgtcctc 240 taattccagg atcctcaacc accagcacgg gaccatgccg aacctgcacg actcctgctc 300 aaggaacctc tacggttccc tcatgttgct gtaccaaacc ttcggacgga aattgcacct 360 gtattcccat cccatcatcc tgggctttcg gaaaattcct atgggagtgg gcctcagccc 420 gtttctcctg gctcagttta ctagtgccat ttgttcagtg gttcgtaggg ctttccccca 480 ctgtctggct tttagttata tggatgatgt ggtattgggg gccaagtctg tatcgcatct 540 tgagtccctt tttaccgctg ntaccaattt tcttttgtct ttgggtatac atttaaaccc 600 taacaaaaca aaaagatggg gttactccct acattttatg ggctatgtca ttggat 656 28625DNAartificial sequenceSynthetic oligonucleotide 28 ttactcaccn acctcctgtc ctccaacttg tcctggttat cgctggatgt gtctgcggcg 60 ttttatcatc ttcctcttca tcctgctgct atgcctcatc ttcttgttgg ttcttctgga 120 ctgtcaaggt atgttgcccg tttgtcctct aattccagga tcctcaacca ccagcagggg 180 accatgccga acctgcacga ctcctgctca aggaacctct acggttccct catgttgctg 240 taccaaacct tcggacggaa attgcacctg tattcccatc ccatcatcct gggctttcgg 300 aaaattccta tgggagtggg cctcagcccg tttctcatgg ctcagtttac tagtgccatt 360 tgttcagtgg ttcgtagggc tttcccccac tgtctggctt ttggttatgt ggatgatgtg 420 gtattggggg ccaagtctgt atcgcatctt gagtcccttt ttaccgctgt taccaatttt 480 cttttgtctt tgggtataca tttaaatcct aacaaaacaa aaagatgggg ttactcccta 540 cattttatgg gctatgtcat tggatgtcat gggtccttgc cacaagaaca catcagacaa 600 aaaatcaaag aatgttttag aaaac 625 291033DNAartificial sequenceSynthetic oligonucleotide 29 tgccccttct gcctccacca atcgccagtc aggaaggcag cctaccccgc tgtctccacc 60 tttgagagac actcatcctc aggccatgca gtggaactca acaaccttcc accaaactct 120 gcaagatccc agagtgaaag gcctgtattt ccctgctggt ggctccagtt caggaacagt 180 aaaccctgtt ccgactactg cctctcactc atcgtcaatc ttctcgagga ttggggtccc 240 tgcgctgaac atggagaaca tcacatcagg actcctagga ccccttctcg tgttacaggc 300 ggggtttttc ttgttgacaa gaatcctcac aataccgcag agtctagact cgtggtggac 360 ttctctcaat tttcgagggg ggactaccgt gtgtcttggc caaaattcgc agtccccaac 420 ctccaatcac tcaccaacct cctgtcctcc aacttgtcct ggttatcgct ggatgtgtct 480 gcggcgtttt atcatcttcc tcttcatcct gctgctatgc ctcatcttct tgttggttct 540 tctggactgt caaggtatgt tgcccgtttg tcctctaatt ccaggatcct caaccaccag 600 caggggacca tgccgaacct gcacgactcc tgctcaagga acctctacgg ttccctcatg 660 ttgctgtacc aaaccttcgg acggaaattg cacctgtatt cccatcccat catcctgggc 720 tttcggaaaa ttcctatggg agtgggcctc agcccgtttc tcatggctca gtttactagt 780 gccatttgtt cagtggttcg tagggctttc ccccactgtc tggcttttgg ttatgtggat 840 gatgtggtat tgggggccaa gtctgtatcg catcttgagt ccctttttac cgctgttacc 900 aattttcttt tgtctttggg tatacattta aatcctaaca aaacaaaaag atggggttac 960 tccctacatt ttatgggcta tgtcattgga tgtcatgggt ccttgccaca agaacacatc 1020 agacaaaaaa tca 1033 301100DNAartificial sequenceSynthetic oligonucleotide 30 ttttggggag ccctcaggct cagggcatat tacaaactct gccagcaaat ccacctcctg 60 cctccaccaa tcgccagtca ggaaggcagc ctaccccgct gtctccacct ttgagagaca 120 ctcatcctca ggccatgcag tggaactcaa caaccttcca ccaaactctg caagatccca 180 gagtgaaagg cctgtatttc cctgctggtg gctccagttc aggaacagta aaccctgttc 240 cgactactgc ctctcactca tcgtcaatct tctcgaggat tggggtccct gcgctgaaca 300 tggagaacat cacatcagga ctcctaggac cccttctcgt gttacaggcg gggtttttct 360 tgttgacaag aatcctcaca ataccgcaga gtctagactc gtggtggact tctctcaatt 420 ttcgaggggg gactaccgtg tgtcttggcc aaaattcgca gtccccaacc tccaatcact 480 caccaacctc ctgtcctcca acttgtcctg gttatcgctg gatgtgtctg cggcgtttta 540 tcatcttcct cttcatcctg ctgctatgcc tcatcttctt gttggttctt ctggactgtc 600 aaggtatgtt gcccgtttgt cctctaattc caggatcctc aaccaccagc aggggaccat 660 gccgaacctg cacgactcct gctcaaggaa cctctacggt tccctcatgt tgctgtacca 720 aaccttcgga cggaaattgc acctgtattc ccatcccatc atcctgggct ttcggaaaat 780 tcctatggga gtgggcctca gcccgtttct catggctcag tttactagtg ccatttgttc 840 agtggttcgt agggctttcc cccactgtct ggcttttggt tatgtggatg atgtggtatt 900 gggggccaag tctgtatcgc atcttgagtc cctttttacc gctgttacca attttctttt 960 gtctttgggt atacatttaa atcctaacaa aacaaaaaga tggggttact ccctacattt 1020 tatgggctat gtcattggat gtcatgggtc cttgccacaa gaacacatca gacaaaaaat 1080 caaagaatgt tttagaaaac 1100 31987DNAartificial sequenceSynthetic oligonucleotide 31 tacaaacttt gccagcaaat ccacctcctg cctccaccaa tcgccagtca ggaaggcagc 60 ctaccccgct gtctccacct ttgagagaca ctcatcctca ggccatgcag tggaactcaa 120 caaccttcca ccaaactctg caagatccca gagtgaaagg cctgtatttc cctgctggtg 180 gctccagttc aggaacagta aaccctgttc cgactactgc ctctcactca tcgtcaatct 240 tctcgaggat tggggtccct gcgctgaaca tggagaacat cacatcagga ctcctaggac 300 cccttctcgt gttacaggcg gggtttttnt tgttgacaag aatcctcaca ataccgcaga 360 gtctagactc gtggtggact tctctcaatt ttcgaggggg gactaccgtg tgtcttggcc 420 aaaattcgca gtccccaacc tccaatcact caccaacctc ctgtcctcca acttgtcctg 480 gttatcgctg gatgtgtctg cggcgtttta tcatcttcct cttcatcctg ctgctatgcc 540 tcatcttctt gttggctcta ctggactgtc aaggtatgtt gcccgtttgt cctctaattc 600 caggatcctc aaccaccagc aggggaccat gccgaacctg cacgactcct gctcaaggaa 660 cctctacggt tccctcatgt tgctgtacca aaccttcgga cggaaattgc acctgtattc 720 ccatcccatc atcctgggct ttcggaaaat tcctatggga gtgggcctca gcccgtttct 780 catggctcag tttactagtg ccatttgttc agtggttcgt agggctttcc cccactgtct 840 ggcttttggt tatgtggatg atgtggtatt gggggccaag tctgtatcgc atcttgagtc 900 cctttttacc gctgttacca attttctttt gtctttgggt atncatttaa atcctaacaa 960 aacaaaaaga tggggttact ccctaca 987 32350PRTartificial sequenceSynthetic polypeptide 32 Ser Gly His Thr Thr Asn Phe Ala Ser Lys Ser Thr Ser Cys Leu His 1 5 10 15 Gln Ser Pro Val Arg Lys Ala Ala Tyr Pro Ala Val Ser Thr Phe Glu 20 25 30 Arg His Ser Ser Ser Gly His Ala Val Glu Leu Asn Asn Leu Pro Pro 35 40 45 Asn Ser Ala Arg Ser Gln Ser Glu Arg Pro Val Phe Pro Cys Trp Trp 50 55 60 Leu Gln Phe Arg Asn Ser Lys Pro Cys Ser Asp Tyr Cys Leu Ser Leu 65 70 75 80 Ile Val Asn Leu Leu Glu Asp Trp Gly Pro Cys Ala Glu His Gly Glu 85 90 95 His His Ile Arg Thr Pro Arg Thr Pro Ser Arg Val Thr Gly Gly Val 100 105 110 Phe Leu Val Asp Lys Asn Pro His Asn Thr Ala Glu Ser Arg Leu Val 115 120 125 Val Asp Phe Ser Gln Phe Ser Arg Gly Asp Tyr Arg Val Ser Trp Pro 130 135 140 Lys Phe Ala Val Pro Asn Leu Gln Ser Leu Thr Asn Leu Leu Ser Ser 145 150 155 160 Asn Leu Ser Trp Leu Ser Leu Asp Val Ser Ala Ala Phe Tyr His Leu 165 170 175 Pro Leu His Pro Ala Ala Met Pro His Leu Leu Val Gly Ser Ser Gly 180 185 190 Leu Ser Arg Tyr Val Ala Arg Leu Ser Ser Asn Ser Arg Ile Leu Asn 195 200 205 His Gln His Gly Thr Met Pro Asn Leu His Asp Ser Cys Ser Arg Asn 210 215 220 Leu Tyr Gly Ser Leu Met Leu Leu Tyr Gln Thr Phe Gly Arg Lys Leu 225 230 235 240 His Leu Tyr Ser His Pro Ile Ile Leu Gly Phe Arg Lys Ile Pro Met 245 250 255 Gly Val Gly Leu Ser Pro Phe Leu Leu Ala Gln Phe Thr Ser Ala Ile 260 265 270 Cys Ser Val Val Arg Arg Ala Phe Pro His Cys Leu Ala Phe Ser Tyr 275 280 285 Met Asp Asp Val Val Leu Gly Ala Lys Ser Val Ser His Leu Glu Ser 290 295 300 Leu Phe Thr Ala Xaa Thr Asn Phe Leu Leu Ser Leu Gly Ile His Leu 305 310 315 320 Asn Pro Asn Lys Thr Lys Arg Trp Gly Tyr Ser Leu His Phe Met Gly 325 330 335 Tyr Val Ile Gly Cys His Gly Ser Xaa Pro Gln Glu His Ile 340 345 350 33181PRTartificial sequenceSynthetic polypeptide 33 Ser Asn Leu Ser Trp Leu Ser Leu Asp Val Ser Ala Ala Phe Tyr His 1 5 10 15 Leu Pro Leu His Pro Ala Ala Met Pro His Leu Leu Val Gly Ser Ser 20 25 30 Gly Leu Ser Arg Tyr Val Ala Arg Leu Ser Ser Asn Ser Arg Ile Leu 35 40 45 Asn His Gln Gln Gly Thr Met Pro Asn Leu His Asp Ser Cys Ser Arg 50 55 60 Asn Leu Tyr Gly Ser Leu Met Leu Leu Tyr Gln Thr Phe Gly Arg Lys 65 70 75 80 Leu His Leu Tyr Ser His Pro Ile Ile Leu Gly Phe Arg Lys Ile Pro 85 90 95 Met Gly Val Gly Leu Ser Pro Phe Leu Met Ala Gln Phe Thr Ser Ala 100 105 110 Ile Cys Ser Val Val Arg Arg Ala Phe Pro His Cys Leu Ala Phe Gly 115 120 125 Tyr Val Asp Asp Val Val Leu Gly Ala Lys Ser Val Ser His Leu Glu 130 135 140 Ser Leu Phe Thr Ala Val Thr Asn Phe Leu Leu Ser Leu Gly Ile His 145 150 155 160 Leu Asn Pro Asn Lys Thr Lys Arg Trp Gly Tyr Ser Leu His Phe Met 165 170 175 Gly Tyr Val Ile Gly 180 34340PRTartificial sequenceSynthetic polypeptide 34 Cys Pro Phe Cys Leu His Gln Ser Pro Val Arg Lys Ala Ala Tyr Pro 1 5 10 15 Ala Val Ser Thr Phe Glu Arg His Ser Ser Ser Gly His Ala Val Glu 20 25 30 Leu Asn Asn Leu Pro Pro Asn Ser Ala Arg Ser Gln Ser Glu Arg Pro 35 40 45 Val Phe Pro Cys Trp Trp Leu Gln Phe Arg Asn Ser Lys Pro Cys Ser 50 55 60 Asp Tyr Cys Leu Ser Leu Ile Val Asn Leu Leu Glu Asp Trp Gly Pro 65 70 75 80 Cys Ala Glu His Gly Glu His His Ile Arg Thr Pro Arg Thr Pro Ser 85 90 95 Arg Val Thr Gly Gly Val Phe Leu Val Asp Lys Asn Pro His Asn Thr 100 105 110 Ala Glu Ser Arg Leu Val Val Asp Phe Ser Gln Phe Ser Arg Gly Asp 115 120 125 Tyr Arg Val Ser Trp Pro Lys Phe Ala Val Pro Asn Leu Gln Ser Leu 130 135 140 Thr Asn Leu Leu Ser Ser Asn Leu Ser Trp Leu Ser Leu Asp Val Ser 145 150 155 160 Ala Ala Phe Tyr His Leu Pro Leu His Pro Ala Ala Met Pro His Leu 165 170 175 Leu Val Gly Ser Ser Gly Leu Ser Arg Tyr Val Ala Arg Leu Ser Ser 180 185 190 Asn Ser Arg Ile Leu Asn His Gln Gln Gly Thr Met Pro Asn Leu His 195 200 205 Asp Ser Cys Ser Arg Asn Leu Tyr Gly Ser Leu Met Leu Leu Tyr Gln 210 215 220 Thr Phe Gly Arg Lys Leu His Leu Tyr Ser His Pro Ile Ile Leu Gly 225 230 235 240 Phe Arg Lys Ile Pro Met Gly Val Gly Leu Ser Pro Phe Leu Met Ala 245 250 255 Gln Phe Thr Ser Ala Ile Cys Ser Val Val Arg Arg Ala Phe Pro His 260 265 270 Cys Leu Ala Phe Gly Tyr Val Asp Asp Val Val Leu Gly Ala Lys Ser 275 280 285 Val Ser His Leu Glu Ser Leu Phe Thr Ala Val Thr Asn Phe Leu Leu 290 295 300 Ser Leu Gly Ile His Leu Asn Pro Asn Lys Thr Lys Arg Trp Gly Tyr 305 310 315 320 Ser Leu His Phe Met Gly Tyr Val Ile Gly Cys His Gly Ser Leu Pro 325 330 335 Gln Glu His Ile 340 35340PRTartificial sequenceSynthetic polypeptide 35 Ser Gly His Ile Thr Asn Ser Ala Ser Lys Ser Thr Ser Cys Leu His 1 5 10 15 Gln Ser Pro Val Arg Lys Ala Ala Tyr Pro Ala Val Ser Thr Phe Glu 20 25 30 Arg His Ser Ser Ser Gly His Ala Val Glu Leu Asn Asn Leu Pro Pro 35 40 45 Asn Ser Ala Arg Ser Gln Ser Glu Arg Pro Val Phe Pro Cys Trp Trp 50 55 60 Leu Gln Phe Arg Asn Ser Lys Pro Cys Ser Asp Tyr Cys Leu Ser Leu 65 70 75 80 Ile Val Asn Leu Leu Glu Asp Trp Gly Pro Cys Ala Glu His Gly Glu 85 90 95 His His Ile Arg Thr Pro Arg Thr Pro Ser Arg Val Thr Gly Gly Val 100 105 110 Phe Leu Val Asp Lys Asn Pro His Asn Thr Ala Glu Ser Arg Leu Val 115 120 125 Val Asp Phe Ser Gln Phe Ser Arg Gly Asp Tyr Arg Val Ser Trp Pro 130 135 140 Lys Phe Ala Val Pro Asn Leu Gln Ser Leu Thr Asn Leu Leu Ser Ser 145 150 155 160 Asn Leu Ser Trp Leu Ser Leu Asp Val Ser Ala Ala Phe Tyr His Leu 165 170 175 Pro Leu His Pro Ala Ala Met Pro His Leu Leu Val Gly Ser Ser Gly 180 185 190 Leu Ser Arg Tyr Val Ala Arg Leu Ser Ser Asn Ser Arg Ile Leu Asn 195 200 205 His Gln Gln Gly Thr Met Pro Asn Leu His Asp Ser Cys Ser Arg Asn 210 215 220 Leu Tyr Gly Ser Leu Met Leu Leu Tyr Gln Thr Phe Gly Arg Lys Leu 225 230 235 240 His Leu Tyr Ser His Pro Ile Ile Leu Gly Phe Arg Lys Ile Pro Met 245 250 255 Gly Val Gly Leu Ser Pro Phe Leu Met Ala Gln Phe Thr Ser Ala Ile 260 265 270 Cys Ser Val Val Arg Arg Ala Phe Pro His Cys Leu Ala Phe Gly Tyr 275 280 285 Val Asp Asp Val Val Leu Gly Ala Lys Ser Val Ser His Leu Glu Ser 290 295 300 Leu Phe Thr Ala Val Thr Asn Phe Leu Leu Ser Leu Gly Ile His Leu 305 310 315 320 Asn Pro Asn Lys Thr Lys Arg Trp Gly Tyr Ser Leu His Phe Met Gly 325 330 335 Tyr Val Ile Gly 340 36328PRTartificial sequenceSynthetic polypeptide 36 Thr Asn Phe Ala Ser Lys Ser Thr Ser Cys Leu His Gln Ser Pro Val 1 5 10 15 Arg Lys Ala Ala Tyr Pro Ala Val Ser Thr Phe Glu Arg His Ser Ser 20 25 30 Ser Gly His Ala Val Glu Leu Asn Asn Leu Pro Pro Asn Ser Ala Arg 35 40 45 Ser Gln Ser Glu Arg Pro Val Phe Pro Cys Trp Trp Leu Gln Phe Arg 50 55 60 Asn Ser Lys Pro Cys Ser Asp Tyr Cys Leu Ser Leu Ile Val Asn Leu 65 70 75 80 Leu Glu Asp Trp Gly Pro Cys Ala Glu His Gly Glu His His Ile Arg 85 90 95 Thr Pro Arg Thr Pro Ser Arg Val Thr Gly Gly Val Phe Xaa Val Asp 100 105 110 Lys Asn Pro His Asn Thr Ala Glu Ser Arg Leu Val Val Asp Phe Ser 115 120 125 Gln Phe Ser Arg Gly Asp Tyr Arg Val Ser Trp Pro Lys Phe Ala Val 130 135 140 Pro Asn Leu Gln Ser Leu Thr Asn Leu Leu Ser Ser Asn Leu Ser Trp 145 150 155 160 Leu Ser Leu Asp Val Ser Ala Ala Phe Tyr His Leu Pro Leu His Pro 165 170 175 Ala Ala Met Pro His Leu Leu Val Gly Ser Thr Gly Leu Ser Arg Tyr 180 185 190 Val Ala Arg Leu Ser Ser Asn Ser Arg Ile Leu Asn His Gln Gln Gly 195 200 205 Thr Met Pro Asn Leu His Asp Ser Cys Ser Arg Asn Leu Tyr Gly Ser 210 215 220 Leu Met Leu Leu Tyr Gln Thr Phe Gly Arg Lys Leu His Leu Tyr Ser 225 230 235 240 His Pro Ile Ile Leu Gly Phe Arg Lys Ile Pro Met Gly Val Gly Leu 245 250 255 Ser Pro Phe Leu Met Ala Gln Phe Thr Ser Ala Ile Cys Ser Val Val 260 265 270 Arg Arg Ala Phe Pro His Cys Leu Ala Phe Gly Tyr Val Asp Asp Val 275 280 285 Val Leu Gly Ala Lys Ser Val Ser His Leu Glu Ser Leu Phe Thr Ala 290 295 300 Val Thr Asn Phe Leu Leu Ser Leu Gly Xaa His Leu Asn Pro Asn Lys 305 310 315 320 Thr Lys Arg Trp Gly Tyr Ser Leu 325 37197PRTartificial sequenceSynthetic polypeptide 37 Gln Ser Leu Asp Ser Trp Trp Thr Ser Leu Asn Phe Arg Gly Gly Thr 1 5 10 15 Thr Val Cys Leu Gly Gln Asn Ser Gln Ser Pro Thr Ser Asn His Ser 20 25 30 Pro Thr Ser Cys Pro Pro Thr Cys Pro Gly Tyr Arg Trp Met Cys Leu 35 40 45 Arg Arg Phe Ile Ile Phe Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe 50 55 60 Leu Leu Val Leu Leu Asp Cys Gln Gly Met Leu Pro Val Cys Pro Leu 65 70 75 80 Ile Pro Gly Ser Ser Thr Thr Ser Thr Gly Pro Cys Arg Thr Cys Thr 85 90 95 Thr Pro Ala Gln Gly Thr Ser Thr Val Pro Ser Cys Cys Cys Thr Lys 100 105 110 Pro Ser Asp Gly Asn Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala 115 120 125 Phe Gly Lys Phe Leu Trp Glu Trp Ala Ser Ala Arg Phe Ser Trp Leu 130 135 140 Ser Leu Leu Val Pro Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr 145 150 155 160 Val Trp Leu Leu Val Ile Trp Met Met Trp Tyr Trp Gly Pro Ser Leu 165 170 175 Tyr Arg Ile Leu Ser Pro Phe Leu Pro Leu Xaa Pro Ile Phe Phe Cys 180 185 190 Leu Trp Val Tyr Ile 195 38161PRTartificial sequenceSynthetic polypeptide 38 Pro Pro Thr Cys Pro Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe Ile 1 5 10 15 Ile Phe Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe Leu Leu Val Leu 20 25 30 Leu Asp Cys Gln Gly Met Leu Pro Val Cys Pro Leu Ile Pro Gly Ser 35 40 45 Ser Thr Thr Ser Arg Gly Pro Cys Arg Thr Cys Thr Thr Pro Ala Gln 50 55 60 Gly Thr Ser Thr Val Pro Ser Cys Cys Cys Thr Lys Pro Ser Asp Gly 65 70 75 80 Asn Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala Phe Gly Lys Phe 85 90 95 Leu Trp Glu Trp Ala Ser Ala Arg Phe Ser Trp Leu Ser Leu Leu Val 100 105 110 Pro Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr Val Trp Leu Leu 115 120 125 Val Met Trp Met Met Trp Tyr Trp Gly Pro Ser Leu Tyr Arg Ile Leu 130 135 140 Ser Pro Phe Leu Pro Leu Leu Pro Ile Phe Phe Cys Leu Trp Val Tyr 145 150 155 160 Ile 39160PRTartificial sequenceSynthetic polypeptide 39 Pro Thr Cys Pro Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe Ile Ile 1 5 10 15 Phe Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe Leu Leu Val Leu Leu 20 25 30 Asp Cys Gln Gly Met Leu Pro Val Cys Pro Leu Ile Pro Gly Ser Ser 35 40 45 Thr Thr Ser Arg Gly Pro Cys Arg Thr Cys Thr Thr Pro Ala Gln Gly 50 55 60 Thr Ser Thr Val Pro Ser Cys Cys Cys Thr Lys Pro Ser Asp Gly Asn 65 70 75 80 Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala Phe Gly Lys Phe Leu 85 90 95 Trp Glu Trp Ala Ser Ala Arg Phe Ser Trp Leu Ser Leu Leu Val Pro 100 105 110 Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr Val Trp Leu Leu Val 115 120 125 Met Trp Met Met Trp Tyr Trp Gly Pro Ser Leu Tyr Arg Ile Leu Ser 130 135 140 Pro Phe Leu Pro Leu Leu Pro Ile Phe Phe Cys Leu Trp Val Tyr Ile 145 150 155 160 40325PRTartificial sequenceSynthetic polypeptide 40 Leu Gly Ser Pro Gln Ala Gln Gly Ile Leu Gln Thr Leu Pro Ala Asn 1 5 10 15 Pro Pro Pro Ala Ser Thr Asn Arg Gln Ser Gly Arg Gln Pro Thr Pro 20 25 30 Leu Ser Pro Pro Leu Arg Asp Thr His Pro Gln Ala Met Gln Trp Asn 35 40 45 Ser Thr Thr Phe His Gln Thr Leu Gln Asp Pro Arg Val Lys Gly Leu 50 55 60 Tyr Phe Pro Ala Gly Gly Ser Ser Ser Gly Thr Val Asn Pro Val Pro 65 70 75 80 Thr Thr Ala Ser His Ser Ser Ser Ile Phe Ser Arg Ile Gly Val Pro 85 90 95 Ala Leu Asn Met Glu Asn Ile Thr Ser Gly Leu Leu Gly Pro Leu Leu 100 105 110 Val Leu Gln Ala Gly Phe Phe Leu Leu Thr Arg Ile Leu Thr Ile Pro 115 120 125 Gln Ser Leu Asp Ser Trp Trp Thr Ser Leu Asn Phe Arg Gly Gly Thr 130 135 140 Thr Val Cys Leu Gly Gln Asn Ser Gln Ser Pro Thr Ser Asn His Ser 145 150 155 160 Pro Thr Ser Cys Pro Pro Thr Cys Pro Gly Tyr Arg Trp Met Cys Leu 165 170 175 Arg Arg Phe Ile Ile Phe Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe 180 185 190 Leu Leu Val Leu Leu Asp Cys Gln Gly Met Leu Pro Val Cys Pro Leu 195 200 205 Ile Pro Gly Ser Ser Thr Thr Ser Arg Gly Pro Cys Arg Thr Cys Thr 210 215 220 Thr Pro Ala Gln Gly Thr Ser Thr Val Pro Ser Cys Cys Cys Thr Lys 225 230 235 240 Pro Ser Asp Gly Asn Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala 245 250 255 Phe Gly Lys Phe Leu Trp Glu Trp Ala Ser Ala Arg Phe Ser Trp Leu 260 265 270 Ser Leu Leu Val Pro Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr 275 280 285 Val Trp Leu Leu Val Met Trp Met Met Trp Tyr Trp Gly Pro Ser Leu 290 295 300 Tyr Arg Ile Leu Ser Pro Phe Leu Pro Leu Leu Pro Ile Phe Phe Cys 305 310 315 320 Leu Trp Val Tyr Ile 325 41309PRTartificial sequenceSynthetic polypeptide 41 Pro Pro Pro Ala Ser Thr Asn Arg Gln Ser Gly Arg Gln Pro Thr Pro 1 5 10 15 Leu Ser Pro Pro Leu Arg Asp Thr His Pro Gln Ala Met Gln Trp Asn 20 25 30 Ser Thr Thr Phe His Gln Thr Leu Gln Asp Pro Arg Val Lys Gly Leu 35 40 45 Tyr Phe Pro Ala Gly Gly Ser Ser Ser Gly Thr Val Asn Pro Val Pro 50 55 60 Thr Thr Ala Ser His Ser Ser Ser Ile Phe Ser Arg Ile Gly Val Pro 65 70 75 80 Ala Leu Asn Met Glu Asn Ile Thr Ser Gly Leu Leu Gly Pro Leu Leu 85 90 95 Val Leu Gln Ala Gly Phe Phe Leu Leu Thr Arg Ile Leu Thr Ile Pro 100 105 110 Gln Ser Leu Asp Ser Trp Trp Thr Ser Leu Asn Phe Arg Gly Gly Thr 115 120 125 Thr Val Cys Leu Gly Gln Asn Ser Gln Ser Pro Thr Ser Asn His Ser 130 135 140 Pro Thr Ser Cys Pro Pro Thr Cys Pro Gly Tyr Arg Trp Met Cys Leu 145 150 155 160 Arg Arg Phe Ile Ile Phe Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe 165 170 175 Leu Leu Ala Leu Leu Asp Cys Gln Gly Met Leu Pro Val Cys Pro Leu 180 185 190 Ile Pro Gly Ser Ser Thr Thr Ser Arg Gly Pro Cys Arg Thr Cys Thr 195 200 205 Thr Pro Ala Gln Gly Thr Ser Thr Val Pro Ser Cys Cys Cys Thr Lys 210 215 220 Pro Ser Asp Gly Asn Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala 225 230 235 240 Phe Gly Lys Phe Leu Trp Glu Trp Ala Ser Ala Arg Phe Ser Trp Leu 245 250 255 Ser Leu Leu Val Pro Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr 260 265 270 Val Trp Leu Leu Val Met Trp Met Met Trp Tyr Trp Gly Pro Ser Leu 275 280 285 Tyr Arg Ile Leu Ser Pro Phe Leu Pro Leu Leu Pro Ile Phe Phe Cys 290 295 300 Leu Trp Val Xaa Ile 305 421031DNAartificial sequenceSynthetic oligonucleotide 42 tactacaaac cttgccagca aatccgcctc ctgcctctac caatcgccag tcaggaaggc 60 agcctacccc tctgactcca cctttgagaa acactcatcc tcaggccatg cagtggaact 120 ccacaaactt ccaccgaact ctacaagatc ccagagtgaa aggcctgtat ctccctgctg 180 gtggctccag ttcaggaaca gtaaaccctg ttccgactac tgtctctcac acatcgtcaa 240 tcttatcgag gattggggac cctgcactga acatggagaa catcacatca ggattcctag 300 gacccctgct cgtgttacag gcggggtttt tcttgttgac aagaatcctc acaataccgc 360 agagtctaga ctcgtggtgg acttctctca attttctagg ggggaccacc gtgtgccttg 420 gccaaaattc gcagtcccca acctccaatc actcaccaac ctcctgtcct ccaacttgtc 480 ctggttatcg ctggatgtgt ctgcggcgtt ttatcatatt cctcttcatc ctgctgctat 540 gcctcatctt cttgttggtt cttctggact atcaaggtat gttgcccgtt tgccctctaa 600 ttccaggatc ctcaaccacc agcacgggac catgcagaac ctgcacgact cctgctcaag 660 gaacctctwt gtatccctca tgttgctgta ccaaacctwc ggmcgsaaat tgcacctgta 720 ttcccatccc atcatcctgg gctttcggaa aattcctatg ggagtgggcc tcagcccgtt 780 tctcctgact cagtttacta gtgccatttg ttcagtggtt cgtagggctt tcccccactg 840 tttggctttc agttatatgg atgatgtggt attgggggcc aggtctgtac agcatcgtga 900 ggcccttttt accgctgtta ccaattttct tttgtctctg ggtatacatt taaccccgga 960 caaaacaaaa agatggggtt actctttaca tttcatgggc tatgtcattg gatgttatgg 1020 gtcattgcca c 1031 43345PRTartificial sequenceSynthetic polypeptide 43 Thr Thr Asn Leu Ala Ser Lys Ser Ala Ser Cys Leu Tyr Gln Ser Pro 1 5 10 15 Val Arg Lys Ala Ala Tyr Pro Ser Asp Ser Thr Phe Glu Lys His Ser 20 25 30 Ser Ser Gly His Ala Val Glu Leu His Lys Leu Pro Pro Asn Ser Thr 35 40 45 Arg Ser Gln Ser Glu Arg Pro Val Ser Pro Cys Trp Trp Leu Gln Phe 50 55 60 Arg Asn Ser Lys Pro Cys Ser Asp Tyr Cys Leu Ser His Ile Val Asn 65 70 75 80 Leu Ile Glu Asp Trp Gly Pro Cys Thr Glu His Gly Glu His His Ile 85 90 95 Arg Ile Pro Arg Thr Pro Ala Arg Val Thr Gly Gly Val Phe Leu Val 100 105 110 Asp Lys Asn Pro His Asn Thr Ala Glu Ser Arg Leu Val Val Asp Phe 115 120 125 Ser Gln Phe Ser Arg Gly Asp His Arg Val Pro Trp Pro Lys Phe Ala 130 135 140 Val Pro Asn Leu Gln Ser Leu Thr Asn Leu Leu Ser Ser Asn Leu Ser 145 150 155 160 Trp Leu Ser Leu Asp Val Ser Ala Ala Phe Tyr His Ile Pro Leu His 165 170 175 Pro Ala Ala Met Pro His Leu Leu Val Gly Ser Ser Gly Leu Ser Arg 180 185 190 Tyr Val Ala Arg Leu Pro Ser Asn Ser Arg Ile Leu Asn His Gln His 195 200 205 Gly Thr Met Gln Asn Leu His Asp Ser Cys Ser Arg Asn Leu Tyr Phe 210 215 220 Val Ser Leu Met Leu Leu Tyr Gln Thr Phe Thr Gly Arg Lys Leu His 225 230 235 240 Leu Tyr Ser His Pro Ile Ile Leu Gly Phe Arg Lys Ile Pro Met Gly 245 250 255 Val Gly Leu Ser Pro Phe Leu Leu Thr Gln Phe Thr Ser Ala Ile Cys 260 265 270 Ser Val Val Arg Arg Ala Phe Pro His Cys Leu Ala Phe Ser Tyr Met 275 280 285 Asp Asp Val Val Leu Gly Ala Arg Ser Val Gln His Arg Glu Ala Leu 290 295 300 Phe Thr Ala Val Thr Asn Phe Leu Leu Ser Leu Gly Ile His Leu Thr 305 310 315 320 Pro Asp Lys Thr Lys Arg Trp Gly Tyr Ser Leu His Phe Met Gly Tyr 325 330 335 Val Ile Gly Cys Tyr Gly Ser Leu Pro 340 345 44317PRTartificial sequenceSynthetic polypeptide 44 Leu Gln Thr Leu Pro Ala Asn Pro Pro Pro Ala Ser Thr Asn Arg Gln 1 5 10 15 Ser Gly Arg Gln Pro Thr Pro Leu Thr Pro Pro Leu Arg Asn Thr His 20 25 30 Pro Gln Ala Met Gln Trp Asn Ser Thr Asn Phe His Arg Thr Leu Gln 35 40 45 Asp Pro Arg Val Lys Gly Leu Tyr Leu Pro Ala Gly Gly Ser Ser Ser 50 55 60 Gly Thr Val Asn Pro Val Pro Thr Thr Val Ser His Thr Ser Ser Ile 65 70 75 80 Leu Ser Arg Ile Gly Asp Pro Ala Leu Asn Met Glu Asn Ile Thr Ser 85 90 95 Gly Phe Leu Gly Pro Leu Leu Val Leu Gln Ala Gly Phe Phe Leu Leu 100 105 110 Thr Arg Ile Leu Thr Ile Pro Gln Ser Leu Asp Ser Trp Trp Thr Ser 115 120 125 Leu Asn Phe Leu Gly Gly Thr Thr Val Cys Leu Gly Gln Asn Ser Gln 130 135 140 Ser Pro Thr Ser Asn His Ser Pro Thr Ser Cys Pro Pro Thr Cys Pro 145 150 155 160 Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe Ile Ile Phe Leu Phe Ile 165 170 175 Leu Leu Leu Cys Leu Ile Phe Leu Leu Val Leu Leu Asp Tyr Gln Gly 180 185 190 Met Leu Pro Val Cys Pro Leu Ile Pro Gly Ser Ser Thr Thr Ser Thr 195 200 205 Gly Pro Cys Arg Thr Cys Thr Thr Pro Ala Gln Gly Thr Ser Met Leu 210 215 220 Tyr Pro Ser Cys Cys Cys Thr Lys Pro Ser Thr Ala Ala Asn Cys Thr 225 230 235 240 Cys Ile Pro Ile Pro Ser Ser Trp Ala Phe Gly Lys Phe Leu Trp Glu 245 250 255 Trp Ala Ser Ala Arg Phe Ser Leu Ser Leu Leu Val Pro Phe Val Gln 260 265 270 Trp Phe Val Gly Leu Ser Pro Thr Val Trp Leu Ser Val Ile Trp Met 275 280 285 Met Trp Tyr Trp Gly Pro Gly Leu Tyr Ser Ile Val Arg Pro Phe Leu 290 295 300 Pro Leu Leu Pro Ile Phe Phe Cys Leu Trp Val Tyr Ile 305 310 315 45888DNAartificial sequenceSynthetic oligonucleotide 45 tggtcacagt gccaacagtt cctcctcctg cctccaccaa tcggcagtca gggaggcagc 60 ctactcccat ctctccacct ctaagagaca gtcatcctca ggccatggtg gctcagcctg 120 ctggtggctc cagttcagga acactcaacc ctgttcccaa tattgcctct cacatctcgt 180 caatctcctt gaggactggg gaccctgcgc cgaacatgga gaacatcaca tcaggattcc 240 taggacccct gctcgtgtta caggcggggt ttttcttgtt gacaagaatc ctcacaatac 300 cgcagagtct agactcgtgg tggacttctc tcagttttct agggggatca cccgtgtgtc 360 ttggccaaaa ttcgcagtcc ccaacctcca atcactcacc aacctcctgt cctccaattt 420 gacctggtta tcgctggata tgtctgcggc gttttatcat attcctcttc atcctgccgc 480 tatgcctcat cttcttattg gttcttctgg attatcaagg tatgttgccc gtttgtcctc 540 taattccagg atccacaaca accagtgcgg gaccctgcaa aacctgcacg actcctgctc 600 aaggcaactc tatgtttccc tcatgttgct gtacaaaacc tacggatgga aattgcacct 660 gtattcccat cccatcatct tgggctttcg caaaatacct atgggagtgg gcctcagtcc 720 gtttctcttg gctcagttta ctagtgccat ttgttcagtg attcgtaggg ctttccccca 780 ctgtttggct ttcagctata ttgatgatgt ggtactgggg gccaagtctg cacaacatct 840 tgagtccctt tataccgctg ttaccaattt tcttttgtct ttgggtat 888 46295PRTartificial sequenceSynthetic polypeptide 46 Gly His Ser Ala Asn Ser Ser Ser Ser Cys Leu His Gln Ser Ala Val 1 5 10 15 Arg Glu Ala Ala Tyr Ser His Leu Ser Thr Ser Lys Arg Gln Ser Ser 20 25 30 Ser Gly His Gly Gly Ser Ala Cys Trp Trp Leu Gln Phe Arg Asn Thr 35 40 45 Gln Pro Cys Ser Gln Tyr Cys Leu Ser His Leu Val Asn Leu Leu Glu 50 55 60 Asp Trp Gly Pro Cys Ala Glu His Gly Glu His His Ile Arg Ile Pro 65 70 75 80 Arg Thr Pro Ala Arg Val Thr Gly Gly Val Phe Leu Val Asp Lys Asn 85 90 95 Pro His Asn Thr Ala Glu Ser Arg Leu Val Val Asp Phe Ser Gln Phe 100 105 110 Ser Arg Gly Ile Thr Arg Val Ser Trp Pro Lys Phe Ala Val Pro Asn 115 120 125 Leu Gln Ser Leu Thr Asn Leu Leu Ser Ser Asn Leu Thr Trp Leu Ser 130 135 140 Leu Asp Met Ser Ala Ala Phe Tyr His Ile Pro Leu His Pro Ala Ala 145 150 155 160 Met Pro His Leu Leu Ile Gly Ser Ser Gly Leu Ser Arg Tyr Val Ala 165 170 175 Arg Leu Ser Ser Asn Ser Arg Ile His Asn Asn Gln Cys Gly Thr Leu 180 185 190 Gln Asn Leu His Asp Ser Cys Ser Arg Gln Leu Tyr Val Ser Leu Met 195 200 205 Leu Leu Tyr Lys Thr Tyr Gly Trp Lys Leu His Leu Tyr Ser His Pro 210 215 220 Ile Ile Leu Gly Phe Arg Lys Ile Pro Met Gly Val Gly Leu Ser Pro 225 230 235 240 Phe Leu Leu Ala Gln Phe Thr Ser Ala Ile Cys Ser Val Ile Arg Arg 245 250 255 Ala Phe Pro His Cys Leu Ala Phe Ser Tyr Ile Asp Asp Val Val Leu 260 265 270 Gly Ala Lys Ser Ala Gln His Leu Glu Ser Leu Tyr Thr Ala Val Thr 275 280 285 Asn Phe Leu Leu Ser Leu Gly 290 295 47293PRTartificial sequenceSynthetic polypeptide 47 Val Thr Val Pro Thr Val Pro Pro Pro Ala Ser Thr Asn Arg Gln Ser 1 5 10 15 Gly Arg Gln Pro Thr Pro Ile Ser Pro Pro Leu Arg Asp Ser His Pro 20 25 30 Gln Ala Met Val Ala Gln Pro Ala Gly Gly Ser Ser Ser Gly Thr Leu 35 40 45 Asn Pro Val Pro Asn Ile Ala Ser His Ile Ser Ser Ile Ser Leu Arg 50 55 60 Thr Gly Asp Pro Ala Pro Asn Met Glu Asn Ile Thr Ser Gly Phe Leu 65 70 75 80 Gly Pro Leu Leu Val Leu Gln Ala Gly Phe Phe Leu Leu Thr Arg Ile 85 90 95 Leu Thr Ile Pro Gln Ser Leu Asp Ser Trp Trp Thr Ser Leu Ser Phe 100 105 110 Leu Gly Gly Ser Pro Val Cys Leu Gly Gln Asn Ser Gln Ser Pro Thr 115 120 125 Ser Asn His Ser Pro Thr Ser Cys Pro Pro Ile Pro Gly Tyr Arg Trp 130 135 140 Ile Cys Leu Arg Arg Phe Ile Ile Phe Leu Phe Ile Leu Pro Leu Cys 145 150 155 160 Leu Ile Phe Leu Leu Val Leu Leu Asp Tyr Gln Gly Met Leu Pro Val 165 170 175 Cys Pro Leu Ile Pro Gly Ser Thr Thr Thr Ser Ala Gly Pro Cys Lys 180 185 190 Thr Cys Thr Thr Pro Ala Gln Gly Asn Ser Met Phe Pro Ser Cys Cys 195 200 205 Cys Thr Lys Pro Thr Asp Gly Asn Cys Thr Cys Ile Pro Ile Pro Ser 210 215 220 Ser Trp Ala Phe Ala Lys Tyr Leu Trp Glu Trp Ala Ser Val Arg Phe 225 230 235 240 Ser Trp Leu Ser Leu Leu Val Pro Phe Val Gln Phe Val Gly Leu Ser 245 250 255 Pro Thr Val Trp Leu Ser Ala Ile Leu Met Met Trp Tyr Trp Gly Pro 260 265 270 Ser Leu His Asn Ile Leu Ser Pro Phe Ile Pro Leu Leu Pro Ile Phe 275 280 285 Phe Cys Leu Trp Val 290 48591DNAartificial sequenceSynthetic oligonucleotide 48 tcctgtcctc caatttgtcc tggttatcgc tggatgtgtc tgcggcgttt tatgatattc 60 ctcttcatcc tgctgctatg cctcatcttc ttattggttc ttctggatta tcaaggtatg 120 ttgcccgtct gtcctctaat tccaggatca acaacaacca gtacgggacc atgcaaaacc 180 aaaacctgca cgactcctgc tcaaggcaac tctatgtttc cctcatgttg ctgtacaaaa 240 cctacggatg gaaattgcac ctgtattccc atcccatcgt cctgggcttt cgcaaaattc 300 ctatgggagt gggcctcagt ccgtttctct tggctcagtt tactagtgcc atttgttcag 360 tggttcgtag ggctttcccc cactgtttgg ctttcagcta tatggatgat gtggtattgg 420 gggccaagtc tgtacagcat cgtgaggccc tttatacagc tgttaccaat tttcttttgt 480 ctctgggtat acatttaaac cctaacaaaa caaaaagatg gggttattcc ctaaacttca 540 tgggttacat aattggaagt tggggaacat tgccacagga tcatattgta c 591 49186PRTartificial sequenceSynthetic polypeptide 49 Ser Asn Leu Ser Trp Leu Ser Leu Asp Val Ser Ala Ala Phe Tyr Asp 1 5 10 15 Ile Pro Leu His Pro Ala Ala Met Pro His Leu Leu Ile Gly Ser Ser 20 25 30 Gly Leu Ser Arg Tyr Val Ala Arg Leu Ser Ser Asn Ser Arg Ile Asn 35 40 45 Asn Asn Gln Tyr Gly Thr Met Gln Asn Gln Asn Leu His Asp Ser Cys 50 55 60 Ser Arg Gln Leu Tyr Val Ser Leu Met Leu Leu Tyr Lys Thr Tyr Gly 65 70 75 80 Trp Lys Leu His Leu Tyr Ser His Pro Ile Val Leu Gly Phe Arg Lys 85 90 95 Ile Pro Met Gly Val Gly Leu Ser Pro Phe Leu Leu Ala Gln Phe Thr 100 105 110 Ser Ala Ile Cys Ser Val Val Arg Arg Ala Phe Pro His Cys Leu Ala 115 120 125 Phe Ser Tyr Met Asp Asp Val Val Leu Gly Ala Lys Ser Val Gln His 130 135 140 Arg Glu Ala Leu Tyr Thr Ala Val Thr Asn Phe Leu Leu Ser Leu Gly 145 150 155 160 Ile His Leu Asn Pro Asn Lys Thr Lys Arg Trp Gly Tyr Ser Leu Asn 165 170 175 Phe Met Gly Tyr Ile Ile Gly Ser Trp Gly 180 185 50165PRTartificial sequenceSynthetic polypeptide 50 Ser Cys Pro Pro Ile Cys Pro Gly Tyr Arg Trp Met Cys Leu Arg Arg 1 5 10 15 Phe Met Ile Phe Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe Leu Leu 20 25 30 Val Leu Leu Asp Tyr Gln Gly Met Leu Pro Val Cys Pro Leu Ile Pro 35 40 45 Gly Ser Thr Thr Thr Ser Thr Gly Pro Cys Lys Thr Lys Thr Cys Thr 50 55 60 Thr Pro Ala Gln Gly Asn Ser Met Phe Pro Ser Cys Cys Cys Thr Lys 65 70 75 80 Pro Thr Asp Gly Asn Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala 85 90 95 Phe Ala Lys Phe Leu Trp Glu Trp Ala Ser Val Arg Phe Ser Trp Leu 100 105 110 Ser Leu Leu Val Pro Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr 115 120 125 Val Trp Leu Ser Ala Ile Trp Met Met Trp Tyr Trp Gly Pro Ser Leu 130 135 140 Tyr Ser Ile Val Arg Pro Phe Ile Gln Leu Leu Pro Ile Phe Phe Cys 145 150 155 160 Leu Trp Val Tyr Ile 165 51669DNAartificial sequenceSynthetic oligonucleotide 51 aatcctcaca ataccgcaga gtctagactt cgtggtgact tctctcaatt ttctagggga 60 ccacccgtgt gtcttggcca aaattcgcag tccccaacct ccaatcactc accaacctct 120 tgtcctccaa tttgtcctgg ttatcgctgg atgtgtctgc ggcgttttat catatccctc 180 ttcatcctgc tgctatgcct catcttctta ttggttcttc tggattatca aggtatgttg 240 cccgtttgtc ctctaattcc aggatccaca acaaccagta cgggaccctg caaaacctgc 300 acgactcctg ctcaaggcaa ctctatgttt ccctcatgtt gctgtacaaa acctacggat 360 ggaaattgca cmtgtattcc catcccatca tcttgggctt tcgcaaaata cctatgggag 420 tgggcctcag tccgtttctc ttggttcagt ttactagtgc catttgttca gtggttcgta 480 gggctttccc ccactgtttg gctttcagct atatggatga tattgtactg ggggccaagt 540 ctgtacaaca tcttgagtcc ctttataccg ctgttaccaa ttttcttttg tctttgggta 600 tacatttaac ccctaacaaa acaaagagat ggggttattc cctgaatttc atgggttatg 660 taattggaa 669 52181PRTartificial sequenceSynthetic polypeptide 52 Ser Asn Leu Ser Trp Leu Ser Leu Asp Val Ser Ala Ala Phe Tyr His 1 5 10 15 Ile Pro Leu His Pro Ala Ala Met Pro His Leu Leu Ile Gly Ser Ser 20 25 30 Gly Leu Ser Arg Tyr Val Ala Arg Leu Ser Ser Asn Ser Arg Ile His 35 40 45 Asn Asn Gln Tyr Gly Thr Leu Gln Asn Leu His Asp Ser Cys Ser Arg 50 55 60 Gln Leu Tyr Val Ser Leu Met Leu Leu Tyr Lys Thr Tyr Gly Trp Lys 65 70 75 80 Leu His Xaa Tyr Ser His Pro Ile Ile Leu Gly Phe Arg Lys Ile Pro 85 90 95 Met Gly Val Gly Leu Ser Pro Phe Leu Leu Val Gln Phe Thr Ser Ala 100 105 110 Ile Cys Ser Val Val Arg Arg Ala Phe Pro His Cys Leu Ala Phe Ser 115 120 125 Tyr Met Asp Asp Ile Val Leu Gly Ala Lys Ser Val Gln His Leu Glu 130 135 140 Ser Leu Tyr Thr Ala Val Thr Asn Phe Leu Leu Ser Leu Gly Ile His 145 150 155 160 Leu Thr Pro Asn Lys Thr Lys Arg Trp Gly Tyr Ser Leu Asn Phe Met 165 170 175 Gly Tyr Val Ile Gly 180 53160PRTartificial sequenceSynthetic polypeptide 53 Pro Ile Cys Pro Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe Ile Ile 1 5 10 15 Ser Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe Leu Leu Val Leu Leu 20 25 30 Asp Tyr Gln Gly Met Leu Pro Val Cys Pro Leu Ile Pro Gly Ser Thr 35 40 45 Thr Thr Ser Thr Gly Pro Cys Lys Thr Cys Thr Thr Pro Ala Gln Gly 50 55 60 Asn Ser Met Phe Pro Ser Cys Cys Cys Thr Lys Pro Thr Asp Gly Asn 65 70 75 80 Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala Phe Ala Lys Tyr Leu 85 90 95 Trp Glu Trp Ala Ser Val Arg Phe Ser Trp Phe Ser Leu Leu Val Pro 100 105 110 Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr Val Trp Leu Ser Ala 115 120 125 Ile Trp Met Ile Leu Tyr Trp Gly Pro Ser Leu Tyr Asn Ile Leu Ser 130 135 140 Pro Phe Ile Pro Leu Leu Pro Ile Phe Phe Cys Leu Trp Val Tyr Ile 145 150 155 160 54554DNAartificial sequenceSynthetic oligonucleotide 54 tccaatttgt cctgggtatc gctggatgtg tctgcggcgt tttatcatat tcctcttcat 60 cctgctgcta tgcctcatct tcttgttggt tcttctggac tatcaaggta tgttgcccgt 120 ttgtcctcta cttccaggaa catcaactac cagcacggga ccatgcaaga cctgcacgac 180 tcctgctcaa ggaacctcta tgtttccctc ttgttgctgt acaaaacctt cggacggaaa 240 ttgcacttgt attcccatcc catcgtcttg ggctttcgca agattcctat gggagtgggc 300 ctcagtccgt ttctcttggc tcartttact agtgccattt gttcagtggt tcgtagggct 360 ttcccccact gtttggcttt cagttatatt gatgatgtgg tattgggggc caagtctgta 420 caacatcttg aatccctttt tacctctatt accaattttc ttatgtcttt gggtatacat 480 ttaaacccta agaaaaccaa acgttggggc tactccctta acttcatggg atatgtaatt 540 ggaagttggg gtac 554 55184PRTartificial sequenceSynthetic polypeptide 55 Ser Asn Leu Ser Trp Val Ser Leu Asp Val Ser Ala Ala Phe Tyr His 1 5 10 15 Ile Pro Leu His Pro Ala Ala Met Pro His Leu Leu Val Gly Ser Ser 20 25 30 Gly Leu Ser Arg Tyr Val Ala Arg Leu Ser Ser Thr Ser Arg Asn Ile 35 40 45 Asn Tyr Gln His Gly Thr Met Gln Asp Leu His Asp Ser Cys Ser Arg 50 55 60 Asn Leu Tyr Val Ser Leu Leu Leu Leu Tyr Lys Thr Phe Gly Arg Lys 65 70 75 80 Leu His Leu Tyr Ser His Pro Ile Val Leu Gly Phe Arg Lys Ile Pro 85 90 95 Met Gly Val Gly Leu Ser Pro Phe Leu Leu Ala Gln Phe Thr Ser Ala 100 105 110 Ile Cys Ser Val Val Arg Arg Ala Phe Pro His Cys Leu Ala Phe Ser 115 120 125 Tyr Ile Asp Asp Val Val Leu Gly Ala Lys Ser Val Gln His Leu Glu 130 135 140 Ser Leu Phe Thr Ser Ile Thr Asn Phe Leu Met Ser Leu Gly Ile His 145 150 155 160 Leu Asn Pro Lys Lys Thr Lys Arg Trp Gly Tyr Ser Leu Asn Phe Met 165 170 175 Gly Tyr Val Ile Gly Ser Trp Gly 180 56160PRTartificial sequenceSynthetic polypeptide 56 Pro Ile Cys Pro Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe Ile Ile 1 5 10 15 Phe Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe Leu Leu Val Leu Leu 20 25 30 Asp Tyr Gln Gly Met Leu Pro Val Cys Pro Leu Leu Pro Gly Thr Ser 35 40 45 Thr Thr Ser Thr Gly Pro Cys Lys Thr Cys Thr Thr Pro Ala Gln Gly 50 55 60 Thr Ser Met Phe Pro Ser Cys Cys Cys Thr Lys Pro Ser Asp Gly Asn 65 70 75 80 Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala Phe Ala Arg Phe Leu 85 90 95 Trp Glu Trp Ala Ser Val Arg Phe Ser Trp Leu Xaa Leu Leu Val Pro 100 105 110 Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr Val Trp Leu Ser Val 115 120 125 Ile Leu Met Met Trp Tyr Trp Gly Pro Ser Leu Tyr Asn Ile Leu Asn 130 135 140 Pro Phe Leu Pro Leu Leu Pro Ile Phe Leu Cys Leu Trp Val Tyr Ile 145 150 155 160 571045DNAartificial sequenceSynthetic oligonucleotide 57 cagcaaatcc gcctcctgcc tctaccaatc gccagtcagg aaggcagcct acccctctgt 60 ctccaccttt grgaaacact catcctcagg ccatgcagtg gaactccaca accttccacc 120 aaactctgcw agatcccaga gtgagaggcc tgtatttccc tgctggtggc tccagttcag 180 gaacagtaaa ccctgttccg acttctgtct ctcacacatc gtcaatcttc tcgaggattg 240 gggwccctgc gctgaacatg gagaacatca catcaggatt cctaggaccc ctgctcgtgt 300 tacaggcggg gtttttcttg ttgacaagaa tcctcacaat accgcagagt ctagactcgt 360 ggtggacttc tctcaatttt ctagggggaa ctaccgtgtg tcttggccaa aattcgcagt 420 tcccaacctc caatcactca ccaacctcct gtcctccaac ttgwcctggt tatcgctgga 480 tgtrtctgcg gcgttttatc atcttcctct tcatcctgct gctatgcctc atcttcttgt 540 tggttcttct ggactatcaa ggtatgttgc ccgtttgtcc tctarttcca ggatcttcaa 600 ccaccagcac gggaccatgc agaacctgca cgactcctgc tcaaggaamc tctatgaatc 660 cctcctgttg ctgtaccaaa ccttcggacg gaaattgcac ctgtattccc atcccatcat 720 cctgggcttt cggaaaattc ctatgggagt gggcctcagc ccgtttctcc tgrctcagtt 780 tactagtgcc atttgttcag tggttcgtag ggctttcccc cactgtttgg ctttcagtta 840 tatggatgat gtggtattgg gggccaagtc tgtaymgcat cttragtccc tttttaccgc 900 tgttaccaat tttcttttgt ctytgggtat acatttaaac cctmacaaaa caaaaagatg 960 gggttactct ttacatttca tgggctatgt cattggatgt tatgggtcat tgccacaaga 1020 tcacatcagacagaaaatca aagaa 1045 58348PRTartificial sequenceSynthetic polypeptide 58 Ser Lys Ser Ala Ser Cys Leu Tyr Gln Ser Pro Val Arg Lys Ala Ala 1 5 10 15 Tyr Pro Ser Val Ser Thr Phe Xaa Lys His Ser Ser Ser Gly His Ala 20 25 30 Val Glu Leu His Asn Leu Pro Pro Asn Ser Ala Arg Ser Gln Ser Glu 35 40 45 Arg Pro Val Phe Pro Cys Trp Trp Leu Gln Phe Arg Asn Ser Lys Pro 50 55 60 Cys Ser Asp Phe Cys Leu Ser His Ile Val Asn Leu Leu Glu Asp Trp 65 70 75 80 Gly Pro Cys Ala Glu His Gly Glu His His Ile Arg Ile Pro Arg Thr 85 90 95 Pro Ala Arg Val Thr Gly Gly Val Phe Leu Val Asp Lys Asn Pro His 100 105 110 Asn Thr Ala Glu Ser Arg Leu Val Val Asp Phe Ser Gln Phe Ser Arg 115 120 125 Gly Asn Tyr Arg Val Ser Trp Pro Lys Phe Ala Val Pro Asn Leu Gln 130 135 140 Ser Leu Thr Asn Leu Leu Ser Ser Asn Leu Xaa Trp Leu Ser Leu Asp 145 150 155 160 Val Ser Ala Ala Phe Tyr His Leu Pro Leu His Pro Ala Ala Met Pro 165 170 175 His Leu Leu Val Gly Ser Ser Gly Leu Ser Arg Tyr Val Ala Arg Leu 180 185 190 Ser Ser Xaa Ser Arg Ile Phe Asn His Gln His Gly Thr Met Gln Asn 195 200 205 Leu His Asp Ser Cys Ser Arg Xaa Leu Tyr Glu Ser Leu Leu Leu Leu 210 215 220 Tyr Gln Thr Phe Gly Arg Lys Leu His Leu Tyr Ser His Pro Ile Ile 225 230 235 240 Leu Gly Phe Arg Lys Ile Pro Met Gly Val Gly Leu Ser Pro Phe Leu 245 250 255 Leu Xaa Gln Phe Thr Ser Ala Ile Cys Ser Val Val Arg Arg Ala Phe 260 265 270 Pro His Cys Leu Ala Phe Ser Tyr Met Asp Asp Val Val Leu Gly Ala 275 280 285 Lys Ser Val Xaa His Leu Xaa Ser Leu Phe Thr Ala Val Thr Asn Phe 290 295 300 Leu Leu Ser Leu Gly Ile His Leu Asn Pro Xaa Lys Thr Lys Arg Trp 305 310 315 320 Gly Tyr Ser Leu His Phe Met Gly Tyr Val Ile Gly Cys Tyr Gly Ser 325 330 335 Leu Pro Gln Asp His Ile Arg Gln Lys Ile Lys Glu 340 345 59311PRTartificial sequenceSynthetic polypeptide 59 Ala Asn Pro Pro Pro Ala Ser Thr Asn Arg Gln Ser Gly Arg Gln Pro 1 5 10 15 Thr Pro Leu Ser Pro Pro Leu Xaa Asn Thr His Pro Gln Ala Met Gln 20 25 30 Trp Asn Ser Thr Thr Phe His Gln Thr Leu Xaa Asp Pro Arg Val Arg 35 40 45 Gly Leu Tyr Phe Pro Ala Gly Gly Ser Ser Ser Gly Thr Val Asn Pro 50 55 60 Val Pro Thr Ser Val Ser His Thr Ser Ser Ile Phe Ser Arg Ile Gly 65 70 75 80 Xaa Pro Ala Leu Asn Met Glu Asn Ile Thr Ser Gly Phe Leu Gly Pro 85 90 95 Leu Leu Val Leu Gln Ala Gly Phe Phe Leu Leu Thr Arg Ile Leu Thr 100 105 110 Ile Pro Gln Ser Leu Asp Ser Trp Trp Thr Ser Leu Asn Phe Leu Gly 115 120 125 Gly Thr Thr Val Cys Leu Gly Gln Asn Ser Gln Phe Pro Thr Ser Asn 130 135 140 His Ser Pro Thr Ser Cys Pro Pro Thr Xaa Pro Gly Tyr Arg Trp Met 145 150 155 160 Xaa Leu Arg Arg Phe Ile Ile Phe Leu Phe Ile Leu Leu Leu Cys Leu 165 170 175 Ile Phe Leu Leu Val Leu Leu Asp Tyr Gln Gly Met Leu Pro Val Cys 180 185 190 Pro Leu Xaa Pro Gly Ser Ser Thr Thr Ser Thr Gly Pro Cys Arg Thr 195 200 205 Cys Thr Thr Pro Ala Gln Gly Xaa Ser Met Asn Pro Ser Cys Cys Cys 210 215 220 Thr Lys Pro Ser Asp Gly Asn Cys Thr Cys Ile Pro Ile Pro Ser Ser 225 230 235 240 Trp Ala Phe Gly Lys Phe Leu Trp Glu Trp Ala Ser Ala Arg Phe Ser 245 250 255 Xaa Leu Ser Leu Leu Val Pro Phe Val Gln Trp Phe Val Gly Leu Ser 260 265 270 Pro Thr Val Trp Leu Ser Val Ile Trp Met Met Trp Tyr Trp Gly Pro 275 280 285 Ser Leu Tyr Xaa Ile Leu Ser Pro Phe Leu Pro Leu Leu Pro Ile Phe 290 295 300 Phe Cys Leu Trp Val Tyr Ile 305 310

Claims

1. A primer or probe capable of hybridizing to a nucleic acid molecule, which nucleic acid molecule comprises a nucleic acid sequence that encodes a reverse transcriptase domain of a DNA polymerase, and further comprises mutations selected from a mutation of codon 84 from valine to methionine; a mutation at codon 214 from valine to adenine; and co-mutations at codon 181 from adenine to threonine and codon 236 from asparagine to threonine of the wild-type sequence.

2. The primer or probe of claim 1, wherein the nucleic acid with a mutation at codon 84 or 214 further comprises a mutation at codon 236 from asparagine to threonine.

3. The primer or probe of claim 1 wherein the nucleic acid comprises co-mutations at 181 from adenine to threonine and at 236 from asparagine to threonine.

4. The primer of claim 1, comprising the sequence gcctcatttt gtgggtcacc ata.

5. The primer of claim 1, comprising the sequence aaattcgcag tccccaaa.

6. The primer of claim 1, comprising the sequence ttggggtgga gccctcaggc t.

7. The primer of claim 1, comprising the sequence gaaaattggt aacagcgg.

8. The primer of claim 1, comprising the sequence tctctgacat actttccaat.

9. The primer of claim 1, comprising the sequence gcctcatttt gtgggtcacc ata.

10. The primer of claim 1, comprising the sequence tctctgacat actttccaat.

11. The primer of claim 1, comprising the sequence tgcacgattc ctgctcaa.

12. The primer of claim 1, comprising the sequence tttctcaaag gtggagacag.

13. The primer of claim 1, comprising the sequence gggaggagat taggttaa.

14. The primer of claim 1, comprising the sequence ggcaaaaacg agagtaactc.

15. The primer of claim 1, comprising the sequence cgcgtcctac tgttcaagcc tccaagctgt gacgcg.