METHOD FOR THE IN VITRO DIAGNOSIS OR PROGNOSIS OF TESTICULAR CANCER

A method for in vitro diagnosis of testicular cancer includes (i) obtaining a biological sample from a patient suspected of having testicular cancer, (ii) performing an assay to determine the methylation status of CpG dinucleotides in a genomic DNA target sequence, the DNA target sequence being the 5′ LTR U3 promoter sequence of the ERVWE1 locus, optionally further including an activator sequence directly upstream of the 5′ LTR U3 promoter sequence, and (iii) diagnosing the patient with testicular cancer when the DNA target sequence is hypomethylated as compared to a methylation status indicative of the absence of testicular cancer.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description

This is a Division of application Ser. No. 12/918,126 filed Aug. 18, 2010, which is a National Stage entry of PCT/FR2009/050388 filed Mar. 10, 2009, which claims priority to FR 0851621 filed Mar. 12, 2008. The disclosure of the prior applications is hereby incorporated by reference herein in its entirety.

Testicular cancer represents 1 to 2% of cancers in men, and 3.5% of urological tumors. It is the most common tumor in young men, and rare before 15 years of age and after 50 years of age. The risk is highest in patients who are seropositive for HIV. Seminoma is the most common form of testicular cancer (40%), but many other types of cancer exist, among which are embryonic carcinoma (20%), teratocarcinoma (30%) and choriocarcinoma (1%).

The diagnosis of testicular cancer is first clinical: it often presents in the form of a hard and irregular swelling of the testicle. An ultrasound confirms the intratesticular tumor and Doppler ultrasound demonstrates the increase in vascularization in the tumor. In some cases, a magnetic resonance examination (testicular MRI) can be useful. A thoracic, abdominal and pelvic scan makes it possible to investigate whether there is any lymph node involvement of the cancer. A blood sample for assaying tumor markers is virtually systematic. It makes it possible to orient the diagnosis of the type of tumor. Two main tumor markers are used and assayed in the blood: β-HCG and α-foetoprotein. However, these markers are not very specific and, furthermore, if the concentration of these markers is at physiological levels, this does not mean that there is an absence of tumor. At the current time, the final diagnosis and final prognosis are given after ablation of the affected testicle (orchidectomy), which constitutes the first stage of treatment. Next, depending on the type of cancer and on its stage, a complementary treatment by radiotherapy or chemotherapy is applied. There is therefore a real need for having markers which are specific for testicular cancer and which, in addition, make it possible to establish as early a diagnosis and prognosis as possible.

The rare event represented by the infection of a germline cell by an exogenous provirus results in the integration, into the host's genome, of a proviral DNA or provirus, which becomes an integral part of the genetic inheritance of the host. This endogenous provirus (HERV) is therefore transmissible to the next generation in Mendelien fashion. It is estimated that there are approximately a hundred or so HERV families representing approximately 8% of the human genome. Each of the families has from several tens to thousands of loci, which are the result of intracellular retrotranspositions of transcriptionally active copies. The loci of the contemporary HERV families are all replication-defective, which signifies loss of the infectious properties and therefore implies an exclusively vertical (Mendelien) transmission mode.

HERV expression has been particularly studied in three specific contexts, placentation, autoimmunity and cancer, which are associated with cell differentiation or with the modulation of immunity. It has thus been shown that the envelope glycoprotein of the ERVWE1 locus of the HERV-W family is involved in the fusion process resulting in syncytiotrophoblast formation. It has, moreover, been suggested that the Rec protein, which is a splice variant of the env gene of HERV-K, could be involved in the testicular tumorogenesis process. However, the following question has not yet been answered: are HERVs players or markers in pathological contexts?

The present inventors have now discovered and demonstrated that nucleic acid sequences belonging to loci of the HERV-W family are associated with testicular cancer and that these sequences are molecular markers for the pathological condition. The sequences identified are U3 retroviral promoter sequences of 5′ LTRs (Long Terminal Repeats) which are hypomethylated in a cancerous biological sample.

In mammals, DNA can be methylated on the cytosines preceding a guanine (CpG doublet). This involves the transfer of a methyl group from S-adenosyl methionine to a cytosine residue so as to form 5-methylcytosine. The methylation of CpG doublets located in a promoter sequence generally results in an underexpression, or even a lack of expression, of the associated gene. Conversely, if the CpG doublets contained in a promoter sequence are hypomethylated, the expression of the associated gene is favored. The role of methylation in carcinogenesis has been recently studied. Thus, hypermethylation on the CpG doublets can result in the underexpression of a tumor suppressor gene, whereas, conversely, hypomethylation of CpG doublets can cause the activation of protooncogenes.

The subject of the present invention is therefore a method for in vitro, diagnosis or prognosis of testicular cancer, in a biological sample from a patient suspected of suffering from testicular cancer, characterized in that it comprises a step of detecting the presence or absence of methylation of CpG dinucleotides in at least one genomic DNA target sequence of the sample, the target sequence being selected from at least one of the sequences identified in SEQ ID Nos. 1 to 7 or from at least one sequence which exhibits at least 99% identity, preferably at least 99.5% identity, and advantageously at least 99.6% identity, with one of the sequences identified in SEQ ID Nos. 1 to 7 and the sequences complementary thereto.

The percentage identity described above has been determined while taking into consideration the nucleotide diversity in the genome. It is known that nucleotide variability is higher in the regions of the genome that are rich in repeat sequences than in the regions which do not contain repeat sequences. By way of example, D. A. Nickerson et al.,[1] have shown a diversity of approximately 0.3% (0.32%) in regions containing repeat sequences.

The sequences SEQ ID Nos. 1 to 6 correspond, respectively, to the sequences of the U3 retroviral promoters of the HW4TT, HW2TT, HW13TT, HWXTT, HW21TT and ERVWE1 loci, and SEQ ID No. 7 corresponds to the sequence of the activator plus the sequence of the U3 region of ERVWE1.

The sample from the patient will generally comprise cells (such as the testicular cells). They may be present in a tissue sample (such as the testicular tissue) or be found in the circulation. In general, the sample is a testicular tissue extract or a biological fluid, such as blood, serum, plasma, urine or else seminal fluid.

More particularly, the method comprises:

(i) extraction of the genomic DNA to be analyzed from the sample,
(ii) treatment of the extracted genomic DNA with one or more reagents so as to convert the cytosine bases, of the CpG dinucleotides, which are nonmethylated at position 5, into uracil,
(iii) at least one amplification of the treated DNA by bringing into contact with at least two primers,
(iv) determination, on the basis of the presence or absence of methylation of the cytosines of the CpG dinucleotides, of a methylation state of said target sequence or of a value which reflects the methylation state of the target sequence, for example the ratio of the number of methylated cytosines of the CpG dinucleotides/total number of cytosines of the CpG dinucleotides. In particular, if the ratio, corresponding to a percentage methylation, is less than or equal to 80%, preferably less than or equal to 60%, and advantageously less than or equal to 30%, this can be correlated with a presumption of testicular cancer.

If necessary, the method comprises a second amplification step after the amplification step described in (iii), which consists in bringing the amplicons obtained in (iii) into contact with at least two primers in order to amplify the target sequence.

The term “target sequence” is intended to mean a sequence or the sequences of a set of clones.

The determination, in the DNA, of the degree of methylation is carried out by any suitable technique. The methylation state or status of a DNA sequence can be established by methods using methylation-sensitive restriction enzymes or by methods involving a chemical modification of the DNA with sodium bisulfite, hydrogen sulfite or disulfite, preferably with a solution of sodium bisulfite, which converts the nonmethylated cytosines into uracils while at the same time not modifying the 5-methylcytosines. The analysis of the methylation can be carried out by conventional methods, such as sequencing, hybridization or PCR. Several methods of analysis use the ammonium bisulfite conversion technique, such as bisulfite sequencing PCR (conversion with ammonium bisulfite, amplification of the sequence of interest and sequencing), MSP (Methylation Specific PCR) and MSO (Methylation Specific Oligonucleotide Microarray) using DNA chips specific for the modified DNA. All these methods are well known to those skilled in the art and mention may be made, by way of illustration, of S. E. Cottrell [2].

Thus, in step (ii) of the abovementioned method, the treatment of the genomic DNA comprises the use of a solution selected from the group consisting of hydrogen sulfite, disulfite and bisulfite, and combinations thereof; preferably, a solution of sodium bisulfite.

In one embodiment of the invention, the method for in vitro diagnosis and/or prognosis of testicular cancer comprises:

(i) extraction of the DNA to be analyzed from the sample from the patient,
(ii) determination, in the DNA to be analyzed, of the degree (percentage) of methylation of the cytosines of the CpG dinucleotides included in at least one of the DNA sequences identified in SEQ ID Nos. 1 to 7 or in at least one sequence which exhibits at least 99% identity, preferably at least 99.5%, advantageously at least 99.6% identity, with a sequence identified in SEQ ID Nos. 1 to 7, and
(iii) comparison of the degree (percentage) of methylation of the cytosines in one or more DNA sequences as defined in (ii) with the degree (percentage) of methylation of said cytosines of said sequence(s) present in the DNA extracted from a noncancerous biological sample; if the degree of methylation in the DNA to be analyzed is determined as being less than the degree of methylation in the DNA extracted from the noncancerous biological sample, this can be correlated with the diagnosis or prognosis of a testicular cancer.

The term “hypomethylated sequence” is therefore intended to mean a DNA sequence comprising one or more CpG doublets, in which a cytosine of at least one CpG dinucleotide or doublet is not methylated at position 5 (i.e. which does not contain a CH3 radical at the fifth position of the cytosine base) in comparison with the same DNA sequence derived from the same type of noncancerous sample. In order to determine the methylation state or status of a target sequence, the following ratio can be calculated:

number of methylated cytosines of the CpG dinucleotides/total number of cytosines of the CpG dinucleotides. If the ratio, corresponding to a percentage methylation, is less than or equal to 80%, preferably less than or equal to 60%, and advantageously less than or equal to 30%, this can be correlated with a presumption of testicular cancer.

The subject of the invention is also an isolated nucleic acid sequence consisting of at least one DNA sequence selected from the sequences identified in SEQ ID Nos. 1 to 7 or from at least one sequence which exhibits at least 99% identity (preferably at least 99.5% or 99.6% identity) with one of the sequences identified in SEQ ID Nos. 1 to 7 and the sequences complementary thereto. The abovementioned sequences which are associated with testicular cancer are used as molecular markers for testicular cancer.

FIGURES

FIG. 1 represents the principle of the WTA method for amplifying RNAs.

FIG. 2 represents a synoptic scheme of the nature and the sequence of the various steps for preprocessing DNA-chip data according to the RMA method.

FIG. 3 illustrates the nomenclature, the position and the structure of the HERV-W loci overexpressed and exhibiting a loss of methylation in the tumoral testicle.

FIG. 4 is a histogram representing the increase in expression of five loci (HW4TT, HW2TT, HW13TT, HWXTT and HW21TT), respectively, in three pairs of testicular samples (testicle 1, testicle 2 and testicle 3), based on a comparative tumor sample/healthy sample quantification. The loci are represented along the x-axis and the factors of increase of expression between tumor tissue and healthy tissue are represented along the y-axis.

FIGS. 5 to 10 represent the methylation status of the U3 region of unique LTR or of the 5′ LTR of the various loci, respectively HW4TT, HW2TT, HW13TT, HWXTT, HW21TT and ERVWE1 in the healthy testicle (normal) and in the tumoral testicle derived from the same patient, after amplification and analysis of the sequences obtained.

EXAMPLES Example 1 Identification of HERV-W loci Expressed in Cancerous Tissues

Method:

The identification of expressed HERV-W loci is based on the design of a high-density DNA chip in the GeneChip format proposed by the company Affymetrix. It is a specially developed, custom-made chip, the probes of which correspond to HERV-W loci. The sequences of the HERV-W family were identified from the GenBank nucleic databank using the Blast algorithm (Altschul et al., 1990) with the sequence of the ERVWE1 locus, located on chromosome 7 at 7q21.2 and encoding the protein called syncytin. The sequences homologous to HERV-W were compared to a library containing reference sequences of the HERV-W family (ERVWE1) cut up into functional regions (LTR, gag, pol and env), using the RepeatMasker software (A. F. A. Smit and P. Green). These elements constitute the HERVgDB bank.

The probes making up the high-density chip were defined on a criterion of uniqueness of their sequences in the HERVgDB bank. The HERV-W proviral and solitary LTRs contained in the HERVgDB bank were extracted. Each of these sequences was broken down into a set of sequences of 25 nucleotides (25-mers) constituting it, i.e. as many potential probes. The evaluation of the uniqueness of each probe was carried out by means of a similarity search with all the 25-mers generated for all the LTRs of the family under consideration. This made it possible to identify all the 25-mers of unique occurrence for each family of HERV. Next, some of these 25-mers were retained as probes. For each U3 or U5 target region, a set of probes was formed on the basis of the probes identified as unique.

The samples analyzed using the HERV high-density chip correspond to RNAs extracted from tumors and to RNAs extracted from the healthy tissues adjacent to these tumors. The tissues analyzed are: uterus, colon, lung, breast, testicle, prostate and ovary. Placental RNAs (health tissue only) were also analyzed. For each sample, 400 ng of total RNA were amplified by means of an unbiased transcriptional method known as WTA. The principle of WTA amplification is the following: primers (RP-T7) comprising a random sequence and a T7 promoter sequence are hybridized to the transcripts; double-standard cDNAs are synthesized and serve as a template for transcriptional amplification by the T7 RNA polymerase; the antisense RNAs generated are converted to double-stranded cDNAs which are then fragmented and labeled by introducing biotinylated nucleotide analogs at the 3′OH ends using terminal transferase (TdT) (cf. FIG. 1).

For each sample, 16 μg of biotin-labeled amplification products were hybridized to a DNA chip according to the protocol recommended by the company Affymetrix. The chips were then washed and labeled, according to the recommended protocol. Finally, the chips were read by a scanner in order to acquire the image of their fluorescence. The image analysis carried out using the GCOS software makes it possible to obtain numerical values of fluorescence intensity which are preprocessed according to the RMA method (cf.: FIG. 2) before being able to carry out a statistical analysis in order to identify the HERV loci specifically expressed in certain samples.

Comparison of the means of more than two classes of samples was carried out by the SAM procedure applied to a Fisher test.

Results:

The processing of the data generated by the analysis on DNA chip using this method made it possible to identify six sets of probes corresponding to an overexpression in just one sample: the tumoral testicle. These six sets of probes are specific for six precise loci referenced HW4TT, HW2TT, HW13TT, HWXTT, HW21TT and ERVWE1 (cf.: FIG. 3). The information relating to the abovementioned loci are summarized in Table 1 below.

TABLE 1 Locus SEQ ID No: Chromosome Position* HW4TT 8 4 41982184:41989670 HW2TT 9 2 17383689:17391462 HW13TT 10 13 68693759:68699228 HWXTT 11 X 113026618:113027400 HW21TT 12 21 27148627:27156168 ERVWE1 13 7 91935221:91945670 *Position given in relation to ensemble version No. 39 (June 2006) (NCBI No. 36) http://www.ensembl.org/Homo_sapiens/index.html

The HW13TT locus is a chimeric provirus of HERV-W/L type resulting from the recombination of an HERV-W provirus and an HERV-L provirus. This chimera is such that the 5′ region made up of the sequence starting from the beginning of the 5′ LTR to the end of the determined gag fragment is of W type and the 3′ region made up of the sequence starting from the subsequent pol fragment to the end of the 3′ LTR (U3-R only) is of L type. This results in a fusion of the 3′ gag W-5′ pol L regions.

Example 2 Validation of the loci Overexpressed in the Tumoral Testicle and Determination of the Associated Induction Factor

Principle:

The six loci identified as overexpressed in the tumoral testicle by means of the high-density HERV chip were validated by real-time RT-PCR on three pairs of testicular samples. The specificity of this overexpression is evaluated by analyzing samples originating from other tissues. To this end, specific amplification systems were developed and used for the loci identified, as described in Table 2 below.

TABLE 2 Locus Sense primer (SEQ ID No:) Antisense primer (SEQ ID No:) G6PD gene TGCAGATGCTGTGTCTGG (14) CGTACTGGCCCAGGACC (15) HW4TT GGTTCGTGCTAATTGAGCTG (16) ATGGTGGCAAGCTTCTTGTT (17) HW2TT TGAGCTTTCCCTCACTGTCC (18) TGTTCGGCTTGATTAGGATG (19) HW13TT CATGGCCCAATATTCCATTC (20) GGTCCTTGTTCACAGAACTCC (21) HWXTT CCGCTCCTGATTGGACTAAA (22) CGTGGGTCAAGGAAGAGAAC (23) HW21TT  ATGACCCGCAGCTTCTAACAG (24) CTCCGCTCACAGAGCTCCTA (25)

The expression of these loci is standardized with respect to that of a suitable housekeeping gene: G6PD. This quantification of expression was carried out using an Mx3005P real-time RT-PCR machine, marketed by the company Stratagene.

Results:

The study of the three pairs of testicular samples indicates that all the putative loci identified, with the exception of HWXTT, the expression of which could not be quantified in the second testicular RNA pair, are overexpressed in the tumoral testicle compared with the health tissue (cf.: FIG. 4).

The analysis of pairs of samples originating from other tissues (colon, uterus, breast, ovary, lung and prostate) shows that the overexpression phenomenon is restricted to the tumoral testicle. Consequently, the expression of the five identified loci assumes the nature of a marker specific for testicular cancer.

Example 3 Epigenetic Control of Transcription

Principle:

DNA methylation is an epigenetic modification which takes place, in eukaryotics, by the addition of a methyl group to the cytosines of 5′-CpG dinucleotides, and results in transcriptional repression when this modification occurs within the nucleotide sequence of a promoter. Apart from a few exceptions, human endogenous sequences of retroviral origin are restricted, owing to this methylation process, to a silent transcriptional state in the cells of the organism under physiological conditions.

In order to analyze the methylation status of the unique LTR or of the 5′ LTR of the five loci, the “bisulfite sequencing PCR” method was used. This method makes it possible, on the basis of sequencing a representative sample of the population, to identify the methylation state of each CG dinucleotide on each of the sequences within the tissue studied.

Since the methylation information is lost during the amplification steps, it is advisable to translate the methylation information actually within the nucleotide sequence by means of the method of treating the genomic DNA with sodium bisulfite. The action of the bisulfite (sulfonation), followed by hydrolytic deamination and then alkaline desulfonation, in fact makes it possible to modify all the cytosines contained in the genomic DNA, into uracil. The speed of deamination of sulfonated cytosines (C) is, however, much higher than that of the sulfonated 5-methyl-Cs. It is therefore possible, by limiting the reaction time to 16 hours, to convert strictly the non-methylated cytosines to uracil (U), while at the same time preserving the cytosines which have a methyl group. After the sodium bisulfite treatment, the sequence of interest is amplified from the genomic DNA derived from the tumoral testicular section and from that derived from the adjacent healthy testicular section, by polymerase chain reaction (PCR) in two stages. The first PCR enables a specific selection of the sequence of interest, the second, “nested”, PCR makes it possible to amplify this sequence.

Since the DNA sequence had been modified by the bisulfate, the design of the primers took into account the code change (C to U), and the primers were selected so as to hybridize to a region containing no CpG (their methylation state, and therefore their conversion state, being a priori unknown).

The sequences of the primers used are described in Tables 3 to 8 below.

TABLE 3 HW4TT locus Sense primer 5′ → 3′ Antisense primer 5′ → 3′ Amplification (SEQ ID No.:) (SEQ ID No.:) First PCR CCAACATCACTAACACAACCT (26) GGGAGTTAGTAAGGGGTTTG (27) Nested PCR CAACCTATTAAACAAAACTAAATT (28) AGATTTAATAGAGTGAAAATAGAGTTT (29)

TABLE 4 HW2TT locus Sense primer 5′ → 3′ Antisense primer 5′ → 3′ Amplification (SEQ ID No.:) (SEQ ID No.:) First PCR TTATTAGTTTAGGGGATAGTTG (30) ACACAATAAACAACCTACTAAAT (31) Nested PCR GAGGGTAAGTGGTGATAAA (32) AACCTACTAAATCCAAAAAAA (33)

TABLE 5 HW13TT locus Sense primer 5′ → 3′ Antisense primer 5′ → 3′ Amplification (SEQ ID No.:) (SEQ ID No.:) First PCR TAGGATTTTAGGTTTATTGTTA (34) AAAAATAAAATATTAAACC (35) Nested PCR ATATGTGGGAGTGAGAGATA (36) CAACAACAAACAATAATAATAA (37)

TABLE 6 HWXTT locus Sense primer 5′ → 3′ Antisense primer 5′ → 3′ Amplification (SEQ ID No.:) (SEQ ID No.:) First PCR TTGAGTTTTTTTATTGATAGTG (38) TCTAAATCCTATTTTCCTACT (39) Nested PCR GTTTTTTTATTGATAGTGAGAGAT (40) TAACAAACCTTTAATCCAAT (41)

TABLE 7 HW21TT locus Sense primer 5′ → 3′ Antisense primer 5′ → 3′ Amplification (SEQ ID No.:) (SEQ ID No.:) First PCR TTTAGTGAGGATGATGTAATAT (42) CAACTTAATAAAAATAAACCCA (43) Nested PCR ATAATGTTTTAGTAAGTGTTGGAT (44) ACAATTACAAACCTTTAACC (45)

TABLE 8 ERVWE1 locus Sense primer 5′ → 3′ Antisense primer 5′ → 3′ Amplification (SEQ ID No.:) (SEQ ID No.:) First PCR AATTCATTCAACATCCATTC (46) GGTTTAATATTATTTATTATTTTGGA (47) Nested PCR CTCTTACCTTCCTATACTCTCTAAA (48) AGAGTGTAGTTGTAAGATTTAATAGAGT (49)

After extraction on a gel and purification, the amplicons are cloned into plasmids, and the latter are used to transform competent bacteria. About twelve plasmid DNA mini preparations are carried out using the transformed bacteria and the amplicons contained in the plasmids are sequenced. The sequences obtained are then analyzed (cf.: FIGS. 5 to 10).

Results:

The analysis of the 5′ region of the transcripts of the loci identified was carried out by means of the 5′ Race technique. It in particular made it possible to show that the transcription is started at the beginning of the R region of the proviral 5′ LTR. This reflects the existence of a promoter role for the U3 region of the proviral 5′ LTR.

1. Methylation state of the U3 sequences of the 5′ LTR of the HW4TT locus:

The U3 sequence of the 5′ LTR of the HW4TT locus of reference contains 5 CpG sites:

a) in the sample of healthy testicular tissue: out of 12 sequences analyzed, 9 are completely methylated. The other 3 each time exhibit 1 CpG nonmethylated out of the 5 contained in the U3 region. This therefore represents an overall methylation of the U3 region of the 5′ LTR of the HW4TT locus amounting to 95% in the healthy testicular sample;

b) in the sample of tumoral testicular tissue: out of 12 sequences analyzed, 5 (i.e. 41.66% of the sequences) are completely demethylated, 3 sequences have 4 CpGs out of 5 nonmethylated, 2 sequences have 2 CpGs out of 5 nonmethylated, 1 sequence has 1 CpG out of 5 nonmethylated, and 1 sequence remains completely methylated. This therefore represents an overall methylation of the U3 region of the 5′ LTR of the HW4TT locus amounting to 30% in the tumoral testicular sample.

2. Methylation state of the U3 sequences of the 5′ LTR of the HW2TT locus:

The U3 sequence of the 5′ LTR of the HW2TT locus of reference contains 5 CpG sites:

a) in the sample of healthy testicular tissue: out of 12 sequences analyzed, 9 are completely methylated, 1 has its 2nd CpG nonmethylated, 1 has the CpG at position 4 nonmethylated, 1 has the CpGs at positions 4 and 5 nonmethylated, and 3 sequences have point mutations on one or two CpGs (one in position 3, one in position 5 and one in positions 4 and 5), very probably reflecting PCR artifacts. This therefore represents an overall methylation of the U3 region of the 5′ LTR of the HW2TT locus amounting to 92.9% in the healthy testicular sample;

b) in the sample of tumoral testicular tissue: out of 12 sequences analyzed, 6 are completely demethylated, 5 sequences have one or two methylated CpG(s) (1 at position 1, 1 other at position 5, 1 on positions 1 and 5, 2 at positions 4 and 5 and 1 at position 3). Finally, one sequence has 4 CpGs methylated out of 5 (positions 1, 2, 4 and 5). This corresponds to an overall methylation of the U3 region of the 5′ LTR of the HW2TT locus amounting to 20% in the tumoral testicular sample.

3. Methylation state of the U3 sequences of the 5′ LTR of the HW13TT locus:

The U3 sequence of the 5′ LTR of the HW13TT locus of reference contains 3 CpG sites:

a) in the sample of healthy testicular tissue: an additional CpG, compared with the reference sequence, is found in 4 of the 10 clones studied for this locus. It is located between CpGs 2 and 3 and is methylated. In the other 6 clones, this site is mutated compared with the reference sequence. The other 3 CpGs of the U3 region are methylated in the 10 sequences analyzed. This therefore represents an overall methylation of the U3 region of the 5′ LTR of the HW13TT locus amounting to 100% in the healthy testicular sample;

b) in the sample of tumoral testicular tissue: the additional CpG indicated above is also found. It is demethylated in 4 of the 10 sequences analyzed, mutated in 3 other sequences, and its methylation state is indeterminate in the last 3 sequences. 7 sequences out of 10 are completely demethylated and the other 3 are methylated on the 2nd and on the 3rd CpG. This corresponds to an overall methylation of the U3 region of the 5′ LTR of the HW13TT locus amounting to 20% in the tumoral testicular sample.

4. Methylation state of the U3 sequences of the solitary LTR of the HWXTT locus:

The U3 sequence of the 5′ LTR of the HWXTT locus of reference contains 6 CpG sites:

a) in the sample of healthy testicular tissue: the 8 sequences analyzed are completely methylated, which corresponds to a methylation percentage of 100% in the healthy testicular sample;

b) in the sample of tumoral testicular tissue: the 9 sequences analyzed are completely demethylated, which corresponds to a methylation percentage of 0%.

5. Methylation state of the U3 sequences of the 5′ LTR of the HW21TT locus:

The U3 sequence of the 5′ LTR of the HW21TT locus of reference contains 7 CpG sites:

a) in the sample of healthy testicular tissue: the 10 sequences analyzed all have 6 CpGs methylated out of 7; for 6 of the sequences, the 1st CpG is nonmethylated and for the other 4 sequences, the 4th CpG is nonmethylated. This therefore represents an overall methylation of the U3 region of the 5′ LTR of the HW21TT locus amounting to 85.7% in the healthy testicular sample;

b) in the sample of tumoral testicular tissue: out of 8 sequences analyzed, 6 are completely demethylated, 2 others exhibit a profile identical to one of those found in the healthy testicular tissue, namely 6 CpGs methylated and the 1st CpG nonmethylated. This corresponds to an overall methylation of the U3 region of the 5′ LTR of the HW21TT locus amounting to 21.4% in the tumoral testicular sample.

6. Methylation state of the sequences of the activator of the U3 of the 5′ LTR of the ERVWE1 locus:

The ERVWE1 locus comprises, in addition to its U3 promoter region, a known activator located directly upstream of the 5′ LTR, and which contains two CpG sites (CpG 1 and 2). The U3 sequence of the 5′ LTR of the ERVWE1 locus of reference contains, for its part, 5 CpG sites (CpGs 3 to 7):

a) in the sample of healthy testicular tissue: out of 10 sequences analyzed, 5 sequences have CpGs 1 and 2 (activator) and 5 (U3) nonmethylated, 1 sequence has CpGs 2 and 5 nonmethylated, 2 sequences have CpGs 1 (activator) and 7 (U3) nonmethylated, 1 sequence has CpG 7 only nonmethylated and, finally, 1 is completely methylated for the 7 CpGs. In total, this corresponds to a methylation percentage of 68.57% in the healthy testicular sample;

b) in the sample of tumoral testicular tissue: out of the 10 sequences analyzed, only 3 sequences exhibit, for each one, a unique methylated CpG (CpG 4 or CpG5 or CpG6), the other 7 sequences are completely demethylated, which corresponds to a methylation percentage of 4.29%.

The very high level of methylation of the U3 retroviral promoters of the loci considered, in the healthy tissue, indicates a repression of the transcriptional expression by an epigenetic mechanism. On the other hand, the low level of methylation of these same promoters in the tumoral tissue reflects a lifting of transcriptional inhibition, the result of which is the significantly higher expression demonstrated by means of the high-density HERV DNA chip and by means of the real-time RT-PCR. Thus, the U3 retroviral promoters of the loci considered appear to be specific markers for the tumoral nature of the testicle.

LITERATURE REFERENCES

[1] Nickerson D. A. et al., DNA sequence diversity in a 9.7-kb region of the human lipoprotein lipase gene, Nature Genetics, Vol. 19, pp 233-240 (1998).
[2] Cottrell S. E., Molecular diagnostic applications of DNA methylation technology, Clinical Biochemistry 37, pp 595-604 (2004).

Claims

1. A method for in vitro diagnosis of testicular cancer, comprising:

obtaining a biological sample from a patient suspected of having testicular cancer;
performing an assay to determine the methylation status of CpG dinucleotides in a genomic DNA target sequence, the DNA target sequence being at least one sequence selected from the group consisting of sequences having at least 99% sequence identity with the full-length sequence of SEQ ID NO: 6 or 7 and the sequences fully complementary thereto; and
diagnosing the patient with testicular cancer when the DNA target sequence is hypomethylated as compared to a methylation status indicative of the absence of testicular cancer,
wherein the assay comprises:
extracting genomic DNA from the biological sample;
treating the extracted genomic DNA to convert cytosine bases of CpG dinucleotides that are nonmethylated at position 5 into uracil bases;
amplifying the treated genomic DNA target sequence; and
determining the methylation status of the CpG dinucleotides in the genomic DNA target sequence from the amplified genomic DNA target sequence.

2. The method of claim 1, wherein the extracted genomic DNA is treated using hydrogen sulfite, disulfite, bisulfite, or a combination thereof.

3. The method of claim 1, wherein the treated genomic DNA target sequence is amplified using at least one primer comprising a sequence selected from the group consisting of the full-length sequences of SEQ ID NOS: 46-49.

4. The method of claim 1, wherein the biological sample is a testicular tissue extract or a biological fluid.

5. The method of claim 1, wherein the biological sample is blood, serum, plasma, urine, or seminal fluid.

6. The method of claim 1, wherein the DNA target sequence is hypomethylated if 60% or less of the CpG dinucleotides are methylated.

7. The method of claim 1, wherein the DNA target sequence is hypomethylated if 30% or less of the CpG dinucleotides are methylated.

8. A method for in vitro diagnosis of testicular cancer, comprising:

obtaining a biological sample from a patient suspected of having testicular cancer;
performing an assay to determine the methylation status of CpG dinucleotides in a genomic DNA target sequence, the DNA target sequence being the 5′ LTR U3 promoter sequence of the ERVWE1 locus, optionally further including an activator sequence directly upstream of the 5′ LTR U3 promoter sequence; and
diagnosing the patient with testicular cancer when the DNA target sequence is hypomethylated as compared to a methylation status indicative of the absence of testicular cancer,
wherein the assay comprises:
extracting genomic DNA from the biological sample;
treating the extracted genomic DNA to convert cytosine bases of CpG dinucleotides that are nonmethylated at position 5 into uracil bases;
amplifying the treated genomic DNA target sequence; and
determining the methylation status of the CpG dinucleotides in the genomic DNA target sequence from the amplified genomic DNA target sequence.

9. The method of claim 8, wherein the extracted genomic DNA is treated using hydrogen sulfite, disulfite, bisulfite, or a combination thereof.

10. The method of claim 8, wherein the treated genomic DNA target sequence is amplified using at least one primer comprising a sequence selected from the group consisting of the full-length sequences of SEQ ID NOS: 46-49.

11. The method of claim 8, wherein the biological sample is a testicular tissue extract or a biological fluid.

12. The method of claim 8, wherein the biological sample is blood, serum, plasma, urine, or seminal fluid.

13. The method of claim 8, wherein the DNA target sequence is hypomethylated if 60% or less of the CpG dinucleotides are methylated.

14. The method of claim 8, wherein the DNA target sequence is hypomethylated if 30% or less of the CpG dinucleotides are methylated.

Patent History
Publication number: 20140349875
Type: Application
Filed: Jul 14, 2014
Publication Date: Nov 27, 2014
Inventors: Juliette GIMENEZ (Caluire et Cuire), Cecile MONTGIRAUD (Lyon), Francois MALLET (Villeurbanne)
Application Number: 14/330,535