METHODS AND COMPOSITIONS FOR RNAi-BASED CANCER TREATMENT
The present invention generally concerns methods and nucleotide-based compositions for treating metastatic cancer that is associated with a primary tumor or a few tumors at the primary organ.
This application is a Continuation-in-Part of International Application No. PCT/IL2013/050340, filed on Apr. 18, 2013, which claims priority from U.S. patent application Ser. No. 13/451,231, filed on Apr. 19, 2012. The contents of each of these applications are incorporated herein by reference.
FIELD OF THE INVENTIONThe present invention generally concerns nucleotide-based agent-based and RNAi-based methods and compositions for treating metastatic cancer.
BACKGROUND OF THE INVENTIONMetastasis is the spread of a cancer from one organ, usually the primary tumor, to another non-adjacent organ. Typically, pancreatic cancer first metastasizes to regional lymph nodes, and later to the liver or to the peritoneal cavity and, rarely, to the lungs, bone or brain. Metastases represent the end-products of a multi-step cell-biological process (Valastyan and Weinberg 2011) termed the invasion metastasis cascade, which involves dissemination of cancer cells to anatomically distant organ sites and their subsequent adaptation to foreign tissue microenvironments. Each of these events is driven by (1) acquisition of genetic and/or epigenetic alterations within tumor cells and (2) cooption of non-neoplastic stromal cells, which together endow incipient metastatic cells with traits needed to generate macroscopic metastases. Recent advances have provided provocative insights regarding these cell-biological and molecular changes, which carry implications concerning the pathogenesis of metastatic progression and the steps of the invasion-metastasis cascade that appear amenable to therapeutic targeting.
An epithelial-mesenchymal transition (EMT) is a biologic process that allows a polarized epithelial cell, which normally interacts with basement membrane via its basal surface, to undergo multiple biochemical changes that enable it to assume a mesenchymal cell phenotype, which includes enhanced migratory capacity, invasiveness, elevated resistance to apoptosis, and greatly increased production of ECM components. Genes that are (abnormally) expressed in the primary tumor can facilitate metastasis by processes including seeding and re-seeding. Some genes relate to colonization at specific far organ. (Gupta and Massagué, 2006). A variety of factors, including Snai1, Snai2, Twist1, Twist2, Zeb1, Zeb2 (SIP1), fibronectin 1 (FN1), Vimentin (vim), N-Cadherin, SERPINA3, CD70, IL13RA2, CD74, and TCF3, were shown to facilitate metastasis, either via induction of EMT through repression of E-cadherin transcription or via other pathways (Kalluri and Weinberg 2009, Brabletz, 2012, Holtz 2007, Pan and Yang 2011, Nozato 2013). Ken et al (US patent application 20120302572) classified in the EMT gene signature (EMTGS) genes of which abnormal expression might be associated with EMT, including the following genes: SERPINA3, ACTN1, AGR2, AKAP12, ALCAM, APIM2, AXL, BSPRY, CCL2, CDH1, CDH2, CEP170, CLDN3, CLDN4, CNN3, CYP4X1, DNMT3A, DSG3, DSP, EFNB2, EHF, ELF3, ELF5, ERBB3, ETV5, FLRT3, FOSB, FOSL1, FOXC1, FXYD5, GPDIL, HMGA1, FIMGA2, HOPX, IFI16, IGFBP2, IHH, IKBIP, IL-11, IL-18, IL6, IL8, ITGA5, ITGB3, LAMB1, LCN2, MAP7, MB, MMP7, MMP9, MPZL2, MSLN, MTA3, MTSS1, OCLN, PCOLCE2, PECAM1, PLAUR, PLXNB1, PPL, PPP1R9A, RASSF8, SCNN1A, SERPINB2, SERPINE1, SFRP1, SH3YL1, SLC27A2, SMAD7, SNAI1, SNAI2, SPARC, SPDEF, SRPX, STAT5A, TBX2, TJP3, TMEM125, TMEM45B, TWIST1, VCAN, VIM, VWF, XBP1, YBX1, ZBTB10, ZEB1, ZEB2.
Some genes of these EMTGS and additional genes are overexpressed in malignant cancers and downregulation by RNAi (RNA interference) potentially can slow metastatic development and progression, including SERPINA3 CD70, IL13RA2 and CD74 (Deng et al 2010). S100P is a metastasis-associated gene that facilitates transendothelial migration of pancreatic cancer cells (Barry et al 2013).
Genes that are over-expressed and therefore down-regulated by RNAi agents may suppress the development of metastasis are targets of this invention, including:
ACTN1, AGR2, AXL, CCL2, CD74, CDH1, CDH2, CLDN3, CLDN4, CX3CR1, CXCL1, FOXC1, FXYD5, HMGA1, HOXB7, IHH, IL6, IL8, IL11, IL13RA2, IL18, ITGA5, ITGB3, LAMB1, LCN2, MMP2, MMP7, MMP9, MSLN, MTA1, PCOLCE2, PECAM1, PLXNB1, S100A11, S100A6, S100P, SERPINA3, SERPINB2, SERPINE1, SFRP1, SLC27A2, SMAD7, SNAI1, SNAI2, SPARC, STAT5A, TBX2, TCF3, TWIST1, TWIST2, VCAN, VEGFA, VIM, XBP1, YBX1, ZEB1 and ZEB2.
K-ras is a GTPase protein encoded by the Kirsten rat sarcoma 2 viral oncogene homolog (K-ras) oncogene (also known as K-ras2 or RASK2; PubMed Gene ID #3845), which belongs to the family of RAS proteins.
The human RAS family consists of three closely related proto-oncogenes: c-Harvey (H)-RAS, c-Kirsten (K)-RAS, and N-RAS, which share 90% of their peptide sequence. RAS proteins are localized in the inner cell membrane, bind GDP and GTP, and possess an intrinsic GTPase activity, implicated in the regulation of their activity. RAS proteins influence proliferation, differentiation, transformation, and apoptosis by relaying mitogenic and growth signals into the cytoplasm and the nucleolus. In a normal cell, most of the RAS molecules are present in an inactive GDP-bound conformation.
K-Ras MutationsGenetic alterations in the K-ras signaling pathway are involved in more than 90% of cases of Pancreatic Cancer (PC) (Réjiba et. al., and references cited therein); the majority of such mutations are gain-of-function mutations at codon 12 (K-rasG12D). PC is an aggressive disease, being one of the leading causes of cancer-related death in the western world. Mutations in K-ras are also well known in other cancers. For example, K-ras is involved in the development and progression of colorectal cancer (CRC). Mutations are present in about 40% of CRC cases, most commonly at codons 12 and 13. These mutations prevent dephosphorylation and inactivation of the protein, causing it to be permanently switched on, independently of EGFR-mediated signaling. These mutated K-ras proteins are unlikely be affected by inhibition of EGFR, since the mutation causes the encoded K-ras protein to “freeze” in its active state for a much longer duration than its non-mutated counterpart. Hence, the response to anti-EGFR mABs is strongly reduced in tumors with mutated K-ras (Normanno et al). K-ras mutations also occur in 20-30% of lung cancer patients.
Anti-K-Ras Mutations RNAi-Based Treatment:RNAi vectors (Brummelkamp et al) and siRNA against mutated K-ras can lead to apoptosis of cancer cells in vitro and in vivo in mice and reduce tumor growth (Wang et al, Morioka et al, Fleming et al, Réjiba et al, WO2010/001325). Moreover, anti-mutated K-ras treatment potentially can slow the epithelial-to-mesenchymal transition (EMT) and thereby slow metastasis of PC disease. For example Singh et al observed an association between epithelial differentiation and tumor cell viability, and that EMT regulators in “K-Ras-addicted” cancers represent candidate therapeutic targets. siRNA (short interfering RNA) have been delivered by millimeter-scale depot technology against mutated K-ras (WO2010/001325 to Shemi) and against other non-oncology targets (US2008/0124370 to Marx).
SUMMARY OF THE INVENTIONThe present invention relates to methods and compositions for treating metastatic cancer that is associated with a primary tumor or a few tumors in the primary organ.
Provided herein is a millimeter-scale drug delivery device (DDD; also referred to herein as a “LODER”), comprising: (a) a biodegradable polymeric matrix; and (b) a nucleotide-based agent, including but limited to RNAi (RNA interference) agent that targets a gene (or genes), incorporated within the biodegradable polymeric matrix, for treating a metastatic cancer originating from a primary tumor or tumors, by inserting the DDD into the primary tumor(s). The targeted gene may be any appropriate target. In some embodiments, the gene is a metastasis-facilitating gene (e.g. a gene that promotes metastasis). The nucleotide-based agent may in some embodiments be an RNAi (RNA interference) agent. The RNAi agent may be, in various embodiments, a DICER substrate, an siRNA, a micro-RNA, an aptamer, or another type of RNAi agent.
In various embodiments, the term “polymeric matrix” may refer to various designs, including homogenous and non-homogenous polymeric matrices.
As used herein “comprising” is to be interpreted as specifying the presence of the stated features, integers, steps, or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps, or components, or groups thereof. Thus, for example, a drug delivery device comprising a biocompatible and biodegradable polymeric matrix and a given anti-K-rasG12D RNAi agent may contain additional excipients or components, such as non-polymeric components, non-matrix components, and additional agents. Additionally, the term “comprising” is intended to include, as separate embodiments, embodiments encompassed by the terms “consisting essentially of” and “consisting of.” The phrase “consisting essentially of” limits the scope of a claim to the recited materials or steps, either alone or in combination with additional materials or steps that do not materially affect the basic and novel characteristics of the claimed invention.
In light of the disclosure provided herein, it will be appreciated by those skilled in the art, in light of the present disclosure, that methods of the present invention are suitable for treating any type of metastatic cancer that is associated with a primary tumor or a few tumors in the primary organ.
The following figures are by way of illustrative example and are not meant to be taken as limiting the claimed invention.
Provided herein is a millimeter-scale drug delivery device (DDD; also referred to herein as a “LODER”), comprising: (a) a biodegradable polymeric matrix; and (b) a nucleotide-based agent, including but limited to RNAi (RNA interference) agent that targets a gene (or genes), incorporated within the biodegradable polymeric matrix, for treating a metastatic cancer originating from one or more primary tumors in the same organ, by inserting the DDD into the primary tumor(s). The targeted gene may be any appropriate target. In some embodiments, the gene is a metastasis-facilitating gene. In other embodiments, the gene is an oncogene. The RNAi may be, in various embodiments, an siRNA, a Dicer substrate RNAi (for example as provided by IDT—Integrated DNA Technologies), micro-RNA, or another type of RNAi.
The primary tumor in which the DDD is inserted may be a solid tumor or, in other embodiments, another type of tumor.
The subject receiving the one or more DDD, in some embodiments, is concurrently receiving chemotherapy for the metastatic cancer or has received or will receive the chemotherapy within 6 months of administration of the DDD. Those of skill in the art will appreciate in light of the present disclosure that various types of chemotherapy may be utilized, for example Erlotinib, Gemcitabine, FOLFIRINOX, Abraxane, or for pancreatic cancer; or in other embodiments a substance selected from pyrimidine analogues, EGFR tyrosine kinase inhibitors, and a subset or all the agents included in FOLFIRINOX. Alternatively or in other embodiments in addition, the subject is receiving or has received or will receive within 6 months radiation therapy for the metastatic cancer.
The subject receiving the DDD, in some embodiments, is concurrently receiving, has received in the past, or is about to receive treatment which is not chemotherapy, including radiation treatment, including external beam radiotherapy external beam radiotherapy (EBRT) and brachytherapy; ultrasound, including High-Intensity Focused Ultrasound (HIFU); surgery; immunotherapy; cryotherapy; hormonal therapy; treatments aimed to normalize the tumor environment, including normalization of hypoxia and pH; and monoclonal antibody therapy. The treatment is provided in various modes known to one skilled in the art, including local treatment at the primary tumor or tumors, local treatment at the metastasis and regional and systemic treatment.
In certain embodiments, the chemotherapy that is administered is indicated for a subject that has any performance status from 0 to 4 (In this invention performance status (PS) refers to the ECOG performance status, ranged from 0 to 5, grade 0=Fully active, able to carry on all pre-disease performance without restriction, and grade 5=dead. Higher PS refers to lower performance. (This is not to be confused with the Karnofsky score, which runs from 100 to 0, where 100 is “perfect” health and 0 is death). In some embodiments the chemotherapy that is administered is indicated specifically for a subject that has a performance status of 1 or higher. Examples of such regimens are Gemcitabine for pancreatic cancer, which is indicated specifically for patients that are unexpected to tolerate harsh regimens such as FOLFIRINOX. In other embodiments, the patient has a performance status of 2 or higher. In still other embodiments, the patient has a performance status of 3 or higher. In yet other embodiments, the patient has a performance status of 4.
Alternatively, the DDD is administered to a subject for whom chemotherapy for the metastatic cancer is contraindicated, for example due to weakness, advanced age, or high performance status. DDD's described herein have been shown to be well tolerated and are thus suitable for patients unable to tolerate chemotherapy regimens. For example, such patients may have a performance status of 1 or higher and/or be older than 76. In other embodiments, the patient has a performance status of 2 or higher. In still other embodiments, the patient has a performance status of 3 or higher. In yet other embodiments, the patient has a performance status of 4.
The gene targeted by the RNAi agent contained in the DDD may, in various embodiments, be a metastasis-facilitating gene and/or an oncogene. In various embodiments, the gene may be selected from Snai1 (snail family zinc finger 1; Entrez Gene ID. No: 6615), Snai2 (also known as SLUG or snail family zinc finger 2; Entrez Gene ID. No: 6591), PAK1 (p21 protein (Cdc42/Rac)-activated kinase 1; Entrez Gene ID. No: 5058), PAK2 (p21 protein (Cdc42/Rac)-activated kinase 2; Entrez Gene ID. No: 5062), ZEB1 (zinc finger E-box binding homeobox 1; Entrez Gene ID. No: 6935), ZEB2 (zinc finger E-box binding homeobox 2; Entrez Gene ID. No: 9839), Twist1 (twist basic helix-loop-helix transcription factor 1; Entrez Gene ID. No: 7291), Twist2 (twist basic helix-loop-helix transcription factor 2; Entrez Gene ID. No: 117581), Goosecoid (goosecoid homeobox; Entrez Gene ID. No: 145258), SIX1 (IX homeobox 1; Entrez Gene ID. No: 6495), FOXC2 (forkhead box C2 (MFH-1, mesenchyme forkhead 1; Entrez Gene ID. No: 2303), Prx1 (Peroxiredoxin 1); Entrez Gene ID. No:5052, FN1 (fibronectin 1; Entrez Gene ID. No: 2335), VIMENTIN (VIM; Entrez Gene ID. No:7431), N-CADHERIN (CDH-2; Entrez Gene ID. No: 1000), SERPINA3 (serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3; Entrez Gene ID. No: 12), CD70 (Entrez Gene ID. No: 970), IL13RA2 (interleukin 13 receptor, alpha 2; Entrez Gene ID. No: 3598), CD74; Entrez Gene ID. No:972), and TCF3 (E12/E47; Entrez Gene ID. No: 6929). In other embodiments, one of the following is selected: Snai1, Snai2, Twist1, Zeb1, Zeb2, FN1, Vimentin (vim), N-Cadherin, SERPINA3, CD70, IL13RA2, CD74, and TCF3. In other embodiments, the gene is selected from SNAI1, TWIST, and TCF3, or in other embodiments is selected from SNAI1, TWIST, TCF3, siG12D, SNAI2, Zeb1, and Goosecoid. The database was accessed on Oct. 14, 2013 or Oct. 15, 2013, for all the Gene ID No's mentioned herein.
In still other embodiments, the target gene is a mutated K-ras gene, for example a mutation selected from G12D, G12V, G12A, G12S, G12C, G13D, and G13C. Specific sequences of certain embodiments of siRNA's against mutated K-ras are set forth hereinbelow.
In yet other embodiments, the DDD comprises, in addition to an RNAi agent against mutated K-ras, another RNAi agent directed against a metastasis-facilitating gene. In various embodiments, the aforementioned gene may be Snai1, Snai2, PAK1, PAK2, ZEB1, ZEB2, Twist1, Twist2, Goosecoid, SIX1, FOXC2, Prx1, FN1, VIMENTIN (VIM), N-CADHERIN, SERPINA3, CD70, IL13RA, CD74, or TCF3.
siRNA Sequences Targeting Mutated K-Ras
In other the RNAi agent contained within the DDD comprises a duplex region, and the nucleotide sequence of the duplex region of the sense strand consists of:
-
- a sequence selected from SEQ ID No: 1-7, namely GUUGGAGCUGAUGGCG (SEQ ID No: 1), GUUGGAGCUGUUGGCG (SEQ ID No: 2), GUUGGAGCUGCUGGCG (SEQ ID No: 3), GUUGGAGCUAGUGGCG (SEQ ID No: 4), GUUGGAGCUUGUGGCG (SEQ ID No: 5), GUUGGAGCUGGUGACG (SEQ ID No: 6), and GUUGGAGCUGGUUGCG (SEQ ID No: 7), either alone or followed by:
- a sequence selected from: (i) UAGGCAAGAGUGCC (SEQ ID No: 8) and (b) a 5′-fragment of 1-13 nucleotides inclusive of SEQ ID No: 8. “Followed by” in this regard means that the 3′-terminus of the sequence selected from SEQ ID No: 1-7 is connected to the 5′-terminus of SEQ ID No: 8 or a fragment thereof.
For purposes of illustration, the following sense strands contain SEQ ID No: 1 and all or a portion of SEQ ID No: 8: GUUGGAGCUGAUGGCGU (SEQ ID No: 16), GUUGGAGCUGAUGGCGUA (SEQ ID No: 17), GUUGGAGCUGAUGGCGUAG (SEQ ID No: 18), GUUGGAGCUGAUGGCGUAGG (SEQ ID No: 19), GUUGGAGCUGAUGGCGUAGGC (SEQ ID No: 20), GUUGGAGCUGAUGGCGUAGGCA (SEQ ID No: 21), GUUGGAGCUGAUGGCGUAGGCAA (SEQ ID No: 22), GUUGGAGCUGAUGGCGUAGGCAAG (SEQ ID No: 23), GUUGGAGCUGAUGGCGUAGGCAAGA (SEQ ID No: 24), GUUGGAGCUGAUGGCGUAGGCAAGAG (SEQ ID No: 25), GUUGGAGCUGAUGGCGUAGGCAAGAGU (SEQ ID No: 26), GUUGGAGCUGAUGGCGUAGGCAAGAGUG (SEQ ID No: 27), GUUGGAGCUGAUGGCGUAGGCAAGAGUGC (SEQ ID No: 28), and GUUGGAGCUGAUGGCGUAGGCAAGAGUGCC (SEQ ID No: 29) Similar sense strains may be readily derived from each of SEQ ID No: 2-7 together with all or a portion of SEQ ID No: 8.
In certain embodiments, the aforementioned 5′ fragment of SEQ ID No: 8 is at least 3 nucleotides in length; thus, the duplex region of the antisense nucleotide is at least 19 nucleotides in length.
In other embodiments, the duplex region is 19 nucleotides in length (thus comprising both one of SEQ ID No: 1-7 with a 3-nucleotide fragment of SEQ ID No: 8). More specific embodiments of such sequences are those selected from GUUGGAGCUGAUGGCGUAG (SEQ ID No: 9), GUUGGAGCUGUUGGCGUAG (SEQ ID No: 10), GUUGGAGCUGCUGGCGUAG (SEQ ID No: 11), GUUGGAGCUAGUGGCGUAG (SEQ ID No: 12), GUUGGAGCUUGUGGCGUAG (SEQ ID No: 13), and GUUGGAGCUGGUGACGUAG (SEQ ID No: 14), and GUUGGAGCUGGUUGCGUAG (SEQ ID No: 15).
In other embodiments, the duplex region is 16 nucleotides in length (thus consisting of one of SEQ ID No: 1-7 alone). In other embodiments, the duplex region is 17, 18, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides in length (thus comprising one of SEQ ID No: 1-7, together with a fragment of SEQ ID No: 8 that is 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides, respectively). In other embodiments, the duplex region is 30 nucleotides in length (thus comprising one of SEQ ID No: 1-7, together with SEQ ID No: 8 in its entirety).
Reference herein to the “duplex region of the sense strand” indicates the portion of the sense strand that exists in a duplex structure after hybridization to the antisense strand. Similarly, reference to the “duplex region of the antisense strand” indicates the portion of the antisense strand that exists in a duplex structure after hybridization to the sense strand. In various embodiments, the duplex region of the sense strand may be either the entire sense strand or a fragment thereof. Similarly, the duplex region of the antisense strand may be either the entire antisense strand or a fragment thereof.
In certain preferred embodiments, the duplex region is perfectly complementary. Thus, the duplex region of the antisense strand is complementary to the duplex region of the sense strand. For purposes of illustration, the following antisense strands have a sequence perfectly complementary to SEQ ID No: 1-7, respectively: CGCCAUCAGCUCCAAC (SEQ ID No: 30), CGCCAACAGCUCCAAC (SEQ ID No: 31), CGCCAGCAGCUCCAAC (SEQ ID No: 32), CGCCACUAGCUCCAAC (SEQ ID No: 33), CGCCACAAGCUCCAAC (SEQ ID No: 34), CGUCACCAGCUCCAAC (SEQ ID No: 35), and CGCAACCAGCUCCAAC (SEQ ID No: 36).
Reference herein to the “nucleotide sequence of the duplex region” relates to the sequence of the nucleotides found in the duplex region. For these purposes, modified ribonucleotides are considered to have the same identity as the ribonucleotide from which they were derived (the “parent ribonucleotide”), provided that they retain the base pairing specificity of the parent ribonucleotide. Thus, cytosine containing a 2′-OMe modification, for example, is still considered cytosine, since it retains the ability to pair with guanine.
In still other embodiments, a DDD of the present invention comprises more than one, for example 2, 3, 4, or 5, of the 16-30 nucleotide anti-K-ras RNAi agents described herein, in other words, RNAi agents whose sense strand comprises (a) a sequence selected from SEQ ID No: 1-7, optionally in combination with (b) either SEQ ID No: 8 or a 1-13 nucleotide fragment thereof. In even more specific embodiments, a DDD of the present invention comprises more than one, for example 2, 3, 4, or 5, of the 19 nucleotide RNAi agents described herein, in other words, RNAi agents whose sense strand consists a sequence selected from SEQ ID No: 9-15. In still other embodiments, the DDD comprises an RNAi agent against a metastasis-facilitating gene in addition to the multiple anti-K-ras RNAi agents.
In still other embodiments, genes that are over-expressed and therefore down-regulated by RNAi agents may suppress the development of metastasis are targets of this invention, including:
ACTN1, AGR2, AXL, CCL2, CD74, CDH1, CDH2, CLDN3, CLDN4, CX3CR1, CXCL1, FOXC1, FXYD5, HMGA1, HOXB7, IHH, IL6, IL8, IL11, IL13RA2, IL18, ITGA5, ITGB3, LAMB1, LCN2, MMP2, MMP7, MMP9, MSLN, MTA1, PCOLCE2, PECAM1, PLXNB1, S100A11, S100A6, S100P, SERPINA3, SERPINB2, SERPINE1, SFRP1, SLC27A2, SMAD7, SNAI1, SNAI2, SPARC, STAT5A, TBX2, TCF3, TWIST1, TWIST2, VCAN, VEGFA, VIM, XBP1, YBX1, ZEB1 and ZEB2.
In still other embodiments, at least one of the sense strand and the antisense strand further comprises a 3′-overhang 1-6-nucleotides (nt) in length, in other words, a region that does not hybridize with the other strand. In more specific embodiments, the 1-6-nt 3′-overhang is present on both the sense strand and the antisense strand.
In other embodiments, the overhang present on at least one of the sense strand and the antisense strand is a 2-nt 3′-overhang. In still more specific embodiments, the overhangs present both the sense strand and the antisense strand are 2-nt 3′-overhangs.
In other embodiments, the 3′-overhang present on at least one of the sense strand and the antisense strand consists of dTdT (a dimer of deoxythymidine). In still more specific embodiments, 3′-overhangs are present on both the sense strand and the antisense strand, each of which consists of dTdT.
In certain embodiments, the sense and antisense strands of an RNAi agent of methods and compositions of the present invention each contain only cytosine, guanine, adenine, and thymidine in the duplex region and the dTdT overhangs.
DDD's Containing Multiple RNAi AgentsAlso provided herein is a DDD that comprises (a) an RNAi agent against mutated K-ras and (b) another RNAi agent directed against a metastasis-facilitating gene. In various embodiments, the aforementioned gene may be selected from Snai1, Snai2, PAK1, PAK2, ZEB1, ZEB2, Twist1, Twist2, Goosecoid, SIX1, FOXC2, and Prx1, or may in other embodiments be selected from FN1, VIMENTIN (VIM), N-CADHERIN, SERPINA3, CD70, IL13RA2, CD74, and TCF3.
Suitable Nucleotides and Nucleotide AnaloguesThe term “nucleotide” as used herein refers to RNA nucleotides cytosine, guanine, adenine, and thymidine and to other similar nucleotide analogues suitable for use in RNAi agents. Such nucleotide analogues may generally be used as the building blocks of the RNAi agents described herein, except where indicated otherwise. Except where stated explicitly, nothing in this application is intended to preclude the utilization of non-classical nucleotide analogues, for example nucleotide analogues whose base or backbone has been chemically modified to enhance its stability or usefulness as an a RNAi agent, provided that they pair with the appropriate complementary bases, as previously mentioned. In certain embodiments, nucleotide analogues that may be used in methods and compositions of the present invention include derivatives wherein the sugar is modified, as in 2′-O-methyl, 2′-O-allyl, 2′-deoxy-2′-fluoro, and 2′,3′-dideoxynucleoside derivatives; nucleic acid analogs based on other sugar backbones, such as threose; locked nucleic acid derivatives; bicyclo sugars; hexose, glycerol and glycol sugars; nucleic acid analogs based on non-ionic backbones, such as “peptide nucleic acids”, these nucleic acids and their analogs in non-linear topologies, including as dendrimers, comb-structures, and nanostructures, and these nucleic acids and their analogs carrying tags (e.g., fluorescent, functionalized, or binding) to the ends, sugars, or nucleobases.
One non-limiting example of non-classical nucleotide analogues suitable for use in methods and compositions in accordance with the present invention include locked nucleic acid (LNA) nucleotide analogues. Certain embodiments of LNA nucleotide analogues are bicyclic nucleic acid analogs that contain one or more 2′-O, 4′-C methylene linkages, which effectively lock the furanose ring in a C3′-endo conformation. This methylene linkage “bridge” restricts the flexibility of the ribofuranose ring and locks the structure into a rigid bicyclic formation. Because of its unique structural conformation, oligonucleotides comprising LNA nucleotide analogues demonstrate a much greater affinity and specificity to their complementary nucleic acids than do natural DNA counterparts. LNAs typically hybridize to complementary nucleic acids even under adverse conditions, such as under low salt concentrations. LNA nucleotide analogues are commercially available, and are described, inter alia, in U.S. Pat. No. 6,130,038, U.S. Pat. No. 6,268,490, and U.S. Pat. No. 6,670,461.
Another non-limiting example of non-classical nucleotide analogues suitable for use in methods and compositions in accordance with the present invention are peptide nucleic acid (PNA) nucleotide analogues. In certain embodiments of PNA nucleotide analogues, the negatively charged sugar-phosphate backbone of DNA is replaced by a neutral polyamide backbone composed of N-(2-aminoethyl) glycine units, such as in the illustrative example below, wherein B represents a nucleoside base. The chemical configuration of PNA typically enables the nucleotide bases to be positioned in approximately the same place as in natural DNA, allowing PNA to hybridize with complementary DNA or RNA sequence. PNA nucleotide analogues are commercially available, and are described, inter alia, in the PCT Applications having the Publication Nos. WO 92/20702, WO 92/20703 and WO 93/12129.
Another non-limiting example of non-classical nucleotide analogues suitable for use in methods and compositions of the present invention are glycol nucleic acid (GNA) nucleotide analogues (Zhang, L et al (2005) “A simple glycol nucleic acid”. J. Am. Chem. Soc. 127:4174-4175). Certain embodiments of GNA nucleotide analogues have an acyclic propylene glycol phosphodiester backbone and have one of the structures below, wherein B represents a nucleoside base:
Another non-limiting example of non-classical nucleotide analogues suitable for use in methods and compositions of the present invention are threose nucleic acid (TNA) described in Wu et al, “Nucleotide Analogues” Organic Letters, 2002, 4(8):1279-1282. Certain embodiments of TNA nucleotide analogues have the structure below, wherein B represents a nucleoside base:
Another non-limiting example of non-classical nucleotide analogues suitable for use in methods and compositions in accordance with aspects of the present invention are bicyclic and tricyclic nucleoside analogs (Steffens et al, Helv Chim Acta (1997) 80:2426-2439; Steffens et al, J Am Chem Soc (1999) 121: 3249-3255; Renneberg et al, J Am Chem Soc (2002) 124: 5993-6002; and Renneberg et al, Nucl Acids Res (2002) 30: 2751-2757).
Another non-limiting example of non-classical nucleotide analogues suitable for use in methods and compositions of the present invention are phosphonomonoester nucleic acids which incorporate a phosphorus group in the backbone, for example analogues with phosphonoacetate and thiophosphonoacetate internucleoside linkages (US Pat. App. No. 2005/0106598; Sheehan et al, Nucleic Acids Res (2003); 31(14):4109-18). In other embodiments, a cyclobutyl ring replaces the naturally occurring furanosyl ring.
In other embodiments of non-classical nucleotide analogues suitable for use in methods and compositions of the present invention, the base is modified. A representative, non-limiting list of modified nucleobases includes 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl
(—C═C—CH3)
uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil(pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further modified nucleobases include tricyclic pyrimidines such as phenoxazinecytidine (1H-pyrimido(5,4-b)(1,4)benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido(5,4-b)(1,4)benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazinecytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido(5,4-b) (1,4)benzoxazin-2(3H)-one), carbazolecytidine (2H-pyrimido(4,5-b)indol-2-one), and pyridoindolecytidine (H-pyrido(3′,2′:4,5)pyrrolo(2,3-d)pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990; those disclosed by Englisch et al., AngewandteChemie, International Edition, 1991, 30, 613; and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993. Certain of these nucleobases are known to those skilled in the art as suitable for increasing the binding affinity of the compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. Modified nucleobases and their use are described, inter alia, in U.S. Pat. No. 3,687,808, U.S. Pat. No. 4,845,205; U.S. Pat. No. 5,130,302; U.S. Pat. No. 5,134,066; U.S. Pat. No. 5,175,273; U.S. Pat. No. 5,367,066; U.S. Pat. No. 5,432,272; U.S. Pat. No. 5,457,187; U.S. Pat. No. 5,459,255; U.S. Pat. No. 5,484,908; U.S. Pat. No. 5,502,177; U.S. Pat. No. 5,525,711; U.S. Pat. No. 5,552,540; U.S. Pat. No. 5,587,469; U.S. Pat. No. 5,594,121, U.S. Pat. No. 5,596,091; U.S. Pat. No. 5,614,617; U.S. Pat. No. 5,645,985; U.S. Pat. No. 5,830,653; U.S. Pat. No. 5,763,588; U.S. Pat. No. 6,005,096; U.S. Pat. No. 5,681,941; and U.S. Pat. No. 5,750,692.
Another non-limiting example of non-classical nucleotide analogues suitable for use in methods and compositions of the present invention are polycyclic heterocyclic compounds in place of one or more of the naturally-occurring heterocyclic base moieties. A number of tricyclic heterocyclic compounds have been previously reported. Such compounds are routinely used in antisense applications to increase the binding properties of the modified strand to a target strand. The most studied modifications are targeted to guanosines hence they have been termed G-clamps or cytidine analogs. Representative cytosine analogs that make 3 hydrogen bonds with a guanosine in a second strand include 1,3-diazaphenoxazine-2-one (Kurchavov, et al., Nucleosides and Nucleotides, 1997, 16, 1837-1846), 1,3-diazaphenothiazine-2-one, (Lin, K.-Y.; Jones, R. J.; Matteucci, M. J. Am. Chem. Soc. 1995, 117, 3873-3874) and 6,7,8,9-tetrafluoro-1,3-diazaphenoxazine-2-one (Wang, J.; Lin, K.-Y., Matteucci, M. Tetrahedron Lett. 1998, 39, 8385-8388). Incorporated into oligonucleotides these base modifications were shown to hybridize with complementary guanine and the latter was also shown to hybridize with adenine and to enhance helical thermal stability by extended stacking interactions.
Other examples of non-classical nucleotide analogues suitable for use in methods and compositions of the present invention are described in US Application Publication No. 2003/0207804 and 2003/0175906.
In other embodiments, an RNAi agent used in methods and compositions of the present invention is conjugated to a cholesterol moiety.
In still other embodiments, an RNAi agent used in methods and compositions of the present invention is conjugated to an α-tocopherol moiety.
2′-OMe ModificationsIn more specific embodiments, an RNAi agent used in methods and compositions of the present invention is chemically modified with a modification selected from 2′-OMe and 2′-O-methoxy on at least one residue of at least one strand thereof. In other, more specific embodiments, the RNAi agent is chemically modified with 2′-OMe or 2′-O-methoxy on at least one residue of each of its 2 strands. In still more specific embodiments, the modification is 2′-OMe. In yet more specific embodiments, the 2′-OMe modification is present on at least one residue of each of its 2 strands.
In even more specific embodiments, four 2′-OMe modifications are present on each strand of the RNAi agent. Alternatively, four 2′-OMe modifications are present on one strand of the RNAi agent, while the other strand contains no modified bases (deoxyribonucleotides naturally occurring in DNA are not considered modified bases for these purposes). In still other embodiments, eight 2′-OMe modifications are present on one strand of the RNAi agent, while the other strand contains four 2′-OMe modifications.
In yet other embodiments, an RNAi agent used in methods and compositions of the present invention is chemically modified with 2′-F.
In more particular embodiments, the sequences of the sense and antisense strands of the RNAi agent of a DDD of methods and compositions of the present invention are:
5′-GUoUoGGAGCUGAUGGCGoUoAGdTdT (SEQ ID No: 37) and5′-CUACGCCAUCAGCUCCAACdTdT (SEQ ID No: 38), respectively. As used herein, “o” preceding a residue denotes a 2′-O-Methyl modification of said residue.
Alternatively, the sequences of the sense and antisense strands of the RNAi agent are:
Another aspect of the present invention provides an RNAi agent, wherein the sequences of the sense and antisense strands of the RNAi agent are:
Yet another aspect of the present invention provides an RNAi agent, wherein the sequences of the sense and antisense strands of the RNAi agent are:
Another aspect of the present invention provides a pharmaceutical composition comprising one of the above RNAi agents.
Millimeter-Scale Implant/Matrix Drug Delivery DevicesThe drug delivery device of the present invention may be a cylinder, in other embodiments a sphere, and in other embodiments, another shape suitable for an implant.
In certain preferred embodiments, a biodegradable matrix used in methods and compositions of the present invention is a polymeric biodegradable matrix. “Polymeric” as used herein refers to the characteristic of comprising a polymer. In more specific embodiments, the biodegradable matrix is held together by the structure of the polymer.
In other embodiments, a biodegradable matrix used in methods and compositions of the present invention is a biocompatible biodegradable matrix. “Biocompatible” as used herein refers to the characteristic of not inducing toxic effects, either as a result of reactivity with the human immune system or body tissues, or the production of toxic degradation by-products. In more specific embodiments, the biodegradable matrix is a polymeric, biocompatible biodegradable matrix.
In yet other embodiments, a DDD of the present invention is biostable.
“Millimeter-scale”, as used herein, refers to a device whose smallest diameter is at least 0.24 mm (fitting within the inner diameter of a 25-gauge needle). In certain preferred embodiments, each of the dimensions (diameter, in the case of a sphere or cylinder; and height and/or width or length, in the case of a cylinder, box-like structure, cube, or other shape with flat walls) is between 0.3-10 mm, inclusive. In more preferred embodiments, each dimension is between 0.5-8 mm, inclusive. In more preferred embodiments, each dimension is between 0.6-1.3 mm, inclusive.
In more preferred embodiments, the device is a cylinder, having a diameter 0.68 mm+/−0.45 mm and a length of 4.5+/−2.5 mm. In other embodiments, the cylinder has a diameter of 0.1-2.5 mm, inclusive, or in other embodiments 0.2-2.0 mm, or in other embodiments 0.3-1.5 mm, or in other embodiments 0.38-0.98 mm, or in other embodiments 0.48-0.88 mm, or in other embodiments 0.53-0.83 mm, or in other embodiments 0.58-0.78 mm, or in other embodiments 0.63-0.73 mm, or in other embodiments 0.68 mm. In other preferred embodiments, the cylinder has a length of 4.5+/−1.5 mm, or in other embodiments 0.5-3.5 mm, inclusive, or in other embodiments 0.7-3.0 mm, or in other embodiments 0.9-2.5 mm, or in other embodiments 1.0-2.0 mm, or in other embodiments 1.1-1.5, or in other embodiments 1.3 mm. In other embodiments, the cylinder has a diameter of 0.38-0.98 mm, inclusive and a length of 0.5-3.5 mm, inclusive. In more preferred embodiments, the diameter is 0.48-0.88 mm, and the length is 0.7-3.0 mm. In more preferred embodiments, the diameter is 0.53-0.83 mm, and the length is 0.9-2.5 mm. In more preferred embodiments, the diameter is 0.58-0.78 mm, and the length is 1.0-2.0 mm. In more preferred embodiments, the diameter is 0.63-0.73 mm, and the length is 1.1-1.5 mm. In more preferred embodiments, the diameter is 0.68 mm, and the length is 1.3 mm. In still other embodiments, the device is a suitable size for administration with a endoscope and a 19-gauge needle.
In other embodiments, the volume of the device is between 0.1 mm3 and 1000 mm3.
In other embodiments, the w/w agent:polymer load ratio above 1:100. In more preferred embodiments, the load is above 1:20. In more preferred embodiments, the load is above 1:9. In more preferred embodiments, the load is above 1:3
In other embodiments, the device is a technology described in US Patent Application Pub. No. 2011/0195123, the contents of which are incorporated herein by reference.
The DDD in some embodiments comprises degradable polymers, wherein the release mechanism includes both bulk erosion and diffusion; or in some embodiments, non degradable, or slowly degraded polymers are used, wherein the predominant release mechanism is diffusion rather than bulk erosion, so that the outer part functions as membrane, and its internal part functions as a drug reservoir, which practically is not affected by the surroundings for an extended period (for example from about a week to about a few months). Combinations of different polymers with different release mechanisms may also optionally be used. The concentration gradient at the surface is preferably maintained effectively constant during a significant period of the total drug releasing period, and therefore the diffusion rate is effectively constant (termed “zero mode” diffusion). The term “constant” refers to a diffusion rate that is preferably maintained above the lower threshold of therapeutic effectiveness, but which may still optionally feature an initial burst and/or fluctuate, for example increasing and decreasing to a certain degree. In other embodiments, there is an initial burst of less than 10% of the total amount of drug (which may be considered negligible). In other embodiments, there is an initial burst of about 20% of the total amount of drug. In other embodiments, the design enables initial a strong burst of 30% or more of the total amount of drug. The diffusion rate is preferably so maintained for a prolonged period, and it can be considered constant to a certain level to optimize the therapeutically effective period, for example the effective silencing period. These embodiments are described in US Patent Application Pub. No. 2011/0195123.
In some embodiments, less than 10% of said RNAi agent is released from the DDD over a time period of three months starting from implantation. In other embodiments, less than 5% of said RNAi agent is released from the DDD over a time period of one month starting from implantation.
Still other embodiments relate to the time point at which 95% of the RNAi agent in the DDD has been released from the DDD in vivo. In certain embodiments, this occurs over a time period between 3-24 months, inclusive; between 3-18 months, inclusive; between 3-15 months, inclusive; between 3-12 months, inclusive; between 4-10 months, inclusive; between 4-8 months, inclusive; or between 5-7 months, inclusive.
In other embodiments, a DDD used in methods and compositions of the present invention further comprises another active agent. In certain embodiments, the additional active agent is another RNAi agent, for example ALN-VSP (AlnylamInc, Cambridge, Mass.). Other examples of additional active agents that may be used are chemotherapy drugs, for example mAB-based agents, cytotoxic drugs, and kinase inhibitors.
Biodegradable MatricesIn certain embodiments, the biodegradable matrix present in the drug delivery device comprises poly(lactic acid) (PLA). In other embodiments, the biodegradable matrix comprises poly(glycolic acid) (PGA). In other embodiments, the biodegradable matrix comprises both PLA and PGA (known as poly(lactic-co-glycolic acid) or PLGA). In other embodiments the matrix comprises a natural polymer comprising β-(1-4)-linked D-glucosamine and N-acetyl-D-glucosamine. In other embodiments, the matrix comprises Chitosan (NCBI PubChem ID #71853).
Methods for making PLGA matrices that incorporate RNAi agents are well known to those skilled in the art. Exemplary methods are described in described in US Patent Application Pub. No. 2011/0195123, the contents of which are incorporated herein by reference—for example in Examples 1.1 and 1.2 thereof.
In more specific embodiments, the PLA/PGA ratio is at least 75:25, more preferably between 75:25 and 95:5 inclusive. In other embodiments, the ratio is between 75:25 and 85:15 inclusive. In yet other embodiments, the ratio is no more than 25:75, more preferably between 25:75 and 5:95 inclusive. In other embodiments, the ratio is between 25:75 and 15:85 inclusive.
In other embodiments, the polymer comprises both PLA and PEG (poly(ethylene glycol)).
In other embodiments, tri-block PLA-PCL-PLA is used to form the matrix. PCL denotes poly-caprolactone.
In other embodiments, Poly(D,L-lactide) (DL-PLA), poly(D,L-glycolide), or poly(D,L-lactide-co-glycolide) is used, each of which is considered a separate embodiment.
Design of biodegradable controlled drug-delivery millimeter-scale DDD containing PLA, PGA, PEG, and/or PCL to have a specified release profile is well within the ability of those skilled in the art in light of the present disclosure. For example, general principles applicable to nano-scale and micro-scale particle carriers containing PLA, PGA, PEG, and/or PCL are described inter alia in Makadia and Siegel; and Park et al.
In another embodiment, the polymer is a polymer described in paragraphs 0076-0078 of US Patent Application Pub. No. 2011/0195123, the contents of which are incorporated herein by reference.
In other embodiments, the biodegradable matrix further comprises an additive for modulating hydrophilic-hydrophobic interactions; in other embodiments for enabling dispersion of the drug and eliminating aggregation; in other embodiments for preserving the drug in hot-temperature or cold-temperature storage conditions, for example 55° C. and −20° C., respectively; in other embodiments for facilitating creation of cavities in the implant that affect to drug diffusion from the matrix. Hydrophilic-hydrophobic interactions may cause aggregation of the active substance in cases of hydrophilic active substances, such as siRNA, incorporated within a hydrophobic polymer, resulting in aggregation during production or subsequently when the device is implanted into the body of a subject and it is subjected for example to hydrolysis. Non-limiting examples of such additives are open monosaccharides, for example mannitol; disaccharides such as trehalose; sorbitol; and other cyclic monosaccharides such as glucose, fructose, galactose and disaccharides such as sucrose. The above additives that are chiral may be in the form of the D-enantiomer, the L-enantiomer, or a racemic mixture. In other embodiments, more than one additive is present. In certain embodiments, the additive is selected from trehalose and mannitol.
In other embodiments, the biodegradable matrix further comprises an additive for preserving the drug within the implant after implantation against low pH. The microenvironment in the implant interior tends to be acidic. Unlike chemotherapy, the pH should preferably be maintained above a threshold. For example while doxorubicin is stable in an acidic environment, with minimal hydrolytic degradation within a pH range of 3 to 6.5, RNAi agents can degrade at pH <3. In more specific embodiments, this additive may be selected from bicarbonate and carbonate, for example sodium bicarbonate and sodium carbonate. In some embodiments, one or more additives against decrease of pH are included in the matrix to control the degradation of the polymer, typically degradation by hydrolysis, thereby to control the release. Such an additive is designed with or without regard to the drug. Non limiting examples include magnesium carbonate, calcium carbonate, calcium hydroxyapatite, sodium bicarbonate and in general salts. In some embodiments, the salt distribution within the polymeric matrix is non-homogenous. In some embodiments, the salt distribution is lower toward the matrix surface and higher toward the center. For example, in some embodiments the concentration of salt in the center is at least 20% higher than the concentration at the matrix edge.
Representative Release ProfilesIn preferred embodiments, a device of the present invention is designed to release the active agent in a controlled fashion. It will be apparent to those of skill in the art, in light of the knowledge in the art taken together with the information provided herein, that the PLA:PGA ratio, the design of the polymer end group, for example a capped terminal end group and an uncapped carboxylic end group, the composition and additives, the molecular weight (MW) of the polymer, and the surface-to-volume ratio of the implant may be adjusted to achieve a particular release profile. For example, deviating the PLA:PGA ratio from 50:50, increasing the MW, or reducing the surface-to-volume ratio can increase the release time.
In other embodiments, the DDD of the present invention is designed with a particular release profile. One relevant parameter is the time point at which 90% of the active agent has been released. In some embodiments, a DDD of the present invention releases 90% of the active agent over a time period between 3-24 months inclusive. In other embodiments, the time point of release of 90% of the active agent is between 3-12 months inclusive. In other embodiments, the time point is between 2-24 months inclusive. In other embodiments, the time point is between 2-15 months inclusive. Another relevant parameter is the percent of active agent released at a given time point. For example, in some embodiments, 80-99% inclusive of the active agent is released at the 3-month timepoint. In other embodiments, 80-99% inclusive of the active agent is released at the 2-month timepoint or the 4-month, 6-month, 9-month, 12-month, or 24-month timepoint, each of which is considered a separate embodiment.
Alternatively or in addition, in some embodiments no more than 30-50% of the active agent of a DDD of the present invention is released during the first 3 weeks.
Dosage and Drug PercentageA DDD of the present invention may, in certain embodiments, contain at least 10 □g siRNA. In more specific embodiments, the amount is between 10-2000 □g (inclusive) siRNA per device. In still more specific embodiments, the amount is between 100-1500 (inclusive) □g, more preferably 150-1000 □g, more preferably 200-470 □g, more preferably 330-420 □g, more preferably 350-400 □g, more preferably 375 □g siRNA per device. In certain embodiments, 2-8 DDD, containing a total of 0.7-3.5 mg siRNA, are implanted into a tumor of a human subject. In certain embodiments 8-24 DDD are implanted into a tumor of a human subject, to improve distribution of the released drug within the tumor. In certain embodiments the number of DDDs per tumor is X, where X is between 8-24 inclusive, and the drug load of each DDD is 3.0/X mg+/−20% (for example X=10 and each DDD has 0.3 mg+/−20%).
In certain embodiments, the drug content of a device of the present invention is at least 10% by weight. Alternatively, the drug content of the device is at least 20%. In still other embodiments, the drug content of the device is at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 28%, or at least 30%, or at least 33%, or at least 36%, or at least 40%.
In another embodiment of a millimeter-scale DDD of the present invention, (a) the biodegradable matrix comprises PLGA, a sugar, (non-limiting embodiments of which are mannitol, trehalose, sucrose, and sorbitol), a pH modulating additive (non-limiting embodiments of which are sodium bicarbonate, magnesium carbonate and calcium carbonate); and (b) the nucleotide sequence of the sense strand of the RNAi agent is GUUGGAGCUGAUGGCGUAGdTdT (SEQ ID No: 41), and the sequence of the antisense strand is CUACGCCAUCAGCUCCAACdTdT (SEQ ID No: 42). In other embodiments, an additional siRNA, for example against a metastasis-facilitating gene, is also present within the DDD.
Some exemplary formulations of drug delivery devices of methods and compositions of the present invention are as follows, by weight: 16-32% siRNA, 7-11% Mannitol, 60-77% PLGA, and 0.5%-3% sodium bicarbonate and other excipients. In more specific embodiments, the DDD is 20%+/−5% siRNA by weight.
Additional FeaturesIn other embodiments, a DDD of the present invention is non-homogeneous. In other embodiments, a DDD of the present invention is multi-layered. In other embodiments, a DDD of the present invention comprises a biodegradable polymeric component attached to a biostable polymeric component and/or to a metallic component. In other embodiments, a DDD of the present invention is coated. A coating can be designed in some embodiments for a number of characteristics, including modulating the release rate or preventing protein stickiness during long-term storage. The coating in other embodiments comprises the same material or a similar material used to form the matrix. In other embodiments, the coating is a PLGA matrix containing no siRNA, or in other embodiments consists of PLA, or of PGA. In other embodiments, the coating further comprises another material, for example PEG.
Therapeutic MethodsAnother aspect of the present invention provides a method of treating a patient having metastatic cancer, comprising the step of administering to the primary tumor(s) a millimeter-scale DDD, wherein the DDD comprises:
A. A biodegradable matrix; and
B. An RNAi (RNA interference) agent incorporated within the biodegradable matrix, wherein the RNAi agent comprises a duplex region, and the nucleotide sequence of the duplex region of the sense strand consists of
-
- a sequence selected from SEQ ID No: 1-7, namely GUUGGAGCUGAUGGCG (SEQ ID No: 1), GUUGGAGCUGUUGGCG (SEQ ID No: 2), GUUGGAGCUGCUGGCG (SEQ ID No: 3), GUUGGAGCUAGUGGCG (SEQ ID No: 4), GUUGGAGCUUGUGGCG (SEQ ID No: 5), GUUGGAGCUGGUGACG (SEQ ID No: 6), and GUUGGAGCUGGUUGCG (SEQ ID No: 7), either alone or followed by:
- a sequence selected from: (i) UAGGCAAGAGUGCC (SEQ ID No: 8) and (b) a 5′-fragment of 1-13 nucleotides inclusive of SEQ ID No: 8.
In more specific embodiments, the DDD is any of the embodiments thereof mentioned herein, each of which is considered to be a separate embodiment. In still more specific embodiments, the biodegradable matrix of the DDD comprises PLGA, mannitol (for example D-mannitol), and sodium bicarbonate; the nucleotide sequence of the sense strand of the RNAi agent of the DDD is GUUGGAGCUGAUGGCGUAGdTdT (SEQ ID No: 41), and the sequence of the antisense strand of the RNAi agent is CUACGCCAUCAGCUCCAACdTdT (SEQ ID No: 42). In more specific embodiments, the DDD contains 16-32% siRNA by weight, 7-11% Mannitol, and 60-77% PLGA, +0.5%-3% sodium bicarbonate and other excipients. In more specific embodiments, the DDD is 20%+/−5% siRNA by weight. In other embodiments, an additional siRNA, for example against a metastasis-facilitating gene, is also present within the DDD.
Another aspect of the present invention provides a method of treating a patient having metastatic cancer, comprising the step of administering to the primary tumor(s) a pharmaceutical composition comprising an RNAi agent, wherein the sequences of the sense and antisense strands of the RNAi agent are:
In other embodiments, the aforementioned method further comprises administration of a chemotherapy drug such as gemcitabine. In other embodiments, the method further comprises radiation treatment.
Another aspect of the present invention provides a method of treating a patient having metastatic cancer, comprising the step of administering to the primary tumor(s) a pharmaceutical composition comprising an RNAi agent, wherein the sequences of the sense and antisense strands of the RNAi agent are:
In other embodiments, the aforementioned method further comprises administration of a chemotherapy drug such as gemcitabine. In other embodiments, the method further comprises radiation treatment.
In other embodiments, the metastatic cancer treated by a method of the present invention is selected from pancreatic tumor, colon tumor, and lung tumor. In more specific embodiments, the cancer is selected from pancreatic carcinoma, pancreatic ductal adenocarcinoma, small-cell lung carcinoma, and colorectal cancer. In even more specific embodiments, the cancer is pancreatic ductal adenocarcinoma. In some embodiments, the tumor is an inoperable tumor; alternatively, it is an operable tumor.
In some preferred embodiments, a device is implanted intratumorally. In still other embodiments, the device is implanted into the vicinity of the tumor. In more specific embodiments, in the case of a well-defined solid tumor, several devices are spaced within the tumor volume. In yet other embodiments, several devices are implanted along a needle cavity within the tumor. In still other embodiments, the device or devices are implanted such that they are not in a direct contact with the perimeter of the tumor. Alternatively, in the case of a poorly defined solid tumor, the device is inserted into an area believed to contain tumor cells.
In still other embodiments, a method of the present invention further comprises the step of administering an anti-cancer agent to the patient. In more specific embodiments, the anti-cancer agent comprises a pyrimidine analogue, non-limiting examples of which are 5-azacytidine, 5-aza-2′-deoxycytidine, 5-fluoro-uracil, 5-fluoro-deoxyuridine (floxuridine), and 5-fluorodeoxyuridine monophosphate. In more specific embodiments, the anti-cancer agent is an inhibitor of ribonucleoside-diphosphatereductase large subunit (EC 1.17.4.1), non-limiting examples of which are motexafin gadolinium (CHEBI: 50161); hydroxyurea; gemcitabine (2′,2′-difluorodeoxycytidine); elacytarabine (CP-4055; an ara-C-5′elaidic-acid-ester) and CP-4126, (CO 1.01; a gemcitabine-5′elaidic-acid-ester; Adema A D et al, Metabolism and accumulation of the lipophilic deoxynucleoside analogs elacytarabine and CP-4126. Invest New Drugs. 2011 Oct. 15. [Epub ahead of print]), and those described in WO2011062503, the contents of which are incorporated herein by reference. In even more specific embodiments, the anti-cancer agent comprises gemcitabine. In alternative embodiments, the anti-cancer agent is gemcitabine. In yet other embodiments, the anti-cancer agent is an EGFR tyrosine kinase inhibitor. In yet other embodiments, the anti-cancer agent comprises a thymidylate synthase inhibitor. In more specific embodiments, the anti-cancer agent comprises leucovorin (Folinic acid; 2-[[4-[(2-amino-5-formyl-4-oxo-1,6,7,8-tetrahydropteridin-6-yl)methylamino]benzoyl]amino]pentanedioic acid). In yet other embodiments, the anti-cancer agent comprises irinotecan. In yet other embodiments, the anti-cancer agent comprises oxaliplatin. In still other embodiments, the anti-cancer agent comprises FOLFIRIN (5-fluorouracil, leucovorin, and irinotecan in combination). In still other embodiments, the anti-cancer agent is FOLFIRINOX (5-fluorouracil, leucovorin, irinotecan, and oxaliplatin in combination), or any combination of a subset of the four agents in FOLFIRINOX. In one embodiments the agent is Modified FOLFIRINOX, administrated as follows: Oxaliplatin (85 mg/m2)—IV for 2 hours, immediately followed by Irinotecan (180 mg/m2)—IV for 90 min. Leucovorin—400 mg/m2, followed by a Fluorouracil continuous IV infusion of 2,400 mg/m2 (over 46 hours) every two weeks. In yet other embodiments, the anti-cancer agent comprises an EGFR tyrosine kinase inhibitor. In more specific embodiments, the anti-cancer agent is Erlotinib.
In some embodiments the Gemcitabine is administrated as follows 1,000 mg/m2 IV is given on a weekly basis (Day1, day7 & day21), (cycle=4 weeks).
In other embodiments, the anti-cancer agent is a Protein-bound paclitaxel, including an agent based on nanoparticle albumin-bound (nab) technology, including Abraxane
In some embodiments, the anti-cancer agent is administered to the patient after administration of the DDD. In more specific embodiments, the anti-cancer agent may be administered to the patient up to 10 days after administration of the DDD. Alternatively, the anti-cancer agent is administered to the patient simultaneously with administration of the DDD. In still other embodiments, the anti-cancer agent is administered to the patient before administration of the DDD. In yet other embodiments, the DDD is administered during ongoing administration of the anti-cancer agent. In still other embodiments, the anti-cancer agent is administered to the patient intratumorally, by a method such as injection and controlled release, or including in other embodiments administration from the same DDD.
In still other embodiments, a method of the present invention further comprises the step of administering radiation therapy to the patient. In some embodiments, the radiation is administered to the patient after administration of the DDD. In more specific embodiments, the radiation may be administered to the patient up to 10 days after administration of the DDD. Alternatively, the radiation is administered to the patient simultaneously with administration of the DDD. In still other embodiments, the radiation is administered to the patient before administration of the DDD. In yet other embodiments, the DDD is administered during ongoing administration of the radiation.
Pharmaceutical CompositionsIn another embodiment, the present invention provides a pharmaceutical composition for treating a patient having metastatic cancer, said pharmaceutical composition comprising a millimeter-scale DDD, said DDD comprising:
A. A biodegradable matrix; and
B. An RNAi (RNA interference) agent incorporated within the biodegradable matrix, wherein the RNAi agent comprises a duplex region, and the nucleotide sequence of the duplex region of the sense strand consists of:
-
- a sequence selected from SEQ ID No: 1-7, namely GUUGGAGCUGAUGGCG (SEQ ID No: 1), GUUGGAGCUGUUGGCG (SEQ ID No: 2), GUUGGAGCUGCUGGCG (SEQ ID No: 3), GUUGGAGCUAGUGGCG (SEQ ID No: 4), GUUGGAGCUUGUGGCG (SEQ ID No: 5), GUUGGAGCUGGUGACG (SEQ ID No: 6), and GUUGGAGCUGGUUGCG (SEQ ID No: 7), either alone or followed by:
- a sequence selected from: (i) UAGGCAAGAGUGCC (SEQ ID No: 8) and (b) a 5′-fragment of 1-13 nucleotides inclusive of SEQ ID No: 8.
In more specific embodiments, the DDD is any of the embodiments thereof mentioned herein, each of which is considered to be a separate embodiment. In still more specific embodiments, the biodegradable matrix of the DDD comprises PLGA, mannitol (for example D-mannitol), and sodium bicarbonate; the nucleotide sequence of the sense strand of the RNAi agent of the DDD is GUUGGAGCUGAUGGCGUAGdTdT (SEQ ID No: 41), and the sequence of the antisense strand of the RNAi agent is CUACGCCAUCAGCUCCAACdTdT (SEQ ID No: 42). In other embodiments, an additional siRNA, for example against a metastasis-facilitating gene, is also present within the DDD.
In another embodiment, the present invention provides a pharmaceutical composition for treating a patient having metastatic cancer, said pharmaceutical composition comprising an RNAi agent, wherein the sequences of the sense and antisense strands of the RNAi agent are:
In other embodiments, the aforementioned pharmaceutical composition further comprises a chemotherapy drug such as gemcitabine. In other embodiments, the pharmaceutical composition is indicated as an adjunct for radiation.
In another embodiment, the present invention provides a pharmaceutical composition for treating a patient having metastatic cancer, said pharmaceutical composition comprising an RNAi agent, wherein the sequences of the sense and antisense strands of the RNAi agent are:
In other embodiments, an additional siRNA, for example against a metastasis-facilitating gene, is also present within the DDD.
In other embodiments, the aforementioned pharmaceutical composition further comprises a chemotherapy drug such as gemcitabine. In other embodiments, the pharmaceutical composition is indicated as an adjunct for radiation.
In another embodiment, the present invention provides use of a millimeter-scale DDD in the preparation of a medicament for treating a patient having metastatic cancer, wherein said DDD comprises:
A. A biodegradable matrix; and
B. An RNAi (RNA interference) agent incorporated within the biodegradable matrix, wherein the RNAi agent comprises a duplex region, and the nucleotide sequence of the duplex region of the sense strand consists of:
-
- a sequence selected from SEQ ID No: 1-7, namely GUUGGAGCUGAUGGCG (SEQ ID No: 1), GUUGGAGCUGUUGGCG (SEQ ID No: 2), GUUGGAGCUGCUGGCG (SEQ ID No: 3), GUUGGAGCUAGUGGCG (SEQ ID No: 4), GUUGGAGCUUGUGGCG (SEQ ID No: 5), GUUGGAGCUGGUGACG (SEQ ID No: 6), and GUUGGAGCUGGUUGCG (SEQ ID No: 7), either alone or followed by:
- a sequence selected from: (i) UAGGCAAGAGUGCC (SEQ ID No: 8) and (b) a 5′-fragment of 1-13 nucleotides inclusive of SEQ ID No: 8.
In other embodiments, an additional siRNA, for example against a metastasis-facilitating gene, is also present within the DDD.
In more specific embodiments, the DDD is any of the embodiments thereof mentioned herein, each of which is considered to be a separate embodiment. In still more specific embodiments, the biodegradable matrix of the DDD comprises PLGA, mannitol (for example D-mannitol), and sodium bicarbonate; the nucleotide sequence of the sense strand of the RNAi agent of the DDD is GUUGGAGCUGAUGGCGUAGdTdT (SEQ ID No: 41), and the sequence of the antisense strand of the RNAi agent is CUACGCCAUCAGCUCCAACdTdT (SEQ ID No: 42).
In another embodiment, the present invention provides use of an RNAi agent in the preparation of a medicament for treating a patient having metastatic cancer, wherein the sequences of the sense and antisense strands of the RNAi agent are:
In other embodiments, an additional siRNA, for example against a metastasis-facilitating gene, is also present within the DDD.
In other embodiments, the aforementioned RNAi agent and a chemotherapy drug such as gemcitabine are both used in the preparation of a medicament for treating a patient having metastatic cancer.
In another embodiment, the present invention provides use of an RNAi agent in the preparation of a medicament for treating a patient having metastatic cancer, wherein the sequences of the sense and antisense strands of the RNAi agent are:
In other embodiments, the aforementioned RNAi agent and a chemotherapy drug such as gemcitabine are both used in the preparation of a medicament for treating a patient having metastatic cancer.
In other embodiments, the metastatic cancer treated using a pharmaceutical composition of the present invention is selected from pancreatic tumor, colon tumor, lung tumor, brain, liver, kidney, prostate, melanoma, endometrial carcinoma, gastric carcinoma, renal carcinoma, biliary carcinoma, cervical carcinoma, and bladder carcinoma. In more specific embodiments, the cancer is selected from pancreatic carcinoma, pancreatic ductal adenocarcinoma, small-cell lung carcinoma, and colorectal cancer. In even more specific embodiments, the cancer is pancreatic ductal adenocarcinoma. In some embodiments, the tumor is an inoperable tumor; alternatively, it is an operable tumor.
In still other embodiments, a pharmaceutical composition of the present invention further comprises an anti-cancer agent. Alternatively, the pharmaceutical composition is indicated for administration in combination with an anti-cancer agent. In more specific embodiments, the anti-cancer agent is a pyrimidine analogue, non-limiting examples of which are mentioned herein. In even more specific embodiments, the anti-cancer agent comprises gemcitabine. In alternative embodiments, the anti-cancer agent is gemcitabine. In yet other embodiments, the anti-cancer agent is an EGFR tyrosine kinase inhibitor. In yet other embodiments, the anti-cancer agent comprises a thymidylate synthase inhibitor. In more specific embodiments, the anti-cancer agent comprises leucovorin (Folinic acid; 2-[[4-[(2-amino-5-formyl-4-oxo-1,6,7,8-tetrahydropteridin-6-yl)methylamino]benzoyl]amino]pentanedioic acid). In yet other embodiments, the anti-cancer agent comprises irinotecan. In yet other embodiments, the anti-cancer agent comprises oxaliplatin. In still other embodiments, the anti-cancer agent comprises FOLFIRIN (5-fluorouracil, leucovorin, and irinotecan in combination). In still other embodiments, the anti-cancer agent is FOLFIRINOX (5-fluorouracil, leucovorin, irinotecan, and oxaliplatin in combination). In yet other embodiments, the anti-cancer agent comprises an EGFR tyrosine kinase inhibitor. In more specific embodiments, the anti-cancer agent is Erlotinib.
In some embodiments, the anti-cancer agent is administered to the patient after administration of the DDD. In more specific embodiments, the anti-cancer agent may be administered to the patient up to 10 days after administration of the DDD. Alternatively, the anti-cancer agent is administered to the patient simultaneously with administration of the DDD. In still other embodiments, the anti-cancer agent is administered to the patient before administration of the DDD. In yet other embodiments, the DDD is administered during ongoing administration of the anti-cancer agent.
In yet other embodiments, a pharmaceutical composition of the present invention is indicated for administration with radiation therapy. In some embodiments, the radiation is administered to the patient after administration of the DDD. In more specific embodiments, the radiation may be administered to the patient up to 10 days after administration of the DDD. Alternatively, the radiation is administered to the patient simultaneously with administration of the DDD. In still other embodiments, the radiation is administered to the patient before administration of the DDD. In yet other embodiments, the DDD is administered during ongoing administration of the radiation.
Also provided herein are the following sequences that can be applied in siRNA design against the indicated targets, where the (typically 2 different) siRNA design contain the sense and antisense strands, in a precise manner as follows, per target. While only the sense strand is shown in some cases, the antisense strand is complementary, as depicted below:
In various embodiments, the described siRNA:
-
- comprises the following sense strand which can be linked to additional nucleotides at the 5′ end and/or at the 3′ end, provided that the overall strand length is 19-30 nucleotides, inclusive; and/or
- the antisense strand may be an antisense strand listed below or, in other embodiments, may be another strand that is fully complementary to the sense strand in the duplex region; the antisense need not be the same length as the sense strand, provided that the length of the antisense is in the range of 19-30 inclusive; and/or
- the 3′ end includes a dTdT end; and/or
- one or more nucleotides of the siRNA are modified:
In other embodiments, a dTdT tail is added to one or more of the aforementioned sequences, yielding, for example, one of the following sequences:
In various embodiments, each strand of any of the above siRNA's contains a dTdT overhang, as shown hereinabove in the aforementioned sense and antisense sequences.
EXPERIMENTAL DETAILS SECTION Example 1 Schematic Depiction of the Described TreatmentDDD's containing RNAi molecules were produced in a biological-class hood in a clean room, as follows:
Step 1: Preparation of siRNA/D-Mannitol/Sodium Bicarbonate Mixture:
siRNA was added to the pre-weighed D-Mannitol and Sodium Bicarbonate, and they were dissolved in RNase-free sterile water.
Step 2: Freezing:
The liquid was placed into glass vials, frozen in dry ice, and lyophilized for 48 hours.
Step 3: PLGA Preparation:
PLGA was dissolved in Ethyl Acetate.
Step 4: Combining PLGA with D-Mannitol/Sodium Bicarbonate/siRNA:
The PLGA solution was poured into the glass vial containing the lyophilized D-Mannitol/Sodium Bicarbonate/siRNA in fractions and stirred until homogenization
Step 5: Solvent Evaporation.
The solution was poured into a Teflon-covered dedicated glass dish and left to evaporate inside a dedicated container for 3-5 days.
Step 6: Release of Film:
The film was released from the glass dish using tweezers and a scalpel.
Step 7: Excision of Individual DDDs:
Individual DDDs were excised using a dedicated puncher. Each DDD was of a cylindrical shape, with a length and diameter of ˜1.3 mm and ˜0.6 mm, respectively.
In other embodiments, steps 5-7 are replaced by direct injection of solution into a tube, for example a PTFE tube, where the injection amount per tube is calculated for example to comprise siRNA in the range of 200 □g-500 □g. The tube is put in a drying chamber, for example drying chambers of the group including heat/humidity chamber, vacuum chamber (Desiccator), hood and centrifuges.
ResultsThe described DDD's have been demonstrated to enable prolonged release of siRNA while protecting the siRNA embedded in the LODER from degradation (WO 2010/001325 to Shemi). The silencing potential of the siRNA sequence set forth in SEQ ID No: 41-42, directed against K-rassiG12D (siG12D), was determined; this sequence was used as the siG12D siRNA sequence throughout the Examples below. Panc1 cells, human pancreatic carcinoma cells that carry the siG12D mutation in the K-ras gene, were mock-transfected or transfected with siG12D or control scrambled siRNA (si-scr). The relative K-ras mRNA levels were assessed by Real-Time PCR, with Hypoxantine PhosphoRybosyl Transferase (HPRT) and Ubiquitin C (UBC) used as endogenous controls. As shown in
Next, we assessed the effect of the LODER-derived siG12D on K-ras protein levels using Panc1-LUC cells, which are a sub-clone of Panc1 cells, stably expressing the luciferase reporter gene. Panc1-LUC cells were incubated in the presence of the siG12D LODER or with a LODER containing a control siRNA (siGFP) and transfection reagent (Lipofectamine). In parallel, two groups of cells were directly transfected with free siG12D or siGFP for comparison. Cells were lysed after 48 or 72 hrs, and total K-ras protein level was assessed by Western blot analysis.
Inhibition of K-ras expression leads to the inhibition of growth of Panc1 pancreatic cancer cells. In order to examine the potential growth-inhibiting effect of siG12D, we measured both cell viability and cell death of Panc1 cells treated with the siG12D LODER.
Panc1-LUC cells were further used to: i) confirm the ability to follow cell growth by monitoring Luciferase activity and ii) to demonstrate the functionality of the LODER-derived siRNA. Panc1-LUC cells were incubated with the siG12D LODER or the siLUC LODER (positive control) or the siGFP LODER (negative control). The cells were also transfected in parallel with free siG12D, siLUC or siGFP for comparison to LODER-embedded siRNA (data not shown). 72 and 96 hours later, cells were harvested and Luciferase expression was measured.
For the in vivo assessment of LODER-siRNA effects, we initially used the murine colon cancer CT26 cells. These cells were stably transfected to constitutively express the luciferase gene (CT26-LUC cells). CT26-LUC cells were injected subcutaneously into BALB/c mice. When tumor volume reached ˜1 cm3, two siLuc or control (siGFP) LODERs were implanted into the tumors. As seen in
We also assessed the ability of the LODER-driven siRNA to inhibit a target gene in normal tissue. We implanted an empty DDD or siLuc DDD into the livers of transgenic mice, expressing the luciferase gene (MUP-Luc) in their liver. The Luciferase levels were measured using a CCCD (a Cooled Charge Coupled Device) camera.
To study the toxic potential of the LODER-driven siRNA, we compared the effect of the siG12D LODER (16, 32 and 64 μg siG12D/kg weight) to that of the empty LODER and to sham-operated or untreated animals. LODERs were implanted into the pancreas of normal mice and rats, both males and females of both species. In parallel, the same and higher doses of siG12D were intraperitoneally injected into normal mice and rats (16, 160 and 320 μg siG12D/kg weight). The duration of this study was 2 weeks in mice and 8 weeks in rats. The results demonstrated that the siG12D LODER had no effect on animal mortality, behavior, on body and liver weight. Hematology and biochemistry tests failed to reveal any statistically significant differences between the tested groups. Gross and histopathology analyses revealed that all noted changes were of minimal severity, and typical in untreated mice or rats of the same age and strain. Based on the lack of adverse reaction following siRNA treatment, the maximum dose of 0.32 mg siRNA/kg body weight was considered as not constituting an acute toxicity risk.
Example 4 LODER-Driven siG12D Inhibits Tumor Growth In VivoWe next aimed to assess the ability of LODERs to inhibit growth of tumors derived from human pancreatic tumor cell lines in vivo. Towards that aim we used two human pancreatic tumor cells: Panc1 and Capan1, both constitutively expressing the luciferase (LUC) gene, referred to as Panc1-LUC and Capan1-LUC. These cell lines bear mutated K-ras genes: K-rasG12D (G12D) and K-rasG12V (G12V), respectively, both mutations leading to the constitutive activation of the K-ras protein. To evaluate the therapeutic potential of the LODER-driven K-ras oncogene silencing, mice bearing subcutaneous tumors originating from Panc1 or Capan1 cells were randomly assigned to treatment groups when the tumors reached an average volume of 1 cm3. Mice bearing Capan1-LUC-derived subcutaneous tumors were divided into 4 groups: untreated and intratumoral implantation of siG12D LODERs, siG12V LODERs or empty LODERs. Each siRNA-loaded LODER contained 2 μg of siRNA. In order to further validate the effect of siG12D LODERs on tumor growth, we used a syngeneic mouse tumor model whereby the PancO2 mouse pancreatic cell line that bears a G12D mutation was subcutaneously injected into mice of matching strain (Corbett et al., 1984). In vitro, siG12D inhibited PancO2 cell growth to a similar extent as Panc1 cells. In vivo, in the subcutaneous syngeneic model, implanted siG12D LODERs eliminated almost entirely the tumor tissue by one week after the implantation (
In an effort to determine the long-term potential effect of the siRNA-LODERs, we analyzed the remaining siRNA content of LODERs isolated from tumors after implantation. The results revealed that the LODER's structure protected the siG12D from degradation for greater than a 70 day period. These results demonstrate that the siG12D LODER effectively inhibited tumor growth in vivo.
Example 5 The Anti-Tumor Effect of the siG12D LODER in an Orthotopic Pancreatic ModelIn order to extend the results of the subcutaneous tumor model experiments, we established an orthotopic pancreatic cancer model. For this purpose, Panc1-LUC or Capan1-LUC cells were injected into the tail of the mouse pancreas via an incision. Tumor development was assessed by in vivo Luciferase activity. When tumors were detected, mice were stratified and divided into treatment groups, keeping a similar average level of Luciferase activity between the groups. Two LODERs were stitched to the pancreatic tumor via a laparotomy.
To provide evidence that tumor growth inhibition occurred due to K-ras silencing, we assessed the effect of the siG12D LODER on K-ras protein expression in tumor tissues. K-ras protein was detected by immunohistochemistry (IH) staining in pancreatic tumor tissues 24 days after treatment with siG12D LODERs, empty LODERs, or untreated. Image analysis software was used to calculate the percentage of K-ras positively-stained cells vs. non-stained cells, in 0.1×0.1 mm2 squares at progressive distances from the LODER placement sites (
To corroborate these results, we assessed the effect of the siG12D LODER on the K-ras pathway. Functional K-ras induces the phosphorylation of Akt and ERK. Here, tumor tissues were tested from mice bearing pancreatic Panc1-LUC-derived tumors from 4 treatment groups: untreated, injected with siG12D or implanted with empty LODERs or siG12D LODERs. Thirty nine days post-treatment, we performed IH analysis of tumor tissues for Akt and ERK. Akt phosphorylation was induced in all treatment groups, except for the untreated group. We calculated the ratio of positively P-ERK-stained vs. non-stained (positive/negative ratio) nuclei in 0.1×0.1 mm2 squares at progressive distances from LODER placement site. The positive/negative ratio was low in areas adjacent to siG12D LODERs, compared to distant areas and the control group. These results are in line with the K-ras staining results, showing that K-ras silencing by the siG12D LODER leads to the suppression of its downstream signaling pathway as well.
In order to confirm that silencing K-ras in the pancreatic tumor inhibits tumor cell growth, we performed CDC47 IH staining. We estimated the percentage of positively stained cells using image analysis software. The results revealed that the siG12D LODER inhibited the growth of tumor cells around the LODER, and this effect extended up to 2 mm far from the LODER. These results confirm that the observed tumor growth inhibition was due to the silencing of K-ras by the siG12D LODER.
Thus, LODER-driven siG12D significantly inhibited in vivo growth of pancreatic tumors in both subcutaneous and orthotopic mouse models.
Example 6 K-Ras Expression in Human Pancreatic TissueOver 90% of human pancreatic ductal adenocarcinoma (PDA) tumors involve mutations in the K-ras oncogene, and PDA is believed to be addicted to the K-ras mutation. Next we investigated K-ras expression and localization in normal pancreatic tissues and pancreatic tumors. K-ras IH staining revealed that while in normal tissue the K-ras protein was found in the cytoplasm, in the tumor tissue, K-ras was localized on the membrane of PanIN (pancreatic intraepithelial neoplasia) lesions (
In the course of tumor development, cancer cells may undergo epithelial-to-mesenchymal transition (EMT). In this process, the cells acquire mesenchymal characteristics and lose epithelial ones. It was previously reported that K-ras inhibition reduces EMT, as manifested by a decrease in cell migration and reduction in contact inhibition Singh et al 2009.
In order to study the effects of siG12D on the EMT process and its consequent increased cellular migration and motility, we conducted a series of experiments in which we examined different aspects of this process. We analyzed the migration characteristics of Panc1 cells following transfection with siG12D or scrambled siRNA, using the scratch and transwell-migration assays. TGF-β was used as a positive control. Migration ability was assessed using a modified Boyden chamber assay, which revealed that siG12D inhibited Panc1 migration by more than 30% (
Treatment of siG12D in vitro was followed by measurement of genes whose expression (high or low) is characteristic of EMT. Treatment resulted in reduced expression of mesenchymal genes (Zeb1 and Slug) and augmented expression of epithelial genes (E-Cadherin), whereas TGF beta treated cells (EMT positive control) exhibited gene expression characteristic of EMT, and untreated cells and cells treated with scrambled siRNA, H19 siRNA, exhibited more neutral gene expression (
Procedure: Female C57/B6 mice (age ˜6 w) were intrapancreatically injected with 105 Panc02 cells. Two months post-injection, mice were sacrificed and liver, spleen and lung tissues were macroscopically examined for the presence of metastases (
We have initiated a Phase I clinical study (NCT01188785). The aim of this phase I study is to assess safety, tolerability and to determine preliminary therapeutic benefits. Here we present a case of a 66-year old female patient with locally advanced, non-operable PDA). One 25 μg siG12D LODER was implanted into the tumor under endoscopic-ultrasound (EUS) guidance. The patient initiated Gemcitabine chemotherapy 16 days later. The treatment was very well tolerated, with no significant side-effects. The serum-based tumor-marker CA 19-9 decreased following the siG12D LODER implantation even before the administration of the first line chemotherapy treatment, and eventually reached normal values. The patient then received local radiation treatment. As shown in
As Shown in
Experimental design: Mice bearing injected pancreatic Panc02 tumors, stably expressing luciferase, are stratified into groups according to luciferase measurements and treated in a time window before the appearance of metastases as follows:
-
- Group 1: 2 EMPTY LODERS are implanted into/adjacent to orthotopic tumors.
- Group 2: 2 siG12D LODERS are implanted into/adjacent to orthotopic tumors.
Tumor growth follow-up is performed by luciferase measurements. The rate of occurrence and size of metastases is measured macroscopically post mortem.
Panc02-luc is a sub-clone of the murine pancreatic carcinoma cell line Panc02 (produced from tumors from K-ras mutated transgenic mice) which stably expresses the luciferase reporter gene. Panc02-luc cells can be grown in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (FCS) and 100 units/ml penicillin/streptomycin, according to the ATCC protocol. Mycoplasma tests can be performed after cell defrost and prior to cell injection to assure that the cell line is mycoplasma free.
Mice: Female C57/B6 mice, 6-7 week old, may be purchased from Harlan, Israel.
Tumor ImplantationMice are anesthetized, and the target skin is shaved and sterilized. An incision is made in the median upper abdominal region, the pancreas is carefully pulled out, and an inoculum (e.g. 100,000) Panc02-luc cells are injected into the tail of pancreas. The pancreas is returned into the abdominal space, and the incision is stitched.
Tumor Growth Follow-UpTumor growth is assessed by Luciferase measurements using the IVIS camera. When tumor size reaches ˜0.5 cm in diameter, mice are divided into several groups that are stratified according to Luciferase intensity levels.
Calibration of Appearance of Metastasis
-
- 1. Mice are implanted with tumors as described above.
- 2. Groups of mice are sacrificed at various times past tumor implantation.
- 3. Macroscopic and histological analyses (e.g. H&E sections) of the liver, spleen and lungs are performed to determine metastasis formation.
The time chosen for LODER treatment will be decided based on the time after tumor implantation when metastases are first detected in at least 20% of the mice.
Treatment GroupsMice with tumors are divided into treatment groups at a time point before metastases first appear (according to the calibration test).
Group 1: Two EMPTY LODERS implanted into/adjacent to orthotopic tumors.
Group 2: Two siG12D LODERS (5 μg siRNA) implanted into/adjacent to orthotopic tumors.
-
- 1. Mice are anesthetized and incised and the pancreas pulled out as described above.
- 2. For tumors bigger than 0.5 cm in diameter, the surgeon implants the appropriate LODERs into the tumor and then stitches the insertion site.
- 3. For tumors smaller than 0.5 cm in diameter, the surgeon affixes the appropriate LODERs to the tumor using a needle.
- 4. The pancreas is returned into the abdominal space
- 5. The incision is stitched.
-
- 1. Primary tumor growth is assessed, e.g. by luciferase measurement. Luciferase can be visualized by injection of Luciferin and measured using an IVIS camera. Visualization is performed before treatment (in order to divide mice into groups) and at various time points after treatment.
- 2. Macroscopic analysis: At the time when mice are expected to bear metastases, mice are sacrificed, and the liver, spleen and lung tissues are examined. The diameter of visible metastases is determined, e.g. using a caliper.
- 3. Histology analysis: Liver, spleen and lung tissues are fixed (e.g. with formalin), embedded in paraffin, and tissue slides are prepared and stained with Hematoxylin and Eosin (H&E). Tissue scan for microscopic metastases is performed by a pathologist.
We expect to see a lower count of macroscopic and microscopic metastases in the treatment group compared to the control. Metastases forming in the treatment group may also be smaller than those in the control group. These results will indicate a metastasis formation inhibitory effect of siG12D LODER treatment.
Example 12 Assessment of Ability of siG12D LODER to Prolong the Survival of Mice with Panc02 Tumors and Metastases General Experimental Design:Similar to the previous Example.
Past Treatment Follow-Up and Analyses1. Primary tumor growth: similar to the previous Example.
2. Overall survival: Following treatment, mice are monitored daily for survival. Severely morbid mice may be euthanized. A survival curve will be produced.
3. Histology analysis: similar to the previous Example. May also include analysis of proliferation markers, e.g. Ki67 and pHH3. Tissue scan for microscopic metastases may be performed by a pathologist.
We expect to see an increased survival in the treatment group compared to the control. Determining the metastatic load by post-mortem examination of liver, spleen and lung tissue will show whether death and morbidity were due to metastases or to the primary tumor. A decrease in proliferation markers in metastases in the treatment group will indicate that tumor local treatment exerts a systemic effect on disseminated metastases.
Example 13 Measuring Levels of Pancreatic Cancer Circulating Tumor Cells (CTCs) in Subjects' Blood Following Treatment with siG12D LODERProtocol: Sample collection is typically performed within 24 h of patients' blood extraction. Whole blood sample is washed with ECL (erythrocyte lysis) buffer until red cells are removed. White blood depletion step: CD47 depletion may be performed using a kit. RNA preparation from CTCs: RNA may be prepared using the Tri-Zol (Invitrogen) reagent.
Relative quantitation of CTC markers: CTC markers relative level is assessed, e.g. by Real-Time PCR, using markers such as EGFR and CK19. Results may be compared to previously collected data from the same patient.
Follow-up radiology: Patients receiving siG12D LODER treatment or chemotherapy without LODER (control group) are subjected to imaging (e.g. by CT scan) of the original tumor and metastases during a follow-up period. The data are analyzed by a radiologist to monitor disease progression.
1-μl of modified siRNA was incubated at with 9-μl 50% human serum, at 37° C. The incubation was stopped at various time points (0 min, 10 min, 30 min, 4 h, 24 h, 1 week, 2 weeks and 4 weeks) by the addition of 10 μl sample buffer and freezing at −70° C. siRNA degradation was evaluated using urea-acrylamide gel-electrophoresis. Gels were stained with ethidium bromide, and band intensity was measured using Image Gauge™ software. Stability was evaluated by calculating the ratio between the intensity at each time point vs. the 0-min time point. Values were classified into five stability groups: Level 0: very unstable; 95-100% degraded; Level 1: unstable; 75-95% degraded; Level 2: medium stability; 50-75% degraded; Level 3: stable; 25-50% degraded; Level 4: very stable. 0-25% degraded.
Viability StudiesPanc1-luc cells were seeded in 96-well plate (0.5×104 cells/well) to 70% confluence and were transfected with siRNAs. 120 hrs later, a 6-hr viability test was performed using the XTT assay. The indicated 4 levels of staining, namely 1, 2, 3, and 4 as shown in the last column of
siG12D was modified with 2′-oxymethyl (“2′-OMe”) at various positions, as set forth in Table 1 below.
The modified siRNA were tested for stability in serum, and several of them exhibited improved stability relative to the unmodified siRNA. Next, their effect on the viability of a pancreatic cancer cell line was tested in cell culture. Several of the modified siRNA exhibited improved efficacy relative to the unmodified siRNA (
This study compared the effects on cell viability of specific modified and unmodified siG12D (using non-specific siRNA as a control), alone and combined with the chemotherapy drug Gemcitabine (Gemzar®).
Experimental procedure: Panc1 cells were transfected using Lipofectamine™ with unmodified and modified siG12D and a scrambled (non-targeting) siRNA control molecule or were mock transfected (no siRNA). Cell viability was assessed 72 hrs post-transfection by the Methylene Blue (MB) test. Additional groups were transfected as described above, followed by 1 hr of treatment with 10 μM Gemzar®. At the exemplary time point of 72 h, Gemzar® enhanced the effect of siG12D by nearly 10% (
Additional studies of EMT utilize various mesenchymal markers (e.g. N-cadherin, Vimentin, S100A4, α-smooth-muscle cell actin [SMA]) and epithelial markers (e.g. E-cadherin, cytokeratin 8 or other cytokeratins, ZO-1, claudins, occludins, Snai1, Snai2, ZEB1, ZEB2, Twist1, and Twist2) to monitor the EMT process.
Example 17 Comparison of Chemotherapy Alone Vs. Chemotherapy +siG12D-DDDPatients with metastatic pancreatic cancer are administered 1 or more courses of Chemotherapy alone, for example Gemcitabine and/or FOLFIRINOX, or siG12D-DDD implantation followed by the same Chemotherapy treatment as the first group, beginning 0-120 days after DDD implantation. Disease progression is assessed, for example as described herein. siG12D-DDD is shown to be an effective adjunct to chemotherapy.
Example 18 Insertion of LODER Targeting Mutated k-Ras into Primary Tumors Prevents Metastasis Overall Experimental Design:In order to assess the ability of LODER targeting mutated k-ras to reduce metastasis formation, C57/B6 mice (from Harlan Laboratories, Israel) were subcutaneously injected with PancO2-luc cells. When the tumor volume reached 1 cm3, the allographs were transplanted into a new C57/B6 mouse. The recipient mice were divided into three groups:
-
- Untreated—tumor alone was transplanted:
- Empty LODER: tumor bound to an empty LODER was transplanted.
- siG12D LODER: tumor bound to a siG12D LODER containing 5 □g of siRNA was transplanted.
One month later, mice were sacrificed, and tumor occurrence and size were measured.
The protocol will now be described in more detail:
Subcutaneous TumorsThe donor mice and recipient mice were 9 week-old C57Bl/6 female mice. Tumor xenografts were established by subcutaneous injection of log-phase growth viable cells, 107 of PancO2-Luc cells in 100 μL PBS. The cells were injected into the right flanks of the mice. Tumor growth was followed by caliper measurements.
Tumor Treatment:When the tumors reached the required size, donor mice were sacrificed, the site of the tumor was sterilized, and the tumor was placed into a sterile tissue culture plate containing HBSS and cut lengthwise and widthwise into slices of 0.5 cm3. The slices were observed under the microscope to confirm that they had a similar morphology, including a similar prevalence of necrotic and tumor tissues. One slice, with or without a LODER was stitched to the tail of the pancreas of each recipient mouse, through an incision on the left abdominal flank. In the LODER groups, prior to implantation, the LODER was incubated in a tube with the tumor slice and Matrigel (Engelbreth-Holm-Swarm ([EHS]) for 5 minutes, which served to attach the tumor to the LODER such that the connection would survive transplantation, and the tumor tissue would maintain its structural integrity.
Tumor Growth Follow-Up:4 weeks after implantation, mice were sacrificed. The tumor occurrence, weight of pancreas with the tumor, and appearance of macroscopic metastases were assessed post mortem.
ResultsThe average tumor weight in the siG12D LODER-treated group was significantly lower (p=0.02) compared to the two control groups: untreated (u/t) and empty LODER-implanted (
Additionally, siG12D LODER hindered metastases development (Table 2).
The effect of siRNA-mediated down-regulation of EMT-related genes on viability of Panc1 cancer cells was measured as follows: siRNAs targeting the indicated genes, namely SLUG (SNAI2), SNAI1 TWIST, Zeb1, Zeb2, Goosecoid, and E12 (TCF3), were designed and synthetized by IDT-Syntezza, using 2 different siRNA's per target (Table 3). Panc1 cells were transfected with the siRNAs using Lipofectamine®. 72 hrs post-transfection, cell viability was tested by Methylene blue (MB) assay. Gemzar® was used as a positive control for cell killing.
As shown in
LODER containing siRNA that target EMT-related genes, e.g. those mentioned in the previous Example, are using in vivo mouse models of pancreatic cancer, such as Panc1 and Panc02 orthotopic and subcutaneous cell grafts. An anti-tumor growth and/or anti-metastases effect is expected.
Example 21 Treatment with Anti-K-Ras siRNA Reduces Levels of Downstream Effector ProteinsTo confirm the specific action of siG12D on the K-ras signaling pathway, KRAS, level of activation of the KRAS downstream effectors ERK and Akt was measured following treatment with siG12D. Human Panc1 pancreatic cancer cells were left untreated (u/t) or transiently transfected with siG12D, non-targeting scrambled siRNA (si-scr) or were mock-transfected using Lipofectamine® 2000. 36 hrs after transfection, cells were lysed and relative levels of KRAS, P-Erk and P-Akt proteins were assessed by Western blot analysis. The results were normalized to the level of β-actin.
Detailed ProtocolPanc1 cell lines (American Type Culture Collection) were cultured in RPMI-1640 medium, supplemented with 10% (v/v) heat-inactivated fetal calf serum (FCS), 2 mM glutamine, 100 units/mL penicillin and 100 μg/mL streptomycin. Cell cultures were maintained in a humidified atmosphere of 5% CO2 at 37° C. For transfection, Panc1 cells were seeded in 12-well plates (7×104/well).
Cell Transfection1.5 μg siRNA per well (1.5 nM final concentration) were used for siRNA transfections.
Western Blot AnalysisWestern blot assays were carried by homogenizing cells in lysis buffer A (0.25M sucrose, 20 mM Tris pH 7.6, 1.5 mM MgCl2, 10% glycerol, 1 mM EDTA and “cOmplete mini” protein inhibitor cocktail (Roche Diagnostics)), incubated on ice for 10 min, centrifuged at 12,000 rpm for 15 min at 4° C., and supernatants were collected. Primary Abs: anti-K-res (Abcam, ab84573), anti-P-Erk (Sigma, M 8159; specific for the diphosphorylated form of MAP kinase); anti-P-Akt (Cell Signaling, #4060; specific for Akt phosphorylated at Ser473) and anti-β-Actin (ICN/MP Biomedicals, USA, #691001). Secondary Abs: DakoEnVision™ System labeled Polymer-HRP anti-mouse (Dako, #K4001) and anti-rabbit (Dako, #K4003). Proteins were visualized by the EZ-ECL chemiluminescence detection kit for HRP (cat #20-500-120 from Biological Industries, Kibbutz Beit Haemek, Israel). Results are expressed as ratio of protein of interest/β-actin to correct for amount of protein loaded in each sample.
ResultsInhibition of K-ras by siG12D decreased the levels of P-Erk and P-Akt (
General Experimental Design:
C57/B6 mice bearing injected pancreatic and subcutaneous Panc02 tumors, stably expressing luciferase, are stratified into groups according to luciferase measurements and treated post-metastases formation as follows:
-
- Group 1: 2 EMPTY LODERS will be implanted into/adjacent to orthotopic tumors
- Group 2: 2 siG12D LODERS will be implanted into/adjacent to orthotopic tumors.
Tumor growth follow-up is performed by luciferase measurements. The presence of circulating tumor cells in the blood of these mice is determined using quantitative PCR (qPCR) and droplet digital PCR) ddPCR.
When tumor size reaches ˜0.5 cm in diameter, mice are divided into groups stratified according to Luciferase intensity levels, up to 20 animals in each group (according to the survival following surgery). For subcutaneous tumors, growth may be measured using a caliper. When tumor size reaches ˜1 cm in diameter, mice are divided into groups stratified according to Luciferase intensity levels.
In other experiments, the treatment groups are divided into treatment groups at the time before metastases first appear (according to the calibration test performed in Example 11). Treatment groups are:
-
- Group 1: Two empty LODERS implanted adjacent to orthotopic tumors or implanted into subcutaneous tumors.
- Group 2: Two siG12D LODERS (5 μg siRNA) implanted into/adjacent to orthotopic tumors.
-
- 1. At certain time points post-treatment, mice are euthanized and blood is extracted.
- 2. CTC along with leukocytes (the blood nucleated cell fraction) is enriched using Erythrocyte Lysis Buffer (ELB).
- 3. RNA is isolated, e.g. using Tri-Zol (Invitrogen) reagent. cDNA is prepared, e.g. using the qScript kit (Quanta).
- 4. CTC markers relative level quantification: relative levels of CTC markers are assessed, e.g. by Real-Time PCR and ddPCR. Marker list may include: EGFR, CK19 and Luciferase (an artificial marker enabled by the genetic labeling of Panc02 cells with the luciferase gene).
Expected results: By this experiment we plan to see a decrease (in either the orthotopic or the subcutaneous models) in the levels of CTC. If such a decrease will be met, this could imply that the ability of pancreatic tumors in the Panc02 model to disseminate tumor cells into the blood is impaired. Dissemination of tumor cells into the blood is an essential step in the formation of distant organ metastasis. Impairment of this procedure is highly likely to impair metastasis formation.
Example 23 Measurement of Ability of siG12D LODER to Decrease the Distant Organ Colonization of Disseminated Tumor CellsGeneral experimental design: C57/B6 mice bearing injected subcutaneous Panc02 non-labeled tumors are stratified into groups with equal tumor average size and treated as follows:
-
- Group 1: 2 empty LODERS are implanted into/adjacent to orthotopic tumors.
- Group 2: 2 siG12D LODERS are implanted into/adjacent to orthotopic tumors.
At 4 days post-treatment, Panc02 cells labeled with luciferase are injected intravenously. Growth of Panc02-luc cells in the lungs is monitored through luciferase measurements.
Treatment Groups:Mice with tumors are divided into treatment groups at the time before metastases first appear.
-
- Group 1: Two empty LODERS are implanted into/adjacent to orthotopic tumors.
- Group 2: Two siG12D LODERS (5 μg siRNA) are implanted into/adjacent to orthotopic tumors.
This experiment is intended to confirm that disruption of tumor growth with siG12D LODER inhibits the colonization of distant organs with tumor cells and thus decreases metastasis formation.
Example 24 Preparation of DDD's Containing siRNA's Against Mutated K-Ras and an EMT-Related GeneDDD's containing siRNA's against mutated K-ras and an EMT-related gene are prepared as described hereinabove, except that the different siRNA's are mixed together prior to mixing with the other solid ingredients.
Example 25 Testing of DDD's Containing siRNA's Against Mutated K-Ras and an EMT-Related GeneDDD's containing siRNA's against mutated K-ras and an EMT-related gene are tested as described hereinabove.
With respect to the jurisdictions allowing it, all patents, patent applications, and publications mentioned herein, both supra and infra, are incorporated herein by reference.
In the claims, the word “comprise”, and variations thereof such as “comprises”, “comprising”, and the like indicate that the components listed are included, but not generally to the exclusion of other components.
REFERENCES
- Barry et al March 2013, Volume 30, Issue 3, pp 251-264)
- Brummelkamp et al, Stable suppression of tumorigenicity by virus-mediated RNA Interference. Cancer Cell September • 2:243 (2002)
- Corbett et al, Induction and chemotherapeuticresponse of two transplantable ductal adenocarcinomas of the pancreas in C56BL/6, Cancer Research 44, 717-726, (1984).
- Deng et al Cancer Research: Apr. 15, 2010; Volume 70, Issue 8, Supplement 1.
- Gupta and Massagué, Cell 127, Nov. 17, 2006.
- Fleming et al, Molecular Consequences of Silencing Mutant K-ras in Pancreatic Cancer Cells: Justification for K-ras-Directed Therapy. Mol Cancer Res 3(7):413-23 (2005).
- Loeher et al, Gemcitabine Alone Versus Gemcitabine Plus Radiotherapy in Patients With Locally Advanced Pancreatic Cancer: An Eastern Cooperative Oncology Group Trial JOURNAL OF CLINICAL ONCOLOGY VOLUME 29 NUMBER 31 4105 (2011)
- Makadia and Siegel, Poly Lactic-co-Glycolic Acid (PLGA) as Biodegradable Controlled Drug Delivery Carrier, Polymers 2011, 3, 1377-1397.
- Morioka C Y et al, Suppression of invasion of a hamster pancreatic cancer cell line by antisense oligonucleotides mutation-matched to K-ras gene. In Vivo. 2005 May-June; 19(3):535-8.
- Normanno et al, Implications for K-ras status and EgFR-targeted therapies in metastatic cRc. Nat. Rev. Clin. Oncol. 6, 519-527 (2009).
- Nozato et al, Epithelial-mesenchymal transition-related gene expression as a new prognostic marker for neuroblastoma, Int J Oncol. 2013; 42: 134-140.
- Padhani A R, Ollivier L. The RECIST (Response Evaluation Criteria in Solid Tumors) criteria: implications for diagnostic radiologists. Br J Radiol 2001; 74: 983-986.
- Park et al, Biodegradable Polymers for Microencapsulation of Drugs. Molecules 2005, 10: 146-161.
- Réjiba et al, K-ras oncogene silencing strategy reduces tumor growth and enhances gemcitabine chemotherapy efficacy for pancreatic cancer treatment. Cancer Science 98(7): 1128-1136 (2007).
- Singh et al, A gene expression signature associated with “K-Ras addiction” reveals regulators of EMT and tumor cell survival. Cancer Cell. 2009 Jun. 2; 15(6):489-500.
- Wang W et al, Identification of effective siRNA against K-ras in human pancreatic cancer cell line MiaPaCa-2 by siRNA expression cassette. World J Gastroenterol. 2005 Apr. 7; 11(13):2026-31.
- Siegel R, Naishadham D, Jemal A: Cancer, statistics, 2012. CA Cancer J Clin 62:10-29
- Maitra A, Hruban R H: Pancreatic cancer. Annu Rev Pathol, 2008, 3:157-88
- Valastyan and Weinberg, Cell. 2011, 147(2): 275-292)
- Kalluri and Weinberg, J Clin Invest. 2009 June; 119(6): 1420-8
- Brabletz, T., Cancer Cell 22, Dec. 11, 2012
- Hotz B, et al, Clin Cancer Res 2007; 13:4769-76
- Jen-Jung Pan, Muh-Hwa Yang, J. of Gastrointestinal Onc., Vol 2, No 3 (September 2011)
- Rachagani, S. et al British Journal of Cancer 2011 104, 1038-1048
- Andreia de Albuquerque et al., Oncology 2012; 82:3-10
- Herman, J. M. et al, Journal Of Clinical Oncology Volume 31 number 7, (2013)
Claims
1. A millimeter-scale drug delivery device (DDD), comprising:
- A. a biodegradable polymeric matrix; and
- B. a nucleotide-based agent that targets a gene, incorporated within said biodegradable polymeric matrix,
- for inhibiting the development of metastases of one or more primary tumors, by inserting said DDD into said primary tumor(s).
2. The DDD of claim 1, wherein said primary tumor is selected from a pancreatic cancer tumor, a prostate cancer tumor, cervical tumor, a brain tumor, a breast tumor, a bladder tumor, colon cancer tumor, and a lung cancer tumor.
3. The DDD of claim 1, wherein said gene is selected from the group consisting of Snai1, Snai2, PAK1, PAK2, ZEB1, ZEB2, Twist1, Twist2, Goosecoid, SIX1, FOXC2, Prx1, FN1, VIMENTIN (VIM), N-CADHERIN, SERPINA3, CD70, IL13RA2, CD74, and TCF3.
4. The DDD of claim 1, wherein said gene is a mutated K-ras gene.
5. The DDD of claim 4, wherein said nucleotide-based agent is an siRNA that comprises a duplex region, and the nucleotide sequence of the sense strand of said duplex region consists of a sequence selected from SEQ ID No: 1-7: (SEQ ID No: 1) GUUGGAGCUGAUGGCG, (SEQ ID No: 2) GUUGGAGCUGUUGGCG, (SEQ ID No: 3) GUUGGAGCUGCUGGCG, (SEQ ID No: 4) GUUGGAGCUAGUGGCG, (SEQ ID No: 5) GUUGGAGCUUGUGGCG, (SEQ ID No: 6) GUUGGAGCUGGUGACG, and (SEQ ID No: 7) GUUGGAGCUGGUUGCG,
- followed by a sequence selected from i. UAGGCAAGAGUGCC (SEQ ID No: 8); and ii. a 5′-fragment of 3-13 nucleotides inclusive of SEQ ID No: 8.
6. The DDD of claim 5, wherein said nucleotide sequence of the sense strand of said duplex region consists of a sequence selected from GUUGGAGCUGAUGGCGUAG (SEQ ID No: 9), GUUGGAGCUGUUGGCGUAG (SEQ ID No: 10), GUUGGAGCUGCUGGCGUAG (SEQ ID No: 11), GUUGGAGCUAGUGGCGUAG (SEQ ID No: 12), GUUGGAGCUUGUGGCGUAG (SEQ ID No: 13), and GUUGGAGCUGGUGACGUAG (SEQ ID No: 14), and GUUGGAGCUGGUUGCGUAG (SEQ ID No: 15).
7. The DDD of claim 4, wherein said DDD further comprises another RNAi agent directed against a metastasis-facilitating gene.
8. The DDD of claim 7, wherein said metastasis-facilitating gene is selected from the group consisting Snai1, Snai2, PAK1, PAK2, ZEB1, ZEB2, Twist1, Twist2, Goosecoid, SIX1, FOXC2, Prx1, and FN1, VIMENTIN (VIM), N-CADHERIN, SERPINA3, CD70, IL13RA2, CD74, and TCF3
9. The DDD of claim 1, wherein said nucleotide-based agent is an siRNA.
10. The DDD of claim 1, further comprising an additive for modulating drug-polymer hydrophobic-hydrophilic interactions.
11. The DDD of claim 1, wherein said DDD is 0.68 mm+/−0.45 mm in diameter and is 4.5+/−2.5 mm in length.
12. The DDD of claim 1, wherein said DDD contains between 200-470 micrograms of RNAi agent per DDD.
13. The DDD of claim 1, wherein said nucleotide-based agent is chemically modified with a modification selected from the group consisting of 2′-O-methyl (2′-OMe), 2′-O-(2-methoxyethyl) (MOE) and 2′-fluorine.
14. The DDD of claim 1, wherein said nucleotide-based agent is conjugated to a molecule selected from the group consisting of a cholesterol moiety, spermine, hydrophobized hyaluronic acid-spermine conjugates (HHSCs), or alpha-tocopherol-vitamin E, or a cell-penetrating peptide; or complexed with a cationic molecule.
15. The DDD of claim 1, wherein the polymer in said biodegradable matrix comprises polylactic acid (PLA) and polyglycolic acid (PGA), wherein said PLA and PGA are present in a ratio of between 75:25 and 95:5, inclusive; and said polymer has a molecular weight of greater than 35 KDa.
16. The DDD of claim 1, wherein said DDD is coated with a coating comprising a biodegradable polymer.
17. The DDD of claim 3, wherein the sequence of the sense strand of the Snai2 RNAi consists of the sequence 5′-guuugcaagaucugcggca-3′ (SEQ ID NO: 69), 5′-cuggucaagaagcauuuca-3′ (SEQ ID NO: 70), 5′-guuugcaagaucugcggcadTdT-3′ (SEQ ID NO: 83) or 5′-cuggucaagaagcauuucadTdT-3′ (SEQ ID NO: 104).
18. The DDD of claim 3, wherein the sequence of the sense strand of the Twist RNAi consists of the sequence 5′-gucugcagcucucgcccaa-3′ (SEQ ID NO: 71), 5′-ggugugcguccagccguug-3′ (SEQ ID NO: 72), 5′-gucugcagcucucgcccaadTdT-3′ (SEQ ID NO: 106), or 5′-ggugugcguccagccguugdTdT-3′ (SEQ ID NO: 108).
19. The DDD of claim 3, wherein the sequence of the sense strand of the Zeb1 RNAi consists of the sequence 5′-gacucgagcauuuagacac-3′ (SEQ ID NO: 73), 5′-cagguguaagcgcagaaag-3′ (SEQ ID NO: 74), 5′-gacucgagcauuuagacacdTdT-3′ (SEQ ID NO: 110), or 5′-cagguguaagcgcagaaagdTdT-3′ (SEQ ID NO: 112).
20. The DDD of claim 3, wherein the sequence of the sense strand of the Zeb2 RNAi consists of the sequence 5′-gucauuagaagaggcguaa-3′ (SEQ ID NO: 75), 5′-cauuagaagaggcguaaca-3′ (SEQ ID NO: 76), 5′-gucauuagaagaggcguaadTdT-3′ (SEQ ID NO: 114), or 5′-cauuagaagaggcguaacadTdT-3′ (SEQ ID NO: 116).
21. The DDD of claim 3, wherein the sequence of the sense strand of the TCF3 RNAi consists of the sequence 5′-cuccuggacuucagcauga-3′ (SEQ ID NO: 99), 5′-gcacuggccucgaucuacu-3′ (SEQ ID NO: 101), 5′-cuccuggacuucagcaugadTdT-3′ (SEQ ID NO: 131), or 5′-gcacuggccucgaucuacudTdT-3′ (SEQ ID NO: 133).
Type: Application
Filed: Oct 18, 2013
Publication Date: Oct 23, 2014
Applicant: Silenseed Ltd. (Jerusalem)
Inventors: Amotz Shemi (Herzeliya), Elina Zorde Khvalevsky (Jerusalem)
Application Number: 14/056,978
International Classification: C12N 15/113 (20060101);