Compositions and Methods for the Therapy and Diagnosis of Influenza

The present invention provides compositions, vaccines, and methods for diagnosing, treating, and preventing influenza infection using a combination of antibodies raised against the influenza hemagglutinin and the matrix 2 ectodomain polypeptides.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History

This application is a continuation of U.S. Ser. No. 13/372,870, filed Feb. 14, 2012, which claims the benefit of provisional application U.S. Ser. No. 61/442,733, filed Feb. 14, 2011, the contents of which are herein incorporated by reference in their entirety.


The contents of the text file named “THER018C01US_SeqList.txt,” which was created on Dec. 22, 2014 and is 909 KB in size, are hereby incorporated by reference in their entirety.


The present invention relates generally to prevention, diagnosis, therapy and monitoring of influenza infection. The invention is more specifically related to compositions containing a combination of human antibodies raised against either the influenza hemagglutinin or matrix 2 protein. Such compositions are useful in pharmaceutical compositions for the prevention and treatment of influenza, and for the diagnosis and monitoring of influenza infection.


Influenza virus infects 5-20% of the population and results in 30,000-50,000 deaths each year in the U.S. Disease caused by influenza A viral infections is typified by its cyclical nature. Antigenic drift and shift allow for different A strains to emerge every year. Added to that, the threat of highly pathogenic strains entering into the general population has stressed the need for novel therapies for flu infections.


The invention provides diagnostic, prophylactic, and therapeutic compositions including a human antibody raised against the Influenza hemagglutinin protein and a human monoclonal antibody raised against the Influenza M2 protein. Moreover, the invention provides diagnostic, prophylactic, and therapeutic compositions including an isolated human antibody raised against an epitope of the Influenza hemagglutinin protein and an isolated human monoclonal antibody raised against an epitope of the Influenza M2 protein. Furthermore, these compositions are pharmaceutical compositions that include a pharmaceutical carrier. These compositions address a long-felt need in the art for pharmaceutical compositions that both strongly neutralizes Influenza virus infection and recognizes constant regions within proteins common to all Influenza strains.

Specifically, the invention provides a composition including: (a) an isolated human antibody that specifically binds to an epitope of the hemagglutinin (HA) glycoprotein of an influenza virus; and (b) an isolated human monoclonal antibody that specifically binds to an epitope in the extracellular domain of the matrix 2 ectodomain (M2e) polypeptide of an influenza virus. In certain embodiments of this composition, the isolated human monoclonal antibody that specifically binds an epitope of the M2e polypeptide is TCN-032 (8I10), 21B15, TCN-031 (23K12), 3241_G23, 3244_I10, 3243_J07, 3259_J21, 3245_O19, 3244_H04, 3136_G05, 3252_C13, 3255_J06, 3420_I23, 3139_P23, 3248_P18, 3253_P10, 3260_D19, 3362_B11, or 3242_P05. Moreover, the isolated human antibody that specifically binds an epitope of the HA glycoprotein is optionally TCN-522 (3212_I12), TCN-521 (3280_D18), TCN-523 (5248_A17), TCN-563 (5237_B21), TCN-526 (5084_C17), TCN-527 (5086_C06), TCN-528 (5087_P17), TCN-529 (5297_H01), TCN-530 (5248_H10), TCN-531 (5091_H13), TCN-532 (5262_H18), TCN-533 (5256_A17), TCN-534 (5249_B02), TCN-535 (5246_P19), TCN-536 (5095_N01), TCN-537 (3194_D21), TCN-538 (3206_O17), TCN-539 (5056_A08), TCN-540 (5060_F05), TCN-541 (5062_M11), TCN-542 (5079_A16), TCN-543 (5081_G23), TCN-544 (5082_A19), TCN-545 (5082_I15), TCN-546 (5089_L08), TCN-547 (5092_F11), TCN-548 (5092_P01), TCN-549 (5092_P04), TCN-550 (5096_F06), TCN-551 (5243_D01), TCN-552 (5249_I23), TCN-553 (5261_C18), TCN-554 (5277_M05), TCN-555 (5246_L16), TCN-556 (5089_K12), TCN-557 (5081_A04), TCN 558 (5248_H10b), TCN-559 (5097_G08), TCN-560 (5084_P10), TCN-504 (3251_K17), SC06-141, SC06-255, SC06-257, SC06-260, SC06-261, SC06-262, SC06-268, SC06-272, SC06-296, SC06-301, SC06-307, SC06-310, SC06-314, SC06-323, SC06-325, SC06-327, SC06-328, SC06-329, SC06-331, SC06-332, SC06-334, SC06-336, SC06-339, SC06-342, SC06-343, SC06-344, CR6141, CR6255, CR6257, CR6260, CR6261, CR6262, CR6268, CR6272, CR6296, CR6301, CR6307, CR6310, CR6314, CR6323, CR6325, CR6327, CR6328, CR6329, CR6331, CR6332, CR6334, CR6336, CR6339, CR6342, CR6343, CR6344, 2A, D7, D8, F10, G17, H40, A66, D80, E88, E90, or H98.

The epitope of the HA glycoprotein is optionally GVTNKVNSIIDK (SEQ ID NO: 198), GVTNKVNSIINK (SEQ ID NO: 283), GVTNKENSIIDK (SEQ ID NO: 202), GVTNKVNRIIDK (SEQ ID NO: 201), GITNKVNSVIEK (SEQ ID NO: 281), GITNKENSVIEK (SEQ ID NO: 257), GITNKVNSIIDK (SEQ ID NO: 225), and KITSKVNNIVDK (SEQ ID NO: 216). The influenza hemaglutinin (HA) glycoprotein includes an HA1 and HA2 subunit. Exemplary epitopes of the HA glycoprotein include the HA1 subunit, HA2 subunit, or both the HA1 and HA2 subunits. Alternatively, or in addition, the epitope of the M2e polypeptide is a discontinuous epitope. For example, the epitope of the M2e polypeptide includes the amino acid at positions 2, 5, and 6 of MSLLTEVETPTRNEWGCRCNDSSD (SEQ ID NO: 1) or the amino acid at positions 2, 5, and 6 of SLLTEV (SEQ ID NO: 42).

The invention further provides a composition including: (a) an isolated human anti-HA antibody, or an antigen-binding fragment thereof, including a heavy chain variable region (VH) domain and a light chain variable (VL) domain, wherein the VH domain and the VL domain each contain three complementarity determining regions 1 to 3 (CDR1-3), and wherein each CDR includes the following amino acid sequences: VH CDR1: SEQ ID NOs: 247, 571, 586, 597, 603, 609, 615, 627, 633, 637, 643, 649, 658, 664, 670, 303, 251, 242, or 222; VH CDR2: SEQ ID NOs: 248, 572, 587, 592, 598, 604, 610, 616, 628, 634, 638, 644, 650, 655, 659, 665, 671, 306, 249, 307, or 221; VH CDR3: SEQ ID NOs: 568, 573, 588, 593, 599, 605, 611, 617, 629, 635, 639, 645, 651, 656, 660, 666, 672, 725, 246, 290, or 220; VL CDR1: SEQ ID NOs: 569, 574, 577, 580, 583, 589, 594, 612, 618, 621, 624, 640, 646, 652, 661, 667, 285, 289, 245, 224, or 219; VL CDR2: SEQ ID NOs: 570, 575, 578, 581, 584, 590, 595, 601, 607, 613, 619, 622, 625, 631, 653, 662, 668, 305, 223, or 231; VL CDR3: SEQ ID NOs: 289, 576, 579, 582, 585, 591, 596, 602, 608, 614, 620, 623, 626, 632, 636, 642, 648, 654, 657, 663, 669, 308, 250, 227, or 280; and (b) an isolated anti-matrix 2 ectodomain (M2e) antibody, or antigen-binding fragment thereof, including a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain and the VL domain each contain three complementarity determining regions 1 to 3 (CDR1-3), and wherein each CDR includes the following amino acid sequences: VH CDR1: SEQ ID NOs: 72, 103, 179, 187, 203, 211, 228, 252, 260, 268, 284, 293, or 301; VH CDR2: SEQ ID NOs: 74, 105, 180, 188, 204, 212, 229, 237, 253, 261, 269, 285, or 294; VH CDR3 SEQ ID NOs: 76, 107, 181, 189, 197, 205, 213, 230, 238, 254, 262, 270, 286, or 295; VL CDR1: SEQ ID NOs: 59, 92, 184, 192, 208, 192, 233, 241, 265, or 273; VL CDR2: SEQ ID NOs: 61, 94, 185, 193, 209, 217, 226, 234, 258, 274, or 282; and VL CDR3: SEQ ID NOs: 63, 96, 186, 194, 210, 218, 243, 259, 267, 275, 291, or 300.

Alternatively, or in addition, the invention provides a composition including: (a) an isolated human anti-HA antibody, or an antigen-binding fragment thereof, including a heavy chain variable region (VH) domain and a light chain variable (VL) domain, wherein the VH domain and the VL domain each contain three complementarity determining regions 1 to 3 (CDR1-3), and wherein each CDR includes the following amino acid sequences: VH CDR1: SEQ ID NOs: 247, 571, 586, 597, 603, 609, 615, 627, 633, 637, 643, 649, 658, 664, 670, 303, 251, 242, or 222; VH CDR2: SEQ ID NOs: 248, 572, 587, 592, 598, 604, 610, 616, 628, 634, 638, 644, 650, 655, 659, 665, 671, 306, 249, 307, or 221; VH CDR3: SEQ ID NOs: 568, 573, 588, 593, 599, 605, 611, 617, 629, 635, 639, 645, 651, 656, 660, 666, 672, 725, 246, 290, or 220; VL CDR1: SEQ ID NOs: 569, 574, 577, 580, 583, 589, 594, 612, 618, 621, 624, 640, 646, 652, 661, 667, 285, 289, 245, 224, or 219; VL CDR2: SEQ ID NOs: 570, 575, 578, 581, 584, 590, 595, 601, 607, 613, 619, 622, 625, 631, 653, 662, 668, 305, 223, or 231; VL CDR3: SEQ ID NOs: 289, 576, 579, 582, 585, 591, 596, 602, 608, 614, 620, 623, 626, 632, 636, 642, 648, 654, 657, 663, 669, 308, 250, 227, or 280; and (b) an isolated anti-matrix 2 ectodomain (M2e) antibody, or antigen-binding fragment thereof, including a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain and the VL domain each contain three complementarity determining regions 1 to 3 (CDR1-3), and wherein each CDR includes the following amino acid sequences: VH CDR1: SEQ ID NOs: 109, 112, 182, 190, 206, 214, 239, 255, 263, 271, 287, 296, or 304; VH CDR2: SEQ ID NOs: 110, 113, 183, 191, 207, 215, 232, 240, 256, 264, 272, 288, or 297; VH CDR3 SEQ ID NOs: 76, 107, 181, 189, 197, 205, 213, 230, 238, 254, 262, 270, 286, or 295; VL CDR1: SEQ ID NOs: 59, 92, 184, 192, 208, 192, 233, 241, 265, or 273; VL CDR2: SEQ ID NOs: 61, 94, 185, 193, 209, 217, 226, 234, 258, 274, or 282; and VL CDR3: SEQ ID NOs: 63, 96, 186, 194, 210, 218, 243, 259, 267, 275, 291, or 300.

The invention provides a composition including: (a) an isolated human anti-HA antibody, or an antigen-binding fragment thereof, including a heavy chain variable region (VH) domain, wherein the VH domain includes the following amino acid sequences: SEQ ID NOs 309, 313, 317, 321, 325, 329, 333, 337, 341, 345, 349, 353, 357, 361, 365, 369, 373, 377, 381, 385, 389, 393, 397, 401, 405, 409, 199, 417, 423, 429, 435, 441, 447, 453, 459, 465, 471, 477, 483, 489, 495, 501, 507, 513, 519, 525, 531, 537, 543, 550, 556, or 562, and a light chain variable (VL) domain, wherein the VL domain includes the following amino acid sequences: SEQ ID NOs 310, 314, 318, 322, 326, 330, 334, 338, 342, 346, 350, 354, 358, 362, 366, 370, 374, 378, 382, 386, 390, 394, 398, 402, 406, 410, 414, 420, 426, 432, 438, 444, 450, 456, 462, 468, 474, 480, 486, 492, 498, 504, 510, 516, 522, 528, 534, 540, 547, 553, 559, or 565; and (b) an isolated anti-matrix 2 ectodomain (M2e) antibody, or antigen-binding fragment thereof, including a heavy chain variable (VH) domain, wherein the VH domain includes the following amino acid sequences: SEQ ID NOs 44, 277, 276, 50, 236, 235, 116, 120, 124, 128, 132, 136, 140, 144, 148, 152, 156, 160, 164, 168, 172, or 176, and a light chain variable (VL) domain, wherein the VL domain includes the following amino acid sequences: SEQ ID NOs 46, 292, 52, 118, 122, 126, 130, 134, 138, 142, 146, 150, 154, 158, 162, 166, 170, or 178.

Furthermore, the invention provides a multivalent vaccine composition including any of the compositions described herein containing an isolated human anti-HA antibody, or an antigen-binding fragment thereof and an isolated anti-matrix 2 ectodomain (M2e) antibody, or antigen-binding fragment thereof. Alternatively, the multivalent vaccine includes antibodies that bind to the epitopes to which the antibodies of the invention bind. Exemplary antibodies of the invention include, but are not limited to, TCN-032 (8I10), 21B15, TCN-031 (23K12), 3241_G23, 3244_I10, 3243_J07, 3259_J21, 3245_O19, 3244_H04, 3136_G05, 3252_C13, 3255_J06, 3420_I23, 3139_P23, 3248_P18, 3253_P10, 3260_D19, 3362_B11, 3242_P05, TCN-522 (3212_I12), TCN-521 (3280_D18), TCN-523 (5248_A17), TCN-563 (5237_B21), TCN-526 (5084_C17), TCN-527 (5086_C06), TCN-528 (5087_P17), TCN-529 (5297_H01), TCN-530 (5248_H10), TCN-531 (5091_H13), TCN-532 (5262_H18), TCN-533 (5256_A17), TCN-534 (5249_B02), TCN-535 (5246_P19), TCN-536 (5095_N01), TCN-537 (3194_D21), TCN-538 (3206_O17), TCN-539 (5056_A08), TCN-540 (5060_F05), TCN-541 (5062_M11), TCN-542 (5079_A16), TCN-543 (5081_G23), TCN-544 (5082_A19), TCN-545 (5082_I15), TCN-546 (5089_L08), TCN-547 (5092_F11), TCN-548 (5092_P01), TCN-549 (5092_P04), TCN-550 (5096_F06), TCN-551 (5243_D01), TCN-552 (5249_I23), TCN-553 (5261_C18), TCN-554 (5277_M05), TCN-555 (5246_L16), TCN-556 (5089_K12), TCN-557 (5081_A04), TCN 558 (5248_H10b), TCN-559 (5097_G08), TCN-560 (5084_P10), TCN-504 (3251_K17), SC06-141, SC06-255, SC06-257, SC06-260, SC06-261, SC06-262, SC06-268, SC06-272, SC06-296, SC06-301, SC06-307, SC06-310, SC06-314, SC06-323, SC06-325, SC06-327, SC06-328, SC06-329, SC06-331, SC06-332, SC06-334, SC06-336, SC06-339, SC06-342, SC06-343, SC06-344, CR6141, CR6255, CR6257, CR6260, CR6261, CR6262, CR6268, CR6272, CR6296, CR6301, CR6307, CR6310, CR6314, CR6323, CR6325, CR6327, CR6328, CR6329, CR6331, CR6332, CR6334, CR6336, CR6339, CR6342, CR6343, CR6344, D7, D8, F10, G17, H40, A66, D80, E88, E90, and H98. For example, the multivalent vaccine may include one or more of the following epitopes: GVTNKVNSIIDK (SEQ ID NO: 198), GVTNKVNSIINK (SEQ ID NO: 283), GVTNKENSIIDK (SEQ ID NO: 202), GVTNKVNRIIDK (SEQ ID NO: 201), GITNKVNSVIEK (SEQ ID NO: 281), GITNKENSVIEK (SEQ ID NO: 257), GITNKVNSIIDK (SEQ ID NO: 225), KITSKVNNIVDK (SEQ ID NO: 216), MSLLTEVETPTRNEWGCRCNDSSD (SEQ ID NO: 1), and MSLLTEVETPTRNEWGCRCNDSSD (SEQ ID NO: 1) provided in its native conformation.

The multivalent vaccine also includes a composition including: (a) a human antibody that specifically binds to an epitope of the hemagglutinin (HA) glycoprotein of an influenza virus; and (b) a human monoclonal antibody that specifically binds to an epitope in the extracellular domain of the matrix 2 ectodomain (M2e) polypeptide of an influenza virus.

The invention provides a pharmaceutical composition including any one of the compositions described herein. Moreover, the pharmaceutical composition includes a pharmaceutical carrier.

The invention provides a method for stimulating an immune response in a subject, including administering to the subject the pharmaceutical composition described herein. The pharmaceutical composition may administered prior to or after exposure of the subject to an Influenza virus.

The invention also provides a method for the treatment of an influenza virus infection in a subject in need thereof, including administering to the subject the pharmaceutical composition described herein. The subjection may have been exposed to an influenza virus. Alternatively, or in addition, the subject has not been diagnosed with an influenza infection. The pharmaceutical composition may administered prior to or after exposure of the subject to an Influenza virus. Preferably, the pharmaceutical composition is administered at a dose sufficient to promote viral clearance or eliminate influenza infected cells.

The invention further provides a method for the prevention of an influenza virus infection in a subject in need thereof, including administering to the subject a vaccine composition described herein, prior to exposure of the subject to an influenza virus. In certain embodiments of this method, the subject is at risk of contracting an influenza infection. The pharmaceutical composition may administered prior to or after exposure of the subject to an Influenza virus. Preferably, the pharmaceutical composition is administered at a dose sufficient to promote viral clearance or eliminate influenza infected cells.

The treatment and prevention methods provided by the invention further include administering an anti-viral drug, a viral entry inhibitor or a viral attachment inhibitor. Exemplary anti-viral drugs include, but are not limited to, a neuraminidase inhibitor, a HA inhibitor, a sialic acid inhibitor, or an M2 ion channel inhibitor. In certain aspects of these methods, the M2 ion channel inhibitor is amantadine or rimantadine. In other aspects of these methods, the neuraminidase inhibitor is zanamivir or oseltamivir phosphate. The antiviral drug may administered prior to or after exposure of the subject to an Influenza virus.

The treatment and prevention methods provided by the invention further include administering a second anti-Influenza A antibody. The second antibody is optionally an antibody described herein. The second antibody may administered prior to or after exposure of the subject to an Influenza virus.

The invention provides a method for determining the presence of an Influenza virus infection in a subject, including the steps of: (a) contacting a biological sample obtained from the subject with any one of the antibodies or pharmaceutical compositions described herein; (b) detecting an amount of the antibody that binds to the biological sample; and (c) comparing the amount of antibody that binds to the biological sample to a control value, and therefrom determining the presence of the Influenza virus in the subject. Optionally, the control value is determined by contacting a control sample obtained from the subject with any one of the antibodies or pharmaceutical compositions described herein and detecting an amount of the antibody that binds to the control sample.

The invention also provides a diagnostic kit including any one of the antibodies, compositions, or pharmaceutical compositions described herein.

The invention further provides a prophylactic kit including a vaccine composition described herein. Preferably, the vaccine is a multivalent vaccine. The term “multivalent vaccine” describes a single vaccine that elicits an immune response either to more than one infectious agent, e.g. the influenza HA glycoprotein and the influenza M2e polypeptide, or to several different epitopes of a molecule, e.g. HA epitopes shown in SEQ ID NOs 198, 283, 202, 201, 281, 257, 225, and 216. Alternatively, or in addition, the term multivalent vaccine is meant to describe the administration of a combination of human antibodies raised against more than one infectious agent, e.g. the influenza HA glycoprotein and the influenza M2e polypeptide.

Other features and advantages of the invention will be apparent from and are encompassed by the following detailed description and claims.


FIG. 1 shows the binding of three antibodies of the present invention and control hu14C2 antibody to 293-HEK cells transfected with an M2 expression construct or control vector, in the presence or absence of free M2 peptide.

FIGS. 2A and B are graphs showing human monoclonal antibody binding to influenza A/Puerto Rico/8/32.

FIG. 3A is a chart showing amino acid sequences of extracellular domains of M2 variants (SEQ ID NOS 1-3, 679 & 5-40, respectively, in order of appearance).

FIGS. 3B and C are bar charts showing binding of human monoclonal anti-influenza antibody binding to M2 variants shown in FIG. 3A.

FIGS. 4A and B are bar charts showing binding of human monoclonal anti-influenza antibody binding to M2 peptides subjected to alanine scanning mutagenesis.

FIG. 5 is a series of bar charts showing binding of MAbs 8i10 and 23K12 to M2 protein representing influenza strain A/HK/483/1997 sequence that was stably expressed in the CHO cell line DG44.

FIG. 6A is a chart showing cross reactivity binding of anti-M2 antibodies to variant M2 peptides (SEQ ID NOS 680-704, respectively, in order of appearance).

FIG. 6B is a chart showing binding activity of M2 antibodies to truncated M2 peptides (SEQ ID NOS 680, 705-724 &19, respectively, in order of appearance).

FIG. 7 is a graph showing survival of influenza infected mice treated with human anti-influenza monoclonal antibodies.

FIG. 8 is an illustration showing the anti-M2 antibodies bind a highly conserved region in the N-Terminus of M2e (SEQ ID NO: 19).

FIG. 9 is a graph showing anti-M2 rHMAb clones from crude supernatant bound to influenza on ELISA, whereas the control anti-M2e mAb 14C2 did not readily bind virus.

FIG. 10 is a series of photographs showing anti-M2 rHMAbs bound to cells infected with influenza. MDCK cells were or were not infected with influenza A/PR/8/32 and Ab binding from crude supernatant was tested 24 hours later. Data were gathered from the FMAT plate scanner.

FIG. 11 is a graph showing anti-M2 rHMAb clones from crude supernatant bound to cells transfected with the influenza subtypes H3N2, HK483, and VN1203 M2 proteins. Plasmids encoding full length M2 cDNAs corresponding to influenza strains H3N2, HK483, and VN1203, as well as a mock plasmid control, were transiently transfected into 293 cells. The 14C2, 8i10, 23K12, and 21B15 mABs were tested for binding to the transfectants, and were detected with an AF647-conjugated anti-human IgG secondary antibody. Shown are the mean fluorescence intensities of the specific mAB bound after FACS analysis.

FIGS. 12A-B are amino acid sequences of the variable regions of anti-M2e mAbs. Framework regions 1-4 (FR 1-4) and complementarity determining regions 1-3 (CDR 1-3) for VH and Vk are shown. FR, CDR, and gene names are defined using the nomenclature in the IMGT database (IMGT®, the International ImMunoGeneTics Information System®). Grey boxes denote identity with the germline sequence which is shown in light blue boxes, hyphens denote gaps, and white boxes are amino acid replacement mutations from the germline.

FIG. 13 is a graph depicting the results of a competition binding analysis of a panel of anti-M2e mAbs with TCN-032 Fab. The indicated anti-M2e mAbs were used to bind to the stable CHO transfectant expressing M2 of A/Hong Kong/483/97 that had previously been treated with or without 10 μg/mL TCN-032 Fab fragment. The anti-M2e mAb bound to the cell surface was detected with goat anti-huIgG FcAlexafluor488 FACS and analyzed by flow cytometry. The results are derived from one experiment.

FIG. 14A is a graph depicting the ability of anti-M2e mAbs TCN-032 and TCN-031 to bind virus particles and virus-infected cells but not M2e-derived synthetic peptide. Purified influenza virus (A/Puerto Rico/8/34) was coated at 10 μg/ml on ELISA wells and binding of anti-M2e mAbs TCN-031, TCN-032, ch14C2, and the HCMV mAbs 2N9 was evaluated using HRP-labeled goat anti-human Fc. Results shown are representative of 3 experiments.

FIG. 14B is a graph depicting the ability of anti-M2e mAbs TCN-032 and TCN-031 to bind virus particles and virus-infected cells but not M2e-derived synthetic peptide. 23mer synthetic peptide of M2 derived from A/Fort Worth/1/50 was coated at 1 μg/ml on ELISA wells and binding of mAbs TCN-031, TCN-032, ch14C2, and 2N9 were evaluated as in panel a. Results shown are representative of 3 experiments.

FIG. 14C is a graph depicting the ability of anti-M2e mAbs TCN-032 and TCN-031 to bind virus particles and virus-infected cells but not M2e-derived synthetic peptide. MDCK cells were infected with A/Puerto Rico/8/34 (PR8) and subsequently stained with mAbs TCN-031, TCN-032, ch14C2 and the HCMV mAb 5J12. Binding of antibodies was detected using Alexafluor 647-conjugated goat anti-Human IgG H&L antibody and quantified by flow cytometry. Results shown are representative of 3 experiments.

FIG. 14D is a series of photographs depicting HEK 293 cells stably transfected with the M2 ectodomain of A/Fort Worth/1/50 (D20) were stained with transient transfection supernatant containing mAbs TCN-031, TCN-032, or the control ch14C2 and analyzed by FMAT for binding to M2 in the presence or absence of 5 ug/ml M2e peptide. Mock transfected cells are 293 cells stably transfected with vector alone. Results shown are representative of one experiment.

FIGS. 15A-D are graphs depicting the Therapeutic efficacy of anti-M2 mAbs TCN-031 and TCN-032 in mice. Mice (n=10) were infected by intranasal inoculation with 5×LD50 A/Vietnam/1203/04 (H5N1) (panels A-B) or (n=5) with 5×LD50 A/Puerto Rico 8/34 (H1N1) (panels C-D), followed by 3 intraperitoneal (ip) injections with mAbs at 24, 72, and 120 hours post-infection (a total of 3 mAb injections per mouse) and weighed daily for 14 days. Percentage survival is shown in a and c, whereas percent weight change of mice is shown in B and D. The results shown for the treatment study of mice infected with A/Vietnam/1203/04 (H5N1) are representative of 2 experiments.

FIG. 16 is a series of graphs depicting the viral titers in lung, liver, and brain of mice treated with anti-M2e mAbs TCN-031 and TCN-032 after challenge with H5N1 A/Vietnam/1203/04. BALB/C mice (n=19) were treated i.p. injection of a 400 μg/200 μL dose of TCN-031, TCN-032, control human mAb 2N9, control chimeric mAb ch14C2, PBS, or left untreated. Tissue viral titers were determined from 3 mice per group at 3 and 6 days post-infection in the lungs (as an indicator of local replication) and in liver and brain (as an indicator of the systemic spread which is characteristic of H5N1 infection).

FIG. 17 is a graph depicting the ability of TCN-031 and TCN-032 can potentiate cytolysis by NK cells. MDCK cells were infected with A/Solomon Island/3/2006 (H1N1) virus, and were treated with mAbs TCN-031, TCN-032, or the subclass-matched negative control mAb 2N9. The cells were then challenged with purified human NK cells, and the lactate dehydrogenase released as a result of cell lysis was measured through light absorbance. The results are representative of two separate experiments with two different normal human donors.

FIG. 18 is a graph depicting complement-dependent cytolysis (CDC) of M2-expressing cells bound with anti-M2 mAb. The stable transfectant expressing M2 of A/Hong Kong/483/97 and a mock control were treated with the indicated mAbs and subsequently challenged with human complement. Lysed cells were visualized by Propidium Iodide staining followed by FACS analysis. The data are representative of two experiments.

FIGS. 19A-C are graphs depicting binding of anti-M2e mAbs TCN-031 and TCN-032 to M2 mutants indicates the epitope is located in the highly conserved N-terminal of M2e. Mutants with alanine substituted at each position of the M2 ectodomain of A/Fort Worth/1/50 (D20) (A) or forty wild-type M2 mutants including A/Vietnam/1203/04 (VN) and A/Hong Kong/483/97 (HK) (B) were transiently transfected into 293 cells. The identity of each wild-type M2 mutant is listed in Table 6. Transfected cells were stained with mAbs TCN-031, TCN-032, or the control ch14C2 and analyzed by FACS for binding to M2 at 24 hours post-transfection. mAbs TCN-031 and TCN-032 do not bind variants with amino acid substitutions at positions 1, 4, or 5 of M2e. (C) The deduced epitope for TCN-031 and TCN-032 occurs in a highly conserved region of M2e and is distinct from that found for ch14C2. Results shown for (A) and (B) are representative of 3 experiments.

FIG. 20 is a graph depicting mAbs TCN-031 and TCN-032 recognize the same region on M2e. The CHO transfectant stably expressing M2 for A/Hong Kong/483/97 as stained with 10 μg/mL TCN-031, TCN-032, or 2N9, followed by detection with Alexafluor647-labeled TCN-031 (TCN-031AF647) or TCN-032 (TCN-032AF647) and analysis by flow cytometry. The results are representative of three experiments.

FIG. 21 is a graph depicting anti-M2e mAbs TCN-031 and TCN-032 bind cells that have been infected with H1N1 A/California/4/09. MDCK cells were infected with Influenza A strain H1N1 A/Memphis/14/96, H1N1 A/California/4/09, or mock infected. Twenty four hours post-infection cells were stained with mAbs TCN-031, TCN-032, or the control ch14C2 and analyzed by FACS for binding to M2. Results shown are for one experiment.


Influenza viruses consist of three types, A, B and C. Influenza A viruses infect a wide variety of birds and mammals, including humans, horses, marine mammals, pigs, ferrets, and chickens. In animals most influenza A viruses cause mild localized infections of the respiratory and intestinal tract. However, highly pathogenic influenza A strains such as H5N1 exist that cause systemic infections in poultry in which mortality may reach 100%. Animals infected with influenza A often act as a reservoir for the influenza viruses and certain subtypes have been shown to cross the species barrier to humans.

Influenza A viruses can be classified into subtypes based on allelic variations in antigenic regions of two genes that encode surface glycoproteins, namely, hemagglutinin (HA) and neuraminidase (NA) which are required for viral attachment and cellular release. Other major viral proteins include the nucleoprotein, the nucleocapsid structural protein, membrane proteins (M1 and M2), polymerases (PA, PB and PB2) and non-structural proteins (NS1 and NS2). Currently, sixteen subtypes of HA (H1-H16) and nine NA (N1-N9) antigenic variants are known in influenza A virus. Previously, only three subtypes have been known to circulate in humans (H1N1, H1N2, and H3N2).

However, in recent years, the pathogenic H5N1 subtype of avian influenza A has been reported to cross the species barrier and infect humans as documented in Hong Kong in 1997 and 2003, leading to the death of several patients. In humans, the avian influenza virus infects cells of the respiratory tract as well as the intestinal tract, liver, spleen, kidneys and other organs. Symptoms of avian influenza infection include fever, respiratory difficulties including shortness of breath and cough, lymphopenia, diarrhea and difficulties regulating blood sugar levels. In contrast to seasonal influenza, the group most at risk is healthy adults, which make up the bulk of the population. Due to the high pathogenicity of certain avian influenza A subtypes, particularly H5N1, and their demonstrated ability to cross over to infect humans, there is a significant economic and public health risk associated with these viral strains, including a real epidemic and pandemic threat. The scale of the threat is illustrated by the 1918 influenza pandemic which killed over 50 million people.

Currently, no effective vaccines for H5N1 infection are available, so passive immunotherapy with immunoglobulins may be an alternative strategy. Use of passive immunization during the 1918 pandemic reportedly halved the death rate. In view of their therapeutic benefit in humans, there is thus a need for antibodies, preferably human antibodies, capable of neutralizing influenza infection, including H5N1.

The invention provides compositions including human antibodies raised against two influenza proteins, hemagglutinin (HA) and matrix 2 ectodomain (M2e), and shows that these compositions can be used in medicine, in particular for diagnosis, prevention and treatment of influenza infections, including H5N1.

HuM2e Antibodies

The present invention provides fully human monoclonal antibodies specifically directed against M2e. Optionally, the antibody is isolated form a B-cell from a human donor. Exemplary monoclonal antibodies include TCN-032 (8I10), 21B15, TCN-031 (23K12), 3241_G23, 3244_I10, 3243_J07, 3259_J21, 3245_O19, 3244_H04, 3136_G05, 3252_C13, 3255_J06, 3420_I23, 3139_P23, 3248_P18, 3253_P10, 3260_D19, 3362_B11, and 3242_P05. described herein. Alternatively, the monoclonal antibody is an antibody that binds to the same epitope as TCN-032 (8I10), 21B15, TCN-031 (23K12), 3241_G23, 3244_I10, 3243_J07, 3259_J21, 3245_O19, 3244_H04, 3136_G05, 3252_C13, 3255_J06, 3420_I23, 3139_P23, 3248_P18, 3253_P10, 3260_D19, 3362_B11, and 3242_P05. The antibodies respectively referred to herein are huM2e antibodies. The huM2e antibody has one or more of the following characteristics: a) binds to an epitope in the extracellular domain of the matrix 2 ectodomain (M2e) polypeptide of an influenza virus; b) binds to influenza A infected cells; or c) binds to influenza A virus.

The epitope that huM2e antibody binds to is a non-linear epitope of a M2 polypeptide. Preferably, the epitope includes the amino terminal region of the M2e polypeptide. More preferably the epitope wholly or partially includes the amino acid sequence SLLTEV (SEQ ID NO: 42). Most preferably, the epitope includes the amino acid at position 2, 5 and 6 of the M2e polypeptide when numbered in accordance with SEQ ID NO: 1. The amino acid at position 2 is a serine; at position 5 is a threonine; and at position 6 is a glutamic acid.

A huM2e antibody contains a heavy chain variable having the amino acid sequence of SEQ ID NOs: 44, 277, 276, 50, 236, 235, 116, 120, 124, 128, 132, 136, 140, 144, 148, 152, 156, 160, 164, 168, 172, or 176 and a light chain variable having the amino acid sequence of SEQ ID NOs: 46, 52, 118, 122, 126, 130, 134, 138, 142, 146, 150, 154, 158, 162, 166, 170, 174, or 178. Preferably, the three heavy chain CDRs include an amino acid sequence at least 90%, 92%, 95%, 97% 98%, 99% or more identical to the amino acid sequence of SEQ ID NOs: 72, 74, 76, 103, 105, 107, 179, 180, 181, 187, 188, 189, 197, 203, 204, 205, 21, 212, 213, 228, 229, 230, 237, 238, 252, 253, 254, 260, 261, 262, 268, 269, 270, 284, 285, 286, 293, 294, 295, and 301 (as determined by the Kabat method) or SEQ ID NOs: 109, 110, 76, 112, 113, 107, 182, 183, 181, 190, 191, 189, 197, 206, 207, 205, 214, 215, 213, 232, 230, 239, 240, 238, 255, 256, 254, 263, 264, 262, 271, 272, 270, 287, 288, 286, 296, 297, 295, and 304 (as determined by the Chothia method) and a light chain with three CDRs that include an amino acid sequence at least 90%, 92%, 95%, 97% 98%, 99% or more identical to the amino acid sequence of SEQ ID NOs: 59, 60, 61, 92, 94, 96, 184, 185, 186, 192, 193, 194, 208, 209, 210, 217, 218, 226, 223, 234, 241, 243, 258, 259, 265, 267, 273, 274, 275, 282, 291, and 300 (as determined by the Kabat method) or SEQ ID NOs: 59, 60, 61, 92, 94, 96, 184, 185, 186, 192, 193, 194, 208, 209, 210, 217, 218, 226, 223, 234, 241, 243, 258, 259, 265, 267, 273, 274, 275, 282, 291, and 300 (as determined by the Chothia method). The antibody binds M2e.

The heavy chain of a M2e antibody is derived from a germ line V (variable) gene such as, for example, the IgHV4 or the IgHV3 germline gene.

The M2e antibodies of the invention include a variable heavy chain (VH) region encoded by a human IgHV4 or the IgHV3 germline gene sequence. A IgHV4 germline gene sequence are shown, e.g., in Accession numbers L10088, M29812, M95114, X56360 and M95117. IgHV3 germline gene sequence are shown, e.g., in Accession numbers X92218, X70208, Z27504, M99679 and AB019437. The M2e antibodies of the invention include a VH region that is encoded by a nucleic acid sequence that is at least 80% homologous to the IgHV4 or the IgHV3 germline gene sequence. Preferably, the nucleic acid sequence is at least 90%, 95%, 96%, 97% homologous to the IgHV4 or the IgHV3 germline gene sequence, and more preferably, at least 98%, 99% homologous to the IgHV4 or the IgHV3 germline gene sequence. The VH region of the M2e antibody is at least 80% homologous to the amino acid sequence of the VH region encoded by the IgHV4 or the IgHV3 VH germline gene sequence. Preferably, the amino acid sequence of VH region of the M2e antibody is at least 90%, 95%, 96%, 97% homologous to the amino acid sequence encoded by the IgHV4 or the IgHV3 germline gene sequence, and more preferably, at least 98%, 99% homologous to the sequence encoded by the IgHV4 or the IgHV3 germline gene sequence.

The M2e antibodies of the invention also include a variable light chain (VL) region encoded by a human IgKV1 germline gene sequence. A human IgKV1 VL germline gene sequence is shown, e.g., Accession numbers X59315, X59312, X59318, J00248, and Y14865. Alternatively, the M2e antibodies include a VL region that is encoded by a nucleic acid sequence that is at least 80% homologous to the IgKV1 germline gene sequence. Preferably, the nucleic acid sequence is at least 90%, 95%, 96%, 97% homologous to the IgKV1 germline gene sequence, and more preferably, at least 98%, 99% homologous to the IgKV1 germline gene sequence. The VL region of the M2e antibody is at least 80% homologous to the amino acid sequence of the VL region encoded the IgKV1 germline gene sequence. Preferably, the amino acid sequence of VL region of the M2e antibody is at least 90%, 95%, 96%, 97% homologous to the amino acid sequence encoded by the IgKV1 germline gene sequence, and more preferably, at least 98%, 99% homologous to the sequence encoded by e the IgKV1 germline gene sequence.

In another aspect the invention provides a composition including an huM2e antibody according to the invention. In various aspects the composition further includes an anti-viral drug, a viral entry inhibitor or a viral attachment inhibitor. The anti-viral drug is for example a neuraminidase inhibitor, a HA inhibitor, a sialic acid inhibitor or an M2 ion channel inhibitor. The M2 ion channel inhibitor is for example amantadine or rimantadine. The neuraminidase inhibitor for example zanamivir, or oseltamivir phosphate. In a further aspect the composition further includes a second anti-influenza A antibody.

In a further aspect the huM2e antibodies according to the invention are operably-linked to a therapeutic agent or a detectable label.

Additionally, the invention provides methods for stimulating an immune response, treating, preventing or alleviating a symptom of an influenza viral infection by administering an huM2e antibody to a subject

Optionally, the subject is further administered with a second agent such as, but not limited to, an influenza virus antibody, an anti-viral drug such as a neuraminidase inhibitor, a HA inhibitor, a sialic acid inhibitor or an M2 ion channel inhibitor, a viral entry inhibitor or a viral attachment inhibitor. The M2 ion channel inhibitor is, for example, amantadine or rimantadine. The neuraminidase inhibitor is, for example, zanamivir or oseltamivir phosphate. The subject is suffering from or is predisposed to developing an influenza virus infection, such as, for example, an autoimmune disease or an inflammatory disorder.

In another aspect, the invention provides methods of administering the huM2e antibody of the invention to a subject prior to, and/or after exposure to an influenza virus. For example, the huM2e antibody of the invention is used to treat or prevent rejection influenza infection. The huM2e antibody is administered at a dose sufficient to promote viral clearance or eliminate influenza A infected cells.

Also included in the invention is a method for determining the presence of an influenza virus infection in a patient, by contacting a biological sample obtained from the patient with a humM2e antibody; detecting an amount of the antibody that binds to the biological sample; and comparing the amount of antibody that binds to the biological sample to a control value.

The invention further provides a diagnostic kit comprising a huM2e antibody.

Other features and advantages of the invention will be apparent from and are encompassed by the following detailed description and claims.

The present invention provides fully human monoclonal antibodies specific against the extracellular domain of the matrix 2 (M2) polypeptide. The antibodies are respectively referred to herein as huM2e antibodies.

M2 is a 96 amino acid transmembrane protein present as a homotetramer on the surface of influenza virus and virally infected cells. M2 contains a 23 amino acid ectodomain (M2e) that is highly conserved across influenza A strains. Few amino acid changes have occurred since the 1918 pandemic strain thus M2e is an attractive target for influenza therapies. In prior studies, monoclonal antibodies specific to the M2 ectodomain (M2e) were derived upon immunizations with a peptide corresponding to the linear sequence of M2e. In contrast, the present invention provides a novel process whereby full-length M2 is expressed in cell lines, which allows for the identification of human antibodies that bound this cell-expressed M2e. The huM2e antibodies have been shown to bind conformational determinants on the M2-transfected cells, as well as native M2, either on influenza infected cells, or on the virus itself. The huM2e antibodies did not bind the linear M2e peptide, but they do bind several natural M2 variants, also expressed upon cDNA transfection into cell lines. Thus, this invention has allowed for the identification and production of human monoclonal antibodies that exhibit novel specificity for a very broad range of influenza A virus strains. These antibodies may be used diagnostically to identify influenza A infection and therapeutically to treat influenza A infection.

The huM2e antibodies of the invention have one or more of the following characteristics: the huM2e antibody binds a) to an epitope in the extracellular domain of the matrix 2 (M2) polypeptide of an influenza virus; b) binds to influenza A infected cells; and/or c) binds to influenza A virus (i.e., virons). The huM2e antibodies of the invention eliminate influenza infected cells through immune effector mechanisms, such as ADCC, and promote direct viral clearance by binding to influenza virons. The huM2e antibodies of the invention bind to the amino-terminal region of the M2e polypeptide. Preferably, the huM2e antibodies of the invention bind to the amino-terminal region of the M2e polypeptide wherein the N-terminal methionine residue is absent. Exemplary M2e sequences include those sequences listed on Table 1 below


In one embodiment, the huM2e antibodies of the invention bind to a M2e that wholly or partially includes the amino acid residues from position 2 to position 7 of M2e when numbered in accordance with SEQ ID NO: 1. For example, the huM2e antibodies of the invention bind wholly or partially to the amino acid sequence SLLTEVET (SEQ ID NO: 41) Most preferably, the huM2e antibodies of the invention bind wholly or partially to the amino acid sequence SLLTEV (SEQ ID NO: 42). Preferably, the huM2e antibodies of the invention bind to non-linear epitope of the M2e protein. For example, the huM2e antibodies bind to an epitope comprising position 2, 5, and 6 of the M2e polypeptide when numbered in accordance to SEQ ID NO: 1 where the amino acid at a) position 2 is a serine; b) position 5 is a threonine; and c) position 6 is a glutamic acid. Exemplary huM2e monoclonal antibodies that bind to this epitope are the TCN-032 (8I10), 21B15, TCN-031 (23K12), 3241_G23, 3244_I10, 3243_J07, 3259_J21, 3245_O19, 3244_H04, 3136_G05, 3252_C13, 3255_J06, 3420_I23, 3139_P23, 3248_P18, 3253_P10, 3260_D19, 3362_B11, and 3242_P05 antibodies described herein.

The TCN-032 (8I10) antibody includes a heavy chain variable region (SEQ ID NO: 44) encoded by the nucleic acid sequence shown below in SEQ ID NO: 43, a short heavy chain variable region (SEQ ID NO: 277) encoded by the nucleic acid sequence shown below in SEQ ID NO: 278, a long heavy chain variable region (SEQ ID NO: 276) encoded by the nucleic acid sequence shown below in SEQ ID NO: 196, and a light chain variable region (SEQ ID NO: 46) encoded by the nucleic acid sequence shown in SEQ ID NO: 45.

The amino acids encompassing the CDRs as defined by Chothia, C. et al. (1989, Nature, 342: 877-883) are underlined and those defined by Kabat E. A. et al. (1991, Sequences of Proteins of Immunological Interest, 5th edit., NIH Publication no. 91-3242 U.S. Department of Heath and Human Services.) are highlighted in bold in the sequences below.

The heavy chain CDRs of the TCN-032 (8I10) antibody have the following sequences per Kabat definition: NYYWS (SEQ ID NO: 72), FIYYGGNTKYNPSLKS (SEQ ID NO: 74) and ASCSGGYCILD (SEQ ID NO: 76). The light chain CDRs of the TCN-032 (8I10) antibody have the following sequences per Kabat definition: RASQNIYKYLN (SEQ ID NO: 59), AASGLQS (SEQ ID NO: 61) and QQSYSPPLT (SEQ ID NO: 63).

The heavy chain CDRs of the TCN-032 (8I10) antibody have the following sequences per Chothia definition: GSSISN (SEQ ID NO: 109), FIYYGGNTK (SEQ ID NO: 110) and ASCSGGYCILD (SEQ ID NO: 76). The light chain CDRs of the TCN-032 (8I10) antibody have the following sequences per Chothia definition: RASQNIYKYLN (SEQ ID NO: 59), AASGLQS (SEQ ID NO: 61) and QQSYSPPLT (SEQ ID NO: 63).

TCN-032 (8I10) VH Nucleotide Sequence: (SEQ ID NO: 43)


TCN-032 (8I10) VH Amino Acid Sequence: (SEQ ID NO: 44)

Kabat Bold, Chothia Underlined


TCN-032 (8I10) VH Short Nucleotide Sequence: (SEQ ID NO: 278)


TCN-032 (8I10) VH Short Amino Acid Sequence: (SEQ ID NO: 277)


TCN-032 (8I10) VH Long Nucleotide Sequence: (SEQ ID NO: 196)


TCN-032 (8I10) VH Long Amino Acid Sequence: (SEQ ID NO: 276)

Kabat Bold, Chothia Underlined


TCN-032 (8I10) VL nucleotide sequence: (SEQ ID NO: 45)


TCN-032 (8I10) VL Amino Acid Sequence: (SEQ ID NO: 46)

Kabat Bold, Chothia underlined


The 21B15 antibody includes a heavy chain variable region (SEQ ID NO: 44) encoded by the nucleic acid sequence shown below in SEQ ID NO: 47, a short heavy chain variable region (SEQ ID NO: 277) encoded by the nucleic acid sequence shown below in SEQ ID NO: 278, a long heavy chain variable region (SEQ ID NO: 276) encoded by the nucleic acid sequence shown below in SEQ ID NO: 196, and a light chain variable region (SEQ ID NO: 46) encoded by the nucleic acid sequence shown in SEQ ID NO: 48.

The amino acids encompassing the CDRs as defined by Chothia et al. 1989, are underlined and those defined by Kabat et al., 1991 are highlighted in bold in the sequences below.

The heavy chain CDRs of the 21B15 antibody have the following sequences per Kabat definition: NYYWS (SEQ ID NO: 72), FIYYGGNTKYNPSLKS (SEQ ID NO: 74) and ASCSGGYCILD (SEQ ID NO: 76). The light chain CDRs of the 21B15 antibody have the following sequences per Kabat definition: RASQNIYKYLN (SEQ ID NO: 59), AASGLQS (SEQ ID NO: 61) and QQSYSPPLT (SEQ ID NO: 63).

The heavy chain CDRs of the 21B15 antibody have the following sequences per Chothia definition: GSSISN (SEQ ID NO: 109), FIYYGGNTK (SEQ ID NO: 110) and ASCSGGYCILD (SEQ ID NO: 76). The light chain CDRs of the 21B15 antibody have the following sequences per Chothia definition: RASQNIYKYLN (SEQ ID NO: 59), AASGLQS (SEQ ID NO: 61) and QQSYSPPLT (SEQ ID NO: 63).

21B15 VH Nucleotide Sequence: (SEQ ID NO: 47)


21B15 VH Amino Acid Sequence: (SEQ ID NO: 44)

Kabat Bold, Chothia Underlined


B15 VH Short Nucleotide Sequence: (SEQ ID NO: 278)


21B15 VH Short Amino Acid Sequence: (SEQ ID NO: 277)

Kabat Bold, Chothia Underlined


21B15 VH Long Nucleotide Sequence: (SEQ ID NO: 196)


21B15 VH Long Amino Acid Sequence: (SEQ ID NO: 276)

Kabat Bold, Chothia Underlined


21B15 VL Nucleotide Sequence: (SEQ ID NO: 48)


21B15 VL Amino Acid Sequence: (SEQ ID NO: 292)

Kabat Bold, Chothia Underlined


The TCN-031 (23K12) antibody includes a heavy chain variable region (SEQ ID NO: 50) encoded by the nucleic acid sequence shown below in SEQ ID NO: 49, a short heavy chain variable region (SEQ ID NO: 236) encoded by the nucleic acid sequence shown below in SEQ ID NO: 244, a long heavy chain variable region (SEQ ID NO: 195) encoded by the nucleic acid sequence shown below in SEQ ID NO: 235, and a light chain variable region (SEQ ID NO: 52) encoded by the nucleic acid sequence shown in SEQ ID NO: 51.

The amino acids encompassing the CDRs as defined by Chothia et al., 1989 are underlined and those defined by Kabat et al., 1991 are highlighted in bold in the sequences below.

The heavy chain CDRs of the TCN-031 (23K12) antibody have the following sequences per Kabat definition: SNYMS (SEQ ID NO: 103), VIYSGGSTYYADSVK (SEQ ID NO: 105) and CLSRMRGYGLDV (SEQ ID NO: 107). The light chain CDRs of the TCN-031 (23K12) antibody have the following sequences per Kabat definition: RTSQSISSYLN (SEQ ID NO: 92), AASSLQSGVPSRF (SEQ ID NO: 94) and QQSYSMPA (SEQ ID NO: 96).

The heavy chain CDRs of the TCN-031 (23K12) antibody have the following sequences per Chothia definition: GFTVSSN (SEQ ID NO: 112), VIYSGGSTY (SEQ ID NO: 113) and CLSRMRGYGLDV (SEQ ID NO: 107). The light chain CDRs of the TCN-031 (23K12) antibody have the following sequences per Chothia definition: RTSQSISSYLN (SEQ ID NO: 92), AASSLQSGVPSRF (SEQ ID NO: 94) and QQSYSMPA (SEQ ID NO: 96).

TCN-031 (23K12) VH Nucleotide Sequence: (SEQ ID NO: 49)


TCN-031 (23K12) VH Amino Acid Sequence: (SEQ ID NO: 50)

Kabat Bold, Chothia Underlined


TCN-031 (23K12) VH Short Nucleotide Sequence: (SEQ ID NO: 244)


TCN-031 (23K12) VH Short Amino Acid Sequence: (SEQ ID NO: 236)

Kabat Bold, Chothia Underlined


TCN-031 (23K12) VH Long Nucleotide Sequence: (SEQ ID NO: 195)


TCN-031 (23K12) VH Long Amino Acid Sequence: (SEQ ID NO: 235)

Kabat Bold, Chothia Underlined


TCN-031 (23K12) VL Nucleotide Sequence: (SEQ ID NO: 51)


TCN-031 (23K12) VL Amino Acid Sequence: (SEQ ID NO: 52)

Kabat Bold, Chothia Underlined


The 3241_G23 antibody (also referred to herein as G23) includes a heavy chain variable region (SEQ ID NO: 116) encoded by the nucleic acid sequence shown below in SEQ ID NO: 115, and a light chain variable region (SEQ ID NO: 118) encoded by the nucleic acid sequence shown in SEQ ID NO: 117.

The amino acids encompassing the CDRs as defined by Chothia et al., 1989 are underlined and those defined by Kabat et al., 1991 are highlighted in bold in the sequences below.

The heavy chain CDRs of the G23 antibody have the following sequences per Kabat definition: GGGYSWN (SEQ ID NO: 179), FMFHSGSPRYNPTLKS (SEQ ID NO: 180) and VGQMDKYYAMDV (SEQ ID NO: 181). The light chain CDRs of the G23 antibody have the following sequences per Kabat definition: RASQSIGAYVN (SEQ ID NO: 184), GASNLQS (SEQ ID NO: 185) and QQTYSTPIT (SEQ ID NO: 186).

The heavy chain CDRs of the G23 antibody have the following sequences per Chothia definition: GGPVSGGG (SEQ ID NO: 182), FMFHSGSPR (SEQ ID NO: 183) and VGQMDKYYAMDV (SEQ ID NO: 181). The light chain CDRs of the G23 antibody have the following sequences per Chothia definition: RASQSIGAYVN (SEQ ID NO: 184), GASNLQS (SEQ ID NO: 185) and QQTYSTPIT (SEQ ID NO: 186).

3241_G23 VH Nucleotide Sequence (SEQ ID NO: 115)


3241_G23 VH Amino Acid Sequence (SEQ ID NO: 116)

Kabat Bold, Chothia Underlined


3241_G23 VL Nucleotide Sequence (SEQ ID NO: 117)


3241_G23 VL Amino Acid Sequence (SEQ ID NO: 118)

Kabat Bold, Chothia Underlined


The 3244_I10 antibody (also referred to herein as 110) includes a heavy chain variable region (SEQ ID NO: 120) encoded by the nucleic acid sequence shown below in SEQ ID NO: 119, and a light chain variable region (SEQ ID NO: 122) encoded by the nucleic acid sequence shown in SEQ ID NO: 121.

The amino acids encompassing the CDRs as defined by Chothia et al., 1989 are underlined and those defined by Kabat et al., 1991 are highlighted in bold in the sequences below.

The heavy chain CDRs of the 110 antibody have the following sequences per Kabat definition: SDYWS (SEQ ID NO: 187), FFYNGGSTKYNPSLKS (SEQ ID NO: 188) and HDAKFSGSYYVAS (SEQ ID NO: 189). The light chain CDRs of the 110 antibody have the following sequences per Kabat definition: RASQSISTYLN (SEQ ID NO: 192), GATNLQS (SEQ ID NO: 193) and QQSYNTPLI (SEQ ID NO: 194).

The heavy chain CDRs of the 110 antibody have the following sequences per Chothia definition: GGSITS (SEQ ID NO: 190), FFYNGGSTK (SEQ ID NO: 191) and HDAKFSGSYYVAS (SEQ ID NO: 189). The light chain CDRs of the 110 antibody have the following sequences per Chothia definition: RASQSISTYLN (SEQ ID NO: 192), GATNLQS (SEQ ID NO: 193) and QQSYNTPLI (SEQ ID NO: 194).

3244_I10 VH Nucleotide Sequence (SEQ ID NO: 119)


3244_I10 VH Amino Acid Sequence (SEQ ID NO: 120)


3244_I10 VL Nucleotide Sequence (SEQ ID NO: 121)


3244_I10 VL Amino Acid Sequence (SEQ ID NO: 122)


The 3243_J07 antibody (also referred to herein as J07) includes a heavy chain variable region (SEQ ID NO: 124) encoded by the nucleic acid sequence shown below in SEQ ID NO: 123, and a light chain variable region (SEQ ID NO: 126) encoded by the nucleic acid sequence shown in SEQ ID NO: 125.

The amino acids encompassing the CDRs as defined by Chothia et al., 1989 are underlined and those defined by Kabat et al., 1991 are highlighted in bold in the sequences below.

The heavy chain CDRs of the J07 antibody have the following sequences per Kabat definition: SDYWS (SEQ ID NO: 187), FFYNGGSTKYNPSLKS (SEQ ID NO: 188) and HDVKFSGSYYVAS (SEQ ID NO: 197). The light chain CDRs of the J07 antibody have the following sequences per Kabat definition: RASQSISTYLN (SEQ ID NO: 192), GATNLQS (SEQ ID NO: 193) and QQSYNTPLI (SEQ ID NO: 194).

The heavy chain CDRs of the J07 antibody have the following sequences per Chothia definition: GGSITS (SEQ ID NO: 190), FFYNGGSTK (SEQ ID NO: 191) and HDVKFSGSYYVAS (SEQ ID NO: 197). The light chain CDRs of the J07 antibody have the following sequences per Chothia definition: RASQSISTYLN (SEQ ID NO: 192), GATNLQS (SEQ ID NO: 193) and QQSYNTPLI (SEQ ID NO: 194).

3243_J07 VH Nucleotide Sequence (SEQ ID NO: 123)


3243_J07 VH Amino Acid Sequence (SEQ ID NO: 124)


3243_J07 VL Nucleotide Sequence (SEQ ID NO: 125)


3243_J07 VL Amino Acid Sequence (SEQ ID NO: 126)


The 3259_J21 antibody (also referred to herein as J21) includes a heavy chain variable region (SEQ ID NO: 128) encoded by the nucleic acid sequence shown below in SEQ ID NO: 127, and a light chain variable region (SEQ ID NO: 130) encoded by the nucleic acid sequence shown in SEQ ID NO: 129.

The amino acids encompassing the CDRs as defined by Chothia et al., 1989 are underlined and those defined by Kabat et al., 1991 are highlighted in bold in the sequences below.

The heavy chain CDRs of the J21 antibody have the following sequences per Kabat definition: SYNWI (SEQ ID NO: 203), HIYDYGRTFYNSSLQS (SEQ ID NO: 204) and PLGILHYYAMDL (SEQ ID NO: 205). The light chain CDRs of the J21 antibody have the following sequences per Kabat definition: RASQSIDKFLN (SEQ ID NO: 208), GASNLHS (SEQ ID NO: 209) and QQSFSVPA (SEQ ID NO: 210).

The heavy chain CDRs of the J21 antibody have the following sequences per Chothia definition: GGSISS (SEQ ID NO: 206), HIYDYGRTF (SEQ ID NO: 207) and PLGILHYYAMDL (SEQ ID NO: 205). The light chain CDRs of the J21 antibody have the following sequences per Chothia definition: RASQSIDKFLN (SEQ ID NO: 208), GASNLHS (SEQ ID NO: 209) and QQSFSVPA (SEQ ID NO: 210).

3259_J21 VH Nucleotide Sequence (SEQ ID NO: 127)


3259_J21 VH Amino Acid Sequence (SEQ ID NO: 128)


3259_J21 VL Nucleotide Sequence (SEQ ID NO: 129)


3259_J21 VL Amino Acid Sequence (SEQ ID NO: 130)


The 3245_O19 antibody (also referred to herein as 019) includes a heavy chain variable region (SEQ ID NO: 132) encoded by the nucleic acid sequence shown below in SEQ ID NO: 131, and a light chain variable region (SEQ ID NO: 134) encoded by the nucleic acid sequence shown in SEQ ID NO: 133.

The amino acids encompassing the CDRs as defined by Chothia et al., 1989 are underlined and those defined by Kabat et al., 1991 are highlighted in bold in the sequences below.

The heavy chain CDRs of the 019 antibody have the following sequences per Kabat definition: STYMN (SEQ ID NO: 211), VFYSETRTYYADSVKG (SEQ ID NO: 212) and VQRLSYGMDV (SEQ ID NO: 213). The light chain CDRs of the 019 antibody have the following sequences per Kabat definition: RASQSISTYLN (SEQ ID NO: 192), GASTLQS (SEQ ID NO: 217) and QQTYSIPL (SEQ ID NO: 218).

The heavy chain CDRs of the 019 antibody have the following sequences per Chothia definition: GLSVSS (SEQ ID NO: 214), VFYSETRTY (SEQ ID NO: 215) and VQRLSYGMDV (SEQ ID NO: 213). The light chain CDRs of the 019 antibody have the following sequences per Chothia definition: RASQSISTYLN (SEQ ID NO: 192), GASTLQS (SEQ ID NO: 217) and QQTYSIPL (SEQ ID NO: 218).

3245_O19 VH Nucleotide Sequence (SEQ ID NO:131)


3245_O19 VH Amino Acid Sequence (SEQ ID NO: 132)


3245_O19 VL Nucleotide Sequence (SEQ ID NO: 133)


3245_O19 VL Amino Acid Sequence (SEQ ID NO: 134)


The 3244_H04 antibody (also referred to herein as H04) includes a heavy chain variable region (SEQ ID NO: 136) encoded by the nucleic acid sequence shown below in SEQ ID NO: 135, and a light chain variable region (SEQ ID NO: 138) encoded by the nucleic acid sequence shown in SEQ ID NO: 137.

The amino acids encompassing the CDRs as defined by Chothia et al., 1989 are underlined and those defined by Kabat et al., 1991 are highlighted in bold in the sequences below.

The heavy chain CDRs of the H04 antibody have the following sequences per Kabat definition: STYMN (SEQ ID NO: 211), VFYSETRTYYADSVKG (SEQ ID NO: 212) and VQRLSYGMDV (SEQ ID NO: 213). The light chain CDRs of the H04 antibody have the following sequences per Kabat definition: RASQSISTYLN (SEQ ID NO: 192), GASSLQS (SEQ ID NO: 226) and QQTYSIPL (SEQ ID NO: 218).

The heavy chain CDRs of the H04 antibody have the following sequences per Chothia definition: GLSVSS (SEQ ID NO: 214), VFYSETRTY (SEQ ID NO: 215) and VQRLSYGMDV (SEQ ID NO: 213). The light chain CDRs of the H04 antibody have the following sequences per Chothia definition: RASQSISTYLN (SEQ ID NO: 192), GASSLQS (SEQ ID NO: 226) and QQTYSIPL (SEQ ID NO: 218).

3244_H04 VH Nucleotide Sequence (SEQ ID NO: 135)


3244_H04 VH Amino Acid Sequence (SEQ ID NO: 136)


3244_H1104 VL Nucleotide Sequence (SEQ ID NO: 137)


3244_H04 VL Amino Acid Sequence (SEQ ID NO: 138)


The 3136_G05 antibody (also referred to herein as G05) includes a heavy chain variable region (SEQ ID NO: 140) encoded by the nucleic acid sequence shown below in SEQ ID NO: 139, and a light chain variable region (SEQ ID NO: 142) encoded by the nucleic acid sequence shown in SEQ ID NO: 141.

The amino acids encompassing the CDRs as defined by Chothia et al., 1989 are underlined and those defined by Kabat et al., 1991 are highlighted in bold in the sequences below.

The heavy chain CDRs of the G05 antibody have the following sequences per Kabat definition: SDFWS (SEQ ID NO: 228), YVYNRGSTKYSPSLKS (SEQ ID NO: 229) and NGRSSTSWGIDV (SEQ ID NO: 230). The light chain CDRs of the 3136_G05 antibody have the following sequences per Kabat definition: RASQSISTYLH (SEQ ID NO: 233), AASSLQS (SEQ ID NO: 234) and QQSYSPPLT (SEQ ID NO: 63).

The heavy chain CDRs of the 3136_G05 antibody have the following sequences per Chothia definition: GGSISS (SEQ ID NO: 206), YVYNRGSTK (SEQ ID NO: 232) and NGRSSTSWGIDV (SEQ ID NO: 230). The light chain CDRs of the 3136_G05 antibody have the following sequences per Chothia definition: RASQSISTYLH (SEQ ID NO: 233), AASSLQS (SEQ ID NO: 234) and QQSYSPPLT (SEQ ID NO: 63).

3136_G05 VH Nucleotide Sequence (SEQ ID NO: 139)


3136_G05 VH Amino Acid Sequence (SEQ ID NO: 140)


3136_G05 VL Nucleotide Sequence (SEQ ID NO: 141)


3136_G05 VL Amino Acid Sequence (SEQ ID NO: 142)


The 3252_C13 antibody (also referred to herein as C13) includes a heavy chain variable region (SEQ ID NO: 144) encoded by the nucleic acid sequence shown below in SEQ ID NO: 143, and a light chain variable region (SEQ ID NO: 146) encoded by the nucleic acid sequence shown in SEQ ID NO: 145.

The amino acids encompassing the CDRs as defined by Chothia et al., 1989 are underlined and those defined by Kabat et al., 1991 are highlighted in bold in the sequences below.

The heavy chain CDRs of the C13 antibody have the following sequences per Kabat definition: SDYWS (SEQ ID NO: 187), YIYNRGSTKYTPSLKS (SEQ ID NO: 237) and HVGGHTYGIDY (SEQ ID NO: 238). The light chain CDRs of the C13 antibody have the following sequences per Kabat definition: RASQSISNYLN (SEQ ID NO: 241), AASSLQS (SEQ ID NO: 234) and QQSYNTPIT (SEQ ID NO: 243).

The heavy chain CDRs of the C13 antibody have the following sequences per Chothia definition: GASISS (SEQ ID NO: 239), YIYNRGSTK (SEQ ID NO: 240) and HVGGHTYGIDY (SEQ ID NO: 238). The light chain CDRs of the C13 antibody have the following sequences per Chothia definition: RASQSISNYLN (SEQ ID NO: 241), AASSLQS (SEQ ID NO: 234) and QQSYNTPIT (SEQ ID NO: 243).

3252_C13 VH Nucleotide Sequence (SEQ ID NO: 143)


3252_C13 VH Amino Acid Sequence (SEQ ID NO: 144)


3252_C13 VL Nucleotide Sequence (SEQ ID NO: 145)


3252_C13 VL Amino Acid Sequence (SEQ ID NO: 146)


The 3259_J06 antibody (also referred to herein as J06) includes a heavy chain variable region (SEQ ID NO: 148) encoded by the nucleic acid sequence shown below in SEQ ID NO: 147, and a light chain variable region (SEQ ID NO: 150) encoded by the nucleic acid sequence shown in SEQ ID NO: 149.

The amino acids encompassing the CDRs as defined by Chothia et al., 1989 are underlined and those defined by Kabat et al., 1991 are highlighted in bold in the sequences below.

The heavy chain CDRs of the J06 antibody have the following sequences per Kabat definition: SDYWS (SEQ ID NO: 187), YIYNRGSTKYTPSLKS (SEQ ID NO: 237) and HVGGHTYGIDY (SEQ ID NO: 238). The light chain CDRs of the J06 antibody have the following sequences per Kabat definition: RASQSISNYLN (SEQ ID NO: 241), AASSLQS (SEQ ID NO: 234) and QQSYNTPIT (SEQ ID NO: 243).

The heavy chain CDRs of the J06 antibody have the following sequences per Chothia definition: GASISS (SEQ ID NO: 239), YIYNRGSTK (SEQ ID NO: 240) and HVGGHTYGIDY (SEQ ID NO: 238). The light chain CDRs of the J06 antibody have the following sequences per Chothia definition: RASQSISNYLN (SEQ ID NO: 241), AASSLQS (SEQ ID NO: 234) and QQSYNTPIT (SEQ ID NO: 243).

3255_J06 VH Nucleotide Sequence (SEQ ID NO: 147)


3255_J06 VH Amino Acid Sequence (SEQ ID NO: 148)


3255_J06 VL Nucleotide Sequence (SEQ ID NO: 149)


3255_J06 VL Amino Acid Sequence (SEQ ID NO: 150)


The 34101123 antibody (also referred to herein as 123) includes a heavy chain variable region (SEQ ID NO: 152) encoded by the nucleic acid sequence shown below in SEQ ID NO: 151, and a light chain variable region (SEQ ID NO: 154) encoded by the nucleic acid sequence shown in SEQ ID NO: 153.

The amino acids encompassing the CDRs as defined by Chothia et al., 1989 are underlined and those defined by Kabat et al., 1991 are highlighted in bold in the sequences below.

The heavy chain CDRs of the 3410_I23 antibody have the following sequences per Kabat definition: SYSWS (SEQ ID NO: 252), YLYYSGSTKYNPSLKS (SEQ ID NO: 253) and TGSESTTGYGMDV (SEQ ID NO: 254). The light chain CDRs of the 3410_I23 antibody have the following sequences per Kabat definition: RASQSISTYLN (SEQ ID NO: 192), AASSLHS (SEQ ID NO: 258) and QQSYSPPIT (SEQ ID NO: 259).

The heavy chain CDRs of the 3410_I23 antibody have the following sequences per Chothia definition: GDSISS (SEQ ID NO: 255), YLYYSGSTK (SEQ ID NO: 256) and TGSESTTGYGMDV (SEQ ID NO: 254). The light chain CDRs of the 3410_I23 antibody have the following sequences per Chothia definition: RASQSISTYLN (SEQ ID NO: 192), AASSLHS (SEQ ID NO: 258) and QQSYSPPIT (SEQ ID NO: 259).

3420_I23 VH Nucleotide Sequence (SEQ ID NO: 151)


3420_I23 VH Amino Acid Sequence (SEQ ID NO: 152)


3420_I23 VL Nucleotide Sequence (SEQ ID NO: 153)


3420_I23 VL Amino Acid Sequence (SEQ ID NO: 154)


The 3139_P23 antibody (also referred to herein as P23) includes a heavy chain variable region (SEQ ID NO: 156) encoded by the nucleic acid sequence shown below in SEQ ID NO: 155, and a light chain variable region (SEQ ID NO:158) encoded by the nucleic acid sequence shown in SEQ ID NO:157.

The amino acids encompassing the CDRs as defined by Chothia et al., 1989 are underlined and those defined by Kabat et al., 1991 are highlighted in bold in the sequences below.

The heavy chain CDRs of the P23 antibody have the following sequences per Kabat definition: NSFWG (SEQ ID NO: 260), YVYNSGNTKYNPSLKS (SEQ ID NO: 261) and HDDASHGYSIS (SEQ ID NO: 262). The light chain CDRs of the 3139_P23 antibody have the following sequences per Kabat definition: RASQTISTYLN (SEQ ID NO: 265), AASGLQS (SEQ ID NO: 61) and QQSYNTPLT (SEQ ID NO: 267).

The heavy chain CDRs of the 3139_P23 antibody have the following sequences per Chothia definition: GGSISN (SEQ ID NO: 263), YVYNSGNTK (SEQ ID NO: 264) and HDDASHGYSIS (SEQ ID NO: 262). The light chain CDRs of the 3139_P23 antibody have the following sequences per Chothia definition: RASQTISTYLN (SEQ ID NO: 265), AASGLQS (SEQ ID NO: 61) and QQSYNTPLT (SEQ ID NO: 267).


3139_P23 VH Amino Acid Sequence (SEQ ID NO: 156)


3139_P23 VL Nucleotide Sequence (SEQ ID NO: 157)


3139_P23 VL Amino Acid Sequence (SEQ ID NO: 158)


The 3248_P18 antibody (also referred to herein as P18) includes a heavy chain variable region (SEQ ID NO: 160) encoded by the nucleic acid sequence shown below in SEQ ID NO: 159, and a light chain variable region (SEQ ID NO: 162) encoded by the nucleic acid sequence shown in SEQ ID NO: 161.

The amino acids encompassing the CDRs as defined by Chothia et al., 1989 are underlined and those defined by Kabat et al., 1991 are highlighted in bold in the sequences below.

The heavy chain CDRs of the 3248_P18 antibody have the following sequences per Kabat definition: AYHWS (SEQ ID NO: 268), HIFDSGSTYYNPSLKS (SEQ ID NO: 269) and PLGSRYYYGMDV (SEQ ID NO: 270). The light chain CDRs of the 3248_P18 antibody have the following sequences per Kabat definition: RASQSISRYLN (SEQ ID NO: 273), GASTLQN (SEQ ID NO: 274) and QQSYSVPA (SEQ ID NO: 275).

The heavy chain CDRs of the 3248_P18 antibody have the following sequences per Chothia definition: GGSISA (SEQ ID NO: 271), HIFDSGSTY (SEQ ID NO: 272) and PLGSRYYYGMDV (SEQ ID NO: 270). The light chain CDRs of the 3248_P18 antibody have the following sequences per Chothia definition: RASQSISRYLN (SEQ ID NO: 273), GASTLQN (SEQ ID NO: 274) and QQSYSVPA (SEQ ID NO: 275).

3248_P18 VH Nucleotide Sequence (SEQ ID NO: 159)


3248_P18 VH Amino Acid Sequence (SEQ ID NO: 160)


3248_P18 VL Nucleotide Sequence (SEQ ID NO: 161)


3248_P18 VL Amino Acid Sequence (SEQ ID NO: 162)


The 3253_P10 antibody (also referred to herein as P10) includes a heavy chain variable region (SEQ ID NO: 164) encoded by the nucleic acid sequence shown below in SEQ ID NO: 163, and a light chain variable region (SEQ ID NO: 166) encoded by the nucleic acid sequence shown in SEQ ID NO: 165.

The amino acids encompassing the CDRs as defined by Chothia et al., 1989 are underlined and those defined by Kabat et al., 1991 are highlighted in bold in the sequences below.

The heavy chain CDRs of the 3253_P10 antibody have the following sequences per Kabat definition: SDYWS (SEQ ID NO: 187), FFYNGGSTKYNPSLKS (SEQ ID NO: 188) and HDAKFSGSYYVAS (SEQ ID NO: 189). The light chain CDRs of the 3253_P10 antibody have the following sequences per Kabat definition: RASQSISTYLN (SEQ ID NO: 192), GATDLQS (SEQ ID NO: 282) and QQSYNTPLI (SEQ ID NO: 194).

The heavy chain CDRs of the 3253_P10 antibody have the following sequences per Chothia definition: GGSITS (SEQ ID NO: 190), FFYNGGSTK (SEQ ID NO: 191) and HDAKFSGSYYVAS (SEQ ID NO: 189). The light chain CDRs of the 3253_P10 antibody have the following sequences per Chothia definition: RASQSISTYLN (SEQ ID NO: 192), GATDLQS (SEQ ID NO: 282) and QQSYNTPLI (SEQ ID NO: 194).

3253_P10 VH Nucleotide Sequence (SEQ ID NO: 163)


3253_P10 VH Amino Acid Sequence (SEQ ID NO: 164)


3253_P10 VL Nucleotide Sequence (SEQ ID NO: 165)


3253_P10 VL Amino Acid Sequence (SEQ ID NO: 166)


The 3260_D19 antibody (also referred to herein as D19) includes a heavy chain variable region (SEQ ID NO: 168) encoded by the nucleic acid sequence shown below in SEQ ID NO: 167, and a light chain variable region (SEQ ID NO: 170) encoded by the nucleic acid sequence shown in SEQ ID NO: 169.

The amino acids encompassing the CDRs as defined by Chothia et al., 1989 are underlined and those defined by Kabat et al., 1991 are highlighted in bold in the sequences below.

The heavy chain CDRs of the 3260_D19 antibody have the following sequences per Kabat definition: DNYIN (SEQ ID NO: 284), VFYSADRTSYADSVKG (SEQ ID NO: 285) and VQKSYYGMDV (SEQ ID NO: 286). The light chain CDRs of the 3260_D19 antibody have the following sequences per Kabat definition: RASQSISRYLN (SEQ ID NO: 273), GASSLQS (SEQ ID NO: 226) and QQTFSIPL (SEQ ID NO: 291).

The heavy chain CDRs of the 3260_D19 antibody have the following sequences per Chothia definition: GFSVSD (SEQ ID NO: 287), VFYSADRTS (SEQ ID NO: 288) and VQKSYYGMDV (SEQ ID NO: 286). The light chain CDRs of the 3260_D19 antibody have the following sequences per Chothia definition: RASQSISRYLN (SEQ ID NO: 273), GASSLQS (SEQ ID NO: 226) and QQTFSIPL (SEQ ID NO: 291).

3260_D19 VH Nucleotide Sequence (SEQ ID NO: 167)


3260_D19 VH Amino Acid Sequence (SEQ ID NO: 168)


3260_D19 VL Nucleotide Sequence (SEQ ID NO: 169)


3260_D19 VL Amino Acid Sequence (SEQ ID NO: 170)


The 3362_B11 antibody (also referred to herein as B11) includes a heavy chain variable region (SEQ ID NO: 172) encoded by the nucleic acid sequence shown below in SEQ ID NO: 171, and a light chain variable region (SEQ ID NO: 174) encoded by the nucleic acid sequence shown in SEQ ID NO: 173.

The amino acids encompassing the CDRs as defined by Chothia et al., 1989 are underlined and those defined by Kabat et al., 1991 are highlighted in bold in the sequences below.

The heavy chain CDRs of the B11 antibody have the following sequences per Kabat definition: SGAYYWT (SEQ ID NO: 293), YIYYSGNTYYNPSLKS (SEQ ID NO: 294) and AASTSVLGYGMDV (SEQ ID NO: 295). The light chain CDRs of the B11 antibody have the following sequences per Kabat definition: RASQSISRYLN (SEQ ID NO: 273), AASSLQS (SEQ ID NO: 234) and QQSYSTPLT (SEQ ID NO: 300).

The heavy chain CDRs of the B11 antibody have the following sequences per Chothia definition: GDSITSGA (SEQ ID NO: 296), YIYYSGNTY (SEQ ID NO: 297) and AASTSVLGYGMDV (SEQ ID NO: 295). The light chain CDRs of the B11 antibody have the following sequences per Chothia definition: RASQSISRYLN (SEQ ID NO: 273), AASSLQS (SEQ ID NO: 234) and QQSYSTPLT (SEQ ID NO: 300).

3362_B11 VH Nucleotide Sequence (SEQ ID NO: 171)


3362_B11 VH Amino Acid Sequence (SEQ ID NO: 172)


3362_B11 VL Nucleotide Sequence (SEQ ID NO: 173)


3362_B11 VH Amino Acid Sequence (SEQ ID NO: 174)


The 3242_P05 antibody (also referred to herein as P05) includes a heavy chain variable region (SEQ ID NO: 176) encoded by the nucleic acid sequence shown below in SEQ ID NO: 175, and a light chain variable region (SEQ ID NO: 178) encoded by the nucleic acid sequence shown in SEQ ID NO: 177.

The amino acids encompassing the CDRs as defined by Chothia et al., 1989 are underlined and those defined by Kabat et al., 1991 are highlighted in bold in the sequences below.

The heavy chain CDRs of the 3242_P05 antibody have the following sequences per Kabat definition: VSDNYIN (SEQ ID NO: 301), VFYSADRTSYADSVKG (SEQ ID NO: 285) and VQKSYYGMDV (SEQ ID NO: 286). The light chain CDRs of the 3242_P05 antibody have the following sequences per Kabat definition: RASQSISRYLN (SEQ ID NO: 273), GASSLQS (SEQ ID NO: 226) and QQTFSIPL (SEQ ID NO: 291).

The heavy chain CDRs of the 3242_P05 antibody have the following sequences per Chothia definition: SGFSV (SEQ ID NO: 304), VFYSADRTS (SEQ ID NO: 288) and VQKSYYGMDV (SEQ ID NO: 286). The light chain CDRs of the 3242_P05 antibody have the following sequences per Chothia definition: The light chain CDRs of the 3242_P05 antibody have the following sequences per Kabat definition: RASQSISRYLN (SEQ ID NO: 273), GASSLQS (SEQ ID NO: 226) and QQTFSIPL (SEQ ID NO: 291).

3242_P05 VH Nucleotide Sequence (SEQ ID NO: 175)


3242_P05 VH Amino Acid Sequence (SEQ ID NO: 176)


3242_P05 VL Nucleotide Sequence (SEQ ID NO: 177)


3242_P05 VL Amino Acid Sequence (SEQ ID NO: 178)


HuM2e antibodies of the invention also include antibodies that include a heavy chain variable amino acid sequence that is at least 90%, 92%, 95%, 97% 98%, 99% or more identical the amino acid sequence of SEQ ID NO: 44, 277, 276, 50, 236, 235, 116, 120, 124, 128, 132, 136, 140, 144, 148, 152, 156, 160, 164, 168, 172, or 176. and/or a light chain variable amino acid that is at least 90%, 92%, 95%, 97% 98%, 99% or more identical the amino acid sequence of SEQ ID NO: 46, 52, 118, 122, 126, 130, 134, 138, 142, 146, 150, 154, 158, 162, 166, 170, 174, 178.

Alternatively, the monoclonal antibody is an antibody that binds to the same epitope as TCN-032 (8I10), 21B15, TCN-031 (23K12), 3241_G23, 3244_I10, 3243_J07, 3259_J21, 3245_O19, 3244_H04, 3136_G05, 3252_C13, 3255_J06, 3420_I23, 3139_P23, 3248_P18, 3253_P10, 3260_D19, 3362_B11, or 3242_P05.

The heavy chain of a M2e antibody is derived from a germ line V (variable) gene such as, for example, the IgHV4 or the IgHV3 germline gene.

The M2e antibodies of the invention include a variable heavy chain (VH) region encoded by a human IgHV4 or the IgHV3 germline gene sequence. An IgHV4 germline gene sequence is shown, e.g., in Accession numbers L10088, M29812, M95114, X56360 and M95117. An IgHV3 germline gene sequence is shown, e.g., in Accession numbers X92218, X70208, Z27504, M99679 and AB019437. The M2e antibodies of the invention include a VH region that is encoded by a nucleic acid sequence that is at least 80% homologous to the IgHV4 or the IgHV3 germline gene sequence. Preferably, the nucleic acid sequence is at least 90%, 95%, 96%, 97% homologous to the IgHV4 or the IgHV3 germline gene sequence, and more preferably, at least 98%, 99% homologous to the IgHV4 or the IgHV3 germline gene sequence. The VH region of the M2e antibody is at least 80% homologous to the amino acid sequence of the VH region encoded by the IgHV4 or the IgHV3 VH germline gene sequence. Preferably, the amino acid sequence of VH region of the M2e antibody is at least 90%, 95%, 96%, 97% homologous to the amino acid sequence encoded by the IgHV4 or the IgHV3 germline gene sequence, and more preferably, at least 98%, 99% homologous to the sequence encoded by the IgHV4 or the IgHV3 germline gene sequence.

The M2e antibodies of the invention also include a variable light chain (VL) region encoded by a human IgKV1 germline gene sequence. A human IgKV1 VL germline gene sequence is shown, e.g., Accession numbers X59315, X59312, X59318, J00248, and Y14865. Alternatively, the M2e antibodies include a VL region that is encoded by a nucleic acid sequence that is at least 80% homologous to the IgKV1 germline gene sequence. Preferably, the nucleic acid sequence is at least 90%, 95%, 96%, 97% homologous to the IgKV1 germline gene sequence, and more preferably, at least 98%, 99% homologous to the IgKV1 germline gene sequence. The VL region of the M2e antibody is at least 80% homologous to the amino acid sequence of the VL region encoded the IgKV1 germline gene sequence. Preferably, the amino acid sequence of VL region of the M2e antibody is at least 90%, 95%, 96%, 97% homologous to the amino acid sequence encoded by the IgKV1 germline gene sequence, and more preferably, at least 98%, 99% homologous to the sequence encoded by e the IgKV1 germline gene sequence.

HA Antibodies I

The HA antibodies of the invention may also be capable of specifically binding to one or more fragments of influenza virus H5N1, such as the surface glycoproteins, hemagglutinin (HA) and neuraminidase (NA), which are required for viral attachment and cellular release, or membrane proteins (M1 and M2). In a specific embodiment, the HA antibodies of the invention are capable of specifically binding to the HA molecule of H5N1 strains. They may be capable of specifically binding to the HA1 and/or HA2 subunit of the HA molecule. They may be capable of specifically binding to linear or structural and/or conformational epitopes on the HA1 and/or HA2 subunit of the HA molecule. The HA molecule may be purified from viruses or recombinantly produced and optionally isolated before use. Alternatively, HA may be expressed on the surface of cells.

For diagnostic purposes, the HA antibodies may also be capable of specifically binding to proteins not present on the surface of H5N1 including the nucleoprotein, the nucleocapsid structural protein, polymerases (PA, PB and PB2), and non-structural proteins (NS1 and NS2). The nucleotide and/or amino acid sequence of proteins of various H5N1 strains can be found in the GenBank-database, NCBI Influenza Virus Sequence Database, Influenza Sequence Database (ISD), EMBL-database and/or other databases. It is well within the reach of the skilled person to find such sequences in the respective databases.

In another embodiment the HA antibodies of the invention are capable of specifically binding to a fragment of the above-mentioned proteins and/or polypeptides, wherein the fragment at least includes an antigenic determinant recognized by the HA antibodies of the invention. An “antigenic determinant” as used herein is a moiety that is capable of binding to an HA antibody of the invention with sufficiently high affinity to form a detectable antigen-antibody complex. As used herein, the terms “antigenic determinant” and “epitope” are equivalents. The HA antibodies of the invention may or may not be capable of specifically binding to the extracellular part of HA (also called herein soluble HA (sHA)).

The HA antibodies of the invention can be intact immunoglobulin molecules such as polyclonal or monoclonal antibodies or the HA antibodies can be antigen-binding fragments including, but not limited to, Fab, F(ab′), F(ab′)2, Fv, dAb, Fd, complementarity determining region (CDR) fragments, single-chain antibodies (scFv), bivalent single-chain antibodies, single-chain phage antibodies, diabodies, triabodies, tetrabodies, and (poly)peptides that contain at least a fragment of an immunoglobulin that is sufficient to confer specific antigen binding to influenza virus H5N1 strains or a fragment thereof. In a preferred embodiment the HA antibodies are human monoclonal antibodies.

HA antibodies can be used in non-isolated or isolated form. Furthermore, the HA antibodies can be used alone or in a mixture including at least one HA antibody (or variant or fragment thereof). Thus, HA antibodies can be used in combination, e.g., as a pharmaceutical composition comprising two or more antibodies of the invention, variants or fragments thereof. For example, antibodies having different, but complementary activities can be combined in a single therapy to achieve a desired prophylactic, therapeutic or diagnostic effect, but alternatively, antibodies having identical activities can also be combined in a single therapy to achieve a desired prophylactic, therapeutic or diagnostic effect. Optionally, the mixture further includes at least one other therapeutic agent. Preferably, the therapeutic agent such as, e.g., M2 inhibitors (e.g., amantidine, rimantadine) and/or neuraminidase inhibitors (e.g., zanamivir, oseltamivir) is useful in the prophylaxis and/or treatment of an influenza virus H5N1 infection.

Typically, HA antibodies can bind to their binding partners, i.e. influenza virus H5N1 or fragments thereof, with an affinity constant (Kd-value) that is lower than 0.2×10−4 M, 1.0×10−5 M, 1.0×10−6 M, 1.0×10−7 M, preferably lower than 1.0×10−5 M, more preferably lower than 1.0×10−9 M, more preferably lower than 1.0×10−10 M, even more preferably lower than 1.0×10−11 M, and in particular lower than 1.0×10−12 M. The affinity constants can vary for antibody isotypes. For example, affinity binding for an IgM isotype refers to a binding affinity of at least about 1.0×10−7 M. Affinity constants can for instance be measured using surface plasmon resonance, for example using the BIACORE system (Pharmacia Biosensor AB, Uppsala, Sweden).

HA antibodies may bind to influenza virus H5N1 or a fragment thereof in soluble form such as for instance in a sample or in suspension or may bind to influenza virus H5N1 or a fragment thereof bound or attached to a carrier or substrate, e.g., microtiter plates, membranes and beads, etc. Carriers or substrates may be made of glass, plastic (e.g., polystyrene), polysaccharides, nylon, nitrocellulose, or Teflon, etc. The surface of such supports may be solid or porous and of any convenient shape. Furthermore, the HA antibodies may bind to influenza virus H5N1 in purified/isolated or non purified/non-isolated form.

HA antibodies exhibit neutralizing activity. Neutralizing activity can for instance be measured as described in International Patent Application PCT/EP2007/059356 (Publication No. WO 2008/028946, the contents of which are incorporated herein in their entirety). Alternative assays measuring neutralizing activity are described in for instance WHO Manual on Animal Influenza Diagnosis and Surveillance, Geneva: World Health Organization, 2005, version 2002.5.

The invention relates to an isolated human HA antibody that recognizes and binds to an epitope in the HA2 subunit of the influenza haemagglutinin protein (HA), characterized in that said HA antibody has neutralizing activity against an influenza virus, for instance, including HA of the H5 subtype. Examples of influenza strains that contain such a HA of the H5 subtype and that are important strains in view of pandemic threats are H5N1, H5N2, H5N8, and H5N9. Particularly preferred are HA antibodies that at least neutralize the H5N1 influenza strain. Preferably, HA antibodies do not depend on an epitope in the HA1 subunit of the HA protein for binding to said HA protein.


The term “human HA antibody” describes an intact immunoglobulin including monoclonal antibodies, such as chimeric, humanized or human monoclonal antibodies, or to an antigen-binding and/or variable domain comprising fragment of an immunoglobulin that competes with the intact immunoglobulin for specific binding to the binding partner of the immunoglobulin, e.g. H5N1. Regardless of structure, the antigen binding fragment binds with the same antigen that is recognized by the intact immunoglobulin. An antigen-binding fragment can comprise a peptide or polypeptide comprising an amino acid sequence of at least 2, 5, 10, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, or 250 contiguous amino acid residues of the amino acid sequence of the HA antibody.

The term “HA antibody”, includes all immunoglobulin classes and subclasses known in the art. Depending on the amino acid sequence of the constant domain of their heavy chains, HA antibodies can be divided into the five major classes of intact antibodies: IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e.g., IgA1, IgA2, IgG1, IgG2, IgG3 and IgG4.

Antigen-binding fragments include, inter alia, Fab, F(ab′), F(ab′)2, Fv, dAb, Fd, complementarity determining region (CDR) fragments, single-chain antibodies (scFv), bivalent single-chain antibodies, single-chain phage antibodies, diabodies, triabodies, tetrabodies, (poly)peptides that contain at least a fragment of an immunoglobulin that is sufficient to confer specific antigen binding to the (poly)peptide, etc. The above fragments may be produced synthetically or by enzymatic or chemical cleavage of intact immunoglobulins or they may be genetically engineered by recombinant DNA techniques. The methods of production are well known in the art and are described, for example, in Antibodies: A Laboratory Manual, Edited by: E. Harlow and D, Lane (1988), Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., which is incorporated herein by reference. An HA antibody or antigen-binding fragment thereof may have one or more binding sites. If there is more than one binding site, the binding sites may be identical to one another or they may be different.

With respect to HA antibodies, the term “complementarity determining regions” (CDR) as used herein means sequences within the variable regions of HA antibodies, such as immunoglobulins, that usually contribute to a large extent to the antigen binding site which is complementary in shape and charge distribution to the epitope recognized on the antigen. The CDR regions of HA antibodies can be specific for linear epitopes, discontinuous epitopes, or conformational epitopes of proteins or protein fragments, either as present on the protein in its native conformation or, in some cases, as present on the proteins as denatured, e.g., by solubilization in SDS. Epitopes of HA antibodies may also consist of posttranslational modifications of proteins.

The term “functional variant”, as used herein, refers to an HA antibody that includes a nucleotide and/or amino acid sequence that is altered by one or more nucleotides and/or amino acids compared to the nucleotide and/or amino acid sequences of the parental HA antibody and that is still capable of competing for binding to the binding partner, e.g. H5N1, with the parental HA antibody. In other words, the modifications in the amino acid and/or nucleotide sequence of the parental HA antibody do not significantly affect or alter the binding characteristics of the HA antibody encoded by the nucleotide sequence or containing the amino acid sequence, i.e. the antibody is still able to recognize and bind its target. The functional variant may have conservative sequence modifications including nucleotide and amino acid substitutions, additions and deletions. These modifications can be introduced by standard techniques known in the art, such as site-directed mutagenesis and random PCR-mediated mutagenesis, and may include natural as well as non-natural nucleotides and amino acids.

Conservative amino acid substitutions include the ones in which the amino acid residue is replaced with an amino acid residue having similar structural or chemical properties. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), non-polar side chains (e.g., glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan). It will be clear to the skilled artisan that other classifications of amino acid residue families than the one used above can also be employed. Furthermore, a HA antibody functional variant may have non-conservative amino acid substitutions, e.g., replacement of an amino acid with an amino acid residue having different structural or chemical properties. Similar minor variations may also include amino acid deletions or insertions, or both. Guidance in determining which amino acid residues may be substituted, inserted, or deleted without abolishing immunological activity may be found using computer programs well known in the art.

A mutation in a nucleotide sequence can be a single alteration made at a locus (a point mutation), such as transition or transversion mutations, or alternatively, multiple nucleotides may be inserted, deleted or changed at a single locus. In addition, one or more alterations may be made at any number of loci within a nucleotide sequence. The mutations may be performed by any suitable method known in the art.

The term “human”, when applied to HA antibodies, refers to molecules that are either directly derived from a human or based upon a human sequence. When an HA antibody is derived from or based on a human sequence and subsequently modified, it is still to be considered human as used throughout the specification. In other words, the term human, when applied to HA antibodies is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences or based on variable or constant regions occurring in a human or human lymphocyte and modified in some form. Thus, the human HA antibodies may include amino acid residues not encoded by human germline immunoglobulin sequences, contain substitutions and/or deletions (e.g., mutations introduced by for instance random or site-specific mutagenesis in vitro or by somatic mutation in vivo). “Based on” as used herein refers to the situation that a nucleic acid sequence may be exactly copied from a template, or with minor mutations, such as by error-prone PCR methods, or synthetically made matching the template exactly or with minor modifications. Semi-synthetic molecules based on human sequences are also considered to be human as used herein.

Single Chain HA Antibodies

The heavy chain of an HA antibody is derived from a germ line V (variable) gene such as, for example, the VH1 or VH3 germline gene (see, Tomlinson I M, Williams S C, Ignatovitch O, Corbett S J, Winter G. V-BASE Sequence Directory. Cambridge, United Kingdom: MRC Centre for Protein Engineering (1997)). The HA antibodies of the invention include a VH region that is encoded by a nucleic acid sequence that is at least 80% homologous to the VH1 or VH3 germline gene sequence. Preferably, the nucleic acid sequence is at least 90%, 95%, 96%, 97% homologous to the VH1 or VH3 germline gene sequence, and more preferably, at least 98%, 99% homologous to the VH1 or VH3 germline gene sequence. The VH region of the HA antibody is at least 80% homologous to the amino acid sequence of the VH region encoded by the VH1 or VH3 VH germline gene sequence. Preferably, the amino acid sequence of VH region of the HA antibody is at least 90%, 95%, 96%, 97% homologous to the amino acid sequence encoded by the VH1 or VH3 germline gene sequence, and more preferably, at least 98%, 99% homologous to the sequence encoded by the VH1 or VH3 germline gene sequence.

In certain aspects of the invention the VH1 germline gene is VH1 (1-2), VH1 (1-18), VH1 (3-23), or VH1 (1-69). In other aspects of the invention the VH3 germline gene is VH3 (3-21)

The HA antibodies of the invention also include a variable light chain (VL) region encoded by a human germline gene sequence selected from the group consisting of VKI, VKII, VKIII, VKIV, VL1, VL2, and VL3 (see, Tomlinson I M, Williams S C, Ignatovitch O, Corbett S J, Winter G. V-BASE Sequence Directory. Cambridge, United Kingdom: MRC Centre for Protein Engineering (1997)). Alternatively, the HA antibodies include a VL region that is encoded by a nucleic acid sequence that is at least 80% homologous to the germline gene sequence of VKI, VKII, VKIII, VKIV, VL1, VL2, or VL3. Preferably, the nucleic acid sequence is at least 90%, 95%, 96%, 97% homologous to the germline gene sequence of VKI, VKII, VKIII, VKIV, VL1, VL2, or VL3, and more preferably, at least 98%, 99% homologous to the germline gene sequence of VKI, VKII, VKIII, VKIV, VL1, VL2, or VL3. The VL region of the HA antibody is at least 80% homologous to the amino acid sequence of the VL region encoded the germline gene sequence of VKI, VKII, VKIII, VKIV, VL1, VL2, or VL3. Preferably, the amino acid sequence of VL region of the HA antibody is at least 90%, 95%, 96%, 97% homologous to the amino acid sequence encoded by the germline gene sequence of VKI, VKII, VKIII, VKIV, VL1, VL2, or VL3, and more preferably, at least 98%, 99% homologous to the sequence encoded by the germline gene sequence of VKI, VKII, VKIII, VKIV, VL1, VL2, or VL3.

In certain aspects of the invention the VKI germline gene is VKI (A20), the VKII germline gene is VKII (A3), the VKIII germline gene is VKIII (A27), and the VKIV germline gene is VKIV (B3). In other aspects of the invention, the VL1 germline gene is VL1 (V1-13), VL1 (V1-16), VL1 (V1-17), or. VL1 (V1-19). Alternatively, the VL2 germline gene is VL2 (V1-3) or VL2 (V1-4). Furthermore, the VL3 germline gene is VL3 (V2-14).

Specific combinations of a VH and HL-locus are provided for each HA antibody described below.

The CDR regions of the HA antibodies of the invention were determined according to Kabat et al. (1991) as described in Sequences of Proteins of Immunological Interest. In certain embodiments of the invention, HA antibodies contain two, three, four, five or all six CDR regions as disclosed herein. Preferably, HA antibodies contain at least two of the CDRs disclosed herein.

The SC06-141 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 309) and a light chain variable region (SEQ ID NO: 310) encoded by the nucleic acid sequence shown in SEQ ID NO: 311 and the amino acid sequence shown in SEQ ID NO: 312. The VH-locus is VH1 (1-18) and the VL locus is HKIV (B3).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-141 antibody have the following CDR sequences: GYYVY (HCDR1, SEQ ID NO: 247), WISAYNGNTNYAQKFQG (HCDR2, SEQ ID NO: 248) and SRSLDV (HCDR3, SEQ ID NO: 568). The light chain CDRs of the SC06-141 antibody have the following CDR sequences: KSSQSVLYSSNNKNYLA (LCDR1, SEQ ID NO: 569), WASTRES (LCDR2, SEQ ID NO: 570) and QQYYSTPLT (LCDR3, SEQ ID NO: 289).

SC06-141 Nucleotide Sequence (SEQ ID NO: 311)

gaggtccagc tggtgcagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtc 60 tcctgcaagg cttctgggta caccttcacc ggctactatg tgtactgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggatgg atcagcgctt acaatggtaa cacaaactat 180 gcacagaagt tccagggcag agtcacgatt accgcggaca aatccacgag cacagcctac 240 atggagctga gcagcctgag atctgaagac acggctgtgt attactgtgc gagaagtaga 300 tccctggacg tctggggcca agggaccacg gtcaccgtct cgagcggtac gggcggttca 360 ggcggaaccg gcagcggcac tggcgggtcg acggatgttg tgatgactca gtctccagac 420 tccctggctg tgtctctggg cgagagggcc accatcaact gcaagtccag ccagagtgtt 480 ttatacagct ccaacaataa gaactactta gcttggtacc agcagaaacc aggacagcct 540 cctaagctgc tcatttactg ggcatctacc cgggaatccg gggtccctga ccgattcagt 600 ggcagcgggt ctgggacaga tttcactctc accatcagca gcctgcaggc tgaagatgtg 660 gcagtttatt actgtcagca atattatagt actcctctca ctttcggcgg agggaccaaa 720 gtggatatca aacgt 735

SC06-141 Amino Acid Sequence (SEQ ID NO: 312)


SC06-141 VH Amino Acid Sequence (SEQ ID NO: 309)


SC06-141 VL Amino Acid Sequence (SEQ ID NO: 310)


The SC06-255 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 313) and a light chain variable region (SEQ ID NO: 314) encoded by the nucleic acid sequence shown in SEQ ID NO: 315 and the amino acid sequence shown in SEQ ID NO: 316. The VH-locus is VH1 (1-69) and the VL locus is VL1 (V1-16).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-255 antibody have the following CDR sequences: SYAIS (HCDR1, SEQ ID NO: 571), GIIPIFGTTKYAPKFQG (HCDR2, SEQ ID NO: 572) and HMGYQVRETMDV (HCDR3, SEQ ID NO: 573). The light chain CDRs of the SC06-255 antibody have the following CDR sequences: SGSTFNIGSNAVD (LCDR1, SEQ ID NO: 574), SNNQRPS (LCDR2, SEQ ID NO: 575) and AAWDDILNVPV (LCDR3, SEQ ID NO: 576).

SC06-255 Nucleotide Sequence (SEQ ID NO: 315)

gaggtgcagc tggtggagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaagtc 60 tcttgcaagg cttctggagg ccccttccgc agctatgcta tcagctgggt gcgacaggcc 120 cctggacaag ggcctgagtg gatgggaggg atcatcccta tttttggtac aacaaaatac 180 gcaccgaagt tccagggcag agtcacgatt accgcggacg atttcgcggg cacagtttac 240 atggagctga gcagcctgcg atctgaggac acggccatgt actactgtgc gaaacatatg 300 gggtaccagg tgcgcgaaac tatggacgtc tggggcaaag ggaccacggt caccgtctcg 360 agcggtacgg gcggttcagg cggaaccggc agcggcactg gcgggtcgac gtcctatgtg 420 ctgactcagc caccctcagc gtctgggacc cccgggcaga gggtcaccat ctcttgttct 480 ggaagcacgt tcaacatcgg aagtaatgct gtagactggt accggcagct cccaggaacg 540 gcccccaaac tcctcatcta tagtaataat cagcggccct caggggtccc tgaccgattc 600 tctggctcca ggtctggcac ctcagcctcc ctggccatca gtgggctcca gtctgaggat 660 gaggctgatt attactgtgc agcatgggat gacatcctga atgttccggt attcggcgga 720 gggaccaagc tgaccgtcct aggt 744

SC06-255 Amino Acid Sequence (SEQ ID NO: 316)


SC06-255 VH Amino Acid Sequence (SEQ ID NO: 313)


SC06-255 VL Amino Acid Sequence (SEQ ID NO: 314)


The SC06-257 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 317) and a light chain variable region (SEQ ID NO: 318) encoded by the nucleic acid sequence shown in SEQ ID NO: 319 and the amino acid sequence shown in SEQ ID NO: 320. The VH-locus is VH1 (1-69) and the VL locus is VL2 (V1-4).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-257 antibody have the following CDR sequences: SYAIS (HCDR1, SEQ ID NO: 571), GIIPIFGTTKYAPKFQG (HCDR2, SEQ ID NO: 572) and HMGYQVRETMDV (HCDR3, SEQ ID NO: 573). The light chain CDRs of the SC06-257 antibody have the following CDR sequences: TGTSSDVGGYNYVS (LCDR1, SEQ ID NO: 577), EVSNRPS (LCDR2, SEQ ID NO: 578) and SSYTSSSTY (LCDR3, SEQ ID NO: 579).

SC06-257 Nucleotide Sequence (SEQ ID NO: 319)

caggtccagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaagtc 60 tcttgcaagg cttctggagg ccccttccgc agctatgcta tcagctgggt gcgacaggcc 120 cctggacaag ggcctgagtg gatgggaggg atcatcccta tttttggtac aacaaaatac 180 gcaccgaagt tccagggcag agtcacgatt accgcggacg atttcgcggg cacagtttac 240 atggagctga gcagcctgcg atctgaggac acggccatgt actactgtgc gaaacatatg 300 gggtaccagg tgcgcgaaac tatggacgtc tggggcaaag ggaccacggt caccgtctcg 360 agcggtacgg gcggttcagg cggaaccggc agcggcactg gcgggtcgac gcagtctgcc 420 ctgactcagc ctgccgccgt gtctgggtct cctggacagt cgatcaccat ctcctgcact 480 ggaaccagca gtgacgttgg tggttataac tatgtctcct ggtaccaaca gcacccaggc 540 aaagccccca aactcatgat ttatgaggtc agtaatcggc cctcaggggt ttctaatcgc 600 ttctctggct ccaagtctgg caacacggcc tccctgacca tctctgggct ccaggctgag 660 gacgaggctg attattactg cagctcatat acaagcagca gcacttatgt cttcggaact 720 gggaccaagg tcaccgtcct aggt 744

SC06-257 Amino Acid Sequence (SEQ ID NO: 320)


SC06-257 VH Amino Acid Sequence (SEQ ID NO: 317)


SC06-257 VL Amino Acid Sequence (SEQ ID NO: 318)


The SC6-260 HA-specific single-cham Fv antibody includes a heavy chain variable region (SEQ ID NO: 321) and a light chain variable region (SEQ ID NO: 322) encoded by the nucleic acid sequence shown in SEQ ID NO: 323 and the amino acid sequence shown in SEQ ID NO: 324. The VH-locus is VH1 (1-69) and the VL locus is VL1 (V1-17).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-260 antibody have the following CDR sequences: SYAIS (HCDR1, SEQ ID NO: 571), GIIPIFGTTKYAPKFQG (HCDR2, SEQ ID NO: 572) and HMGYQVRETMDV (HCDR3, SEQ ID NO: 573). The light chain CDRs of the SC06-260 antibody have the following CDR sequences: SGSRSNVGDNSVY (LCDR1, SEQ ID NO: 580), KNTQRPS (LCDR2, SEQ ID NO: 581) and VAWDDSVDGYV (LCDR3, SEQ ID NO: 582).

SC06-260 Nucleotide Sequence (SEQ ID NO: 323)

gaggtgcagc tggtggagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaagtc 60 tcttgcaagg cttctggagg ccccttccgc agctatgcta tcagctgggt gcgacaggcc 120 cctggacaag ggcctgagtg gatgggaggg atcatcccta tttttggtac aacaaaatac 180 gcaccgaagt tccagggcag agtcacgatt accgcggacg atttcgcggg cacagtttac 240 atggagctga gcagcctgcg atctgaggac acggccatgt actactgtgc gaaacatatg 300 gggtaccagg tgcgcgaaac tatggacgtc tggggcaaag ggaccacggt caccgtctcg 360 agcggtacgg gcggttcagg cggaaccggc agcggcactg gcgggtcgac gtcctatgtg 420 ctgactcagc caccctcagt ctctgggacc cccgggcaga gggtcaccat ctcttgctct 480 ggaagccgct ccaacgtcgg agataattct gtatattggt atcaacacgt cccagaaatg 540 gcccccaaac tcctcgtcta taagaatact caacggccct caggagtccc tgcccggttt 600 tccggctcca agtctggcac ttcagcctcc ctggccatca ttggcctcca gtccggcgat 660 gaggctgatt attattgtgt ggcatgggat gacagcgtag atggctatgt cttcggatct 720 gggaccaagg tcaccgtcct aggt 744

SC06-260 Amino Acid Sequence (SEQ ID NO: 324)


SC06-260 VH Amino Acid Sequence (SEQ ID NO: 321)


SC06-260 VL Amino Acid Sequence (SEQ ID NO: 322)


The SC06-261 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 325) and a light chain variable region (SEQ ID NO: 326) encoded by the nucleic acid sequence shown in SEQ ID NO: 327 and the amino acid sequence shown in SEQ ID NO: 328. The VH-locus is VH1 (1-69) and the VL locus is VL1 (V1-19).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-261 antibody have the following CDR sequences: SYAIS (HCDR1, SEQ ID NO: 571), GIIPIFGTTKYAPKFQG (HCDR2, SEQ ID NO: 572) and HMGYQVRETMDV (HCDR3, SEQ ID NO: 573). The light chain CDRs of the SC06-261 antibody have the following CDR sequences: SGSSSNIGNDYVS (LCDR1, SEQ ID NO: 583), DNNKRPS (LCDR2, SEQ ID NO: 584) and ATWDRRPTAYVV (LCDR3, SEQ ID NO: 585).

SC06-261 Nucleotide Sequence (SEQ ID NO: 327)

gaggtgcagc tggtggagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaagtc 60 tcttgcaagg cttctggagg ccccttccgc agctatgcta tcagctgggt gcgacaggcc 120 cctggacaag ggcctgagtg gatgggaggg atcatcccta tttttggtac aacaaaatac 180 gcaccgaagt tccagggcag agtcacgatt accgcggacg atttcgcggg cacagtttac 240 atggagctga gcagcctgcg atctgaggac acggccatgt actactgtgc gaaacatatg 300 gggtaccagg tgcgcgaaac tatggacgtc tggggcaaag ggaccacggt caccgtctcg 360 agcggtacgg gcggttcagg cggaaccggc agcggcactg gcgggtcgac gcagtctgtg 420 ttgacgcagc cgccctcagt gtctgcggcc ccaggacaga aggtcaccat ctcctgctct 480 ggaagcagct ccaacattgg gaatgattat gtatcctggt accagcagct cccaggaaca 540 gcccccaaac tcctcattta tgacaataat aagcgaccct cagggattcc tgaccgattc 600 tctggctcca agtctggcac gtcagccacc ctgggcatca ccggactcca gactggggac 660 gaggccaact attactgcgc aacatgggat cgccgcccga ctgcttatgt tgtcttcggc 720 ggagggacca agctgaccgt cctaggt 747

SC06-261 Amino Acid Sequence (SEQ ID NO: 328)


SC06-261 VH Amino Acid Sequence (SEQ ID NO: 325)


SC06-261 VL Amino Acid Sequence (SEQ ID NO: 326)


The SC06-262 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 329) and a light chain variable region (SEQ ID NO: 330) encoded by the nucleic acid sequence shown in SEQ ID NO: 331 and the amino acid sequence shown in SEQ ID NO: 332. The VH-locus is VH1 (1-69) and the VL locus is VKI (A20).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-262 antibody have the following CDR sequences: GSAIS (HCDR1, SEQ ID NO: 586), GISPLFGTTNYAQKFQG (HCDR2, SEQ ID NO: 587) and GPKYYSEYMDV (HCDR3, SEQ ID NO: 588). The light chain CDRs of the SC06-262 antibody have the following CDR sequences: RASQGISSYLA (LCDR1, SEQ ID NO: 589), DASTLRS (LCDR2, SEQ ID NO: 590) and QRYNSAPPI (LCDR3, SEQ ID NO: 591).

SC06-262 Nucleotide Sequence (SEQ ID NO: 331)

caggtacagc tgcagcagtc aggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg tttccggagt cattttcagc ggcagtgcga tcagctgggt gcgacaggcc 120 cctggacaag gccttgagtg gatgggaggg atcagccctc tctttggcac aacaaattac 180 gcacaaaagt tccagggcag agtcacgatt accgcggacc aatccacgaa cacaacctac 240 atggaggtga acagcctgag atatgaggac acggccgtgt atttctgtgc gcgaggtcca 300 aaatattaca gtgagtacat ggacgtctgg ggcaaaggga ccacggtcac cgtctcgagc 360 ggtacgggcg gttcaggcgg aaccggcagc ggcactggcg ggtcgacgga catccagatg 420 acccagtctc catcctccct gtctgcatct gtaggagaca gagtcaccat cacttgccgg 480 gcgagtcagg gcattagcag ttatttagcc tggtatcagc agaagccagg gaaagttcct 540 acactcctga tctatgatgc atccactttg cgatcagggg tcccatctcg cttcagtggc 600 agtggatctg cgacagattt cactctcacc atcagcagcc tgcagcctga agatgttgca 660 acttattact gtcaaaggta taacagtgcc cccccgatca ccttcggcca agggacacga 720 ctggagatta aacgt 735

SC06-262 Amino Acid Sequence (SEQ ID NO: 332)


SC06-262 VH Amino Acid Sequence (SEQ ID NO: 329)


SC06-262 VL Amino Acid Sequence (SEQ ID NO: 330)


The SC06-268 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 333) and a light chain variable region (SEQ ID NO: 334) encoded by the nucleic acid sequence shown in SEQ ID NO: 335 and the amino acid sequence shown in SEQ ID NO: 336. The VH-locus is VH1 (1-69) and the VL locus is VL3 (V2-14).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-268 antibody have the following CDR sequences: SYAIS (HCDR1, SEQ ID NO: 571), GIMGMFGTTNYAQKFQG (HCDR2, SEQ ID NO: 592) and SSGYYPEYFQD (HCDR3, SEQ ID NO: 593). The light chain CDRs of the SC06-268 antibody have the following CDR sequences: SGHKLGDKYVS (LCDR1, SEQ ID NO: 594), QDNRRPS (LCDR2, SEQ ID NO: 595) and QAWDSSTA (LCDR3, SEQ ID NO: 596).

SC06-268 Nucleotide Sequence (SEQ ID NO: 335)

caggtccagc tggtacagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cttctggagg caccttcagt agttatgcta tcagctgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggagga atcatgggta tgtttggcac aactaactac 180 gcacagaagt tccagggcag agtcacgatt accgcggacg aattcacgag cgcagcctac 240 atggagctga ggagcctgag atctgaggac acggccgtct actactgtgc gaggtctagt 300 ggttattacc ccgaatactt ccaggactgg ggccagggca ccctggtcac cgtctcgagc 360 ggtacgggcg gttcaggcgg aaccggcagc ggcactggcg ggtcgacgca gtctgtgctg 420 actcagccac cctcagagtc cgtgtcccca ggacagacag ccagcgtcac ctgctctgga 480 cataaattgg gggataaata tgtttcgtgg tatcagcaga agccaggcca gtcccctgta 540 ttactcatct atcaagataa caggcggccc tcagggatcc ctgagcgatt cataggctcc 600 aactctggga acacagccac tctgaccatc agcgggaccc aggctctgga tgaggctgac 660 tattactgtc aggcgtggga cagcagcact gcggttttcg gcggagggac caagctgacc 720 gtcctaggt 729

SC06-268 Amino Acid Sequence (SEQ ID NO: 336)


SC06-268 VH Amino Acid Sequence (SEQ ID NO: 333)


SC06-268 VL Amino Acid Sequence (SEQ ID NO: 334)


The SC06-272 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 337) and a light chain variable region (SEQ ID NO: 338) encoded by the nucleic acid sequence shown in SEQ ID NO: 339 and the amino acid sequence shown in SEQ ID NO: 340. The VH-locus is VH1 (1-69) and the VL locus is VL2 (V1-3).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-272 antibody have the following CDR sequences: SYAIT (HCDR1, SEQ ID NO: 597), GIIGMFGSTNYAQNFQG (HCDR2, SEQ ID NO: 598) and STGYYPAYLHH (HCDR3, SEQ ID NO: 599). The light chain CDRs of the SC06-272 antibody have the following CDR sequences: TGTSSDVGGYNYVS (LCDR1, SEQ ID NO: 577), DVSKRPS (LCDR2, SEQ ID NO: 601) and SSYTSSSTHV (LCDR3, SEQ ID NO: 602).

SC06-272 Nucleotide Sequence (SEQ ID NO: 339)

cagatgcagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cttctggagg caccttctcc agttatgcta tcacctgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggaggg atcatcggta tgtttggttc aacaaactac 180 gcacagaact tccagggcag agtcacgatt accgcggacg aatccacgag cacagcctac 240 atggagctga gcagcctcag atctgaggac acggccgtgt attactgtgc gagaagtact 300 ggttattacc ctgcatacct ccaccactgg ggccagggca ccctggtcac cgtctcgagc 360 ggtacgggcg gttcaggcgg aaccggcagc ggcactggcg ggtcgacgca gtctgccctg 420 actcagcctc gctcagtgtc cgggtctcct ggacagtcag tcaccatctc ctgcactgga 480 accagcagtg atgttggtgg ttataactat gtctcctggt accaacagca cccaggcaaa 540 gcccccaaac tcatgattta tgatgtcagt aagcggccct caggggtccc tgatcgcttc 600 tctggctcca agtctggcaa cacggcctcc ctgaccatct ctgggctcca ggctgaggat 660 gaggctgatt attactgcag ctcatataca agcagcagca ctcatgtctt cggaactggg 720 accaaggtca ccgtcctagg t 741

SC06-272 Amino Acid Sequence (SEQ ID NO: 340)


SC06-272 VH Amino Acid Sequence (SEQ ID NO: 337)


SC06-272 VL Amino Acid Sequence (SEQ ID NO: 338)


The SC06-296 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 341) and a light chain variable region (SEQ ID NO: 342) encoded by the nucleic acid sequence shown in SEQ ID NO: 343 and the amino acid sequence shown in SEQ ID NO: 344. The VH-locus is VH1 (1-2) and the VL locus is VKIII (A27).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-296 antibody have the following CDR sequences: SYYMH (HCDR1, SEQ ID NO: 603), WINPNSGGTNYAQKFQG (HCDR2, SEQ ID NO: 604) and EGKWGPQAAFDI (HCDR3, SEQ ID NO: 605). The light chain CDRs of the SC06-296 antibody have the following CDR sequences: RASQSVSSSYLA (LCDR1, SEQ ID NO: 646), DASSRAT (LCDR2, SEQ ID NO: 607) and QQYGSSLW (LCDR3, SEQ ID NO: 608).

SC06-296 Nucleotide Sequence (SEQ ID NO: 343)

gaggtgcagc tggtggagac cggggctgag gtgaagaagc ctggggcctc agtgaaggtt 60 tcctgcaagg catctggata caccttcacc agctactata tgcactgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggatgg atcaacccta acagtggtgg cacaaactat 180 gcacagaagt ttcagggcag ggtcaccatg accagggaca cgtccatcag cacagcctac 240 atggagctga gcaggctgag atctgacgac acggccgtgt attactgtgc gagagagggg 300 aaatggggac ctcaagcggc ttttgatatc tggggccaag ggacaatggt caccgtctcg 360 agcggtacgg gcggttcagg cggaaccggc agcggcactg gcgggtcgac ggaaattgtg 420 atgacgcagt ctccaggcac cctgtctttg tctccagggg aaagagccac cctctcctgc 480 agggccagtc agagtgttag cagcagctac ttagcctggt accagcagaa acctggccag 540 gctcccaggc tcctcatcta tgatgcatcc agcagggcca ctgacatccc agacaggttc 600 agtggcagtg ggtctgggac agacttcact ctcaccatca gcagactgga gcctgaagat 660 tttgcagtgt attactgtca gcagtatggt agctcacttt ggacgttcgg ccaagggacc 720 aaggtggaga tcaaacgt 738

SC06-296 Amino Acid Sequence (SEQ ID NO: 344)


SC06-296 VH amino acid sequence (SEQ ID NO: 341)


SC06-296 VL Amino Acid Sequence (SEQ ID NO: 342)


The SC06-301 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 345) and a light chain variable region (SEQ ID NO: 346) encoded by the nucleic acid sequence shown in SEQ ID NO: 347 and the amino acid sequence shown in SEQ ID NO: 348. The VH-locus is VH1 (3-23) and the VL locus is VKII (A3).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-301 antibody have the following CDR sequences: IYAMS (HCDR1, SEQ ID NO: 609), AISSSGDSTYYADSVKG (HCDR2, SEQ ID NO: 610) and AYGYTFDP (HCDR3, SEQ ID NO: 611). The light chain CDRs of the SC06-301 antibody have the following CDR sequences: RSSQSLLHSNGYNYLD (LCDR1, SEQ ID NO: 612), LGSNRAS (LCDR2, SEQ ID NO: 613) and MQALQTPL (LCDR3, SEQ ID NO: 614).

SC06-301 Nucleotide Sequence (SEQ ID NO: 347)

gaggtgcagc tggtagagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttagc atctatgcca tgagctgggt ccgccaggca 120 ccagggaagg ggctggagtg ggtctcagct attagtagta gtggtgatag cacatactac 180 gcagactccg tgaagggccg gttcaccatc tccagagaca acgccaggaa cacgctgtat 240 ctgcaaatga acagtctgag agccgaggac acggctgtgt attactgtgc gagagcgtat 300 ggctacacgt tcgacccctg gggccaggga accctggtca ccgtctcgag cggtacgggc 360 ggttcaggcg gaaccggcag cggcactggc gggtcgacgg aaattgtgct gactcagtct 420 ccactctccc tgcccgtcac ccctggagag ccggcctcca tctcctgcag gtctagtcag 480 agcctcctgc atagtaatgg atacaactat ttggattggt acctgcagaa gccagggcag 540 tctccacagc tcctgatcta tttgggttct aatcgggcct ccggggtccc tgacaggttc 600 agtggcagtg gatcaggcac agattttaca ctgaaaatca gcagagtgga ggctgaggat 660 gttggggttt attactgcat gcaagctcta caaactcccc tcactttcgg cggagggacc 720 aaggtggaga tcaaacgt 738

SC06-301 Amino Acid Sequence (SEQ ID NO: 348)


SC06-301 VH Amino Acid Sequence (SEQ ID NO: 345)


SC06-301 VL Amino Acid Sequence (SEQ ID NO: 346)


The SC06-307 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 349) and a light chain variable region (SEQ ID NO: 350) encoded by the nucleic acid sequence shown in SEQ ID NO: 351 and the amino acid sequence shown in SEQ ID NO: 352. The VH-locus is VH3 (3-21) and the VL locus is VKIII (A27).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-307 antibody have the following CDR sequences: SYSMN (HCDR1, SEQ ID NO: 615), SISSSSSYIYYVDSVKG (HCDR2, SEQ ID NO: 616) and GGGSYGAYEGFDY (HCDR3, SEQ ID NO: 617). The light chain CDRs of the SC06-307 antibody have the following CDR sequences: RASQRVSSYLA (LCDR1, SEQ ID NO: 618), GASTRAA (LCDR2, SEQ ID NO: 619) and QQYGRTPLT (LCDR3, SEQ ID NO: 620).

SC06-307 Nucleotide Sequence (SEQ ID NO: 351)

caggtccagc tggtgcagtc tgggggaggc ctggtcaagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt agctatagca tgaactgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcatcc attagtagta gtagtagtta catatactac 180 gtagactcag tgaagggccg attcaccatc tccagagaca acgccaagaa ctcactgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagaggtggt 300 gggagctacg gggcctacga aggctttgac tactggggcc agggcaccct ggtcaccgtc 360 tcgagcggta cgggcggttc aggcggaacc ggcagcggca ctggcgggtc gacggaaatt 420 gtgctgactc agtctccagg caccctgtct ttgtctccag gggaaagagc caccctctcc 480 tgcagggcca gtcagcgtgt tagcagctac ttagcctggt accaacagaa acctggccag 540 gctcccaggc tcctcatcta tggtgcatcc accagggccg ctggcatccc agacaggttc 600 agtggcagtg ggtctgggac agacttcact ctcaccatca gcagactgga gcctgaagat 660 tctgcagtgt attactgtca gcagtatggt aggacaccgc tcactttcgg cggagggacc 720 aaggtggaga tcaaacgt 738

SC06-307 Amino Acid Sequence (SEQ ID NO: 352)


SC06-307 VH Amino Acid Sequence (SEQ ID NO: 349)


SC06-307 VL Amino Acid Sequence (SEQ ID NO: 350)


The SC06-310 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 353) and a light chain variable region (SEQ ID NO: 354) encoded by the nucleic acid sequence shown in SEQ ID NO: 355 and the amino acid sequence shown in SEQ ID NO: 356. The VH-locus is VH1 (1-69) and the VL locus is VL3 (V2-14).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-310 antibody have the following CDR sequences: SYAIS (HCDR1, SEQ ID NO: 571), GIIPIFGTTKYAPKFQG (HCDR2, SEQ ID NO: 572) and HMGYQVRETMDV (HCDR3, SEQ ID NO: 573). The light chain CDRs of the SC06-310 antibody have the following CDR sequences: GGNNIGSKSVH (LCDR1, SEQ ID NO: 621), DDSDRPS (LCDR2, SEQ ID NO: 622) and QVWDSSSDHAV (LCDR3, SEQ ID NO: 623).

SC06-310 Nucleotide Sequence (SEQ ID NO: 355)

gaggtgcagc tggtggagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaagtc 60 tcttgcaagg cttctggagg ccccttccgc agctatgcta tcagctgggt gcgacaggcc 120 cctggacaag ggcctgagtg gatgggaggg atcatcccta tttttggtac aacaaaatac 180 gcaccgaagt tccagggcag agtcacgatt accgcggacg atttcgcggg cacagtttac 240 atggagctga gcagcctgcg atctgaggac acggccatgt actactgtgc gaaacatatg 300 gggtaccagg tgcgcgaaac tatggacgtc tggggcaaag ggaccacggt caccgtctcg 360 agcggtacgg gcggttcagg cggaaccggc agcggcactg gcgggtcgac gtcctatgtg 420 ctgactcagc caccctcggt gtcagtggcc ccaggacaga cggccaggat tacctgtggg 480 ggaaacaaca ttggaagtaa aagtgtgcac tggtaccagc agaagccagg ccaggcccct 540 gtgctggtcg tctatgatga tagcgaccgg ccctcaggga tccctgagcg attctctggc 600 tccaactctg ggaacacggc caccctgacc atcagcaggg tcgaagccgg ggatgaggcc 660 gactattact gtcaggtgtg ggatagtagt agtgatcatg ctgtgttcgg aggaggcacc 720 cagctgaccg tcctcggt 738

SC6-310 Amino Acid Sequence (SEQ ID NO: 356)


SC06-310 VH Amino Acid Sequence (SEQ ID NO: 353)


SC06-310 VL Amino Acid Sequence (SEQ ID NO: 354)


The SC06-314 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 357) and a light chain variable region (SEQ ID NO: 358) encoded by the nucleic acid sequence shown in SEQ ID NO: 359 and the amino acid sequence shown in SEQ ID NO: 360. The VH-locus is VH1 (1-69) and the VL locus is VL1 (V1-17).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-314 antibody have the following CDR sequences: SYAIS (HCDR1, SEQ ID NO: 571), GIIPIFGTTKYAPKFQG (HCDR2, SEQ ID NO: 572) and HMGYQVRETMDV (HCDR3, SEQ ID NO: 573). The light chain CDRs of the SC06-314 antibody have the following CDR sequences: SGSSSNIGSNYVY (LCDR1, SEQ ID NO: 624), RDGQRPS (LCDR2, SEQ ID NO: 625) and ATWDDNLSGPV (LCDR3, SEQ ID NO: 626).

SC06-314 Nucleotide Sequence (SEQ ID NO: 359)

gaggtgcagc tggtggagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaagtc 60 tcttgcaagg cttctggagg ccccttccgc agctatgcta tcagctgggt gcgacaggcc 120 cctggacaag ggcctgagtg gatgggaggg atcatcccta tttttggtac aacaaaatac 180 gcaccgaagt tccagggcag agtcacgatt accgcggacg atttcgcggg cacagtttac 240 atggagctga gcagcctgcg atctgaggac acggccatgt actactgtgc gaaacatatg 300 gggtaccagg tgcgcgaaac tatggacgtc tggggcaaag ggaccacggt caccgtctcg 360 agcggtacgg gcggttcagg cggaaccggc agcggcactg gcgggtcgac gtcctatgtg 420 ctgactcagc caccctcagc gtctgggacc cccgggcaga gggtcaccat ctcttgttct 480 ggaagcagct ccaacatcgg aagtaattat gtatactggt accagcagct cccaggcacg 540 gcccccaaac tcctcatcta tagggatggt cagcggccct caggggtccc tgaccgattc 600 tctggctcca agtctggcac ctcagcctcc ctggccatca gtggactccg gtccgatgat 660 gaggctgatt attactgtgc aacatgggat gacaacctga gtggtccagt attcggcgga 720 gggaccaagc tgaccgtcct aggt 744

SC06-314 Amino Acid Sequence (SEQ ID NO: 360)


SC06-314 VH Amino Acid Sequence (SEQ ID NO: 357)


SC06-314 VL Amino Acid Sequence (SEQ ID NO: 358)


The SC06-323 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 361) and a light chain variable region (SEQ ID NO: 362) encoded by the nucleic acid sequence shown in SEQ ID NO: 363 and the amino acid sequence shown in SEQ ID NO: 364. The VH-locus is VH1 (1-69) and the VL locus is VKIII (A27).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-323 antibody have the following CDR sequences: SYGIS (HCDR1, SEQ ID NO: 627), DIIGMFGSTNYAQNFQG (HCDR2, SEQ ID NO: 628) and SSGYYPAYLPH (HCDR3, SEQ ID NO: 629). The light chain CDRs of the SC06-323 antibody have the following CDR sequences: RASQSVSSSYLA (LCDR1, SEQ ID NO: 646), GASSRAT (LCDR2, SEQ ID NO: 631) and QQYGSSPRT (LCDR3, SEQ ID NO: 632).

SC06-323 Nucleotide Sequence (SEQ ID NO: 363)

gaggtgcagc tggtggagtc tggggctgag gtgaagaagc cagggtcctc ggtgaaggtc 60 tcctgtaagg cctctggagg caccttctcc agctatggta tcagctgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggagac atcatcggta tgtttggttc aacaaactac 180 gcacagaact tccagggcag actcacgatt accgcggacg aatccacgag cacagcctac 240 atggagctga gcagcctgag atctgaggac acggccgtgt attactgtgc gagaagtagt 300 ggttattacc ctgcatacct cccccactgg ggccagggca ccttggtcac cgtctcgagc 360 ggtacgggcg gttcaggcgg aaccggcagc ggcactggcg ggtcgacgga aattgtgttg 420 acccagtctc caggcaccct gtctttgtct ccaggggaaa gagccaccct ctcctgcagg 480 gccagtcaga gtgttagcag cagctactta gcctggtacc agcagaaacc tggccaggct 540 cccaggctcc tcatctatgg tgcatccagc agggccactg gcatcccaga caggttcagt 600 ggcagtgggt ctgggacaga cttcactctc accatcagca gactggagcc tgaagatttt 660 gcagtgtatt actgtcagca gtatggtagc tcacccagaa ctttcggcgg agggaccaag 720 gtggagatca aacgt 735

SC06-323 Amino Acid Sequence (SEQ ID NO: 364)


SC06-323 VH Amino Acid Sequence (SEQ ID NO: 361)


SC06-323 VL Amino Acid Sequence (SEQ ID NO: 362)


The SC06-325 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 365) and a light chain variable region (SEQ ID NO: 366) encoded by the nucleic acid sequence shown in SEQ ID NO: 367 and the amino acid sequence shown in SEQ ID NO: 368. The VH-locus is VH1 (1-69) and the VL locus is VL2 (V1-4).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-325 antibody have the following CDR sequences: FYSMS (HCDR1, SEQ ID NO: 633), GIIPMFGTTNYAQKFQG (HCDR2, SEQ ID NO: 634) and GDKGIYYYYMDV (HCDR3, SEQ ID NO: 635). The light chain CDRs of the SC06-325 antibody have the following CDR sequences: TGTSSDVGGYNYVS (LCDR1, SEQ ID NO: 577), EVSNRPS (LCDR2, SEQ ID NO: 578) and SSYTSSSTLV (LCDR3, SEQ ID NO: 636).

SC06-325 Nucleotide Sequence (SEQ ID NO: 367)

gaggtgcagc tggtggagtc tggggctgag gtgaagaagc cggggtcctc ggtgaaggtc 60 tcctgcaagg cttctggagg caccttcagc ttctattcta tgagctgggt gcgacaggcc 120 cctggacaag gacttgagtg gatgggaggg atcatcccta tgtttggtac aacaaactac 180 gcacagaagt tccagggcag agtcacgatt accgcggtcg aatccacgag cacagcctac 240 atggaggtga gcagcctgag atctgaggac acggccgttt attactgtgc gagaggtgat 300 aagggtatct actactacta catggacgtc tggggcaaag ggaccacggt caccgtctcg 360 agcggtacgg gcggttcagg cggaaccggc agcggcactg gcgggtcgac gcagtctgcc 420 ctgactcagc ctgcctccgt gtctgggtct cctggacagt cgatcaccat ctcctgcact 480 ggaaccagca gtgacgttgg tggttataac tatgtctcct ggtaccaaca gcacccaggc 540 aaagccccca aactcatgat ttatgaggtc agtaatcggc cctcaggggt ttctaatcgc 600 ttctctggct ccaagtctgg caacacggcc tccctgacca tctctgggct ccaggctgag 660 gacgaggctg attattactg cagctcatat acaagcagca gcactcttgt cttcggaact 720 gggaccaagg tcaccgtcct aggt 744

SC06-325 Amino Acid Sequence (SEQ ID NO: 368)


SC06-325 VH Amino Acid Sequence (SEQ ID NO: 365)


SC06-325 VL Amino Acid Sequence (SEQ ID NO: 366)


The SC06-327 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 369) and a light chain variable region (SEQ ID NO: 370) encoded by the nucleic acid sequence shown in SEQ ID NO: 371 and the amino acid sequence shown in SEQ ID NO: 372. The VH-locus is VH1 (1-69) and the VL locus is VL3 (V2-14).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-327 antibody have the following CDR sequences: THAIS (SEQ ID NO: 637), GIIAIFGTANYAQKFQG (SEQ ID NO: 638) and GSGYHISTPFDN (SEQ ID NO: 639). The light chain CDRs of the SC06-327 antibody have the following CDR sequences: GGNNIGSKGVH (SEQ ID NO: 640), DDSDRPS (SEQ ID NO: 622) and QVWDSSSDHVV (SEQ ID NO: 642).

SC06-327 Nucleotide Sequence (SEQ ID NO: 371)

gaggtgcagc tggtggagac cggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cctctggagg caccttcagg acccatgcta tcagttgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggaggg atcatcgcta tcttcggaac agcaaactac 180 gcacagaagt tccagggcag aatcacgatt accgcggacg aatccacgag tacagcctac 240 atggagctga gcagcctgag atctgaggac acggccgtgt atttctgtgc gagaggcagt 300 ggttatcata tatcgacacc ctttgacaac tggggccagg gaaccctggt caccgtctcg 360 agcggtacgg gcggttcagg cggaaccggc agcggcactg gcgggtcgac gtcctatgtg 420 ctgactcagc caccctcggt gtcagtggcc ccaggacaga cggccaggat tacctgtggg 480 ggaaacaaca ttggaagtaa aggtgtgcac tggtaccagc agaagcctgg ccaggcccct 540 gtgctggtcg tctatgatga tagcgaccgg ccctcaggga tccctgagcg attctctggc 600 tccaactctg ggaacacggc caccctgacc atcagcaggg tcgaagccgg ggatgaggcc 660 gactattact gtcaggtgtg ggatagtagt agtgatcatg tggtattcgg cggagggacc 720 aagctgaccg tcctaggt 738

SC06-327 Amino Acid Sequence (SEQ ID NO: 372)


SC06-327 VH Amino Acid Sequence (SEQ ID NO: 369)


SC06-327 VL Amino Acid Sequence (SEQ ID NO: 370)


The SC06-328 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 373) and a light chain variable region (SEQ ID NO: 374) encoded by the nucleic acid sequence shown in SEQ ID NO: 375 and the amino acid sequence shown in SEQ ID NO: 376. The VH-locus is VH1 (1-69) and the VL locus is VKIII (A27).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-328 antibody have the following CDR sequences: GYAIS (HCDR1, SEQ ID NO: 643), GIIPIFGTTNYAQKFQG (HCDR2, SEQ ID NO: 644) and VKDGYCTLTSCPVGWYFDL (HCDR3, SEQ ID NO: 645). The light chain CDRs of the SC06-328 antibody have the following CDR sequences: RASQSVSSSYLA (LCDR1, SEQ ID NO: 646), GASSRAT (LCDR2, SEQ ID NO: 631) and QQYGSSLT (LCDR3, SEQ ID NO: 648).

SC06-328 Nucleotide Sequence (SEQ ID NO: 375)

gaggtgcagc tggtggagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cttctggaca catcttcagc ggctatgcaa tcagttgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggaggg atcatcccta tctttggtac aacaaactac 180 gcacagaagt tccagggcag agtcacgatt accgcggacc aatccacgag cacagcctac 240 atggacctga gcaacttgag atctgaggac acggccgtct attactgtgc gagagtgaaa 300 gatggatatt gtactcttac cagctgccct gtcggctggt acttcgatct ctggggccgt 360 ggcaccctgg tcactgtctc gagcggtacg ggcggttcag gcggaaccgg cagcggcact 420 ggcgggtcga cggaaattgt gatgacgcag tctccaggca ccctgtcttt gtctccaggg 480 gaaagagcca ccctctcgtg cagggccagt cagagtgtta gcagcagcta cttagcctgg 540 taccagcaga aacctggcca ggctcccagg ctcctcatct ttggtgcctc cagcagggcc 600 actggcatcc cagacaggtt cagtggcagt gggtctggga cagacttcac tctcaccatc 660 agcagactgg agcctgaaga ttttgcagtg tattactgtc agcagtatgg tagctcactc 720 actttcggcg gagggaccaa gctggagatc aaacgt 756

SC06-328 Amino Acid Sequence (SEQ ID NO: 376)


SC06-328 VH Amino Acid Sequence (SEQ ID NO: 373)


SC06-328 VL Amino Acid Sequence (SEQ ID NO: 374)


The SC06-329 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 377) and a light chain variable region (SEQ ID NO: 378) encoded by the nucleic acid sequence shown in SEQ ID NO: 379 and the amino acid sequence shown in SEQ ID NO: 380. The VH-locus is VH1 (1-69) and the VL locus is VKIII (A27).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-329 antibody have the following CDR sequences: SNSIS (HCDR1, SEQ ID NO: 649), GIFALFGTTDYAQKFQG (HCDR2, SEQ ID NO: 650) and GSGYTTRNYFDY (HCDR3, SEQ ID NO: 651). The light chain CDRs of the SC06-329 antibody have the following CDR sequences: RASQSVSSNYLG (LCDR1, SEQ ID NO: 652), GASSRAS (LCDR2, SEQ ID NO: 653) and QQYGSSPLT (LCDR3, SEQ ID NO: 654).

SC06-329 Nucleotide Sequence (SEQ ID NO: 379)

gaggtccagc tggtacagtc tggggctgag gttaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cttctggagg catcttcaga agcaattcta tcagttgggt gcgacaggcc 120 cctgggcaag ggcttgagtg gatgggaggg atcttcgctc ttttcggaac aacagactac 180 gcgcagaagt tccagggcag agtcacgatt accgcggacg aatcttcgac cacagtctac 240 ctggagctga gtagcctgac atctgaggac acggccgttt attactgtgc gagaggcagt 300 ggctacacca cacgcaacta ctttgactac tggggccagg gcaccctggt caccgtctcg 360 agcggtacgg gcggttcagg cggaaccggc agcggcactg gcgggtcgac ggaaattgtg 420 ctgactcagt ctccaggcac cctgtctttg tctccagggg aaagagccac actctcctgc 480 agggccagtc agagtgttag cagcaactac ttaggctggt accagcagaa acctggccag 540 gctcccaggc tcctgatcta tggtgcatcc agcagggcca gtggcatccc agacaggttc 600 agtggcggtg ggtctgggac agacttcact ctcaccatca gcagactgga gcctgaagat 660 tttgcagtgt attactgtca gcagtatggt agctcacccc tcactttcgg cggagggacc 720 aaggtggaga tcaaacgt 738

SC06-329 Amino Acid Sequence (SEQ ID NO: 380)


SC06-329 VH Amino Acid Sequence (SEQ ID NO: 377)


SC06-329 VL Amino Acid Sequence (SEQ ID NO: 378)


The SC06-331 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 381) and a light chain variable region (SEQ ID NO: 382) encoded by the nucleic acid sequence shown in SEQ ID NO: 383 and the amino acid sequence shown in SEQ ID NO: 384. The VH-locus is VH1 (1-69) and the VL locus is VL3 (V2-14).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-331 lantibody have the following CDR sequences: SYAIS (HCDR1, SEQ ID NO: 571), GIIGMFGTANYAQKFQG (HCDR2, SEQ ID NO: 655) and GNYYYESSLDY (HCDR3, SEQ ID NO: 656). The light chain CDRs of the SC06-331 antibody have the following CDR sequences: GGNNIGSKSVH (LCDR1, SEQ ID NO: 621), DDSDRPS (LCDR2, SEQ ID NO: 622) and QVWDSSSDH (LCDR3, SEQ ID NO: 657).

SC06-331 Nucleotide Sequence (SEQ ID NO: 383)

gaggtgcagc tggtggagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cttctggagg caccttcagc agctatgcta tcagctgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggaggg atcatcggta tgttcggtac agcaaactac 180 gcacagaagt tccagggcag agtcacgatt accgcggacg aatttacgag cacagcctac 240 atggagctga gcagcctgag atctgaggac acggccgtgt attactgtgc gagaggaaat 300 tattactatg agagtagtct cgactactgg ggccagggaa ccctggtcac cgtctcgagc 360 ggtacgggcg gttcaggcgg aaccggcagc ggcactggcg ggtcgacgca gtctgtcgtg 420 acgcagccgc cctcggtgtc agtggcccca ggacagacgg ccaggattac ctgtggggga 480 aacaacattg gaagtaaaag tgtgcactgg taccagcaga agccaggcca ggcccctgtg 540 ctggtcgtct atgatgatag cgaccggccc tcagggatcc ctgagcgatt ctctggctcc 600 aactctggga acacggccac cctgaccatc agcagggtcg aagccgggga tgaggccgac 660 tattactgtc aggtgtggga tagtagtagt gatcattatg tcttcggaac tgggaccaag 720 gtcaccgtcc taggt 735

SC06-331 Amino Acid Sequence (SEQ ID NO: 384)


SC06-331 VH Amino Acid Sequence (SEQ ID NO: 381)


SC06-331 VL Amino Acid Sequence (SEQ ID NO: 382)


The SC06-332 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 385) and a light chain variable region (SEQ ID NO: 386) encoded by the nucleic acid sequence shown in SEQ ID NO: 387 and the amino acid sequence shown in SEQ ID NO: 388. The VH-locus is VH1 (1-69) and the VL locus is VKI (A20).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-332 antibody have the following CDR sequences: NFAIN (HCDR1, SEQ ID NO: 658), GIIAVFGTTKYAHKFQG (HCDR2, SEQ ID NO: 659) and GPHYYSSYMDV (HCDR3, SEQ ID NO: 660). The light chain CDRs of the SC06-332 antibody have the following CDR sequences: RASQGISTYLA (LCDR1, SEQ ID NO: 661), AASTLQS (LCDR2, SEQ ID NO: 662) and QKYNSAPS (LCDR3, SEQ ID NO: 663).

SC06-332 Nucleotide Sequence (SEQ ID NO: 387)

caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc ggtaaaggtc 60 tcctgcaagg cttctggagg ccccttccgc aattttgcta tcaactgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggaggg atcatcgctg tctttgggac gacaaagtac 180 gcacataagt tccagggcag agtcaccatc accgcggacg actccacaaa tacagcttac 240 atggagctgg gcagcctgaa atctgaggac acggccgtgt attactgtgc gagaggtccc 300 cactactact cctcctacat ggacgtctgg ggcgaaggga ccacggtcac cgtctcgagc 360 ggtacgggcg gttcaggcgg aaccggcagc ggcactggcg ggtcgacgga catccagttg 420 acccagtctc catcctccct gtctgcatct gtaggagaca gagtcaccat cacttgccgg 480 gcgagtcagg gcattagcac ttatttagcc tggtatcagc agaaacccgg gaaagttcct 540 aaactcctga tctatgctgc atccactttg caatcagggg tcccatctcg gttcagtggc 600 agtggatctg ggacagattt cactctcacc atcagcagcc tgcagcctga agatgttgca 660 acttattact gtcaaaagta taacagtgcc ccttctttcg gccctgggac caaagtggat 720 atcaaacgt 729

SC06-332 Amino Acid Sequence (SEQ ID NO: 388)


SC06-332 VH Amino Acid Sequence (SEQ ID NO: 385)


SC06-332 VL Amino Acid Sequence (SEQ ID NO: 386)


The SC06-334 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 389) and a light chain variable region (SEQ ID NO: 390) encoded by the nucleic acid sequence shown in SEQ ID NO: 391 and the amino acid sequence shown in SEQ ID NO: 392. The VH-locus is VH1 (1-69) and the VL locus is VL3 (V2-14).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-334 antibody have the following CDR sequences: SNAVS (HCDR1, SEQ ID NO: 664), GILGVFGSPSYAQKFQG (HCDR2, SEQ ID NO: 665) and GPTYYYSYMDV (HCDR3, SEQ ID NO: 666). The light chain CDRs of the SC06-334 antibody have the following CDR sequences: GGNNIGRNSVH (LCDR1, SEQ ID NO: 667), DDSDRPS (LCDR2, SEQ ID NO: 622) and QVWHSSSDHYV (LCDR3, SEQ ID NO: 669).

SC06-334 Nucleotide Sequence (SEQ ID NO: 391)

gaggtgcagc tggtggagac tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 ccctgcaaat cttctggaag ccccttcagg agtaatgctg tcagctgggt gcgacaggcc 120 cccggacaag ggcttgagtg ggtgggagga atcctcggtg tctttggttc accaagctac 180 gcacagaagt tccagggcag agtcacgatt accgcggacg aatccaccaa cacagtccac 240 atggagctga gaggtttgag atctgaggac acggccgtgt attattgtgc gagaggtcct 300 acctactact actcctacat ggacgtctgg ggcaaaggga ccacggtcac cgtctcgagc 360 ggtacgggcg gttcaggcgg aaccggcagc ggcactggcg ggtcgacgtc ctatgtgctg 420 actcagccac cctcggagtc agtggcccca ggacagacgg ccaggattac ctgtggggga 480 aataacattg gaagaaatag tgtgcactgg tatcagcaga agccaggcca ggcccctgtg 540 ctggtcgtgt atgatgatag cgaccggccc tcagggatcc ctgagcgatt ttctggctcc 600 aagtctggga acacggccac cctgattatc agcagggtcg aagtcgggga tgaggccgac 660 tactactgtc aggtgtggca tagtagtagt gatcattatg tcttcggaac tgggaccaag 720 gtcaccgtcc taggt 735

SC06-334 Amino Acid Sequence (SEQ ID NO: 392)


SC06-334 VH Amino Acid Sequence (SEQ ID NO: 389)


SC06-334 VL Amino Acid Sequence (SEQ ID NO: 390)


The SC06-336 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 393) and a light chain variable region (SEQ ID NO: 394) encoded by the nucleic acid sequence shown in SEQ ID NO: 395 and the amino acid sequence shown in SEQ ID NO: 396. The VH-locus is VH1 (1-69) and the VL locus is VKIII (A27).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-336 antibody have the following CDR sequences: SYAIS (HCDR1, SEQ ID NO: 670), GIFGMFGTANYAQKFQG (HCDR2, SEQ ID NO: 671) and SSGYYPQYFQD (HCDR3, SEQ ID NO: 672). The light chain CDRs of the SC06-336 antibody have the following CDR sequences: RASQSVSSSYLA (LCDR1, SEQ ID NO: 646), GASSRAT (LCDR2, SEQ ID NO: 631) and QQYGSSSLT (LCDR3, SEQ ID NO: 308).

SC06-336 Nucleotide Sequence (SEQ ID NO: 395)

cagatgcagc tggtacaatc tggagctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cttctggagg caccttcagc agctatgcta tcagctgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggaggg atcttcggta tgtttgggac agcaaactac 180 gcgcagaagt tccagggcag agtcacgatt accgcggacg aattcacgag cgcggcctac 240 atggagctga gcagcctggg atctgaggac acggccatgt attactgtgc gaggtctagt 300 ggttattacc cccaatactt ccaggactgg ggccagggca ccctggtcac cgtctcgagc 360 ggtacgggcg gttcaggcgg aaccggcagc ggcactggcg ggtcgacgga aattgtgatg 420 acacagtctc caggcaccct gtctttgtct ccagggcaaa gagccaccct ctcctgcagg 480 gccagtcaga gtgttagcag cagctactta gcctggtacc agcagaaacc tggccaggct 540 cccagactcc tcatgtatgg tgcatccagc agggccactg gcatcccaga caggttcagt 600 ggcagtgggt ctgggacaga cttcactctc accatcagca gactggagcc tgaagatttt 660 gcagtgtatt actgtcagca gtatggtagc tcatcgctca ctttcggcgg agggaccaag 720 ctggagatca aacgt 735

SC06-336 Amino Acid Sequence (SEQ ID NO: 396)


SC06-336 VH Amino Acid Sequence (SEQ ID NO: 393)


SC06-336 VL Amino Acid Sequence (SEQ ID NO: 394)


The SC06-339 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 397) and a light chain variable region (SEQ ID NO: 398) encoded by the nucleic acid sequence shown in SEQ ID NO: 399 and the amino acid sequence shown in SEQ ID NO: 400. The VH-locus is VH1 (1-69) and the VL locus is VL3 (V2-14).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-339 antibody have the following CDR sequences: SYAIS (HCDR1, SEQ ID NO: 303), GIIAIFHTPKYAQKFQG (HCDR2, SEQ ID NO: 306) and GSTYDFSSGLDY (HCDR3, SEQ ID NO: 725). The light chain CDRs of the SC06-339 antibody have the following CDR sequences: GGNNIGSKSVH (LCDR1, SEQ ID NO: 621), DDSDRPS (LCDR2, SEQ ID NO: 622) and QVWDSSSDHVV (LCDR3, SEQ ID NO: 642).

SC06-339 Nucleotide Sequence (SEQ ID NO: 399)

gaggtgcagc tggtggagtc cggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cttctggagg catcttcaac agttatgcta tcagctgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggaggc atcatcgcta tctttcatac accaaagtac 180 gcacagaagt tccagggcag agtcacgatt accgcggacg aatccacgaa cacagcctac 240 atggaactga gaagcctgaa atctgaggac acggccctgt attactgtgc gagagggtcc 300 acttacgatt tttcgagtgg ccttgactac tggggccagg gaaccctggt caccgtctcg 360 agcggtacgg gcggttcagg cggaaccggc agcggcactg gcgggtcgac gcaggcaggg 420 ctgactcagc caccctcggt gtcagtggcc ccaggacaga cggccaggat tacctgtggg 480 ggaaacaaca ttggaagtaa aagtgtgcac tggtaccagc agaagccagg ccaggcccct 540 gtcctagtcg tctatgatga tagcgaccgg ccctcaggga tccctgagcg attctctggc 600 tccaactctg ggaacacggc caccctgacc atcagcaggg tcgaagccgg ggatgaggcc 660 gactattact gtcaggtgtg ggatagtagt agtgatcatg tggtattcgg cggagggacc 720 aagctgaccg tcctaggt 738

SC06-339 Amino Acid Sequence (SEQ ID NO: 400)


SC06-339 VH Amino Acid Sequence (SEQ ID NO: 397)


SC06-339 VL Amino Acid Sequence (SEQ ID NO: 398)


The SC06-342 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 401) and a light chain variable region (SEQ ID NO: 402) encoded by the nucleic acid sequence shown in SEQ ID NO: 403 and the amino acid sequence shown in SEQ ID NO: 404. The VH-locus is VH1 (1-69) and the VL locus is VKIV (B3).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-342 antibody have the following CDR sequences: SYAIS (HCDR1, SEQ ID NO: 251), GVIPIFRTANYAQNFQG (HCDR2, SEQ ID NO: 249) and LNYHDSGTYYNAPRGWFDP (HCDR3, SEQ ID NO: 246). The light chain CDRs of the SC06-342 antibody have the following CDR sequences: KSSQSILNSSNNKNYLA (LCDR1, SEQ ID NO: 245), WASTRES (LCDR2, SEQ ID NO: 570) and QQYYSSPPT (LCDR3, SEQ ID NO: 250).

SC06-342 Nucleotide Sequence (SEQ ID NO: 403)

caggtccagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cttctggagg cttcttcagc agctatgcta tcagctgggt gcgccaggcc 120 cctggacaag gacttgagtg gatggggggg gtcatcccta tctttcgtac agcaaactac 180 gcacagaact tccagggcag agtcaccatt accgcggacg aattcacatc gtatatggag 240 ctgagcagcc tgagatctga cgacacggcc gtgtattact gtgcgaggtt gaattaccat 300 gattcgggga cttattataa cgccccccgg ggctggttcg acccctgggg ccagggaacc 360 ctggtcaccg tctcgagcgg tacgggcggt tcaggcggaa ccggcagcgg cactggcggg 420 tcgacggaca tccagatgac ccagtctcca gactccctgg ctgtgtctct gggcgagaag 480 gccaccatca actgcaagtc cagccagagt attttaaaca gctccaacaa taagaactac 540 ttagcttggt accagcagaa accaggacag cctcctaagc tgctcattta ctgggcatct 600 acccgggaat ccggggtccc tgaccgattc agtggcagcg ggtctgggac agatttcact 660 ctcaccatca gcagcctgca ggctgaagat gtggcagttt attactgtca gcaatattat 720 agtagtccgc cgacgttcgg ccaagggacc aaggtggaaa tcaaacgt 768

SC06-342 Amino Acid Sequence (SEQ ID NO: 404)


SC06-342 VH Amino Acid Sequence (SEQ ID NO: 401)


SC06-342 VL Amino Acid Sequence (SEQ ID NO: 402)


The SC06-343 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 405) and a light chain variable region (SEQ ID NO: 406) encoded by the nucleic acid sequence shown in SEQ ID NO: 407 and the amino acid sequence shown in SEQ ID NO: 408. The VH-locus is VH1 (1-69) and the VL locus is VL3 (V2-14).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-343 antibody have the following CDR sequences: YYAMS (HCDR1, SEQ ID NO: 242), GISPMFGTTTYAQKFQG (HCDR2, SEQ ID NO: 307) and SSNYYDSVYDY (HCDR3, SEQ ID NO: 290). The light chain CDRs of the SC06-343 antibody have the following CDR sequences: GGHNIGSNSVH (LCDR1, SEQ ID NO: 224), DNSDRPS (LCDR2, SEQ ID NO: 223) and QVWGSSSDH (LCDR3, SEQ ID NO: 227).

SC06-343 Nucleotide Sequence (SEQ ID NO: 407)

caggtccagc tggtgcagtc tggagctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cttctggagt caccttcagt tactatgcta tgagctgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggagga atcagcccta tgtttgggac aacaacctac 180 gcacagaagt tccagggcag agtcacgatt actgcggacg actccacgag tacagcctac 240 atggaggtga ggagcctgag atctgaggac acggccgtgt attactgtgc gagatcttcg 300 aattactatg atagtgtata tgactactgg ggccagggaa ccctggtcac cgtctcgagc 360 ggtacgggcg gttcaggcgg aaccggcagc ggcactggcg ggtcgacgca gtctgtcgtg 420 acgcagccgc cctcggagtc agtggcccca ggacagacgg ccaggattac ctgtggggga 480 cataacattg gaagtaatag tgtgcactgg taccagcaga agccaggcca ggcccctgtg 540 ctggtcgtgt atgataatag cgaccggccc tcagggatcc ctgagcgatt ctctggctcc 600 aactctggga acacggccac cctgaccatc agcagggtcg aagccgggga tgaggccgac 660 tattactgtc aggtgtgggg tagtagtagt gaccattatg tcttcggaac tgggaccaag 720 gtcaccgtcc taggt 735

SC06-343 Amino Acid Sequence (SEQ ID NO: 408)


SC06-343 VH Amino Acid Sequence (SEQ ID NO: 405)


SC06-343 VL Amino Acid Sequence (SEQ ID NO: 406)


The SC06-344 HA-specific single-chain Fv antibody includes a heavy chain variable region (SEQ ID NO: 409) and a light chain variable region (SEQ ID NO: 410) encoded by the nucleic acid sequence shown in SEQ ID NO: 411 and the amino acid sequence shown in SEQ ID NO: 412. The VH-locus is VH1 (1-69) and the VL locus is VL1 (V1-13).

The amino acids encompassing the CDRs are highlighted in bold in the sequences below. The heavy chain CDRs of the SC06-344 antibody have the following CDR sequences: NYAMS (HCDR1, SEQ ID NO: 222), GIIAIFGTPKYAQKFQG (HCDR2, SEQ ID NO: 221) and IPHYNFGSGSYFDY (HCDR3, SEQ ID NO: 220). The light chain CDRs of the SC06-344 antibody have the following CDR sequences: TGSSSNIGAGYDVH (LCDR1, SEQ ID NO: 219), GNSNRPS (LCDR2, SEQ ID NO: 231) and GTWDSSLSAYV (LCDR3, SEQ ID NO: 280).

SC06-344 Nucleotide Sequence (SEQ ID NO: 411)

caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc ggtgagagtc 60 tcctgcaagg cttctggaag catcttcaga aactatgcta tgagctgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggaggg atcatcgcta tttttgggac accaaagtac 180 gcacagaagt tccagggcag agtcacgatt accgcggacg aatcgacgag cactgtctac 240 atggaactga gcggactgag atctgaggac acggccatgt attactgtgc gaggattccc 300 cactataatt ttggttcggg gagttatttc gactactggg gccagggaac cctggtcacc 360 gtctcgagcg gtacgggcgg ttcaggcgga accggcagcg gcactggcgg gtcgacgact 420 gtgttgacac agccgccctc agtgtctggg gccccagggc agagggtcac catctcctgc 480 actgggagca gctccaacat cggggcaggt tatgatgtac actggtacca gcagcttcca 540 ggaacagccc ccaaactcct catctatggt aacagcaatc ggccctcagg ggtccctgac 600 cgattctctg gctccaagtc tggcacgtca gccaccctgg gcatcaccgg actccagact 660 ggggacgagg ccgattatta ctgcggaaca tgggatagca gcctgagtgc ttatgtcttc 720 ggaactggga ccaaggtcac cgtcctaggt 750

SC06-344 Amino Acid Sequence (SEQ ID NO: 412)


SC06-344 VH Amino Acid Sequence (SEQ ID NO: 409)


SC06-344 VL Amino Acid Sequence (SEQ ID NO: 410)


IgG HA Antibodies

The CR6141 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 199) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 279 and the heavy chain amino acid sequence shown in SEQ ID NO: 413. The CR6141 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 414) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 415 and the light chain amino acid sequence shown in SEQ ID NO: 416.

CR6141 Heavy Chain Nucleotide Sequence (SEQ ID NO: 279)

gaggtccagc tggtgcagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtc 60 tcctgcaagg cttctgggta caccttcacc ggctactatg tgtactgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggatgg atcagcgctt acaatggtaa cacaaactat 180 gcacagaagt tccagggcag agtcacgatt accgcggaca aatccacgag cacagcctac 240 atggagctga gcagcctgag atctgaagac acggctgtgt attactgtgc gagaagtaga 300 tccctggacg tctggggcca agggaccacg gtcaccgtct cgagtgctag caccaagggc 360 cccagcgtgt tccccctggc ccccagcagc aagagcacca gcggcggcac agccgccctg 420 ggctgcctgg tgaaggacta cttccccgag cccgtgaccg tgagctggaa cagcggcgcc 480 ttgaccagcg gcgtgcacac cttccccgcc gtgctgcaga gcagcggcct gtacagcctg 540 agcagcgtgg tgaccgtgcc cagcagcagc ctgggcaccc agacctacat ctgcaacgtg 600 aaccacaagc ccagcaacac caaggtggac aaacgcgtgg agcccaagag ctgcgacaag 660 acccacacct gccccccctg ccctgccccc gagctgctgg gcggaccctc cgtgttcctg 720 ttccccccca agcccaagga caccctcatg atcagccgga cccccgaggt gacctgcgtg 780 gtggtggacg tgagccacga ggaccccgag gtgaagttca actggtacgt ggacggcgtg 840 gaggtgcaca acgccaagac caagccccgg gaggagcagt acaacagcac ctaccgggtg 900 gtgagcgtgc tcaccgtgct gcaccaggac tggctgaacg gcaaggagta caagtgcaag 960 gtgagcaaca aggccctgcc tgcccccatc gagaagacca tcagcaaggc caagggccag 1020 ccccgggagc cccaggtgta caccctgccc cccagccggg aggagatgac caagaaccag 1080 gtgtccctca cctgtctggt gaagggcttc taccccagcg acatcgccgt ggagtgggag 1140 agcaacggcc agcccgagaa caactacaag accacccccc ctgtgctgga cagcgacggc 1200 agcttcttcc tgtacagcaa gctcaccgtg gacaagagcc ggtggcagca gggcaacgtg 1260 ttcagctgca gcgtgatgca cgaggccctg cacaaccact acacccagaa gagcctgagc 1320 ctgagccccg gcaag 1335

CR6141 Heavy Chain Amino Acid Sequence (SEQ ID NO: 413)


CR6141 VH Amino Acid Sequence (SEQ ID NO: 199)


CR6141 Light Chain Nucleotide Sequence (SEQ ID NO: 415)

gatgttgtga tgactcagtc tccagactcc ctggctgtgt ctctgggcga gagggccacc 60 atcaactgca agtccagcca gagtgtttta tacagctcca acaataagaa ctacttagct 120 tggtaccagc agaaaccagg acagcctcct aagctgctca tttactgggc atctacccgg 180 gaatccgggg tccctgaccg attcagtggc agcgggtctg ggacagattt cactctcacc 240 atcagcagcc tgcaggctga agatgtggca gtttattact gtcagcaata ttatagtact 300 cctctcactt tcggcggagg gaccaaagtg gatatcaaac gtgcggccgc acccagcgtg 360 ttcatcttcc ccccctccga cgagcagctg aagagcggca ccgccagcgt ggtgtgcctg 420 ctgaacaact tctacccccg ggaggccaag gtgcagtgga aggtggacaa cgccctgcag 480 agcggcaaca gccaggagag cgtgaccgag caggacagca aggactccac ctacagcctg 540 agcagcaccc tcaccctgag caaggccgac tacgagaagc acaaggtgta cgcctgcgag 600 gtgacccacc agggcctgag cagccccgtg accaagagct tcaaccgggg cgagtgt 657

CR6141 Light Chain Amino Acid Sequence (SEQ ID NO: 416)


CR6141 VL Amino Acid Sequence (SEQ ID NO: 414)


The CR6255 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 417) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 418 and the heavy chain amino acid sequence shown in SEQ ID NO: 419. The CR6255 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 420) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 421 and the light chain amino acid sequence shown in SEQ ID NO: 422.

CR6255 Heavy Chain Nucleotide Sequence (SEQ ID NO: 418)

gaggtgcagc tggtggagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaagtc 60 tcttgcaagg cttctggagg ccccttccgc agctatgcta tcagctgggt gcgacaggcc 120 cctggacaag ggcctgagtg gatgggaggg atcatcccta tttttggtac aacaaaatac 180 gcaccgaagt tccagggcag agtcacgatt accgcggacg atttcgcggg cacagtttac 240 atggagctga gcagcctgcg atctgaggac acggccatgt actactgtgc gaaacatatg 300 gggtaccagg tgcgcgaaac tatggacgtc tggggcaaag ggaccacggt caccgtctcg 360 agtgctagca ccaagggccc cagcgtgttc cccctggccc ccagcagcaa gagcaccagc 420 ggcggcacag ccgccctggg ctgcctggtg aaggactact tccccgagcc cgtgaccgtg 480 agctggaaca gcggcgcctt gaccagcggc gtgcacacct tccccgccgt gctgcagagc 540 agcggcctgt acagcctgag cagcgtggtg accgtgccca gcagcagcct gggcacccag 600 acctacatct gcaacgtgaa ccacaagccc agcaacacca aggtggacaa acgcgtggag 660 cccaagagct gcgacaagac ccacacctgc cccccctgcc ctgcccccga gctgctgggc 720 ggaccctccg tgttcctgtt cccccccaag cccaaggaca ccctcatgat cagccggacc 780 cccgaggtga cctgcgtggt ggtggacgtg agccacgagg accccgaggt gaagttcaac 840 tggtacgtgg acggcgtgga ggtgcacaac gccaagacca agccccggga ggagcagtac 900 aacagcacct accgggtggt gagcgtgctc accgtgctgc accaggactg gctgaacggc 960 aaggagtaca agtgcaaggt gagcaacaag gccctgcctg cccccatcga gaagaccatc 1020 agcaaggcca agggccagcc ccgggagccc caggtgtaca ccctgccccc cagccgggag 1080 gagatgacca agaaccaggt gtccctcacc tgtctggtga agggcttcta ccccagcgac 1140 atcgccgtgg agtgggagag caacggccag cccgagaaca actacaagac caccccccct 1200 gtgctggaca gcgacggcag cttcttcctg tacagcaagc tcaccgtgga caagagccgg 1260 tggcagcagg gcaacgtgtt cagctgcagc gtgatgcacg aggccctgca caaccactac 1320 acccagaaga gcctgagcct gagccccggc aag 1353

CR6255 Heavy Chain Amino Acid Sequence (SEQ ID NO: 419)


CR6255 VH Amino Acid Sequence (SEQ ID NO: 417)


CR6255 Light Chain Nucleotide Sequence (SEQ ID NO: 421)

tcctatgtgc tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 tcttgttctg gaagcacgtt caacatcgga agtaatgctg tagactggta ccggcagctc 120 ccaggaacgg cccccaaact cctcatctat agtaataatc agcggccctc aggggtccct 180 gaccgattct ctggctccag gtctggcacc tcagcctccc tggccatcag tgggctccag 240 tctgaggatg aggctgatta ttactgtgca gcatgggatg acatcctgaa tgttccggta 300 ttcggcggag ggaccaagct gaccgtccta ggtgcggccg caggccagcc caaggccgct 360 cccagcgtga ccctgttccc cccctcctcc gaggagctgc aggccaacaa ggccaccctg 420 gtgtgcctca tcagcgactt ctaccctggc gccgtgaccg tggcctggaa ggccgacagc 480 agccccgtga aggccggcgt ggagaccacc acccccagca agcagagcaa caacaagtac 540 gccgccagca gctacctgag cctcaccccc gagcagtgga agagccaccg gagctacagc 600 tgccaggtga cccacgaggg cagcaccgtg gagaagaccg tggcccccac cgagtgcagc 660

CR6255 Light Chain Amino Acid Sequence (SEQ ID NO: 422)


CR6255 VL Amino Acid Sequence (SEQ ID NO: 420)


The CR6257 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 423) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 424 and the heavy chain amino acid sequence shown in SEQ ID NO: 425. The CR6257 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 426) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 427 and the light chain amino acid sequence shown in SEQ ID NO: 428.

CR6257 Heavy Chain Nucleotide Sequence (SEQ ID NO: 424)

caggtccagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaagtc 60 tcttgcaagg cttctggagg ccccttccgc agctatgcta tcagctgggt gcgacaggcc 120 cctggacaag ggcctgagtg gatgggaggg atcatcccta tttttggtac aacaaaatac 180 gcaccgaagt tccagggcag agtcacgatt accgcggacg atttcgcggg cacagtttac 240 atggagctga gcagcctgcg atctgaggac acggccatgt actactgtgc gaaacatatg 300 gggtaccagg tgcgcgaaac tatggacgtc tggggcaaag ggaccacggt caccgtctcg 360 agtgctagca ccaagggccc cagcgtgttc cccctggccc ccagcagcaa gagcaccagc 420 ggcggcacag ccgccctggg ctgcctggtg aaggactact tccccgagcc cgtgaccgtg 480 agctggaaca gcggcgcctt gaccagcggc gtgcacacct tccccgccgt gctgcagagc 540 agcggcctgt acagcctgag cagcgtggtg accgtgccca gcagcagcct gggcacccag 600 acctacatct gcaacgtgaa ccacaagccc agcaacacca aggtggacaa acgcgtggag 660 cccaagagct gcgacaagac ccacacctgc cccccctgcc ctgcccccga gctgctgggc 720 ggaccctccg tgttcctgtt cccccccaag cccaaggaca ccctcatgat cagccggacc 780 cccgaggtga cctgcgtggt ggtggacgtg agccacgagg accccgaggt gaagttcaac 840 tggtacgtgg acggcgtgga ggtgcacaac gccaagacca agccccggga ggagcagtac 900 aacagcacct accgggtggt gagcgtgctc accgtgctgc accaggactg gctgaacggc 960 aaggagtaca agtgcaaggt gagcaacaag gccctgcctg cccccatcga gaagaccatc 1020 agcaaggcca agggccagcc ccgggagccc caggtgtaca ccctgccccc cagccgggag 1080 gagatgacca agaaccaggt gtccctcacc tgtctggtga agggcttcta ccccagcgac 1140 atcgccgtgg agtgggagag caacggccag cccgagaaca actacaagac caccccccct 1200 gtgctggaca gcgacggcag cttcttcctg tacagcaagc tcaccgtgga caagagccgg 1260 tggcagcagg gcaacgtgtt cagctgcagc gtgatgcacg aggccctgca caaccactac 1320 acccagaaga gcctgagcct gagccccggc aag 1353

CR6257 Heavy Chain Amino Acid Sequence (SEQ ID NO: 425)


CR6257 VH Amino Acid Sequence (SEQ ID NO: 423)


CR6257 Light Chain Nucleotide Sequence (SEQ ID NO: 427)

cagtctgccc tgactcagcc tgccgccgtg tctgggtctc ctggacagtc gatcaccatc 60 tcctgcactg gaaccagcag tgacgttggt ggttataact atgtctcctg gtaccaacag 120 cacccaggca aagcccccaa actcatgatt tatgaggtca gtaatcggcc ctcaggggtt 180 tctaatcgct tctctggctc caagtctggc aacacggcct ccctgaccat ctctgggctc 240 caggctgagg acgaggctga ttattactgc agctcatata caagcagcag cacttatgtc 300 ttcggaactg ggaccaaggt caccgtccta ggtgcggccg caggccagcc caaggccgct 360 cccagcgtga ccctgttccc cccctcctcc gaggagctgc aggccaacaa ggccaccctg 420 gtgtgcctca tcagcgactt ctaccctggc gccgtgaccg tggcctggaa ggccgacagc 480 agccccgtga aggccggcgt ggagaccacc acccccagca agcagagcaa caacaagtac 540 gccgccagca gctacctgag cctcaccccc gagcagtgga agagccaccg gagctacagc 600 tgccaggtga cccacgaggg cagcaccgtg gagaagaccg tggcccccac cgagtgcagc 660

CR6257 Light Chain Amino Acid Sequence (SEQ ID NO: 428)


CR6257 VL Amino Acid Sequence (SEQ ID NO: 426)


The CR6260 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 429) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 430 and the heavy chain amino acid sequence shown in SEQ ID NO: 431. The CR6260 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 432) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 433 and the light chain amino acid sequence shown in SEQ ID NO: 434.

CR6260 Heavy Chain Nucleotide Sequence (SEQ ID NO: 430)

gaggtgcagc tggtggagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaagtc 60 tcttgcaagg cttctggagg ccccttccgc agctatgcta tcagctgggt gcgacaggcc 120 cctggacaag ggcctgagtg gatgggaggg atcatcccta tttttggtac aacaaaatac 180 gcaccgaagt tccagggcag agtcacgatt accgcggacg atttcgcggg cacagtttac 240 atggagctga gcagcctgcg atctgaggac acggccatgt actactgtgc gaaacatatg 300 gggtaccagg tgcgcgaaac tatggacgtc tggggcaaag ggaccacggt caccgtctcg 360 agtgctagca ccaagggccc cagcgtgttc cccctggccc ccagcagcaa gagcaccagc 420 ggcggcacag ccgccctggg ctgcctggtg aaggactact tccccgagcc cgtgaccgtg 480 agctggaaca gcggcgcctt gaccagcggc gtgcacacct tccccgccgt gctgcagagc 540 agcggcctgt acagcctgag cagcgtggtg accgtgccca gcagcagcct gggcacccag 600 acctacatct gcaacgtgaa ccacaagccc agcaacacca aggtggacaa acgcgtggag 660 cccaagagct gcgacaagac ccacacctgc cccccctgcc ctgcccccga gctgctgggc 720 ggaccctccg tgttcctgtt cccccccaag cccaaggaca ccctcatgat cagccggacc 780 cccgaggtga cctgcgtggt ggtggacgtg agccacgagg accccgaggt gaagttcaac 840 tggtacgtgg acggcgtgga ggtgcacaac gccaagacca agccccggga ggagcagtac 900 aacagcacct accgggtggt gagcgtgctc accgtgctgc accaggactg gctgaacggc 960 aaggagtaca agtgcaaggt gagcaacaag gccctgcctg cccccatcga gaagaccatc 1020 agcaaggcca agggccagcc ccgggagccc caggtgtaca ccctgccccc cagccgggag 1080 gagatgacca agaaccaggt gtccctcacc tgtctggtga agggcttcta ccccagcgac 1140 atcgccgtgg agtgggagag caacggccag cccgagaaca actacaagac caccccccct 1200 gtgctggaca gcgacggcag cttcttcctg tacagcaagc tcaccgtgga caagagccgg 1260 tggcagcagg gcaacgtgtt cagctgcagc gtgatgcacg aggccctgca caaccactac 1320 acccagaaga gcctgagcct gagccccggc aag 1353

CR6260 Heavy Chain Amino Acid Sequence (SEQ ID NO: 431)


CR6260 VH Amino Acid Sequence (SEQ ID NO: 429)


CR6260 Light Chain Nucleotide Sequence (SEQ ID NO: 433)

tcctatgtgc tgactcagcc accctcagtc tctgggaccc ccgggcagag ggtcaccatc 60 tcttgctctg gaagccgctc caacgtcgga gataattctg tatattggta tcaacacgtc 120 ccagaaatgg cccccaaact cctcgtctat aagaatactc aacggccctc aggagtccct 180 gcccggtttt ccggctccaa gtctggcact tcagcctccc tggccatcat tggcctccag 240 tccggcgatg aggctgatta ttattgtgtg gcatgggatg acagcgtaga tggctatgtc 300 ttcggatctg ggaccaaggt caccgtccta ggtgcggccg caggccagcc caaggccgct 360 cccagcgtga ccctgttccc cccctcctcc gaggagctgc aggccaacaa ggccaccctg 420 gtgtgcctca tcagcgactt ctaccctggc gccgtgaccg tggcctggaa ggccgacagc 480 agccccgtga aggccggcgt ggagaccacc acccccagca agcagagcaa caacaagtac 540 gccgccagca gctacctgag cctcaccccc gagcagtgga agagccaccg gagctacagc 600 tgccaggtga cccacgaggg cagcaccgtg gagaagaccg tggcccccac cgagtgcagc 660

CR6260 Light Chain Amino Acid Sequence (SEQ ID NO: 434)


CR6260 VL Amino Acid Sequence (SEQ ID NO: 432)


The CR6261 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 435) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 436 and the heavy chain amino acid sequence shown in SEQ ID NO: 437. The CR6261 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 438) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 439 and the light chain amino acid sequence shown in SEQ ID NO: 440.

CR6261 Heavy Chain Nucleotide Sequence (SEQ ID NO: 436)

gaggtgcagc tggtggagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaagtc 60 tcttgcaagg cttctggagg ccccttccgc agctatgcta tcagctgggt gcgacaggcc 120 cctggacaag ggcctgagtg gatgggaggg atcatcccta tttttggtac aacaaaatac 180 gcaccgaagt tccagggcag agtcacgatt accgcggacg atttcgcggg cacagtttac 240 atggagctga gcagcctgcg atctgaggac acggccatgt actactgtgc gaaacatatg 300 gggtaccagg tgcgcgaaac tatggacgtc tggggcaaag ggaccacggt caccgtctcg 360 agtgctagca ccaagggccc cagcgtgttc cccctggccc ccagcagcaa gagcaccagc 420 ggcggcacag ccgccctggg ctgcctggtg aaggactact tccccgagcc cgtgaccgtg 480 agctggaaca gcggcgcctt gaccagcggc gtgcacacct tccccgccgt gctgcagagc 540 agcggcctgt acagcctgag cagcgtggtg accgtgccca gcagcagcct gggcacccag 600 acctacatct gcaacgtgaa ccacaagccc agcaacacca aggtggacaa acgcgtggag 660 cccaagagct gcgacaagac ccacacctgc cccccctgcc ctgcccccga gctgctgggc 720 ggaccctccg tgttcctgtt cccccccaag cccaaggaca ccctcatgat cagccggacc 780 cccgaggtga cctgcgtggt ggtggacgtg agccacgagg accccgaggt gaagttcaac 840 tggtacgtgg acggcgtgga ggtgcacaac gccaagacca agccccggga ggagcagtac 900 aacagcacct accgggtggt gagcgtgctc accgtgctgc accaggactg gctgaacggc 960 aaggagtaca agtgcaaggt gagcaacaag gccctgcctg cccccatcga gaagaccatc 1020 agcaaggcca agggccagcc ccgggagccc caggtgtaca ccctgccccc cagccgggag 1080 gagatgacca agaaccaggt gtccctcacc tgtctggtga agggcttcta ccccagcgac 1140 atcgccgtgg agtgggagag caacggccag cccgagaaca actacaagac caccccccct 1200 gtgctggaca gcgacggcag cttcttcctg tacagcaagc tcaccgtgga caagagccgg 1260 tggcagcagg gcaacgtgtt cagctgcagc gtgatgcacg aggccctgca caaccactac 1320 acccagaaga gcctgagcct gagccccggc aag 1353

CR6261 Heavy Chain Amino Acid Sequence (SEQ ID NO: 437)


CR6261 VH Amino Acid Sequence (SEQ ID NO: 435)


CR6261 Light Chain Nucleotide Sequence (SEQ ID NO: 439)

cagtctgtgt tgacgcagcc gccctcagtg tctgcggccc caggacagaa ggtcaccatc 60 tcctgctctg gaagcagctc caacattggg aatgattatg tatcctggta ccagcagctc 120 ccaggaacag cccccaaact cctcatttat gacaataata agcgaccctc agggattcct 180 gaccgattct ctggctccaa gtctggcacg tcagccaccc tgggcatcac cggactccag 240 actggggacg aggccaacta ttactgcgca acatgggatc gccgcccgac tgcttatgtt 300 gtcttcggcg gagggaccaa gctgaccgtc ctaggtgcgg ccgcaggcca gcccaaggcc 360 gctcccagcg tgaccctgtt ccccccctcc tccgaggagc tgcaggccaa caaggccacc 420 ctggtgtgcc tcatcagcga cttctaccct ggcgccgtga ccgtggcctg gaaggccgac 480 agcagccccg tgaaggccgg cgtggagacc accaccccca gcaagcagag caacaacaag 540 tacgccgcca gcagctacct gagcctcacc cccgagcagt ggaagagcca ccggagctac 600 agctgccagg tgacccacga gggcagcacc gtggagaaga ccgtggcccc caccgagtgc 660

CR6261 Light Chain Amino Acid Sequence (SEQ ID NO: 440)


CR6261 VL Amino Acid Sequence (SEQ ID NO: 438)


The CR6262 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 441) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 442 and the heavy chain amino acid sequence shown in SEQ ID NO: 443. The CR6262 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 444) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 445 and the light chain amino acid sequence shown in SEQ ID NO: 446.

CR6262 Heavy Chain Nucleotide Sequence (SEQ ID NO: 442)

caggtacagc tgcagcagtc aggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg tttccggagt cattttcagc ggcagtgcga tcagctgggt gcgacaggcc 120 cctggacaag gccttgagtg gatgggaggg atcagccctc tctttggcac aacaaattac 180 gcacaaaagt tccagggcag agtcacgatt accgcggacc aatccacgaa cacaacctac 240 atggaggtga acagcctgag atatgaggac acggccgtgt atttctgtgc gcgaggtcca 300 aaatattaca gtgagtacat ggacgtctgg ggcaaaggga ccacggtcac cgtctcgagt 360 gctagcacca agggccccag cgtgttcccc ctggccccca gcagcaagag caccagcggc 420 ggcacagccg ccctgggctg cctggtgaag gactacttcc ccgagcccgt gaccgtgagc 480 tggaacagcg gcgccttgac cagcggcgtg cacaccttcc ccgccgtgct gcagagcagc 540 ggcctgtaca gcctgagcag cgtggtgacc gtgcccagca gcagcctggg cacccagacc 600 tacatctgca acgtgaacca caagcccagc aacaccaagg tggacaaacg cgtggagccc 660 aagagctgcg acaagaccca cacctgcccc ccctgccctg cccccgagct gctgggcgga 720 ccctccgtgt tcctgttccc ccccaagccc aaggacaccc tcatgatcag ccggaccccc 780 gaggtgacct gcgtggtggt ggacgtgagc cacgaggacc ccgaggtgaa gttcaactgg 840 tacgtggacg gcgtggaggt gcacaacgcc aagaccaagc cccgggagga gcagtacaac 900 agcacctacc gggtggtgag cgtgctcacc gtgctgcacc aggactggct gaacggcaag 960 gagtacaagt gcaaggtgag caacaaggcc ctgcctgccc ccatcgagaa gaccatcagc 1020 aaggccaagg gccagccccg ggagccccag gtgtacaccc tgccccccag ccgggaggag 1080 atgaccaaga accaggtgtc cctcacctgt ctggtgaagg gcttctaccc cagcgacatc 1140 gccgtggagt gggagagcaa cggccagccc gagaacaact acaagaccac cccccctgtg 1200 ctggacagcg acggcagctt cttcctgtac agcaagctca ccgtggacaa gagccggtgg 1260 cagcagggca acgtgttcag ctgcagcgtg atgcacgagg ccctgcacaa ccactacacc 1320 cagaagagcc tgagcctgag ccccggcaag 1350

CR6262 Heavy Chain Amino Acid Sequence (SEQ ID NO: 443)


CR6262 VH Amino Acid Sequence (SEQ ID NO: 441)


CR6262 Light Chain Nucleotide Sequence (SEQ ID NO: 445)

gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgcc gggcgagtca gggcattagc agttatttag cctggtatca gcagaagcca 120 gggaaagttc ctacactcct gatctatgat gcatccactt tgcgatcagg ggtcccatct 180 cgcttcagtg gcagtggatc tgcgacagat ttcactctca ccatcagcag cctgcagcct 240 gaagatgttg caacttatta ctgtcaaagg tataacagtg cccccccgat caccttcggc 300 caagggacac gactggagat taaacgtgcg gccgcaccca gcgtgttcat cttccccccc 360 tccgacgagc agctgaagag cggcaccgcc agcgtggtgt gcctgctgaa caacttctac 420 ccccgggagg ccaaggtgca gtggaaggtg gacaacgccc tgcagagcgg caacagccag 480 gagagcgtga ccgagcagga cagcaaggac tccacctaca gcctgagcag caccctcacc 540 ctgagcaagg ccgactacga gaagcacaag gtgtacgcct gcgaggtgac ccaccagggc 600 ctgagcagcc ccgtgaccaa gagcttcaac cggggcgagt gt 642

CR6262 Light Chain Amino Acid Sequence (SEQ ID NO: 446)


CR6262 VL Amino Acid Sequence (SEQ ID NO: 444)


The CR6268 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 447) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 448 and the heavy chain amino acid sequence shown in SEQ ID NO: 449. The CR6268 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 450) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 451 and the light chain amino acid sequence shown in SEQ ID NO: 452.

CR6268 Heavy Chain Nucleotide Sequence (SEQ ID NO: 448)

caggtccagc tggtacagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cttctggagg caccttcagt agttatgcta tcagctgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggagga atcatgggta tgtttggcac aactaactac 180 gcacagaagt tccagggcag agtcacgatt accgcggacg aattcacgag cgcagcctac 240 atggagctga ggagcctgag atctgaggac acggccgtct actactgtgc gaggtctagt 300 ggttattacc ccgaatactt ccaggactgg ggccagggca ccctggtcac cgtctcgagt 360 gctagcacca agggccccag cgtgttcccc ctggccccca gcagcaagag caccagcggc 420 ggcacagccg ccctgggctg cctggtgaag gactacttcc ccgagcccgt gaccgtgagc 480 tggaacagcg gcgccttgac cagcggcgtg cacaccttcc ccgccgtgct gcagagcagc 540 ggcctgtaca gcctgagcag cgtggtgacc gtgcccagca gcagcctggg cacccagacc 600 tacatctgca acgtgaacca caagcccagc aacaccaagg tggacaaacg cgtggagccc 660 aagagctgcg acaagaccca cacctgcccc ccctgccctg cccccgagct gctgggcgga 720 ccctccgtgt tcctgttccc ccccaagccc aaggacaccc tcatgatcag ccggaccccc 780 gaggtgacct gcgtggtggt ggacgtgagc cacgaggacc ccgaggtgaa gttcaactgg 840 tacgtggacg gcgtggaggt gcacaacgcc aagaccaagc cccgggagga gcagtacaac 900 agcacctacc gggtggtgag cgtgctcacc gtgctgcacc aggactggct gaacggcaag 960 gagtacaagt gcaaggtgag caacaaggcc ctgcctgccc ccatcgagaa gaccatcagc 1020 aaggccaagg gccagccccg ggagccccag gtgtacaccc tgccccccag ccgggaggag 1080 atgaccaaga accaggtgtc cctcacctgt ctggtgaagg gcttctaccc cagcgacatc 1140 gccgtggagt gggagagcaa cggccagccc gagaacaact acaagaccac cccccctgtg 1200 ctggacagcg acggcagctt cttcctgtac agcaagctca ccgtggacaa gagccggtgg 1260 cagcagggca acgtgttcag ctgcagcgtg atgcacgagg ccctgcacaa ccactacacc 1320 cagaagagcc tgagcctgag ccccggcaag 1350

CR6268 Heavy Chain Amino Acid Sequence (SEQ ID NO: 449)


CR6268 VH Amino Acid Sequence (SEQ ID NO: 447)


CR6268 Light Chain Nucleotide Sequence (SEQ ID NO: 451)

cagtctgtgc tgactcagcc accctcagag tccgtgtccc caggacagac agccagcgtc 60 acctgctctg gacataaatt gggggataaa tatgtttcgt ggtatcagca gaagccaggc 120 cagtcccctg tattactcat ctatcaagat aacaggcggc cctcagggat ccctgagcga 180 ttcataggct ccaactctgg gaacacagcc actctgacca tcagcgggac ccaggctctg 240 gatgaggctg actattactg tcaggcgtgg gacagcagca ctgcggtttt cggcggaggg 300 accaagctga ccgtcctagg tgcggccgca ggccagccca aggccgctcc cagcgtgacc 360 ctgttccccc cctcctccga ggagctgcag gccaacaagg ccaccctggt gtgcctcatc 420 agcgacttct accctggcgc cgtgaccgtg gcctggaagg ccgacagcag ccccgtgaag 480 gccggcgtgg agaccaccac ccccagcaag cagagcaaca acaagtacgc cgccagcagc 540 tacctgagcc tcacccccga gcagtggaag agccaccgga gctacagctg ccaggtgacc 600 cacgagggca gcaccgtgga gaagaccgtg gcccccaccg agtgcagc 648

CR6268 Light Chain Amino Acid Sequence (SEQ ID NO: 452)


CR6268 VL Amino Acid Sequence (SEQ ID NO: 450)


The CR6272 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 453) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 454 and the heavy chain amino acid sequence shown in SEQ ID NO: 455. The CR6272 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 456) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 457 and the light chain amino acid sequence shown in SEQ ID NO: 458.

CR6272 Heavy Chain Nucleotide Sequence (SEQ ID NO: 454)

cagatgcagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cttctggagg caccttctcc agttatgcta tcacctgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggaggg atcatcggta tgtttggttc aacaaactac 180 gcacagaact tccagggcag agtcacgatt accgcggacg aatccacgag cacagcctac 240 atggagctga gcagcctcag atctgaggac acggccgtgt attactgtgc gagaagtact 300 ggttattacc ctgcatacct ccaccactgg ggccagggca ccctggtcac cgtctcgagt 360 gctagcacca agggccccag cgtgttcccc ctggccccca gcagcaagag caccagcggc 420 ggcacagccg ccctgggctg cctggtgaag gactacttcc ccgagcccgt gaccgtgagc 480 tggaacagcg gcgccttgac cagcggcgtg cacaccttcc ccgccgtgct gcagagcagc 540 ggcctgtaca gcctgagcag cgtggtgacc gtgcccagca gcagcctggg cacccagacc 600 tacatctgca acgtgaacca caagcccagc aacaccaagg tggacaaacg cgtggagccc 660 aagagctgcg acaagaccca cacctgcccc ccctgccctg cccccgagct gctgggcgga 720 ccctccgtgt tcctgttccc ccccaagccc aaggacaccc tcatgatcag ccggaccccc 780 gaggtgacct gcgtggtggt ggacgtgagc cacgaggacc ccgaggtgaa gttcaactgg 840 tacgtggacg gcgtggaggt gcacaacgcc aagaccaagc cccgggagga gcagtacaac 900 agcacctacc gggtggtgag cgtgctcacc gtgctgcacc aggactggct gaacggcaag 960 gagtacaagt gcaaggtgag caacaaggcc ctgcctgccc ccatcgagaa gaccatcagc 1020 aaggccaagg gccagccccg ggagccccag gtgtacaccc tgccccccag ccgggaggag 1080 atgaccaaga accaggtgtc cctcacctgt ctggtgaagg gcttctaccc cagcgacatc 1140 gccgtggagt gggagagcaa cggccagccc gagaacaact acaagaccac cccccctgtg 1200 ctggacagcg acggcagctt cttcctgtac agcaagctca ccgtggacaa gagccggtgg 1260 cagcagggca acgtgttcag ctgcagcgtg atgcacgagg ccctgcacaa ccactacacc 1320 cagaagagcc tgagcctgag ccccggcaag 1350

CR6272 Heavy Chain Amino Acid Sequence (SEQ ID NO: 455)


CR6272 VH Amino Acid Sequence (SEQ ID NO: 453)


CR6272 Light Chain Nucleotide Sequence (SEQ ID NO: 457)

cagtctgccc tgactcagcc tcgctcagtg tccgggtctc ctggacagtc agtcaccatc 60 tcctgcactg gaaccagcag tgatgttggt ggttataact atgtctcctg gtaccaacag 120 cacccaggca aagcccccaa actcatgatt tatgatgtca gtaagcggcc ctcaggggtc 180 cctgatcgct tctctggctc caagtctggc aacacggcct ccctgaccat ctctgggctc 240 caggctgagg atgaggctga ttattactgc agctcatata caagcagcag cactcatgtc 300 ttcggaactg ggaccaaggt caccgtccta ggtgcggccg caggccagcc caaggccgct 360 cccagcgtga ccctgttccc cccctcctcc gaggagctgc aggccaacaa ggccaccctg 420 gtgtgcctca tcagcgactt ctaccctggc gccgtgaccg tggcctggaa ggccgacagc 480 agccccgtga aggccggcgtg gagaccacc acccccagca agcagagcaa caacaagtac 540 gccgccagca gctacctgag cctcaccccc gagcagtgga agagccaccg gagctacagc 600 tgccaggtga cccacgaggg cagcaccgtg gagaagaccg tggcccccac cgagtgcagc 660

CR6272 Light Chain Amino Acid Sequence (SEQ ID NO: 458)


CR6272 VL Amino Acid Sequence (SEQ ID NO: 456)


The CR696 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 459) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 460 and the heavy chain amino acid sequence shown in SEQ ID NO: 461. The CR6296 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 462) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 463 and the light chain amino acid sequence shown in SEQ ID NO: 464.

CR6296 Heavy Chain Nucleotide Sequence (SEQ ID NO: 460)

gaggtgcagc tggtggagac cggggctgag gtgaagaagc ctggggcctc agtgaaggtt 60 tcctgcaagg catctggata caccttcacc agctactata tgcactgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggatgg atcaacccta acagtggtgg cacaaactat 180 gcacagaagt ttcagggcag ggtcaccatg accagggaca cgtccatcag cacagcctac 240 atggagctga gcaggctgag atctgacgac acggccgtgt attactgtgc gagagagggg 300 aaatggggac ctcaagcggc ttttgatatc tggggccaag ggacaatggt caccgtctcg 360 agtgctagca ccaagggccc cagcgtgttc cccctggccc ccagcagcaa gagcaccagc 420 ggcggcacag ccgccctggg ctgcctggtg aaggactact tccccgagcc cgtgaccgtg 480 agctggaaca gcggcgcctt gaccagcggc gtgcacacct tccccgccgt gctgcagagc 540 agcggcctgt acagcctgag cagcgtggtg accgtgccca gcagcagcct gggcacccag 600 acctacatct gcaacgtgaa ccacaagccc agcaacacca aggtggacaa acgcgtggag 660 cccaagagct gcgacaagac ccacacctgc cccccctgcc ctgcccccga gctgctgggc 720 ggaccctccg tgttcctgtt cccccccaag cccaaggaca ccctcatgat cagccggacc 780 cccgaggtga cctgcgtggt ggtggacgtg agccacgagg accccgaggt gaagttcaac 840 tggtacgtgg acggcgtgga ggtgcacaac gccaagacca agccccggga ggagcagtac 900 aacagcacct accgggtggt gagcgtgctc accgtgctgc accaggactg gctgaacggc 960 aaggagtaca agtgcaaggt gagcaacaag gccctgcctg cccccatcga gaagaccatc 1020 agcaaggcca agggccagcc ccgggagccc caggtgtaca ccctgccccc cagccgggag 1080 gagatgacca agaaccaggt gtccctcacc tgtctggtga agggcttcta ccccagcgac 1140 atcgccgtgg agtgggagag caacggccag cccgagaaca actacaagac caccccccct 1200 gtgctggaca gcgacggcag cttcttcctg tacagcaagc tcaccgtgga caagagccgg 1260 tggcagcagg gcaacgtgtt cagctgcagc gtgatgcacg aggccctgca caaccactac 1320 acccagaaga gcctgagcct gagccccggc aag 1353

CR6296 Heavy Chain Amino Acid Sequence (SEQ ID NO: 461)


CR6296 VH Amino Acid Sequence (SEQ ID NO: 459)


CR6296 Light Chain Nucleotide Sequence (SEQ ID NO: 463)

gaaattgtga tgacgcagtc tccaggcacc ctgtctttgt ctccagggga aagagccacc 60 ctctcctgca gggccagtca gagtgttagc agcagctact tagcctggta ccagcagaaa 120 cctggccagg ctcccaggct cctcatctat gatgcatcca gcagggccac tgacatccca 180 gacaggttca gtggcagtgg gtctgggaca gacttcactc tcaccatcag cagactggag 240 cctgaagatt ttgcagtgta ttactgtcag cagtatggta gctcactttg gacgttcggc 300 caagggacca aggtggagat caaacgtgcg gccgcaccca gcgtgttcat cttccccccc 360 tccgacgagc agctgaagag cggcaccgcc agcgtggtgt gcctgctgaa caacttctac 420 ccccgggagg ccaaggtgca gtggaaggtg gacaacgccc tgcagagcgg caacagccag 480 gagagcgtga ccgagcagga cagcaaggac tccacctaca gcctgagcag caccctcacc 540 ctgagcaagg ccgactacga gaagcacaag gtgtacgcct gcgaggtgac ccaccagggc 600 ctgagcagcc ccgtgaccaa gagcttcaac cggggcgagt gt 642

CR6296 Light Chain Amino Acid Sequence (SEQ ID NO: 464)


CR6296 VL Amino Acid Sequence (SEQ ID NO: 462)


The CR6301 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 465) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 466 and the heavy chain amino acid sequence shown in SEQ ID NO: 467. The CR6301 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 468) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 469 and the light chain amino acid sequence shown in SEQ ID NO: 470.

CR6301 Heavy Chain nucleotide sequence (SEQ ID NO: 466)

gaggtgcagctggtagagtctgggggaggcttggtacagcctggggggtccctgagactc 60 tcctgtgcagcctctggattcacctttagcatctatgccatgagctgggtccgccaggca 120 ccagggaaggggctggagtgggtctcagctattagtagtagtggtgatagcacatactac 180 gcagactccgtgaagggccggttcaccatctccagagacaacgccaggaacacgctgtat 240 ctgcaaatgaacagtctgagagccgaggacacggctgtgtattactgtgcgagagcgtat 300 ggctacacgttcgacccctggggccagggaaccctggtcaccgtctcgagtgctagcacc 360 aagggccccagcgtgttccccctggcccccagcagcaagagcaccagcggcggcacagcc 420 gccctgggctgcctggtgaaggactacttccccgagcccgtgaccgtgagctggaacagc 480 ggcgccttgaccagcggcgtgcacaccttccccgccgtgctgcagagcagcggcctgtac 540 agcctgagcagcgtggtgaccgtgcccagcagcagcctgggcacccagacctacatctgc 600 aacgtgaaccacaagcccagcaacaccaaggtggacaaacgcgtggagcccaagagctgc 660 gacaagacccacacctgccccccctgccctgcccccgagctgctgggcggaccctccgtg 720 ttcctgttcccccccaagcccaaggacaccctcatgatcagccggacccccgaggtgacc 780 tgcgtggtggtggacgtgagccacgaggaccccgaggtgaagttcaactggtacgtggac 840 ggcgtggaggtgcacaacgccaagaccaagccccgggaggagcagtacaacagcacctac 900 cgggtggtgagcgtgctcaccgtgctgcaccaggactggctgaacggcaaggagtacaag 960 tgcaaggtgagcaacaaggccctgcctgcccccatcgagaagaccatcagcaaggccaag 1020 ggccagccccgggagccccaggtgtacaccctgccccccagccgggaggagatgaccaag 1080 aaccaggtgtccctcacctgtctggtgaagggcttctaccccagcgacatcgccgtggag 1140 tgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagc 1200 gacggcagcttcttcctgtacagcaagctcaccgtggacaagagccggtggcagcagggc 1260 aacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagagc 1320 ctgagcctgagccccggcaag 1341

CR6301 Heavy Chain Amino Acid Sequence (SEQ ID NO: 467)


CR6301 VH Amino Acid Sequence (SEQ ID NO: 465)


CR6301 Light Chain Nucleotide Sequence (SEQ ID NO: 469)

gaaattgtgc tgactcagtc tccactctcc ctgcccgtca cccctggaga gccggcctcc 60 atctcctgca ggtctagtca gagcctcctg catagtaatg gatacaacta tttggattgg 120 tacctgcaga agccagggca gtctccacag ctcctgatct atttgggttc taatcgggcc 180 tccggggtcc ctgacaggtt cagtggcagt ggatcaggca cagattttac actgaaaatc 240 agcagagtgg aggctgagga tgttggggtt tattactgca tgcaagctct acaaactccc 300 ctcactttcg gcggagggac caaggtggag atcaaacgtg cggccgcacc cagcgtgttc 360 atcttccccc cctccgacga gcagctgaag agcggcaccg ccagcgtggt gtgcctgctg 420 aacaacttct acccccggga ggccaaggtg cagtggaagg tggacaacgc cctgcagagc 480 ggcaacagcc aggagagcgt gaccgagcag gacagcaagg actccaccta cagcctgagc 540 agcaccctca ccctgagcaa ggccgactac gagaagcaca aggtgtacgc ctgcgaggtg 600 acccaccagg gcctgagcag ccccgtgacc aagagcttca accggggcga gtgt 654

CR6301 Light Chain Amino Acid Sequence (SEQ ID NO: 470)


CR6301 VL Amino Acid Sequence (SEQ ID NO:468)


The CR6307 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 471) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 472 and the heavy chain amino acid sequence shown in SEQ ID NO: 473. The CR6307 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 474) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 475 and the light chain amino acid sequence shown in SEQ ID NO: 476.

CR6307 Heavy Chain nucleotide sequence (SEQ ID NO: 472)

caggtccagc tggtgcagtc tgggggaggc ctggtcaagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt agctatagca tgaactgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcatcc attagtagta gtagtagtta catatactac 180 gtagactcag tgaagggccg attcaccatc tccagagaca acgccaagaa ctcactgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagaggtggt 300 gggagctacg gggcctacga aggctttgac tactggggcc agggcaccct ggtcaccgtc 360 tcgagtgcta gcaccaaggg ccccagcgtg ttccccctgg cccccagcag caagagcacc 420 agcggcggca cagccgccct gggctgcctg gtgaaggact acttccccga gcccgtgacc 480 gtgagctgga acagcggcgc cttgaccagc ggcgtgcaca ccttccccgc cgtgctgcag 540 agcagcggcc tgtacagcct gagcagcgtg gtgaccgtgc ccagcagcag cctgggcacc 600 cagacctaca tctgcaacgt gaaccacaag cccagcaaca ccaaggtgga caaacgcgtg 660 gagcccaaga gctgcgacaa gacccacacc tgccccccct gccctgcccc cgagctgctg 720 ggcggaccct ccgtgttcct gttccccccc aagcccaagg acaccctcat gatcagccgg 780 acccccgagg tgacctgcgt ggtggtggac gtgagccacg aggaccccga ggtgaagttc 840 aactggtacg tggacggcgt ggaggtgcac aacgccaaga ccaagccccg ggaggagcag 900 tacaacagca cctaccgggt ggtgagcgtg ctcaccgtgc tgcaccagga ctggctgaac 960 ggcaaggagt acaagtgcaa ggtgagcaac aaggccctgc ctgcccccat cgagaagacc 1020 atcagcaagg ccaagggcca gccccgggag ccccaggtgt acaccctgcc ccccagccgg 1080 gaggagatga ccaagaacca ggtgtccctc acctgtctgg tgaagggctt ctaccccagc 1140 gacatcgccg tggagtggga gagcaacggc cagcccgaga acaactacaa gaccaccccc 1200 cctgtgctgg acagcgacgg cagcttcttc ctgtacagca agctcaccgt ggacaagagc 1260 cggtggcagc agggcaacgt gttcagctgc agcgtgatgc acgaggccct gcacaaccac 1320 tacacccaga agagcctgag cctgagcccc ggcaag 1356

CR6307 Heavy Chain Amino Acid Sequence (SEQ ID NO: 473)


CR6307 VH Amino Acid Sequence (SEQ ID NO: 471)


CR6307 Light Chain Nucleotide Sequence (SEQ ID NO: 475)

gaaattgtgc tgactcagtc tccaggcacc ctgtctttgt ctccagggga aagagccacc 60 ctctcctgca gggccagtca gcgtgttagc agctacttag cctggtacca acagaaacct 120 ggccaggctc ccaggctcct catctatggt gcatccacca gggccgctgg catcccagac 180 aggttcagtg gcagtgggtc tgggacagac ttcactctca ccatcagcag actggagcct 240 gaagattctg cagtgtatta ctgtcagcag tatggtagga caccgctcac tttcggcgga 300 gggaccaagg tggagatcaa acgtgcggcc gcacccagcg tgttcatctt ccccccctcc 360 gacgagcagc tgaagagcgg caccgccagc gtggtgtgcc tgctgaacaa cttctacccc 420 cgggaggcca aggtgcagtg gaaggtggac aacgccctgc agagcggcaa cagccaggag 480 agcgtgaccg agcaggacag caaggactcc acctacagcc tgagcagcac cctcaccctg 540 agcaaggccg actacgagaa gcacaaggtg tacgcctgcg aggtgaccca ccagggcctg 600 agcagccccg tgaccaagag cttcaaccgg ggcgagtgt 639

CR6307 Light Chain Amino Acid Sequence (SEQ ID NO: 476)


CR6307 VL Amino Acid Sequence (SEQ ID NO: 474)


The CR6310 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 477) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 478 and the heavy chain amino acid sequence shown in SEQ ID NO: 479. The CR6310 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 480) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 481 and the light chain amino acid sequence shown in SEQ ID NO: 482.

CR6310 Heavy Chain nucleotide sequence (SEQ ID NO: 478)

gaggtgcagc tggtggagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaagtc 60 tcttgcaagg cttctggagg ccccttccgc agctatgcta tcagctgggt gcgacaggcc 120 cctggacaag ggcctgagtg gatgggaggg atcatcccta tttttggtac aacaaaatac 180 gcaccgaagt tccagggcag agtcacgatt accgcggacg atttcgcggg cacagtttac 240 atggagctga gcagcctgcg atctgaggac acggccatgt actactgtgc gaaacatatg 300 gggtaccagg tgcgcgaaac tatggacgtc tggggcaaag ggaccacggt caccgtctcg 360 agtgctagca ccaagggccc cagcgtgttc cccctggccc ccagcagcaa gagcaccagc 420 ggcggcacag ccgccctggg ctgcctggtg aaggactact tccccgagcc cgtgaccgtg 480 agctggaaca gcggcgcctt gaccagcggc gtgcacacct tccccgccgt gctgcagagc 540 agcggcctgt acagcctgag cagcgtggtg accgtgccca gcagcagcct gggcacccag 600 acctacatct gcaacgtgaa ccacaagccc agcaacacca aggtggacaa acgcgtggag 660 cccaagagct gcgacaagac ccacacctgc cccccctgcc ctgcccccga gctgctgggc 720 ggaccctccg tgttcctgtt cccccccaag cccaaggaca ccctcatgat cagccggacc 780 cccgaggtga cctgcgtggt ggtggacgtg agccacgagg accccgaggt gaagttcaac 840 tggtacgtgg acggcgtgga ggtgcacaac gccaagacca agccccggga ggagcagtac 900 aacagcacct accgggtggt gagcgtgctc accgtgctgc accaggactg gctgaacggc 960 aaggagtaca agtgcaaggt gagcaacaag gccctgcctg cccccatcga gaagaccatc 1020 agcaaggcca agggccagcc ccgggagccc caggtgtaca ccctgccccc cagccgggag 1080 gagatgacca agaaccaggt gtccctcacc tgtctggtga agggcttcta ccccagcgac 1140 atcgccgtgg agtgggagag caacggccag cccgagaaca actacaagac caccccccct 1200 gtgctggaca gcgacggcag cttcttcctg tacagcaagc tcaccgtgga caagagccgg 1260 tggcagcagg gcaacgtgtt cagctgcagc gtgatgcacg aggccctgca caaccactac 1320 acccagaaga gcctgagcct gagccccggc aag 1353

CR6310 Heavy Chain Amino Acid Sequence (SEQ ID NO: 479)


CR6310 VH Amino Acid Sequence (SEQ ID NO: 477)


CR6310 Light Chain Nucleotide Sequence (SEQ ID NO: 481)

tcctatgtgc tgactcagcc accctcggtg tcagtggccc caggacagac ggccaggatt 60 acctgtgggg gaaacaacat tggaagtaaa agtgtgcact ggtaccagca gaagccaggc 120 caggcccctg tgctggtcgt ctatgatgat agcgaccggc cctcagggat ccctgagcga 180 ttctctggct ccaactctgg gaacacggcc accctgacca tcagcagggt cgaagccggg 240 gatgaggccg actattactg tcaggtgtgg gatagtagta gtgatcatgc tgtgttcgga 300 ggaggcaccc agctgaccgt cctcggtgcg gccgcaggcc agcccaaggc cgctcccagc 360 gtgaccctgt tccccccctc ctccgaggag ctgcaggcca acaaggccac cctggtgtgc 420 ctcatcagcg acttctaccc tggcgccgtg accgtggcct ggaaggccga cagcagcccc 480 gtgaaggccg gcgtggagac caccaccccc agcaagcaga gcaacaacaa gtacgccgcc 540 agcagctacc tgagcctcac ccccgagcag tggaagagcc accggagcta cagctgccag 600 gtgacccacg agggcagcac cgtggagaag accgtggccc ccaccgagtg cagc 654

CR6310 Light Chain Amino Acid Sequence (SEQ ID NO: 482)


CR6310 VL Amino Acid Sequence (SEQ ID NO: 480)


The CR6314 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 483) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 484 and the heavy chain amino acid sequence shown in SEQ ID NO: 485. The CR6314 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 486) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 487 and the light chain amino acid sequence shown in SEQ ID NO: 488.

CR6314 Heavy Chain Nucleotide Sequence (SEQ ID NO: 484)

gaggtgcagc tggtggagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaagtc 60 tcttgcaagg cttctggagg ccccttccgc agctatgcta tcagctgggt gcgacaggcc 120 cctggacaag ggcctgagtg gatgggaggg atcatcccta tttttggtac aacaaaatac 180 gcaccgaagt tccagggcag agtcacgatt accgcggacg atttcgcggg cacagtttac 240 atggagctga gcagcctgcg atctgaggac acggccatgt actactgtgc gaaacatatg 300 gggtaccagg tgcgcgaaac tatggacgtc tggggcaaag ggaccacggt caccgtctcg 360 agtgctagca ccaagggccc cagcgtgttc cccctggccc ccagcagcaa gagcaccagc 420 ggcggcacag ccgccctggg ctgcctggtg aaggactact tccccgagcc cgtgaccgtg 480 agctggaaca gcggcgcctt gaccagcggc gtgcacacct tccccgccgt gctgcagagc 540 agcggcctgt acagcctgag cagcgtggtg accgtgccca gcagcagcct gggcacccag 600 acctacatct gcaacgtgaa ccacaagccc agcaacacca aggtggacaa acgcgtggag 660 cccaagagct gcgacaagac ccacacctgc cccccctgcc ctgcccccga gctgctgggc 720 ggaccctccg tgttcctgtt cccccccaag cccaaggaca ccctcatgat cagccggacc 780 cccgaggtga cctgcgtggt ggtggacgtg agccacgagg accccgaggt gaagttcaac 840 tggtacgtgg acggcgtgga ggtgcacaac gccaagacca agccccggga ggagcagtac 900 aacagcacct accgggtggt gagcgtgctc accgtgctgc accaggactg gctgaacggc 960 aaggagtaca agtgcaaggt gagcaacaag gccctgcctg cccccatcga gaagaccatc 1020 agcaaggcca agggccagcc ccgggagccc caggtgtaca ccctgccccc cagccgggag 1080 gagatgacca agaaccaggt gtccctcacc tgtctggtga agggcttcta ccccagcgac 1140 atcgccgtgg agtgggagag caacggccag cccgagaaca actacaagac caccccccct 1200 gtgctggaca gcgacggcag cttcttcctg tacagcaagc tcaccgtgga caagagccgg 1260 tggcagcagg gcaacgtgtt cagctgcagc gtgatgcacg aggccctgca caaccactac 1320 acccagaaga gcctgagcct gagccccggc aag 1353

CR6314 Heavy Chain Amino Acid Sequence (SEQ ID NO: 485)


CR6314 VH Amino Acid Sequence (SEQ ID NO: 483)


CR6314 Light Chain Nucleotide Sequence (SEQ ID NO: 487)

tcctatgtgc tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 tcttgttctg gaagcagctc caacatcgga agtaattatg tatactggta ccagcagctc 120 ccaggcacgg cccccaaact cctcatctat agggatggtc agcggccctc aggggtccct 180 gaccgattct ctggctccaa gtctggcacc tcagcctccc tggccatcag tggactccgg 240 tccgatgatg aggctgatta ttactgtgca acatgggatg acaacctgag tggtccagta 300 ttcggcggag ggaccaagct gaccgtccta ggtgcggccg caggccagcc caaggccgct 360 cccagcgtga ccctgttccc cccctcctcc gaggagctgc aggccaacaa ggccaccctg 420 gtgtgcctca tcagcgactt ctaccctggc gccgtgaccg tggcctggaa ggccgacagc 480 agccccgtga aggccggcgt ggagaccacc acccccagca agcagagcaa caacaagtac 540 gccgccagca gctacctgag cctcaccccc gagcagtgga agagccaccg gagctacagc 600 tgccaggtga cccacgaggg cagcaccgtg gagaagaccg tggcccccac cgagtgcagc 660

CR6314 Light Chain Amino Acid Sequence (SEQ ID NO: 488)


CR6314 VL Amino Acid Sequence (SEQ ID NO: 486)


The CR6323 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 489) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 490 and the heavy chain amino acid sequence shown in SEQ ID NO: 491. The CR6323 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 492) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 493 and the light chain amino acid sequence shown in SEQ ID NO: 494.

CR6323 Heavy Chain nucleotide sequence (SEQ ID NO: 490)

gaggtgcagc tggtggagtc tggggctgag gtgaagaagc cagggtcctc ggtgaaggtc 60 tcctgtaagg cctctggagg caccttctcc agctatggta tcagctgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggagac atcatcggta tgtttggttc aacaaactac 180 gcacagaact tccagggcag actcacgatt accgcggacg aatccacgag cacagcctac 240 atggagctga gcagcctgag atctgaggac acggccgtgt attactgtgc gagaagtagt 300 ggttattacc ctgcatacct cccccactgg ggccagggca ccttggtcac cgtctcgagt 360 gctagcacca agggccccag cgtgttcccc ctggccccca gcagcaagag caccagcggc 420 ggcacagccg ccctgggctg cctggtgaag gactacttcc ccgagcccgt gaccgtgagc 480 tggaacagcg gcgccttgac cagcggcgtg cacaccttcc ccgccgtgct gcagagcagc 540 ggcctgtaca gcctgagcag cgtggtgacc gtgcccagca gcagcctggg cacccagacc 600 tacatctgca acgtgaacca caagcccagc aacaccaagg tggacaaacg cgtggagccc 660 aagagctgcg acaagaccca cacctgcccc ccctgccctg cccccgagct gctgggcgga 720 ccctccgtgt tcctgttccc ccccaagccc aaggacaccc tcatgatcag ccggaccccc 780 gaggtgacct gcgtggtggt ggacgtgagc cacgaggacc ccgaggtgaa gttcaactgg 840 tacgtggacg gcgtggaggt gcacaacgcc aagaccaagc cccgggagga gcagtacaac 900 agcacctacc gggtggtgag cgtgctcacc gtgctgcacc aggactggct gaacggcaag 960 gagtacaagt gcaaggtgag caacaaggcc ctgcctgccc ccatcgagaa gaccatcagc 1020 aaggccaagg gccagccccg ggagccccag gtgtacaccc tgccccccag ccgggaggag 1080 atgaccaaga accaggtgtc cctcacctgt ctggtgaagg gcttctaccc cagcgacatc 1140 gccgtggagt gggagagcaa cggccagccc gagaacaact acaagaccac cccccctgtg 1200 ctggacagcg acggcagctt cttcctgtac agcaagctca ccgtggacaa gagccggtgg 1260 cagcagggca acgtgttcag ctgcagcgtg atgcacgagg ccctgcacaa ccactacacc 1320 cagaagagcc tgagcctgag ccccggcaag 1350

CR6323 Heavy Chain Amino Acid Sequence (SEQ ID NO: 491)


CR6323 VH Amino Acid Sequence (SEQ ID NO: 489)


CR6323 Light Chain Nucleotide Sequence (SEQ ID NO: 493)

gaaattgtgt tgacccagtc tccaggcacc ctgtctttgt ctccagggga aagagccacc 60 ctctcctgca gggccagtca gagtgttagc agcagctact tagcctggta ccagcagaaa 120 cctggccagg ctcccaggct cctcatctat ggtgcatcca gcagggccac tggcatccca 180 gacaggttca gtggcagtgg gtctgggaca gacttcactc tcaccatcag cagactggag 240 cctgaagatt ttgcagtgta ttactgtcag cagtatggta gctcacccag aactttcggc 300 ggagggacca aggtggagat caaacgtgcg gccgcaccca gcgtgttcat cttccccccc 360 tccgacgagc agctgaagag cggcaccgcc agcgtggtgt gcctgctgaa caacttctac 420 ccccgggagg ccaaggtgca gtggaaggtg gacaacgccc tgcagagcgg caacagccag 480 gagagcgtga ccgagcagga cagcaaggac tccacctaca gcctgagcag caccctcacc 540 ctgagcaagg ccgactacga gaagcacaag gtgtacgcct gcgaggtgac ccaccagggc 600 ctgagcagcc ccgtgaccaa gagcttcaac cggggcgagt gt 642

CR6323 Light Chain Amino Acid Sequence (SEQ ID NO: 494)


CR6323 VL Amino Acid Sequence (SEQ ID NO: 492)


The CR6325 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 495) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 496 and the heavy chain amino acid sequence shown in SEQ ID NO: 497. The CR6325 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 498) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 499 and the light chain amino acid sequence shown in SEQ ID NO: 500.

CR6325 Heavy Chain nucleotide sequence (SEQ ID NO: 496)

gaggtgcagc tggtggagtc tggggctgag gtgaagaagc cggggtcctc ggtgaaggtc 60 tcctgcaagg cttctggagg caccttcagc ttctattcta tgagctgggt gcgacaggcc 120 cctggacaag gacttgagtg gatgggaggg atcatcccta tgtttggtac aacaaactac 180 gcacagaagt tccagggcag agtcacgatt accgcggtcg aatccacgag cacagcctac 240 atggaggtga gcagcctgag atctgaggac acggccgttt attactgtgc gagaggtgat 300 aagggtatct actactacta catggacgtc tggggcaaag ggaccacggt caccgtctcg 360 agtgctagca ccaagggccc cagcgtgttc cccctggccc ccagcagcaa gagcaccagc 420 ggcggcacag ccgccctggg ctgcctggtg aaggactact tccccgagcc cgtgaccgtg 480 agctggaaca gcggcgcctt gaccagcggc gtgcacacct tccccgccgt gctgcagagc 540 agcggcctgt acagcctgag cagcgtggtg accgtgccca gcagcagcct gggcacccag 600 acctacatct gcaacgtgaa ccacaagccc agcaacacca aggtggacaa acgcgtggag 660 cccaagagct gcgacaagac ccacacctgc cccccctgcc ctgcccccga gctgctgggc 720 ggaccctccg tgttcctgtt cccccccaag cccaaggaca ccctcatgat cagccggacc 780 cccgaggtga cctgcgtggt ggtggacgtg agccacgagg accccgaggt gaagttcaac 840 tggtacgtgg acggcgtgga ggtgcacaac gccaagacca agccccggga ggagcagtac 900 aacagcacct accgggtggt gagcgtgctc accgtgctgc accaggactg gctgaacggc 960 aaggagtaca agtgcaaggt gagcaacaag gccctgcctg cccccatcga gaagaccatc 1020 agcaaggcca agggccagcc ccgggagccc caggtgtaca ccctgccccc cagccgggag 1080 gagatgacca agaaccaggt gtccctcacc tgtctggtga agggcttcta ccccagcgac 1140 atcgccgtgg agtgggagag caacggccag cccgagaaca actacaagac caccccccct 1200 gtgctggaca gcgacggcag cttcttcctg tacagcaagc tcaccgtgga caagagccgg 1260 tggcagcagg gcaacgtgtt cagctgcagc gtgatgcacg aggccctgca caaccactac 1320 acccagaaga gcctgagcct gagccccggc aag 1353

CR6325 Heavy Chain Amino Acid Sequence (SEQ ID NO: 497)


CR6325 VH Amino Acid Sequence (SEQ ID NO: 495)


CR6325 Light Chain Nucleotide Sequence (SEQ ID NO: 499)

cagtctgccc tgactcagcc tgcctccgtg tctgggtctc ctggacagtc gatcaccatc 60 tcctgcactg gaaccagcag tgacgttggt ggttataact atgtctcctg gtaccaacag 120 cacccaggca aagcccccaa actcatgatt tatgaggtca gtaatcggcc ctcaggggtt 180 tctaatcgct tctctggctc caagtctggc aacacggcct ccctgaccat ctctgggctc 240 caggctgagg acgaggctga ttattactgc agctcatata caagcagcag cactcttgtc 300 ttcggaactg ggaccaaggt caccgtccta ggtgcggccg caggccagcc caaggccgct 360 cccagcgtga ccctgttccc cccctcctcc gaggagctgc aggccaacaa ggccaccctg 420 gtgtgcctca tcagcgactt ctaccctggc gccgtgaccg tggcctggaa ggccgacagc 480 agccccgtga aggccggcgt ggagaccacc acccccagca agcagagcaa caacaagtac 540 gccgccagca gctacctgag cctcaccccc gagcagtgga agagccaccg gagctacagc 600 tgccaggtga cccacgaggg cagcaccgtg gagaagaccg tggcccccac cgagtgcagc 660

CR6325 Light Chain Amino Acid Sequence (SEQ ID NO: 500)


CR6325 VL Amino Acid Sequence (SEQ ID NO: 498)


The CR6327 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 501) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 502 and the heavy chain amino acid sequence shown in SEQ ID NO: 503. The CR6327 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 504) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 505 and the light chain amino acid sequence shown in SEQ ID NO: 506.

CR6327 Heavy Chain nucleotide sequence (SEQ ID NO: 502)

gaggtgcagc tggtggagac cggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cctctggagg caccttcagg acccatgcta tcagttgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggaggg atcatcgcta tcttcggaac agcaaactac 180 gcacagaagt tccagggcag aatcacgatt accgcggacg aatccacgag tacagcctac 240 atggagctga gcagcctgag atctgaggac acggccgtgt atttctgtgc gagaggcagt 300 ggttatcata tatcgacacc ctttgacaac tggggccagg gaaccctggt caccgtctcg 360 agtgctagca ccaagggccc cagcgtgttc cccctggccc ccagcagcaa gagcaccagc 420 ggcggcacag ccgccctggg ctgcctggtg aaggactact tccccgagcc cgtgaccgtg 480 agctggaaca gcggcgcctt gaccagcggc gtgcacacct tccccgccgt gctgcagagc 540 agcggcctgt acagcctgag cagcgtggtg accgtgccca gcagcagcct gggcacccag 600 acctacatct gcaacgtgaa ccacaagccc agcaacacca aggtggacaa acgcgtggag 660 cccaagagct gcgacaagac ccacacctgc cccccctgcc ctgcccccga gctgctgggc 720 ggaccctccg tgttcctgtt cccccccaag cccaaggaca ccctcatgat cagccggacc 780 cccgaggtga cctgcgtggt ggtggacgtg agccacgagg accccgaggt gaagttcaac 840 tggtacgtgg acggcgtgga ggtgcacaac gccaagacca agccccggga ggagcagtac 900 aacagcacct accgggtggt gagcgtgctc accgtgctgc accaggactg gctgaacggc 960 aaggagtaca agtgcaaggt gagcaacaag gccctgcctg cccccatcga gaagaccatc 1020 agcaaggcca agggccagcc ccgggagccc caggtgtaca ccctgccccc cagccgggag 1080 gagatgacca agaaccaggt gtccctcacc tgtctggtga agggcttcta ccccagcgac 1140 atcgccgtgg agtgggagag caacggccag cccgagaaca actacaagac caccccccct 1200 gtgctggaca gcgacggcag cttcttcctg tacagcaagc tcaccgtgga caagagccgg 1260 tggcagcagg gcaacgtgtt cagctgcagc gtgatgcacg aggccctgca caaccactac 1320 acccagaaga gcctgagcct gagccccggc aag 1353

CR6327 Heavy Chain Amino Acid Sequence (SEQ ID NO: 503)


CR6327 VH Amino Acid Sequence (SEQ ID NO: 501)


CR6327 Light Chain Nucleotide Sequence (SEQ ID NO: 505)

tcctatgtgc tgactcagcc accctcggtg tcagtggccc caggacagac ggccaggatt 60 acctgtgggg gaaacaacat tggaagtaaa ggtgtgcact ggtaccagca gaagcctggc 120 caggcccctg tgctggtcgt ctatgatgat agcgaccggc cctcagggat ccctgagcga 180 ttctctggct ccaactctgg gaacacggcc accctgacca tcagcagggt cgaagccggg 240 gatgaggccg actattactg tcaggtgtgg gatagtagta gtgatcatgt ggtattcggc 300 ggagggacca agctgaccgt cctaggtgcg gccgcaggcc agcccaaggc cgctcccagc 360 gtgaccctgt tccccccctc ctccgaggag ctgcaggcca acaaggccac cctggtgtgc 420 ctcatcagcg acttctaccc tggcgccgtg accgtggcct ggaaggccga cagcagcccc 480 gtgaaggccg gcgtggagac caccaccccc agcaagcaga gcaacaacaa gtacgccgcc 540 agcagctacc tgagcctcac ccccgagcag tggaagagcc accggagcta cagctgccag 600 gtgacccacg agggcagcac cgtggagaag accgtggccc ccaccgagtg cagc 654

CR6327 Light Chain Amino Acid Sequence (SEQ ID NO: 506)


CR6327 VL Amino Acid Sequence (SEQ ID NO: 504)


The CR6328 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 507) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 508 and the heavy chain amino acid sequence shown in SEQ ID NO: 509. The CR6328 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 510) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 511 and the light chain amino acid sequence shown in SEQ ID NO: 512.

CR6328 Heavy Chain nucleotide sequence (SEQ ID NO: 508)

gaggtgcagc tggtggagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cttctggaca catcttcagc ggctatgcaa tcagttgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggaggg atcatcccta tctttggtac aacaaactac 180 gcacagaagt tccagggcag agtcacgatt accgcggacc aatccacgag cacagcctac 240 atggacctga gcaacttgag atctgaggac acggccgtct attactgtgc gagagtgaaa 300 gatggatatt gtactcttac cagctgccct gtcggctggt acttcgatct ctggggccgt 360 ggcaccctgg tcactgtctc gagtgctagc accaagggcc ccagcgtgtt ccccctggcc 420 cccagcagca agagcaccag cggcggcaca gccgccctgg gctgcctggt gaaggactac 480 ttccccgagc ccgtgaccgt gagctggaac agcggcgcct tgaccagcgg cgtgcacacc 540 ttccccgccg tgctgcagag cagcggcctg tacagcctga gcagcgtggt gaccgtgccc 600 agcagcagcc tgggcaccca gacctacatc tgcaacgtga accacaagcc cagcaacacc 660 aaggtggaca aacgcgtgga gcccaagagc tgcgacaaga cccacacctg ccccccctgc 720 cctgcccccg agctgctggg cggaccctcc gtgttcctgt tcccccccaa gcccaaggac 780 accctcatga tcagccggac ccccgaggtg acctgcgtgg tggtggacgt gagccacgag 840 gaccccgagg tgaagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgccaagacc 900 aagccccggg aggagcagta caacagcacc taccgggtgg tgagcgtgct caccgtgctg 960 caccaggact ggctgaacgg caaggagtac aagtgcaagg tgagcaacaa ggccctgcct 1020 gcccccatcg agaagaccat cagcaaggcc aagggccagc cccgggagcc ccaggtgtac 1080 accctgcccc ccagccggga ggagatgacc aagaaccagg tgtccctcac ctgtctggtg 1140 aagggcttct accccagcga catcgccgtg gagtgggaga gcaacggcca gcccgagaac 1200 aactacaaga ccaccccccc tgtgctggac agcgacggca gcttcttcct gtacagcaag 1260 ctcaccgtgg acaagagccg gtggcagcag ggcaacgtgt tcagctgcag cgtgatgcac 1320 gaggccctgc acaaccacta cacccagaag agcctgagcc tgagccccgg caag 1374

CR6328 Heavy Chain Amino Acid Sequence (SEQ ID NO: 509)


CR6328 VH Amino Acid Sequence (SEQ ID NO: 507)


CR6328 Light Chain Nucleotide Sequence (SEQ ID NO: 511)

gaaattgtga tgacgcagtc tccaggcacc ctgtctttgt ctccagggga aagagccacc 60 ctctcgtgca gggccagtca gagtgttagc agcagctact tagcctggta ccagcagaaa 120 cctggccagg ctcccaggct cctcatcttt ggtgcctcca gcagggccac tggcatccca 180 gacaggttca gtggcagtgg gtctgggaca gacttcactc tcaccatcag cagactggag 240 cctgaagatt ttgcagtgta ttactgtcag cagtatggta gctcactcac tttcggcgga 300 gggaccaagc tggagatcaa acgtgcggcc gcacccagcg tgttcatctt ccccccctcc 360 gacgagcagc tgaagagcgg caccgccagc gtggtgtgcc tgctgaacaa cttctacccc 420 cgggaggcca aggtgcagtg gaaggtggac aacgccctgc agagcggcaa cagccaggag 480 agcgtgaccg agcaggacag caaggactcc acctacagcc tgagcagcac cctcaccctg 540 agcaaggccg actacgagaa gcacaaggtg tacgcctgcg aggtgaccca ccagggcctg 600 agcagccccg tgaccaagag cttcaaccgg ggcgagtgt 639

CR6328 Light Chain Amino Acid Sequence (SEQ ID NO: 512)


CR6328 VL Amino Acid Sequence (SEQ ID NO: 510)


The CR6329 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 513) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 514 and the heavy chain amino acid sequence shown in SEQ ID NO: 515. The CR6329 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 516) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 517 and the light chain amino acid sequence shown in SEQ ID NO: 518.

CR6329 Heavy Chain nucleotide sequence (SEQ ID NO: 514)

gaggtccagc tggtacagtc tggggctgag gttaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cttctggagg catcttcaga agcaattcta tcagttgggt gcgacaggcc 120 cctgggcaag ggcttgagtg gatgggaggg atcttcgctc ttttcggaac aacagactac 180 gcgcagaagt tccagggcag agtcacgatt accgcggacg aatcttcgac cacagtctac 240 ctggagctga gtagcctgac atctgaggac acggccgttt attactgtgc gagaggcagt 300 ggctacacca cacgcaacta ctttgactac tggggccagg gcaccctggt caccgtctcg 360 agtgctagca ccaagggccc cagcgtgttc cccctggccc ccagcagcaa gagcaccagc 420 ggcggcacag ccgccctggg ctgcctggtg aaggactact tccccgagcc cgtgaccgtg 480 agctggaaca gcggcgcctt gaccagcggc gtgcacacct tccccgccgt gctgcagagc 540 agcggcctgt acagcctgag cagcgtggtg accgtgccca gcagcagcct gggcacccag 600 acctacatct gcaacgtgaa ccacaagccc agcaacacca aggtggacaa acgcgtggag 660 cccaagagct gcgacaagac ccacacctgc cccccctgcc ctgcccccga gctgctgggc 720 ggaccctccg tgttcctgtt cccccccaag cccaaggaca ccctcatgat cagccggacc 780 cccgaggtga cctgcgtggt ggtggacgtg agccacgagg accccgaggt gaagttcaac 840 tggtacgtgg acggcgtgga ggtgcacaac gccaagacca agccccggga ggagcagtac 900 aacagcacct accgggtggt gagcgtgctc accgtgctgc accaggactg gctgaacggc 960 aaggagtaca agtgcaaggt gagcaacaag gccctgcctg cccccatcga gaagaccatc 1020 agcaaggcca agggccagcc ccgggagccc caggtgtaca ccctgccccc cagccgggag 1080 gagatgacca agaaccaggt gtccctcacc tgtctggtga agggcttcta ccccagcgac 1140 atcgccgtgg agtgggagag caacggccag cccgagaaca actacaagac caccccccct 1200 gtgctggaca gcgacggcag cttcttcctg tacagcaagc tcaccgtgga caagagccgg 1260 tggcagcagg gcaacgtgtt cagctgcagc gtgatgcacg aggccctgca caaccactac 1320 acccagaaga gcctgagcct gagccccggc aag 1353

CR6329 Heavy Chain Amino Acid Sequence (SEQ ID NO: 515)


CR6329 VH Amino Acid Sequence (SEQ ID NO: 513)


CR6329 Light Chain Nucleotide Sequence (SEQ ID NO: 517)

gaaattgtgc tgactcagtc tccaggcacc ctgtctttgt ctccagggga aagagccaca 60 ctctoctgca gggccagtca gagtgttagc agcaactact taggctggta ccagcagaaa 120 cctggccagg ctcccaggct cctgatctat ggtgcatcca gcagggccag tggcatccca 180 gacaggttca gtggcggtgg gtctgggaca gacttcactc tcaccatcag cagactggag 240 cctgaagatt ttgcagtgta ttactgtcag cagtatggta gctcacccct cactttcggc 300 ggagggacca aggtggagat caaacgtgcg gccgcaggcc agcccaaggc cgctcccagc 360 gtgaccctgt tccccccctc ctccgaggag ctgcaggcca acaaggccac cctggtgtgc 420 ctcatcagcg acttctaccc tggcgccgtg accgtggcct ggaaggccga cagcagcccc 480 gtgaaggccg gcgtggagac caccaccccc agcaagcaga gcaacaacaa gtacgccgcc 540 agcagctacc tgagcctcac ccccgagcag tggaagagcc accggagcta cagctgccag 600 gtgacccacg agggcagcac cgtggagaag accgtggccc ccaccgagtg cagc 654

CR6329 Light Chain Amino Acid Sequence (SEQ ID NO: 518)


CR6329 VL Amino Acid Sequence (SEQ ID NO: 516)


The CR6331 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 519) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 520 and the heavy chain amino acid sequence shown in SEQ ID NO: 521. The CR6331 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 522) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 523 and the light chain amino acid sequence shown in SEQ ID NO: 524.

CR6331 Heavy Chain Nucleotide Sequence (SEQ ID NO: 520)

gaggtgcagc tggtggagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cttctggagg caccttcagc agctatgcta tcagctgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggaggg atcatcggta tgttcggtac agcaaactac 180 gcacagaagt tccagggcag agtcacgatt accgcggacg aatttacgag cacagcctac 240 atggagctga gcagcctgag atctgaggac acggccgtgt attactgtgc gagaggaaat 300 tattactatg agagtagtct cgactactgg ggccagggaa ccctggtcac cgtctcgagt 360 gctagcacca agggccccag cgtgttcccc ctggccccca gcagcaagag caccagcggc 420 ggcacagccg ccctgggctg cctggtgaag gactacttcc ccgagcccgt gaccgtgagc 480 tggaacagcg gcgccttgac cagcggcgtg cacaccttcc ccgccgtgct gcagagcagc 540 ggcctgtaca gcctgagcag cgtggtgacc gtgcccagca gcagcctggg cacccagacc 600 tacatctgca acgtgaacca caagcccagc aacaccaagg tggacaaacg cgtggagccc 660 aagagctgcg acaagaccca cacctgcccc ccctgccctg cccccgagct gctgggcgga 720 ccctccgtgt tcctgttccc ccccaagccc aaggacaccc tcatgatcag ccggaccccc 780 gaggtgacct gcgtggtggt ggacgtgagc cacgaggacc ccgaggtgaa gttcaactgg 840 tacgtggacg gcgtggaggt gcacaacgcc aagaccaagc cccgggagga gcagtacaac 900 agcacctacc gggtggtgag cgtgctcacc gtgctgcacc aggactggct gaacggcaag 960 gagtacaagt gcaaggtgag caacaaggcc ctgcctgccc ccatcgagaa gaccatcagc 1020 aaggccaagg gccagccccg ggagccccag gtgtacaccc tgccccccag ccgggaggag 1080 atgaccaaga accaggtgtc cctcacctgt ctggtgaagg gcttctaccc cagcgacatc 1140 gccgtggagt gggagagcaa cggccagccc gagaacaact acaagaccac cccccctgtg 1200 ctggacagcg acggcagctt cttcctgtac agcaagctca ccgtggacaa gagccggtgg 1260 cagcagggca acgtgttcag ctgcagcgtg atgcacgagg ccctgcacaa ccactacacc 1320 cagaagagcc tgagcctgag ccccggcaag 1350

CR6331 Heavy Chain Amino Acid Sequence (SEQ ID NO: 521)


CR6331 VH Amino Acid Sequence (SEQ ID NO: 519)


CR6331 Light Chain Nucleotide Sequence (SEQ ID NO: 523)

cagtctgtcg tgacgcagcc gccctcggtg tcagtggccc caggacagac ggccaggatt 60 acctgtgggg gaaacaacat tggaagtaaa agtgtgcact ggtaccagca gaagccaggc 120 caggcccctg tgctggtcgt ctatgatgat agcgaccggc cctcagggat ccctgagcga 180 ttctctggct ccaactctgg gaacacggcc accctgacca tcagcagggt cgaagccggg 240 gatgaggccg actattactg tcaggtgtgg gatagtagta gtgatcatta tgtcttcgga 300 actgggacca aggtcaccgt cctaggtgcg gccgcaggcc agcccaaggc cgctcccagc 360 gtgaccctgt tccccccctc ctccgaggag ctgcaggcca acaaggccac cctggtgtgc 420 ctcatcagcg acttctaccc tggcgccgtg accgtggcct ggaaggccga cagcagcccc 480 gtgaaggccg gcgtggagac caccaccccc agcaagcaga gcaacaacaa gtacgccgcc 540 agcagctacc tgagcctcac ccccgagcag tggaagagcc accggagcta cagctgccag 600 gtgacccacg agggcagcac cgtggagaag accgtggccc ccaccgagtg cagc 654

CR6331 Light Chain Amino Acid Sequence (SEQ ID NO: 524)


CR6331 VL Amino Acid Sequence (SEQ ID NO: 522)


The CR6332 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 525) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 526 and the heavy chain amino acid sequence shown in SEQ ID NO: 527. The CR6332 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 528) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 529 and the light chain amino acid sequence shown in SEQ ID NO: 530.

CR6332 Heavy Chain Nucleotide Sequence (SEQ ID NO: 526)

caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc ggtaaaggtc 60 tcctgcaagg cttctggagg ccccttccgc aattttgcta tcaactgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggaggg atcatcgctg tctttgggac gacaaagtac 180 gcacataagt tccagggcag agtcaccatc accgcggacg actccacaaa tacagcttac 240 atggagctgg gcagcctgaa atctgaggac acggccgtgt attactgtgc gagaggtccc 300 cactactact cctcctacat ggacgtctgg ggcgaaggga ccacggtcac cgtctcgagt 360 gctagcacca agggccccag cgtgttcccc ctggccccca gcagcaagag caccagcggc 420 ggcacagccg ccctgggctg cctggtgaag gactacttcc ccgagcccgt gaccgtgagc 480 tggaacagcg gcgccttgac cagcggcgtg cacaccttcc ccgccgtgct gcagagcagc 540 ggcctgtaca gcctgagcag cgtggtgacc gtgcccagca gcagcctggg cacccagacc 600 tacatctgca acgtgaacca caagcccagc aacaccaagg tggacaaacg cgtggagccc 660 aagagctgcg acaagaccca cacctgcccc ccctgccctg cccccgagct gctgggcgga 720 ccctccgtgt tcctgttccc ccccaagccc aaggacaccc tcatgatcag ccggaccccc 780 gaggtgacct gcgtggtggt ggacgtgagc cacgaggacc ccgaggtgaa gttcaactgg 840 tacgtggacg gcgtggaggt gcacaacgcc aagaccaagc cccgggagga gcagtacaac 900 agcacctacc gggtggtgag cgtgctcacc gtgctgcacc aggactggct gaacggcaag 960 gagtacaagt gcaaggtgag caacaaggcc ctgcctgccc ccatcgagaa gaccatcagc 1020 aaggccaagg gccagccccg ggagccccag gtgtacaccc tgccccccag ccgggaggag 1080 atgaccaaga accaggtgtc cctcacctgt ctggtgaagg gcttctaccc cagcgacatc 1140 gccgtggagt gggagagcaa cggccagccc gagaacaact acaagaccac cccccctgtg 1200 ctggacagcg acggcagctt cttcctgtac agcaagctca ccgtggacaa gagccggtgg 1260 cagcagggca acgtgttcag ctgcagcgtg atgcacgagg ccctgcacaa ccactacacc 1320 cagaagagcc tgagcctgag ccccggcaag 1350

CR6332 Heavy Chain Amino Acid Sequence (SEQ ID NO: 527)


CR6332 VH Amino Acid Sequence (SEQ ID NO: 525)


CR6332 Light Chain Nucleotide Sequence (SEQ ID NO: 529)

gacatccagt tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgcc gggcgagtca gggcattagc acttatttag cctggtatca gcagaaaccc 120 gggaaagttc ctaaactcct gatctatgct gcatccactt tgcaatcagg ggtcccatct 180 cggttcagtg gcagtggatc tgggacagat ttcactctca ccatcagcag cctgcagcct 240 gaagatgttg caacttatta ctgtcaaaag tataacagtg ccccttcttt cggccctggg 300 accaaagtgg atatcaaacg tgcggccgca cccagcgtgt tcatcttccc cccctccgac 360 gagcagctga agagcggcac cgccagcgtg gtgtgcctgc tgaacaactt ctacccccgg 420 gaggccaagg tgcagtggaa ggtggacaac gccctgcaga gcggcaacag ccaggagagc 480 gtgaccgagc aggacagcaa ggactccacc tacagcctga gcagcaccct caccctgagc 540 aaggccgact acgagaagca caaggtgtac gcctgcgagg tgacccacca gggcctgagc 600 agccccgtga ccaagagctt caaccggggc gagtgt 636

CR6332 Light Chain Amino Acid Sequence (SEQ ID NO: 530)


CR6332 VL Amino Acid Sequence (SEQ ID NO: 528)


The CR6334 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 531) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 532 and the heavy chain amino acid sequence shown in SEQ ID NO: 533. The CR6334 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 534) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 535 and the light chain amino acid sequence shown in SEQ ID NO: 536.

CR6334 Heavy Nucleotide Sequence (SEQ ID NO: 532)

gaggtgcagc tggtggagac tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 ccctgcaaat cttctggaag ccccttcagg agtaatgctg tcagctgggt gcgacaggcc 120 cccggacaag ggcttgagtg ggtgggagga atcctcggtg tctttggttc accaagctac 180 gcacagaagt tccagggcag agtcacgatt accgcggacg aatccaccaa cacagtccac 240 atggagctga gaggtttgag atctgaggac acggccgtgt attattgtgc gagaggtcct 300 acctactact actcctacat ggacgtctgg ggcaaaggga ccacggtcac cgtctcgagt 360 gctagcacca agggccccag cgtgttcccc ctggccccca gcagcaagag caccagcggc 420 ggcacagccg ccctgggctg cctggtgaag gactacttcc ccgagcccgt gaccgtgagc 480 tggaacagcg gcgccttgac cagcggcgtg cacaccttcc ccgccgtgct gcagagcagc 540 ggcctgtaca gcctgagcag cgtggtgacc gtgcccagca gcagcctggg cacccagacc 600 tacatctgca acgtgaacca caagcccagc aacaccaagg tggacaaacg cgtggagccc 660 aagagctgcg acaagaccca cacctgcccc ccctgccctg cccccgagct gctgggcgga 720 ccctccgtgt tcctgttccc ccccaagccc aaggacaccc tcatgatcag ccggaccccc 780 gaggtgacct gcgtggtggt ggacgtgagc cacgaggacc ccgaggtgaa gttcaactgg 840 tacgtggacg gcgtggaggt gcacaacgcc aagaccaagc cccgggagga gcagtacaac 900 agcacctacc gggtggtgag cgtgctcacc gtgctgcacc aggactggct gaacggcaag 960 gagtacaagt gcaaggtgag caacaaggcc ctgcctgccc ccatcgagaa gaccatcagc 1020 aaggccaagg gccagccccg ggagccccag gtgtacaccc tgccccccag ccgggaggag 1080 atgaccaaga accaggtgtc cctcacctgt ctggtgaagg gcttctaccc cagcgacatc 1140 gccgtggagt gggagagcaa cggccagccc gagaacaact acaagaccac cccccctgtg 1200 ctggacagcg acggcagctt cttcctgtac agcaagctca ccgtggacaa gagccggtgg 1260 cagcagggca acgtgttcag ctgcagcgtg atgcacgagg ccctgcacaa ccactacacc 1320 cagaagagcc tgagcctgag ccccggcaag 1350

CR6334 Heavy Chain Amino Acid Sequence (SEQ ID NO: 533)


CR6334 VH Amino Acid Sequence (SEQ ID NO: 531)


CR6334 Light Chain Nucleotide Sequence (SEQ ID NO: 535)

tcctatgtgc tgactcagcc accctcggag tcagtggccc caggacagac ggccaggatt 60 acctgtgggg gaaataacat tggaagaaat agtgtgcact ggtatcagca gaagccaggc 120 caggcccctg tgctggtcgt gtatgatgat agcgaccggc cctcagggat ccctgagcga 180 ttttctggct ccaagtctgg gaacacggcc accctgatta tcagcagggt cgaagtcggg 240 gatgaggccg actactactg tcaggtgtgg catagtagta gtgatcatta tgtcttcgga 300 actgggacca aggtcaccgt cctaggtgcg gccgcaggcc agcccaaggc cgctcccagc 360 gtgaccctgt tccccccctc ctccgaggag ctgcaggcca acaaggccac cctggtgtgc 420 ctcatcagcg acttctaccc tggcgccgtg accgtggcct ggaaggccga cagcagcccc 480 gtgaaggccg gcgtggagac caccaccccc agcaagcaga gcaacaacaa gtacgccgcc 540 agcagctacc tgagcctcac ccccgagcag tggaagagcc accggagcta cagctgccag 600 gtgacccacg agggcagcac cgtggagaag accgtggccc ccaccgagtg cagc 654

CR6334 Light Chain Amino Acid Sequence (SEQ ID NO: 536)


CR6334 VL Amino Acid Sequence (SEQ ID NO: 534)


The CR6336 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 537) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 538 and the heavy chain amino acid sequence shown in SEQ ID NO: 539. The CR6336 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 540) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 541 and the light chain amino acid sequence shown in SEQ ID NO: 542.

CR6336 Heavy Chain Nucleotide Sequence (SEQ ID NO: 538)

cagatgcagc tggtacaatc tggagctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60 tcctgcaagg cttctggagg caccttcagc agctatgcta tcagctgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggaggg atcttcggta tgtttgggac agcaaactac 180 gcgcagaagt tccagggcag agtcacgatt accgcggacg aattcacgag cgcggcctac 240 atggagctga gcagcctggg atctgaggac acggccatgt attactgtgc gaggtctagt 300 ggttattacc cccaatactt ccaggactgg ggccagggca ccctggtcac cgtctcgagt 360 gctagcacca agggccccag cgtgttcccc ctggccccca gcagcaagag caccagcggc 420 ggcacagccg ccctgggctg cctggtgaag gactacttcc ccgagcccgt gaccgtgagc 480 tggaacagcg gcgccttgac cagcggcgtg cacaccttcc ccgccgtgct gcagagcagc 540 ggcctgtaca gcctgagcag cgtggtgacc gtgcccagca gcagcctggg cacccagacc 600 tacatctgca acgtgaacca caagcccagc aacaccaagg tggacaaacg cgtggagccc 660 aagagctgcg acaagaccca cacctgcccc ccctgccctg cccccgagct gctgggcgga 720 ccctccgtgt tcctgttccc ccccaagccc aaggacaccc tcatgatcag ccggaccccc 780 gaggtgacct gcgtggtggt ggacgtgagc cacgaggacc ccgaggtgaa gttcaactgg 840 tacgtggacg gcgtggaggt gcacaacgcc aagaccaagc cccgggagga gcagtacaac 900 agcacctacc gggtggtgag cgtgctcacc gtgctgcacc aggactggct gaacggcaag 960 gagtacaagt gcaaggtgag caacaaggcc ctgcctgccc ccatcgagaa gaccatcagc 1020 aaggccaagg gccagccccg ggagccccag gtgtacaccc tgccccccag ccgggaggag 1080 atgaccaaga accaggtgtc cctcacctgt ctggtgaagg gcttctaccc cagcgacatc 1140 gccgtggagt gggagagcaa cggccagccc gagaacaact acaagaccac cccccctgtg 1200 ctggacagcg acggcagctt cttcctgtac agcaagctca ccgtggacaa gagccggtgg 1260 cagcagggca acgtgttcag ctgcagcgtg atgcacgagg ccctgcacaa ccactacacc 1320 cagaagagcc tgagcctgag ccccggcaag 1350

CR6336 Heavy Chain Amino Acid Sequence (SEQ ID NO: 539)


CR6336 VH Amino Acid Sequence (SEQ ID NO: 537)


CR6336 Light Chain Nucleotide Sequence (SEQ ID NO: 541)

gaaattgtga tgacacagtc tccaggcacc ctgtctttgt ctccagggca aagagccacc 60 ctctcctgca gggccagtca gagtgttagc agcagctact tagcctggta ccagcagaaa 120 cctggccagg ctcccagact cctcatgtat ggtgcatcca gcagggccac tggcatccca 180 gacaggttca gtggcagtgg gtctgggaca gacttcactc tcaccatcag cagactggag 240 cctgaagatt ttgcagtgta ttactgtcag cagtatggta gctcatcgct cactttcggc 300 ggagggacca agctggagat caaacgtgcg gccgcaccca gcgtgttcat cttccccccc 360 tccgacgagc agctgaagag cggcaccgcc agcgtggtgt gcctgctgaa caacttctac 420 ccccgggagg ccaaggtgca gtggaaggtg gacaacgccc tgcagagcgg caacagccag 480 gagagcgtga ccgagcagga cagcaaggac tccacctaca gcctgagcag caccctcacc 540 ctgagcaagg ccgactacga gaagcacaag gtgtacgcct gcgaggtgac ccaccagggc 600 ctgagcagcc ccgtgaccaa gagcttcaac cggggcgagt gt 642

CR6336 Light Chain Amino Acid Sequence (SEQ ID NO: 542)


CR6336 VL Amino Acid Sequence (SEQ ID NO: 540)


The CR6339 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 543) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 545 and the heavy chain amino acid sequence shown in SEQ ID NO: 546. The CR6339 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 547) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 548 and the light chain amino acid sequence shown in SEQ ID NO: 549.

CR6339 Heavy Chain Nucleotide Sequence (SEQ ID NO: 545)

gaggtgcagc tggtggagtc cggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc   60 tcctgcaagg cttctggagg catcttcaac agttatgcta tcagctgggt gcgacaggcc  120 cctggacaag ggcttgagtg gatgggaggc atcatcgcta tctttcatac accaaagtac  180 gcacagaagt tccagggcag agtcacgatt accgcggacg aatccacgaa cacagcctac  240 atggaactga gaagcctgaa atctgaggac acggccctgt attactgtgc gagagggtcc  300 acttacgatt tttcgagtgg ccttgactac tggggccagg gaaccctggt caccgtctcg  360 agtgctagca ccaagggccc cagcgtgttc cccctggccc ccagcagcaa gagcaccagc  420 ggcggcacag ccgccctggg ctgcctggtg aaggactact tccccgagcc cgtgaccgtg  480 agctggaaca gcggcgcctt gaccagcggc gtgcacacct tccccgccgt gctgcagagc  540 agcggcctgt acagcctgag cagcgtggtg accgtgccca gcagcagcct gggcacccag  600 acctacatct gcaacgtgaa ccacaagccc agcaacacca aggtggacaa acgcgtggag  660 cccaagagct gcgacaagac ccacacctgc cccccctgcc ctgcccccga gctgctgggc  720 ggaccctccg tgttcctgtt cccccccaag cccaaggaca ccctcatgat cagccggacc  780 cccgaggtga cctgcgtggt ggtggacgtg agccacgagg accccgaggt gaagttcaac  840 tggtacgtgg acggcgtgga ggtgcacaac gccaagacca agccccggga ggagcagtac  900 aacagcacct accgggtggt gagcgtgctc accgtgctgc accaggactg gctgaacggc  960 aaggagtaca agtgcaaggt gagcaacaag gccctgcctg cccccatcga gaagaccatc 1020 agcaaggcca agggccagcc ccgggagccc caggtgtaca ccctgccccc cagccgggag 1080 gagatgacca agaaccaggt gtccctcacc tgtctggtga agggcttcta ccccagcgac 1140 atcgccgtgg agtgggagag caacggccag cccgagaaca actacaagac caccccccct 1200 gtgctggaca gcgacggcag cttcttcctg tacagcaagc tcaccgtgga caagagccgg 1260 tggcagcagg gcaacgtgtt cagctgcagc gtgatgcacg aggccctgca caaccactac 1320 acccagaaga gcctgagcct gagccccggc aag 1353

CR6339 Heavy Chain Amino Acid Sequence (SEQ ID NO: 546)


CR6339 VH Amino Acid Sequence (SEQ ID NO: 543)


CR6339 Light Chain Nucleotide Sequence (SEQ ID NO: 548)

caggcagggc tgactcagcc accctcggtg tcagtggccc caggacagac ggccaggatt  60 acctgtgggg gaaacaacat tggaagtaaa agtgtgcact ggtaccagca gaagccaggc 120 caggcccctg tcctagtcgt ctatgatgat agcgaccggc cctcagggat ccctgagcga 180 ttctctggct ccaactctgg gaacacggcc accctgacca tcagcagggt cgaagccggg 240 gatgaggccg actattactg tcaggtgtgg gatagtagta gtgatcatgt ggtattcggc 300 ggagggacca agctgaccgt cctaggtgcg gccgcaggcc agcccaaggc cgctcccagc 360 gtgaccctgt tccccccctc ctccgaggag ctgcaggcca acaaggccac cctggtgtgc 420 ctcatcagcg acttctaccc tggcgccgtg accgtggcct ggaaggccga cagcagcccc 480 gtgaaggccg gcgtggagac caccaccccc agcaagcaga gcaacaacaa gtacgccgcc 540 agcagctacc tgagcctcac ccccgagcag tggaagagcc accggagcta cagctgccag 600 gtgacccacg agggcagcac cgtggagaag accgtggccc ccaccgagtg cagc 654

CR6339 Light Chain Amino Acid Sequence (SEQ ID NO: 549)


CR6339 VL Amino Acid Sequence (SEQ ID NO: 547)


The CR6342 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 550) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 551 and the heavy chain amino acid sequence shown in SEQ ID NO: 552. The CR6342 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 553) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 554 and the light chain amino acid sequence shown in SEQ ID NO: 555.

CR6342 Heavy Chain nucleotide sequence (SEQ ID NO: 551)

caggtccagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc   60 tcctgcaagg cttctggagg cttcttcagc agctatgcta tcagctgggt gcgccaggcc  120 cctggacaag gacttgagtg gatggggggg gtcatcccta tctttcgtac agcaaactac  180 gcacagaact tccagggcag agtcaccatt accgcggacg aattcacatc gtatatggag  240 ctgagcagcc tgagatctga cgacacggcc gtgtattact gtgcgaggtt gaattaccat  300 gattcgggga cttattataa cgccccccgg ggctggttcg acccctgggg ccagggaacc  360 ctggtcaccg tctcgagtgc tagcaccaag ggccccagcg tgttccccct ggcccccagc  420 agcaagagca ccagcggcgg cacagccgcc ctgggctgcc tggtgaagga ctacttcccc  480 gagcccgtga ccgtgagctg gaacagcggc gccttgacca gcggcgtgca caccttcccc  540 gccgtgctgc agagcagcgg cctgtacagc ctgagcagcg tggtgaccgt gcccagcagc  600 agcctgggca cccagaccta catctgcaac gtgaaccaca agcccagcaa caccaaggtg  660 gacaaacgcg tggagcccaa gagctgcgac aagacccaca cctgcccccc ctgccctgcc  720 cccgagctgc tgggcggacc ctccgtgttc ctgttccccc ccaagcccaa ggacaccctc  780 atgatcagcc ggacccccga ggtgacctgc gtggtggtgg acgtgagcca cgaggacccc  840 gaggtgaagt tcaactggta cgtggacggc gtggaggtgc acaacgccaa gaccaagccc  900 cgggaggagc agtacaacag cacctaccgg gtggtgagcg tgctcaccgt gctgcaccag  960 gactggctga acggcaagga gtacaagtgc aaggtgagca acaaggccct gcctgccccc 1020 atcgagaaga ccatcagcaa ggccaagggc cagccccggg agccccaggt gtacaccctg 1080 ccccccagcc gggaggagat gaccaagaac caggtgtccc tcacctgtct ggtgaagggc 1140 ttctacccca gcgacatcgc cgtggagtgg gagagcaacg gccagcccga gaacaactac 1200 aagaccaccc cccctgtgct ggacagcgac ggcagcttct tcctgtacag caagctcacc 1260 gtggacaaga gccggtggca gcagggcaac gtgttcagct gcagcgtgat gcacgaggcc 1320 ctgcacaacc actacaccca gaagagcctg agcctgagcc ccggcaag 1368

CR6342 Heavy Chain Amino Acid Sequence (SEQ ID NO: 552)


CR6342 VH Amino Acid Sequence (SEQ ID NO: 550)


CR6342 Light Chain Nucleotide Sequence (SEQ ID NO: 554)

gacatccaga tgacccagtc tccagactcc ctggctgtgt ctctgggcga gaaggccacc  60 atcaactgca agtccagcca gagtatttta aacagctcca acaataagaa ctacttagct 120 tggtaccagc agaaaccagg acagcctcct aagctgctca tttactgggc atctacccgg 180 gaatccgggg tccctgaccg attcagtggc agcgggtctg ggacagattt cactctcacc 240 atcagcagcc tgcaggctga agatgtggca gtttattact gtcagcaata ttatagtagt 300 ccgccgacgt tcggccaagg gaccaaggtg gaaatcaaac gtgcggccgc acccagcgtg 360 ttcatcttcc ccccctccga cgagcagctg aagagcggca ccgccagcgt ggtgtgcctg 420 ctgaacaact tctacccccg ggaggccaag gtgcagtgga aggtggacaa cgccctgcag 480 agcggcaaca gccaggagag cgtgaccgag caggacagca aggactccac ctacagcctg 540 agcagcaccc tcaccctgag caaggccgac tacgagaagc acaaggtgta cgcctgcgag 600 gtgacccacc agggcctgag cagccccgtg accaagagct tcaaccgggg cgagtgt 657

CR6342 Light Chain Amino Acid Sequence (SEQ ID NO: 555)


CR6342 VL Amino Acid Sequence (SEQ ID NO: 553)


The CR6343 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 556) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 557 and the heavy chain amino acid sequence shown in SEQ ID NO: 558. The CR6343 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 559) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 560 and the light chain amino acid sequence shown in SEQ ID NO: 561.

CR6343 Heavy Chain nucleotide sequence (SEQ ID NO: 557)

caggtccagc tggtgcagtc tggagctgag gtgaagaagc ctgggtcctc ggtgaaggtc   60 tcctgcaagg cttctggagt caccttcagt tactatgcta tgagctgggt gcgacaggcc  120 cctggacaag ggcttgagtg gatgggagga atcagcccta tgtttgggac aacaacctac  180 gcacagaagt tccagggcag agtcacgatt actgcggacg actccacgag tacagcctac  240 atggaggtga ggagcctgag atctgaggac acggccgtgt attactgtgc gagatcttcg  300 aattactatg atagtgtata tgactactgg ggccagggaa ccctggtcac cgtctcgagt  360 gctagcacca agggccccag cgtgttcccc ctggccccca gcagcaagag caccagcggc  420 ggcacagccg ccctgggctg cctggtgaag gactacttcc ccgagcccgt gaccgtgagc  480 tggaacagcg gcgccttgac cagcggcgtg cacaccttcc ccgccgtgct gcagagcagc  540 ggcctgtaca gcctgagcag cgtggtgacc gtgcccagca gcagcctggg cacccagacc  600 tacatctgca acgtgaacca caagcccagc aacaccaagg tggacaaacg cgtggagccc  660 aagagctgcg acaagaccca cacctgcccc ccctgccctg cccccgagct gctgggcgga  720 ccctccgtgt tcctgttccc ccccaagccc aaggacaccc tcatgatcag ccggaccccc  780 gaggtgacct gcgtggtggt ggacgtgagc cacgaggacc ccgaggtgaa gttcaactgg  840 tacgtggacg gcgtggaggt gcacaacgcc aagaccaagc cccgggagga gcagtacaac  900 agcacctacc gggtggtgag cgtgctcacc gtgctgcacc aggactggct gaacggcaag  960 gagtacaagt gcaaggtgag caacaaggcc ctgcctgccc ccatcgagaa gaccatcagc 1020 aaggccaagg gccagccccg ggagccccag gtgtacaccc tgccccccag ccgggaggag 1080 atgaccaaga accaggtgtc cctcacctgt ctggtgaagg gcttctaccc cagcgacatc 1140 gccgtggagt gggagagcaa cggccagccc gagaacaact acaagaccac cccccctgtg 1200 ctggacagcg acggcagctt cttcctgtac agcaagctca ccgtggacaa gagccggtgg 1260 cagcagggca acgtgttcag ctgcagcgtg atgcacgagg ccctgcacaa ccactacacc 1320 cagaagagcc tgagcctgag ccccggcaag 1350

CR6343 Heavy Chain Amino Acid Sequence (SEQ ID NO: 558)


CR6343 VH Amino Acid Sequence (SEQ ID NO: 556)


CR6343 Light Chain Nucleotide Sequence (SEQ ID NO: 560)

cagtctgtcg tgacgcagcc gccctcggag tcagtggccc caggacagac ggccaggatt  60 acctgtgggg gacataacat tggaagtaat agtgtgcact ggtaccagca gaagccaggc 120 caggcccctg tgctggtcgt gtatgataat agcgaccggc cctcagggat ccctgagcga 180 ttctctggct ccaactctgg gaacacggcc accctgacca tcagcagggt cgaagccggg 240 gatgaggccg actattactg tcaggtgtgg ggtagtagta gtgaccatta tgtcttcgga 300 actgggacca aggtcaccgt cctaggtgcg gccgcaggcc agcccaaggc cgctcccagc 360 gtgaccctgt tccccccctc ctccgaggag ctgcaggcca acaaggccac cctggtgtgc 420 ctcatcagcg acttctaccc tggcgccgtg accgtggcct ggaaggccga cagcagcccc 480 gtgaaggccg gcgtggagac caccaccccc agcaagcaga gcaacaacaa gtacgccgcc 540 agcagctacc tgagcctcac ccccgagcag tggaagagcc accggagcta cagctgccag 600 gtgacccacg agggcagcac cgtggagaag accgtggccc ccaccgagtg cagc 654

CR6343 Light Chain Amino Acid Sequence (SEQ ID NO: 561)


CR6343 VL Amino Acid Sequence (SEQ ID NO: 559)


The CR6344 HA-specific IgG antibody includes a heavy chain variable region (SEQ ID NO: 562) encoded by the heavy chain nucleotide sequence shown in SEQ ID NO: 563 and the heavy chain amino acid sequence shown in SEQ ID NO: 564. The CR6344 HA-specific IgG antibody also includes a light chain variable region (SEQ ID NO: 565) encoded by the light chain nucleotide sequence shown in SEQ ID NO: 566 and the light chain amino acid sequence shown in SEQ ID NO: 567.

CR6344 Heavy Chain nucleotide sequence (SEQ ID NO: 563)

caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc ggtgagagtc   60 tcctgcaagg cttctggaag catcttcaga aactatgcta tgagctgggt gcgacaggcc  120 cctggacaag ggcttgagtg gatgggaggg atcatcgcta tttttgggac accaaagtac  180 gcacagaagt tccagggcag agccacgatt accgcggacg aatcgacgag cactgtctac  240 atggaactga gcggactgag atctgaggac acggccatgt attactgtgc gaggattccc  300 cactataatt ttggttcggg gagttatttc gactactggg gccagggaac cctggtcacc  360 gtctcgagtg ctagcaccaa gggccccagc gtgttccccc tggcccccag cagcaagagc  420 accagcggcg gcacagccgc cctgggctgc ctggtgaagg actacttccc cgagcccgtg  480 accgtgagct ggaacagcgg cgccttgacc agcggcgtgc acaccttccc cgccgtgctg  540 cagagcagcg gcctgtacag cctgagcagc gtggtgaccg tgcccagcag cagcctgggc  600 acccagacct acatctgcaa cgtgaaccac aagcccagca acaccaaggt ggacaaacgc  660 gtggagccca agagctgcga caagacccac acctgccccc cctgccctgc ccccgagctg  720 ctgggcggac cctccgtgtt cctgttcccc cccaagccca aggacaccct catgatcagc  780 cggacccccg aggtgacctg cgtggtggtg gacgtgagcc acgaggaccc cgaggtgaag  840 ttcaactggt acgtggacgg cgtggaggtg cacaacgcca agaccaagcc ccgggaggag  900 cagtacaaca gcacctaccg ggtggtgagc gtgctcaccg tgctgcacca ggactggctg  960 aacggcaagg agtacaagtg caaggtgagc aacaaggccc tgcctgcccc catcgagaag 1020 accatcagca aggccaaggg ccagccccgg gagccccagg tgtacacccc gccccccagc 1080 cgggaggaga tgaccaagaa ccaggtgtcc ctcacctgtc tggtgaaggg cttctacccc 1140 agcgacatcg ccgtggagtg ggagagcaac ggccagcccg agaacaacta caagaccacc 1200 ccccctgtgc tggacagcga cggcagcttc ttcctgtaca gcaagctcac cgtggacaag 1260 agccggtggc agcagggcaa cgtgttcagc tgcagcgtga tgcacgaggc cctgcacaac 1320 cactacaccc agaagagcct gagcctgagc cccggcaag  1359

CR6344 Heavy Chain Amino Acid Sequence (SEQ ID NO: 564)


CR6344 VH Amino Acid Sequence (SEQ ID NO: 562)


CR6344 Light Chain Nucleotide Sequence (SEQ ID NO: 566)

actgtgttga cacagccgcc ctcagtgtct ggggccccag ggcagagggt caccatctcc  60 tgcactggga gcagctccaa catcggggca ggttatgatg tacactggta ccagcagctt 120 ccaggaacag cccccaaact cctcatctat ggtaacagca atcggccctc aggggtccct 180 gaccgattct ctggctccaa gtctggcacg tcagccaccc tgggcatcac cggactccag 240 actggggacg aggccgatta ttactgcgga acatgggata gcagcctgag tgcttatgtc 300 ttcggaactg ggaccaaggt caccgtccta ggtgcggccg caggccagcc caaggccgct 360 cccagcgtga ccctgttccc cccctcctcc gaggagctgc aggccaacaa ggccaccctg 420 gtgtgcctca tcagcgactt ctaccctggc gccgtgaccg tggcctggaa ggccgacagc 480 agccccgtga aggccggcgt ggagaccacc acccccagca agcagagcaa caacaagtac 540 gccgccagca gctacctgag cctcaccccc gagcagtgga agagccaccg gagctacagc 600 tgccaggtga cccacgaggg cagcaccgtg gagaagaccg tggcccccac cgagtgcagc 660

CR6344 Light Chain Amino Acid Sequence (SEQ ID NO: 567)


CR6344 VL Amino Acid Sequence (SEQ ID NO: 565)


HA Antibody Epitopes

The invention relates to an isolated human HA antibody that is able to recognize and bind to an epitope in the HA2 subunit of the influenza haemagglutinin protein (HA) (also known as hemagglutinin (HA)), characterized in that the HA antibody has neutralizing activity against an influenza virus 5 including HA of the H5 subtype. Examples of influenza strains that contain such a HA of the H5 subtype and that are important strains in view of pandemic threats are H5N1, H5N2, H5N8, and H5N9. Particularly preferred are HA antibodies that at least neutralize the H5N1 influenza strain. Preferably, an HA antibody of the invention does not depend on an epitope in the HA1 subunit of the HA protein for binding to said HA protein.

A number of the antibodies of the invention (such as CR6307 and CR6323) do not depend on conformational epitopes and recognize the HA2 epitope even in a reduced form (when used in western-blotting). This is an advantage over the antibodies from the art because when a conformational change is induced in the HA protein due to whatever mutation in another part of the protein, such conformational change will not most likely hamper the binding of the antibodies of the present invention to the HA2 epitope, whereas antibodies that do depend on conformation might very well be unable to bind when such mutations occur.

In another preferred embodiment, an HA antibody of the invention also has neutralizing activity against an influenza virus comprising HA of the H1 subtype, and preferably wherein the HA antibody also has neutralizing activity against influenza virus comprising HA of the H2, H6 and/or H9 subtype. The HA antibodies of the invention interact with an epitope present in the HA2 epitopes present in the H5, H1, H2, H6, and H9 subtypes (see, International Patent Application PCT/EP2007/059356, published as WO 2008/028946, the contents of which are incorporated by reference in their entirety), and it has been shown that the HA antibodies of the invention cross-neutralize between influenza subtypes because of this epitope-sharing.

In another preferred aspect of the invention an HA antibody of the invention binds to an epitope that is selected from the group consisting of the amino acid sequence: GVTNKVNSIIDK (SEQ ID NO: 198), GVTNKVNSIINK (SEQ ID NO: 283), GVTNKENSIIDK (SEQ ID NO: 202), GVTNKVNRIIDK (SEQ ID NO: 201), GITNKVNSVIEK (SEQ ID NO: 281), GITNKENSVIEK (SEQ ID NO: 257), GITNKVNSIIDK (SEQ ID NO: 225), and KITSKVNNIVDK (SEQ ID NO: 216). Certain HA antibodies of the invention, CR6261, CR6325, and CR6329 interact with the GVTNKVNSIIDK (SEQ ID NO: 198) epitope present in H5N1, and are not hampered by a mutation in the TGLRN (SEQ ID NO: 200) epitope in HA1 that do influence the binding of C179. Moreover, some HA antibodies, such as CR6307 and CR6323 are not even hampered by a escape mutant, as disclosed in Okuno et al. (1993) with a valine->glutamic acid mutation at position 6 (exemplified by GVTNKENSIIDK (SEQ ID NO: 202)). This epitope is part of an extended alpha helix in the HA2 region. The residues in this putative epitope that are predicted to be most solvent exposed are underlined in bold: GVTNKENSIIDK (SEQ ID NO: 202). These amino acids would be most accessible to an HA antibody and thus may form the most important region of the epitope. Consistent with this notion the highlighted (bolded) amino acids are absolutely conserved in identity and position in all the sequences presented. This knowledge could be used to predict binding epitopes in influenza subtypes that do not carry the same sequence as above (i.e. H3, H7 and B strains).

HA Antibodies II

The invention provides neutralizing human monoclonal antibodies that bind influenza A virus and inhibit the influenza A virus from infecting a cell. Although neutralizing human monoclonal antibodies of the invention bind epitopes within proteins that are exposed on the surface of an influenza virus, the invention focuses on the relatively invariant Influenza hemagglutinin (HA) protein. A neutralizing MAb raised against an Influenza HA protein, which is maintained in its native conformation, provides a superior therapy for all Influenza A strains because it is not dependent upon small changes to the amino acid sequence.

The Influenza hemagglutinin (HA) protein is responsible for allowing the virus to recognize target cells through binding the monosaccharide sialic acid-containing receptors on the surface of the target cell prior to infection. Moreover, the Influenza HA protein is responsible for allowing entry of the viral genome into the target cell by fusing the host endosomal membrane with the viral membrane.

The Influenza hemagglutinin (HA) protein is a homotrimeric integral membrane glycoprotein found on the surface of the Influenza virus. Using the host cell's protein synthesis machinery, the Influenza HA protein is first synthesized as a single-chain precursor polypeptide (HA0) in the endoplasmic reticulum, where it is also assembled as a homotrimer. The resulting HA homotrimer is subsequently exported to the cell surface via the Golgi network. HA homotrimers located on a cell surface are cleaved by a host-produced protease into two smaller peptide subunits: HA1 and HA2. The HA2 subunit forms a long helical chain anchored to the viral membrane whereas the HA1 subunit tops the HA2 subunit to form a large globule. The cleavage step, which converts the HA0 precursor into the mature HA protein containing HA1 and HA2 subunits, is essential for the viral pathogenicity of Influenza. Structurally, the mature HA protein contains a central α-helix coil resulting in an overall cylindrical shape with three spherical heads. The HA protein, and specifically, the HA1 subunit of the mature HA protein, binds receptors containing glycans with terminal sialic acids on host cells. The way in which sialic acid is connected to galactose, for example, α2-3 linkages as in avian serotypes versus α2-6 linkages as in human serotypes, not only determine species specificity of an Influenza virus, but also prevents cross-species infection. However, within certain serotypes of HA, such as H1 and H3, only two amino acid mutations in the framework sequence are required to convert species specificity from avian to human.

To mediate infection, the Influenza HA protein first binds sialic acid-containing receptors present on the surface of the target cell. Consequently, the target cell membrane endocytoses or engulfs the Influenza virus. Once inside the endosome, and upon the host cell's acidification of that compartment, the Influenza HA protein partially unfolds revealing a very hydrophobic fusion peptide that inserts itself into the endosomal membrane. As the rest of the Influenza HA protein refolds, the fusion protein retracts and fuses the endosomal membrane with the viral membrane. Upon fusion of the cellular and viral membranes, the contents of the virus, including the viral genome, are released in the cytoplasm of the target cell.

At least 16 different Influenza A hemagglutinin serotypes or antigens have been identified: H1-H16. Only HA serotypes H1-H3 normally mediate human Influenza infection. However, Influenza strains thought to infect only certain avian or mammalian species can mutate to infect humans. As described above, only a few amino acids need to change along the length of the entire protein to enable Influenza to cross a species barrier. For instance, a single amino acid change in the sequence of the H5 subtype allowed an avian-specific Influenza strain to become infectious in humans (H5N1). A pandemic arose when an Influenza strain common to swine species, became lethal to humans (H1N1). In contrast to Influenza A, Influenza B and C viruses each contain only one form of HA protein.

Specifically, the invention provides an isolated fully human monoclonal antibody, wherein said monoclonal antibody has the following characteristics: a) binds to an influenza A virus; b) binds to a cell contacted with influenza A; c) binds to an epitope of an influenza A viral protein; and, optionally, d) neutralizes influenza A virus infection. An antibody that does not neutralize influenza A virus infection may be used, for instance, for a conjugate therapy. In certain aspects, this antibody binds to a eukaryotic cell. Moreover, the cell is optionally a human cell.

In another aspect, this antibody is isolated from a B-cell from a human donor. Isolation of a fully human monoclonal antibody of the invention from a B-cell is performed using recombinant methods. Alternatively, or in addition, the isolated fully human monoclonal antibody of the invention is isolated from the supernatant of a plasma cell cultured either in vitro or ex vivo. Plasma cells also known as a differentiated B-cells, plasma B-cells, plasmacytes, or effector B-cells. The fully human monoclonal antibody isolated from either a B-cell or a plasma cell demonstrates neutralizing activity.

Antibodies of the invention bind to an epitope of influenza A viral hemagglutinin (HA) protein. Exemplary HA epitopes to which the antibodies of the invention bind include a hemagglutinin precursor peptide (HA0), a HA1 subunit, a HA2 subunit, a mature protein containing HA1 and HA2, and a recombinant HA polypeptide. Alternatively, antibodies of the invention bind to an epitope within a hemagglutinin precursor peptide (HA0), a HA1 subunit, a HA2 subunit, a mature protein containing HA1 and HA2, or a recombinant HA polypeptide. Recombinant HA polypeptides are encoded, for example, by the sequence of SEQ ID NO: 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, or 744.

Antibodies of the invention bind to an epitope that is linear or non-linear. In certain aspects of the invention, a non-linear epitope is a discontinuous epitope.

An antibody of the invention is TCN-522 (3212_I12), TCN-521 (3280_D18), TCN-523 (5248_A17), TCN-563 (5237_B21), TCN-526 (5084_C17), TCN-527 (5086_C06), TCN-528 (5087_P17), TCN-529 (5297_H01), TCN-530 (5248_H10a), TCN-531 (5091_H13), TCN-532 (5262_H18), TCN-533 (5256_A17), TCN-534 (5249_B02), TCN-535 (5246_P19), TCN-536 (5095_N01), TCN-537 (3194_D21), TCN-538 (3206_O17), TCN-539 (5056_A08), TCN-540 (5060_F05), TCN-541 (5062_M11), TCN-542 (5079_A16), TCN-543 (5081_G23), TCN-544 (5082_A19), TCN-545 (5082_I15), TCN-546 (5089_L08), TCN-547 (5092_F11), TCN-548 (5092_P01), TCN-549 (5092_P04), TCN-550 (5096_F06), TCN-551 (5243_D01), TCN-552 (52491123), TCN-553 (5261_C18), TCN-554 (5277_M05), TCN-555 (5246_L16), TCN-556 (5089_K12), TCN-557 (5081_A04), TCN-558 (5248_H10b), TCN-559 (5097_G08), TCN-560 (5084_P10), or TCN-504 (3251_K17).

The invention further encompasses an antibody that binds the same epitope as TCN-522 (3212_I12), TCN-521 (3280_D18), TCN-523 (5248_A17), TCN-563 (5237_B21), TCN-526 (5084_C17), TCN-527 (5086_C06), TCN-528 (5087_P17), TCN-529 (5297_H01), TCN-530 (5248_H10a), TCN-531 (5091_H13), TCN-532 (5262_H18), TCN-533 (5256_A17), TCN-534 (5249_B02), TCN-535 (5246_P19), TCN-536 (5095_N01), TCN-537 (3194_D21), TCN-538 (3206_O17), TCN-539 (5056_A08), TCN-540 (5060_F05), TCN-541 (5062_M11), TCN-542 (5079_A16), TCN-543 (5081_G23), TCN-544 (5082_A19), TCN-545 (5082_I15), TCN-546 (5089_L08), TCN-547 (5092_F11), TCN-548 (5092_P01), TCN-549 (5092_P04), TCN-550 (5096_F06), TCN-551 (5243_D01), TCN-552 (5249_I23), TCN-553 (5261_C18), TCN-554 (5277_M05), TCN-555 (5246_L16), TCN-556 (5089_K12), TCN-557 (5081_A04), TCN-558 (5248_H10b), TCN-559 (5097_G08), TCN-560 (5084_P10), or TCN-504 (3251_K17).

The invention provides an isolated fully human monoclonal anti-HA antibody or fragment thereof, wherein said antibody includes a variable heavy chain (VH) region comprising CDR1 and CDR2, wherein the VH region is encoded by a human IGHV1 (or specifically, IGHV1-18, IGHV1-2, IGHV1-69, IGHV1-8), IGHV2 (or specifically, IGHV2-5), IGHV3 (or specifically, IGHV3-30, IGHV3-33, IGHV3-49, IGHV3-53, 66, IGHV3-7), IGHV4 (or specifically, IGHV4-31, IGHV4-34, IGHV4-39, IGHV4-59, IGHV4-61), or IGHV5 (or specifically, IGHV5-51) VH germline sequence or an allele thereof, or a nucleic acid sequence that is homologous to the IGHV1, IGHV2, IGHV3, IGHV4, or IGHV5 VH germline gene sequence or an allele thereof. In one aspect, the nucleic acid sequence that is homologous to the IGHV1, IGHV2, IGHV3, IGHV4, or IGHV5 VH germline sequence is at least 75% homologous to the IGHV1, IGHV2, IGHV3, IGHV4, or IGHV5 VH germline sequence or an allele thereof. Exemplary alleles include, but are not limited to, IGHV1-18*01, IGHV1-2*02, IGHV1-2*04, IGHV1-69*01, IGHV1-69*05, IGHV1-69*06, IGHV1-69*12, IGHV1-8*01, IGHV2-5*10, IGHV3-30-3*01, IGHV3-30*03, IGHV3-30*18, IGHV3-33*05, IGHV3-49*04, IGHV3-53*01, IGHV3-66*03, IGHV3-7*01, IGHV4-31*03, IGHV4-31*06, IGHV4-34*01, IGHV4-34*02, IGHV4-34*03, IGHV4-34*12, IGHV4-39*01, IGHV4-59*01, IGHV4-59*03, IGHV4-61*01, IGHV4-61*08, and IGHV5-51*01.

An antibody of the invention, or specifically, any antibody described herein, may be operably-linked to a therapeutic agent or a detectable label.

The invention further provides a pharmaceutical composition including an antibody described herein and a pharmaceutical carrier. This composition optionally includes an anti-viral drug, a viral entry inhibitor or a viral attachment inhibitor. Exemplary anti-viral drugs include, but are not limited to, a neuraminidase inhibitor, a HA inhibitor, a sialic acid inhibitor and an M2 ion channel inhibitor. In one embodiment of the composition, the M2 ion channel inhibitor is amantadine or rimantadine. Alternatively, or in addition, the neuraminidase inhibitor zanamivir or oseltamivir phosphate. The composition may also include a second anti-Influenza A antibody. The second anti-Influenza A antibody is optionally an antibody described herein.

The invention provides a method for stimulating an immune response in a subject, including administering to the subject the pharmaceutical composition described herein.

Moreover, the invention provides a method for the treatment of an Influenza virus infection in a subject, including administering to the subject the pharmaceutical composition described herein. This method further includes administering an anti-viral drug, a viral entry inhibitor or a viral attachment inhibitor.

The invention also provides a method for the prevention of an Influenza virus infection in a subject, including administering to the subject the pharmaceutical composition described herein prior to exposure of the subject to Influenza virus or infection. This method further includes administering an anti-viral drug, a viral entry inhibitor or a viral attachment inhibitor. This method may be a method of vaccination.

The subject of these methods may have an Influenza infection or is predisposed to developing an Influenza virus infection. Subjects predisposed to developing an Influenza infection, or who may be at elevated risk for contracting an infection, are those subjects with compromised immune systems because of autoimmune disease, those persons receiving immunosuppressive therapy (for example, following organ transplant), those persons afflicted with human immunodeficiency syndrome (HIV) or acquired immune deficiency syndrome (AIDS), certain forms of anemia that deplete or destroy white blood cells, those persons receiving radiation or chemotherapy, or those persons afflicted with an inflammatory disorder. Additionally, subject of extreme young or old age are at increased risk. Any person who comes into physical contact or close physical proximity with an infected individual has an increased risk of developing an Influenza virus infection. Moreover, a subject is at risk of contracting an influenza infection due to proximity to an outbreak of the disease, e.g. subject resides in a densely-populated city or in close proximity to subjects having confirmed or suspected infections of Influenza virus, or choice of employment, e.g. hospital worker, pharmaceutical researcher, traveler to infected area, or frequent flier.

According to the methods described herein, exemplary anti-viral drugs include, but are not limited to, a neuraminidase inhibitor, a HA inhibitor, a sialic acid inhibitor and an M2 ion channel. In one aspect of these methods, the M2 ion channel inhibitor is amantadine or rimantadine. Alternatively, or in addition, the neuraminidase inhibitor is zanamivir or oseltamivir phosphate.

These methods optionally include administering a second anti-Influenza A antibody. For example, the antibody is administered prior to or after exposure to Influenza virus. In certain aspects of these methods, the antibody is administered at a dose sufficient to promote viral clearance or to eliminate Influenza A infected cells. The second antibody is optionally an antibody described herein.

The invention further provides a method for determining the presence of a Influenza virus infection in a subject, including the steps of: (a) contacting a biological sample obtained from the subject with an antibody described herein or the pharmaceutical composition described herein; (b) detecting an amount of the antibody that binds to the biological sample; and (c) comparing the amount of antibody that binds to the biological sample to a control value, and therefrom determining the presence of the Influenza virus in the subject.

The invention provides a vaccine composition including an antibody described herein. This composition optionally contains a pharmaceutical carrier.

Alternatively, the invention provides a vaccine composition including an epitope of an antibody described herein. This composition optionally contains a pharmaceutical carrier.

Vaccines of the invention are multivalent vaccines. The term “multivalent vaccine” is meant to describe a single vaccine that elicits an immune response either to more than one infectious agent, e.g. recombinant homotrimeric HA0 proteins or fragments thereof derived from multiple strains of Influenza A (see, Table 9), or to several different epitopes of a molecule, e.g. a linear and a discontinuous epitope of the same recombinant homotrimeric HA0 protein or fragment thereof derived from a single strain of Influenza A. Alternatively, or in addition, the term multivalent vaccine is meant to describe the administration of a combination of human antibodies raised against more than one infectious agent, e.g. a combination of HuMHA antibodies raised against recombinant homotrimeric HA0 proteins or fragments thereof derived from multiple strains of Influenza A (see, Table 9).

The invention provides a diagnostic kit including an antibody described herein.

The invention provides a prophylactic kit including an antibody described herein or an epitope of an antibody described herein. Alternatively, or in addition, the invention provides a prophylactic kit including a vaccine composition described herein.

In a preferred embodiment, the present invention provides fully human monoclonal antibodies specifically directed against the Influenza hemagglutinin glycoprotein, which neutralize influenza infection. Optionally, the antibody is isolated from a B-cell from a mammalian donor, and preferably, a human donor. In certain embodiments of the invention, the antibody is identified for its ability to bind an intact or whole Influenza virus. Alternatively, or in addition, the antibody is identified isolated for its ability to bind to an epitope of a recombinant homotrimeric Influenza HA0 protein or HA protein(s) isolated from multiple Influenza strains, or made as recombinant proteins such as those influenza A virus strains provided in Table 9. Alternatively, or in addition, the antibody is identified for its ability to inhibit or neutralize virus infection of susceptible eukaryotic cells. Exemplary neutralizing antibodies of this profile include, but are not limited to, those antibodies listed in Table 10. Alternatively, the monoclonal antibody is an antibody that binds to the same epitope as the antibodies provided in Table 10. In certain embodiments, neutralizing human monoclonal antibodies of the invention are anti-HA antibodies. A monoclonal anti-HA antibody of the invention has one or more of the following characteristics: a) binds to an epitope in an HA1 subunit of an Influenza hemagglutinin (HA) protein; b) binds to an epitope in the HA2 subunit of Influenza hemagglutinin (HA) protein; c) binds to an epitope in the extracellular domain of an Influenza hemagglutinin (HA) protein, consisting of an HA1 subunit and an HA2 subunit; d) binds to an epitope of a recombinant homotrimeric Influenza HA0 protein; e) binds to an epitope of an Influenza HA protein expressed on an infected cell; f) binds to an epitope of an Influenza HA protein expressed on a modified cell; g) binds to an Influenza virus; or h) inhibits virus infection of susceptible eukaryotic cells.

Modified cells of the invention are transfected or transformed with a polynucleotide that encodes an Influenza HA protein, or any fragment thereof. The term “Influenza HA protein fragment” is meant to describe any portion of the protein that is smaller or less than the entire protein. Polynucleotides and polypeptides of the invention do not always encode a functional Influenza HA protein.

Infected cells of the invention are mammalian, and preferably human in origin. Specifically, mammalian cells are infected with Influenza A virus in vivo, in vitro, in situ, ex vivo, in culture, and any combination thereof. Cells are infected with active or inactive virions. Exemplary inactive virions display the HA protein on their surfaces, however, they are replication-defective, and therefore, unable to propagate within the cell or subject.

Epitopes of the human monoclonal antibodies of the invention include a transmembrane or integral membrane Influenza A protein. Specifically, epitopes of the human monoclonal antibodies of the invention comprise Influenza hemagglutinin (HA) protein.

Epitopes of the human monoclonal antibodies of the invention include one or more subunits of an influenza hemagglutinin (HA) protein. HA proteins of the invention include hemagglutinin precursor proteins (HA0), the HA1 subunit, the HA2 subunit, the mature protein containing the HA1 and HA2 subunits, and a recombinant HA protein. Recombinant HA proteins contain SEQ ID NO: 726. Exemplary recombinant proteins include but, are not limited to, those proteins described by SEQ ID NO: 727-744.

Epitopes of the human monoclonal antibodies of the invention are linear or non-linear. For instance, a non-linear epitope is discontinuous. Discontinuous epitopes are available for antibody binding only when the Influenza HA protein is maintained in its native homotrimeric conformation. When an antibody binds to a discontinuous epitope, the antibody binds to a three-dimensional surface of the target protein, i.e. the Influenza HA protein, upon which juxtaposed amino acids are alternatively exposed or masked.

Recombinant homotrimeric HA0 proteins of the invention are encoded by, for instance, sequences described by any one of SEQ ID NO: 727-744. In certain embodiments of the invention, the human monoclonal antibodies, or monoclonal anti-HA antibodies, described herein bind membrane-bound or soluble recombinant homotrimeric Influenza HA proteins. Alternatively, the monoclonal anti-HA antibodies described herein bind membrane-bound and soluble recombinant homotrimeric Influenza HA proteins. In certain embodiments of the invention, the monoclonal anti-HA antibodies described herein bind and neutralize Influenza virus subtypes H1, H2, and H3. In other embodiments of the invention, the monoclonal anti-HA antibodies bind Influenza virus subtypes H1, H2, and H3, and neutralize one of these subtypes, such as H1, H2, or H3. In a specific embodiment, the monoclonal anti-HA antibodies bind Influenza subtypes H1N1, H2N2, and H3N2, and neutralize H1N1.

In one aspect, the HA precursor polypeptide (HA0) of the soluble and recombinant homotrimeric Influenza HA protein contains a trimerization domain (foldon) encoded in the phage T4 fibritin. An exemplary trimerization domain isolated from the phage T4 fibritin has the following sequence wherein a thrombin cleavage site is italicized and bolded, a T4 trimerization domain or sequence is underlined, a V5 tag is boxed, and a hexa-histidine (His) tag is bolded:


As used herein, the term “neutralizing antibody” is meant to describe an antibody that inhibits or prevents influenza A infection, inhibits or prevents Influenza A viral entry into a cell, inhibits or prevents influenza replication, inhibits or prevents influenza egress from a host cell, or reduces the Influenza A titer in a cell, biological sample, or subject. In a preferred embodiment, neutralizing antibodies of the invention prevent viral entry into the cytoplasmic compartment of host cells.

The present invention provides fully human monoclonal antibodies that bind influenza virus and neutralize infection. In certain embodiments, the present invention provides fully human monoclonal neutralizing antibodies specific against the Influenza hemagglutinin protein. The antibodies are respectively referred to herein is human monoclonal anti-HA (huMHA) antibodies.

The Influenza hemagglutinin (HA) protein is a homotrimeric integral membrane glycoprotein found on the surface of the Influenza virus. To mimic the native conformation of this homotrimeric protein, the methods of the invention provide an isolated HA protein precursor that is operably-linked to a trimerization or foldon domain from the phage T4 fibritin protein


The resultant recombinant homotrimeric foldon HA protein not only retains the native Influenza hemagglutinin homotrimeric conformation, but also becomes soluble, i.e. the protein is no longer bound to a viral or cellular membrane. Specifically, these recombinant HA homotrimeric proteins lack an integral membrane or transmembrane domain. In certain embodiments, these recombinant HA homotrimeric proteins include HA1 and HA2 subunits as well as a trimerization domain, the resultant recombinant HA homotrimeric protein containing between 1-50, 50-100, 100-150, 150-200, 200-250, 250-300, 300-350, 350-400, 400-450, 450-500,500-550, 550-600 amino acids (aa) or any length of amino acids in between. Preferably, these recombinant HA homotrimeric proteins contain between 565-575 amino acids (aa). Recombinant HA homotrimeric proteins further include a signal cleavage site at the N-terminus containing between 15-25 aa. Alternatively, or in addition, recombinant HA homotrimeric proteins further include a transmembrane domain positioned between amino acids 525-535 of HA depending on the influenza A virus subtype. In a preferred embodiment, the HA protein is derived from one or more strains of an Influenza A virus. Recombinant HA homotrimeric proteins of the invention retain the native signal sequence to enable secretion. Moreover, recombinant HA homotrimeric proteins of the invention contain a same signal sequence, which is not derived from HA. Furthermore, signal sequences used with recombinant HA homotrimeric proteins of the invention include those signal sequences known in the art that allow efficient secretion of proteins, such as the signal sequence of the immunoglobulin light kappa chain. Alternatively, recombinant HA homotrimeric proteins, or the HA0 precursors thereof, may have the native signal sequences in the expression constructs used by Immune Technology Corp. Signal sequences are retained or manipultated to allow efficient secretion from, for instance, art-recognized cell lines maintained in vitro, e.g. 293 HEK cells.

Recombinant HA homotrimeric proteins may retain a native HA1/HA2 protease cleavage site, which is critical for viral pathogenicity. In one aspect of the invention, recombinant HA homotrimeric proteins contain a substituted HA1/HA2 protease cleavage site. For example, the recombinant HA protein encoded by SEQ ID NO: 737 does not have a native cleavage site, but rather a cleavage site substituted from another HA protein. Furthermore, these proteins optionally retain sialic acid-containing receptor binding sites within the HA1 subunit.

According to the methods of the invention, human antibodies obtained from blood, serum, plasma, or cerebral spinal fluid, are contacted to recombinant and soluble HA homotrimers of the invention in vitro, wherein the recombinant and soluble HA homotrimers act as targets for human antibody binding to confirm specificity of the isolated human antibody for an Influenza HA homotrimer in its native conformation. In general, the methods include obtaining serum or plasma samples from subjects or patients that have been infected with or vaccinated against an infectious agent. These serum or plasma samples are then screened to identify those that contain antibodies specific for a particular polypeptide associated with the infectious agent, such as, e.g. a polypeptide specifically expressed on the surface of cells infected with the infectious agent, but not uninfected cells. In particular embodiments, the serum or plasma samples are screened by contacting the samples with a cell that has been transfected with an expression vector that expresses the polypeptide expressed on the surface of infected cells. In particular embodiments the serum or plasma samples are screened by contacting the samples with a recombinant protein which represents a particular protein of the infectious agent such as, e.g. hemagglutinin of the influenza A virus. In particular embodiments the serum or plasma samples are screened by contacting the samples with a purified form of the infectious agent such as, e.g. intact whole virions of the influenza A virus. In particular embodiments, the serum or plasma samples are screened by contacting the samples with a live form of the infectious agent such as, e.g. intact whole virions of the influenza A virus to determine the presence of serum antibodies that inhibit or neutralize infection of susceptible cells. Exemplary susceptible cells are eukaryotic or mammalian cells, such as MDCK cells.

Once a subject or patient is identified as having serum or plasma containing an antibody specific for the infectious agent polypeptide or virus of interest, mononuclear and/or B cells obtained from the same subject or patient are used to identify a cell or clone thereof that produces the antibody, using any of the methods described herein or available in the art. Once a B cell that produces the antibody is identified, cDNAs encoding the variable regions or fragments thereof of the antibody may be cloned using standard RT-PCR vectors and primers specific for conserved antibody sequences, and subcloned into expression vectors used for the recombinant production of monoclonal antibodies specific for the infectious agent polypeptide of interest.

More specifically, B cells are collected from a particular donor, i.e. a subject or patient is identified as having serum or plasma containing an antibody specific for HA, cultured, and antibody is secreted from these B cells into the culture medium. The culture medium is separated from these B cells, the B cells are lysed, and then frozen for storage. The culture medium is then screened for antibody binding to various HA targets and/or inhibition/neutralization of infection in vitro. When a culture well is identified as having an antibody of the desired specificity, reverse-transcriptase polymerase chain reaction (RT-PCR) is applied to the B-cell lysate to amplify the antibody variable regions and subsequently clone, express, and test for binding and function of the recombinant antibody,

Human antibodies, such as the MAbs listed in Table 10, which bind the recombinant and soluble HA homotrimer and/or bind whole virions, and optionally inhibit or neutralize infection of live virus are recombinantly reproduced and formulated into a pharmaceutical composition for administration to a subject at risk of contacting an Influenza virus. Furthermore, recombinant and soluble HA homotrimers are derived from multiple strains of Influenza viruses, including multiple strains of influenza A virus. Exemplary human antibodies specifically bind Influenza A, and may be selected for an inability to bind influenza B and C virus strains.

The invention further provides a novel process whereby full-length HA is expressed in mammalian cell lines, which allows for the identification of human antibodies that bind this cell-expressed HA. The huMHA antibodies have been shown to bind conformational determinants on the HA-transfected cells, as well as native HA, which can be isolated, or contacted to huMHA antibodies when presented either on Influenza infected cells or on Influenza A virus. Alternatively, or in addition, huMHA antibodies bind native HA, recombinant homotrimeric HA, purified virus, infected cells, linear peptide, synthetic HA peptide, HA transfected mammalian cells, and HA expressed on the surface of genetically altered bacteriophage virus, which are used for gene fragment display assays. Thus, this invention has allowed for the identification and production of human monoclonal antibodies that exhibit novel specificity for a very broad range of Influenza A virus strains. These antibodies may be used prophylactically to prevent Influenza A infection, diagnostically to identify Influenza A infection and therapeutically to treat Influenza A infection. Moreover, the epitopes to which huMHA antibodies of the invention bind are used as vaccines to prevent influenza A infection.

The huMHA antibodies of the invention has one or more of the following characteristics: a) binds to an epitope in an HA1 subunit of an Influenza hemagglutinin (HA) protein; b) binds to an epitope in the HA2 subunit of Influenza hemagglutinin (HA) protein; c) binds to an epitope in the extracellular domain of an Influenza hemagglutinin (HA) protein, consisting of an HA1 subunit and an HA2 subunit; d) binds to an epitope of a recombinant homotrimeric Influenza HA0 protein; e) binds to an epitope of an Influenza HA protein expressed on an infected cell; f) binds to an epitope of an Influenza HA protein expressed on a modified cell; g) binds to an Influenza virus; or h) inhibits virus infection of susceptible eukaryotic cells. The huMHA antibodies of the invention eliminate Influenza infected cells through immune effector mechanisms such as ADCC and/or CDC and promote direct viral clearance by binding to Influenza virions.

Exemplary Influenza A strains used for screening human plasma samples, B Cell Culture supernatants (BCC SN), and monoclonal transfection supernatants (MN are shown in Table 8 below). Live strains were used for the neutralization assays described herein. Inactivated strains were used for the virus binding assays described herein. Recombinant homotrimeric HA protein was used in the trimeric HA binding assay.

TABLE 8 Virus Trimeric HA Virus Subtype Neutralization binding binding A/California/4/09 H1 + A/Solomon Islands/ H1 + + + 3/06 A/South Carolina/1/18 H1 + A/Japan/305/57 H2 + + A/Wisconsin/67/05 H3 + + + A/swine/Ontario/ H4 + 01911-2/99 A/Vietnam/1203/04 H5 + A/Indonesia/5/05 H5 + A/Egypt/3300- H5 + NAMRU3/08 A/common magpie/ H5 + Hong Kong/5052/07 A/Anhui/1/05 H5 + A/chicken/Vietnam/ H5 + NCVD-016/08 A/Hong Kong/156/97 H5 + A/northern shoveler/ H6 + California/HKWF115/ 07 A/Netherlands/219/03 H7 + A/duck/Yangzhou/ H8 + 02/05 A/Hong Kong/2108/03 H9 + A/Hong Kong/1073/99 H9 +

Exemplary HA sequences include those sequences listed on Table 9 below.

TABLE 9 GenBank Type Accession No. Subtype HA Sequence from Strain SEQ ID NO: A ACP41105 H1 A/California/04/2009(H1N1) SEQ ID NO: 727 A ABU99109 H1 A/Solomon Islands/3/2006(H1N1) SEQ ID NO: 728 A AFI17241 H1 A/South Carolina/1/18(H1N1) SEQ ID NO: 729 A AAA43185 H2 A/Japan/305/1957(H2N2) SEQ ID NO: 730 A ACF54576 H3 A/Wisconsin/67/2005(H3N2) SEQ ID NO: 731 A AAG17427 H4 A/Swine/Ontario/01911-2/99 (H4N6) SEQ ID NO: 732 A AF028709 H5 A/Hong Kong/156/97 (H5N1) SEQ ID NO: 733 A AAT73274 H5 A/VietNam/1203/2004(H5N1) SEQ ID NO: 734 A ABW06108 H5 A/Indonesia/5/2005(H5N1) SEQ ID NO: 735 A ACI06185 H5 A/Egypt/3300-NAMRU3/2008(H5N1) SEQ ID NO: 736 A ACJ26242 H5 A/common magpie/Hong Kong/5052/2007(H5N1) SEQ ID NO: 737 A ABD28180 H5 A/Anhui/1/2005(H5N1) SEQ ID NO: 738 A ACO07033 H5 A/chicken/Vietnam/NCVD-016/2008(H5N1) SEQ ID NO: 739 A ACE81692 H6 A/northern shoveler/California/HKWF115/2007(H6N1) SEQ ID NO: 740 A AAR02640 H7 A/Netherlands/219/03(H7N7) SEQ ID NO: 741 A ABK32094 H8 A/duck/Yangzhou/02/2005(H8N4) SEQ ID NO: 742 A ABB58945 H15 A/HK/2108/2003(H9N2) SEQ ID NO: 743 A NC_004908 H9 A/Hong Kong/1073/99 (H9N2) SEQ ID NO: 744

In one embodiment, the huMHA antibodies of the invention bind to an HA that wholly or partially includes the amino acid residues from position 1 to position 525 of Influenza hemagglutinin when numbered in accordance with SEQ ID NO: 727-744. Alternatively, the monoclonal antibody is an antibody that binds to the same epitope as the mAbs listed in Table 10.

TABLE 10 BCC Well ID Theraclone ID 3251_K17 TCN-504 3280_D18 TCN-521 3212_I12 TCN-522 5248_A17 TCN-523 5237_B21 TCN-524 5084_C17 TCN-526 5086_C06 TCN-527 5087_P17 TCN-528 5297_H01 TCN-529 5248_H10a TCN-530 5091_H13 TCN-531 5262_H18 TCN-532 5256_A17 TCN-533 5249_B02 TCN-534 5246_P19 TCN-535 5095_N01 TCN-536 3194_D21 TCN-537 3206_O17 TCN-538 5056_A08 TCN-539 5060_F05 TCN-540 5062_M11 TCN-541 5079_A16 TCN-542 5081_G23 TCN-543 5082_A19 TCN-544 5082_I15 TCN-545 5089_L08 TCN-546 5092_F11 TCN-547 5092_P01 TCN-548 5092_P04 TCN-549 5096_F06 TCN-550 5243_D01 TCN-551 5249_I23 TCN-552 5261_C18 TCN-553 5277_M05 TCN-554 5246_L16 TCN-555 5089_K12 TCN-556 5081_A04 TCN-557 5248_H10b TCN-558 5097_G08 TCN-559 5084_P10 TCN-560

The antibodies of the invention are able to neutralize Influenza A. Monoclonal antibodies can be produced by known procedures, e.g., as described by R. Kennet et al. in “Monoclonal Antibodies and Functional Cell Lines; Progress and Applications”. Plenum Press (New York), 1984. Further materials and methods applied are based on known procedures, e.g., such as described in J. Virol. 67:6642-6647, 1993.

These antibodies can be used as prophylactic or therapeutic agents upon appropriate formulation, or as a diagnostic tool.

A “neutralizing antibody” is one that can neutralize the ability of that pathogen to initiate and/or perpetuate an infection in a host and/or in target cells in vitro. The invention provides a neutralizing monoclonal human antibody, wherein the antibody recognizes an antigen from an Influenza virus, which is preferably derived from the HA protein. Preferably an antibody according to the invention is a novel monoclonal antibody referred to herein as TCN-522 (corresponding to BCC plate and well location 3212_I12), TCN-521 (3280_D18), TCN-523 (5248_A17), TCN-563 (5237_B21), TCN-526 (5084_C17), TCN-527 (5086_C06), TCN-528 (5087_P17), TCN-529 (5297_H01), TCN-530 (5248_H10a), TCN-531 (5091_H13), TCN-532 (5262_H18), TCN-533 (5256_A17), TCN-534 (5249_B02), TCN-535 (5246_P19), TCN-536 (5095_N01), TCN-537 (3194_D21), TCN-538 (3206_O17), TCN-539 (5056_A08), TCN-540 (5060_F05), TCN-541 (5062_M11), TCN-542 (5079_A16), TCN-543 (5081_G23), TCN-544 (5082_A19), TCN-545 (5082_I15), TCN-546 (5089_L08), TCN-547 (5092_F11), TCN-548 (5092_P01), TCN-549 (5092_P04), TCN-550 (5096_F06), TCN-551 (5243_D01), TCN-552 (5249_I23), TCN-553 (5261_C18), TCN-554 (5277_M05), TCN-555 (5246_L16), TCN-556 (5089_K12), TCN-557 (5081_A04), TCN-558 (5248_H10b), TCN-559 (5097_G08), TCN-560 (5084_P10), and TCN-504 (3251_K17). These antibodies were initially isolated from human samples and are produced by the B cell cultures referred to as 3212_I12, 3280_D18, 5248_A17, 5237_B21, 5084_C17, 5086_C06, 5087_P17, 5297_H01, 5248_H10a, 5091_H13, 5262_H18, 5256_A17, 5249_B02, 5246_P19, 5095_N01, 3194_D21, 3206_O17, 5056_A08, 5060_F05, 5062_M11, 5079_A16, 5081_G23, 5082_A19, 5082_I15, 5089_L08, 5092_F11, 5092_P01, 5092_P04, 5096_F06, 5243_D01, 5249_I23, 5261_C18, 5277_M05, 5246_L16, 5089_K12, 5081_A04, 5248_H10b, 5097_G08, 5084_P10, and 3251_K17. These antibodies have broad neutralizing activity or broad binding activity for Influenza A in vitro.

The CDRs of the antibody heavy chains are referred to as CDRH1, CDRH2 and CDRH3, respectively. Similarly, the CDRs of the antibody light chains are referred to as CDRL1, CDRL2 and CDRL3, respectively. The position of the CDR amino acids is defined according to the IMGT numbering system as: CDR1—IMGT positions 27 to 38, CDR2—IMGT positions 56 to 65 and CDR3—IMGT positions 105 to 117. (Lefranc, M P. et al. 2003 IMGT unique numbering for immunoglobulin and T cell receptor variable regions and Ig superfamily V-like domains. Dev Comp Immunol. 27 (1):55-77; Lefranc, M P. 1997. Unique database numbering system for immunogenetic analysis. Immunology Today, 18:509; Lefranc, M P. 1999. The IMGT unique numbering for Immunoglobulins, T cell receptors and Ig-like domains. The Immunologist, 7:132-136.)

The sequences of the antibodies were determined, including the sequences of the variable regions of the Gamma heavy and Kappa or Lambda light chains of the antibodies designated. In addition, the sequence of each of the polynucleotides and polypeptides encoding the antibody sequences was determined for TCN-522 (3212_I12), TCN-521 (3280_D18), TCN-523 (5248_A17), TCN-563 (5237_B21), TCN-526 (5084_C17), TCN-527 (5086_C06), TCN-528 (5087_P17), TCN-529 (5297_H01), TCN-530 (5248_H10a), TCN-531 (5091_H13), TCN-532 (5262_H18), TCN-533 (5256_A17), TCN-534 (5249_B02), TCN-535 (5246_P19), TCN-536 (5095_N01), TCN-537 (3194_D21), TCN-538 (3206_O17), TCN-539 (5056_A08), TCN-540 (5060_F05), TCN-541 (5062_M11), TCN-542 (5079_A16), TCN-543 (5081_G23), TCN-544 (5082_A19), TCN-545 (5082_I15), TCN-546 (5089_L08), TCN-547 (5092_F11), TCN-548 (5092_P01), TCN-549 (5092_P04), TCN-550 (5096_F06), TCN-551 (5243_D01), TCN-552 (52491123), TCN-553 (5261_C18), TCN-554 (5277_M05), TCN-555 (5246_L16), TCN-556 (5089_K12), TCN-557 (5081_A04), TCN-558 (5248_H10b), TCN-559 (5097_G08), TCN-560 (5084_P10), and TCN-504 (3251_K17).

Shown below are the polypeptide and polynucleotide sequences of the heavy and light chains, with the signal peptides at the N-terminus (or 5′ end) and the constant regions at the C-terminus (or 3′ end) of the variable regions, which are shown in bolded text.

TCN-504 (3251_K17) Heavy Chain Variable Region Nucleotide Sequence:


TCN-504 (3251_K17) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-504 (3251_K17) Gamma Heavy Chain Kabat CDRs:


TCN-504 (3251_K17) Gamma Heavy Chain Chothia CDRs


TCN-504 (3251_K17) Light Chain Variable Region Nucleotide Sequence:


TCN-504 (3251_K17) Light Chain Variable Region Amino Acid Sequence (KabatCDRs in Bold, Chothia CDRs Underlined)


TCN-504 (3251_K17) Light Chain Kabat CDRs:


TCN-504 (3251_K17) Light Chain Chothia CDRs:


TCN-521 (3280_D18) Heavy Chain Variable Region Nucleotide Sequence:


TCN-521 (3280_D18) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-521 (3280_D18) Gamma Heavy Chain Kabat CDRs:


TCN-521 (3280_D18) Gamma Heavy Chain Chothia CDRs:


TCN-521 (3280_D18) Light Chain Variable Region Nucleotide Sequence:


TCN-521 (3280_D18) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-521 (3280_D18) Light Chain Kabat CDRs:


TCN-521 (3280_D18) Light Chain Chothia CDRs:


TCN-522 (3212_I12) Heavy Chain Variable Region Nucleotide Sequence:


TCN-522 (3212_I12) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-522 (3212_I12) Gamma Heavy Chain Kabat CDRs:


TCN-522 (3212_I12) Gamma Heavy Chain Chothia CDRs:


TCN-522 (3212_I12) Light Chain Variable Region Nucleotide Sequence:


TCN-522 (3212_I12) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-522 (3212_I12) Light Chain Kabat CDRs:


TCN-522 (3212_I12) Light Chain Chothia CDRs


TCN-523 (5248_A17) Heavy Chain Variable Region Nucleotide Sequence:


TCN-523 (5248_A17) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-523 (5248_A17) Gamma Heavy Chain Kabat CDRs:


TCN-523 (5248_A17) Gamma Heavy Chain Chothia CDRs:


TCN-523 (5248_A17) Light Chain Variable Region Nucleotide Sequence:


TCN-523 (5248_A17) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-523 (5248_A17) Light Chain Kabat CDRs:


TCN-523 (5248_A17) Light Chain Chothia CDRs:


TCN-563 (5237_B21) Heavy Chain Variable Region Nucleotide Sequence:


TCN-563 (5237_B21) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-563 (5237_B21) Gamma Heavy Chain Kabat CDRs:


TCN-563 (5237_B21) Gamma Heavy Chain Chothia CDRs:


TCN-563 (5237_B21) Light Chain Variable Region Nucleotide Sequence:


TCN-563 (5237_B21) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-563 (5237_B21) Light Chain Kabat CDRs:


TCN-563 (5237_B21) Light Chain Chothia CDRs:


TCN-526 (5084_C17) heavy chain variable region nucleotide sequence:


TCN-526 (5084_C17) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-526 (5084_C17) Gamma Heavy Chain Kabat CDRs:


TCN-526 (5084_C17) Gamma Heavy Chain Chothia CDRs:


TCN-526 (5084_C17) Light Chain Variable Region Nucleotide Sequence:


TCN-526 (5084_C17) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-526 (5084_C17) Light Chain Kabat CDRs:


TCN-526 (5084_C17) Light Chain Chothia CDRs:


TCN-527 (5086_C06) Heavy Chain Variable Region Nucleotide Sequence:


TCN-527 (5086_C06) Gamma Heavy Chain Variable Region Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-527 (5086_C06) Gamma Heavy Chain Kabat CDRs:


TCN-527 (5086_C06) Gamma Heavy Chain Chothia CDRs:


TCN-527 (5086_C06) Light Chain Variable Region Nucleotide Sequence:


TCN-527 (5086_C06) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-527 (5086_C06) Light Chain Kabat CDRs:


TCN-527 (5086_C06) Light Chain Chothia CDRs:


TCN-528 (5087_P17) Heavy Chain Variable Region Nucleotide Sequence:


TCN-528 (5087_P17) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in bold, Chothia CDRs underlined)


TCN-528 (5087_P17) Gamma Heavy Chain Kabat CDRs:


TCN-528 (5087_P17) Gamma Heavy Chain Chothia CDRs:


TCN-528 (5087_P17) Light Chain Variable Region Nucleotide Sequence:


TCN-528 (5087_P17) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-528 (5087_P17) Light Chain Kabat CDRs:


TCN-528 (5087_P17) Light Chain Chothia CDRs:


TCN-529 (5297_H01) Heavy Chain Variable Region Nucleotide Sequence:


TCN-529 (5297_H01) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-529 (5297_H01) Gamma Heavy Chain Kabat CDRs:


TCN-529 (5297_H01) Gamma Heavy Chain Chothia CDRs:


TCN-529 (5297_H01) Light Chain Variable Region Nucleotide Sequence:


TCN-529 (5297_H01) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-529 (5297_H01) Light Chain Kabat CDRs:


TCN-529 (5297_H01) Light Chain Chothia CDRs:


TCN-530 (5248_H10a) Heavy Chain Variable Region Nucleotide Sequence:


TCN-530 (5248_H10a) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-530 (5248_H10a) Gamma Heavy Chain Kabat CDRs:


TCN-530 (5248_H10a) Gamma Heavy Chain Chothia CDRs:


TCN-530 (5248_H10a) Light Chain Variable Region Nucleotide Sequence:


TCN-530 (5248_H10a) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-530 (5248_H10a) Light Chain Kabat CDRs:


TCN-530 (5248_H10a) Light Chain Chothia CDRs:


TCN-531 (5091_H13) Heavy Chain Variable Region Nucleotide Sequence:


TCN-531 (5091_H13) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-531 (5091_H13) Gamma Heavy Chain Kabat CDRs:


TCN-531 (5091_H13) Gamma Heavy Chain Chothia CDRs:


TCN-531 (5091_H13) light chain variable region nucleotide sequence:


TCN-531 (5091_H13) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-531 (5091_H13) Light Chain Kabat CDRs:


TCN-531 (5091_H13) Light Chain Chothia CDRs:


TCN-532 (5262_H18) Heavy Chain Variable Region Nucleotide Sequence:


TCN-532 (5262_H18) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-532 (5262_H18) Gamma Heavy Chain Kabat CDRs:


TCN-532 (5262_H18) Gamma Heavy Chain Chothia CDRs:


TCN-532 (5262_H18) Light Chain Variable Region Nucleotide Sequence:


TCN-532 (5262_H18) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-532 (5262_H18) Light Chain Kabat CDRs:


TCN-532 (5262_H18) Light Chain Chothia CDRs:


TCN-533 (5256_A17) Heavy Chain Variable Region Nucleotide Sequence:


TCN-533 (5256_A17) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-533 (5256_A17) Gamma Heavy Chain Kabat CDRs:


TCN-533 (5256_A17) Gamma Heavy Chain Chothia CDRs:


TCN-533 (5256_A17) Light Chain Variable Region Nucleotide Sequence:


TCN-533 (5256_A17) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-533 (5256_A17) Light Chain Kabat CDRs:


TCN-533 (5256_A17) Light chain Chothia CDRs:


TCN-534 (5249_B02) Heavy Chain Variable Region Nucleotide Sequence:


TCN-534 (5249_B02) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-534 (5249_B02) Gamma Heavy Chain Kabat CDRs:


TCN-534 (5249_B02) Gamma Heavy Chain Chothia CDRs:


TCN-534 (5249_B02) Light Chain Variable Region Nucleotide Sequence:


TCN-534 (5249_B02) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-534 (5249_B02) Light Chain Kabat CDRs:


TCN-534 (5249_B02) Light Chain Chothia CDRs:


TCN-535 (5246_P19) Heavy Chain Variable Region Nucleotide Sequence:


TCN-535 (5246_P19) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-535 (5246_P19) Gamma Heavy Chain Kabat CDRs:


TCN-535 (5246_P19) Gamma Heavy Chain Chothia CDRs:


TCN-535 (5246_P19) Light Chain Variable Region Nucleotide Sequence:


TCN-535 (5246_P19) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-535 (5246_P19) Light Chain Kabat CDRs:


TCN-535 (5246_P19) Light Chain Chothia CDRs:


TCN-536 (5095_N01) Heavy Chain Variable Region Nucleotide Sequence:


TCN-536 (5095_N01) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-536 (5095_N01) Gamma Heavy Chain Kabat CDRs:


TCN-536 (5095_N01) Gamma Heavy Chain Chothia CDRs:


TCN-536 (5095_N01) Light Chain Variable Region Nucleotide Sequence:


TCN-536 (5095_N01) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-536 (5095_N01) Light Chain Kabat CDRs:


TCN-536 (5095_N01) Light Chain Chothia CDRs:


TCN-537 (3194_D21) Heavy Chain Variable Region Nucleotide Sequence:


TCN-537 (3194_D21) gamma heavy chain variable region amino acid sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-537 (3194_D21) Gamma Heavy Chain Kabat CDRs:


TCN-537 (3194_D21) Gamma Heavy Chain Chothia CDRs:


TCN-537 (3194_D21) Light Chain Variable Region Nucleotide Sequence:


TCN-537 (3194_D21) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-537 (3194_D21) Light Chain Kabat CDRs:


TCN-537 (3194_D21) Light Chain Chothia CDRs:


TCN-538 (3206_O17) Heavy Chain Variable Region Nucleotide Sequence:


TCN-538 (3206_O17) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-538 (3206_O17) Gamma Heavy Chain Kabat CDRs:


TCN-538 (3206_O17) Gamma Heavy Chain Chothia CDRs:


TCN-538 (3206_O17) Light Chain Variable Region Nucleotide Sequence:


TCN-538 (3206_O17) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRS Underlined)


TCN-538 (3206_O17) Light Chain Kabat CDRs:


TCN-538 (3206_O17) Light Chain Chothia CDRs:


TCN-539 (5056_A08) Heavy Chain Variable Region Nucleotide Sequence:


TCN-539 (5056_A08) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-539 (5056_A08) Gamma Heavy Chain Kabat CDRs:


TCN-539 (5056_A08) Gamma Heavy Chain Chothia CDRs:


TCN-539 (5056_A08) light chain variable region nucleotide sequence:


TCN-539 (5056_A08) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-539 (5056_A08) Light Chain Kabat CDRs:


TCN-539 (5056_A08) Light Chain Chothia CDRs:


TCN-540 (5060_F05) Heavy Chain Variable Region Nucleotide Sequence:


TCN-540 (5060_F05) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-540 (5060_F05) Gamma Heavy Chain Kabat CDRs:


TCN-540 (5060_F05) Gamma Heavy Chain Chothia CDRs:


TCN-540 (5060_F05) Light Chain Variable Region Nucleotide Sequence:


TCN-540 (5060_F05) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-540 (5060_F05) Light chain Kabat CDRs:


TCN-540 (5060_F05) Light Chain Chothia CDRs:


TCN-541 (5062_M11) Heavy Chain Variable Region Nucleotide Sequence:


TCN-541 (5062_M11) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-541 (5062_M11) Gamma Heavy Chain Kabat CDRs:


TCN-541 (5062_M11) Gamma Heavy Chain Chothia CDRs:


TCN-541 (5062_M11) Light Chain Variable Region Nucleotide Sequence:


TCN-541 (5062_M11) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-541 (5062_M11) Light Chain Kabat CDRs:


TCN-541 (5062_M11) Light Chain Chothia CDRs:


TCN-542 (5079_A16) Heavy Chain Variable Region Nucleotide Sequence:


TCN-542 (5079_A16) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-542 (5079_A16) Gamma Heavy Chain Kabat CDRs:


TCN-542 (5079_A16) Gamma Heavy Chain Chothia CDRs:


TCN-542 (5079_A16) Light Chain Variable Region Nucleotide Sequence:


TCN-542 (5079_A16) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-542 (5079_A16) Light Chain Kabat CDRs:


TCN-542 (5079_A16) Light Chain Chothia CDRs:


TCN-543 (5081_G23) Heavy Chain Variable Region Nucleotide Sequence:


TCN-543 (5081_G23) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-543 (5081_G23) Gamma Heavy Chain Kabat CDRs:


TCN-543 (5081_G23) Gamma Heavy Chain Chothia CDRs:


TCN-543 (5081_G23) Light Chain Variable Region Nucleotide Sequence:


TCN-543 (5081_G23) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-543 (5081_G23) Light Chain Kabat CDRs:


TCN-543 (5081_G23) Light Chain Chothia CDRs:


TCN-544 (5082_A19) Heavy Chain Variable Region Nucleotide Sequence:


TCN-544 (5082_A19) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-544 (5082_A19) Gamma Heavy Chain Kabat CDRs:


TCN-544 (5082_A19) Gamma Heavy Chain Chothia CDRs:


TCN-544 (5082_A19) Light Chain Variable Region Nucleotide Sequence:


TCN-544 (5082_A19) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-544 (5082_A19) Light Chain Kabat CDRs:


TCN-544 (5082_A19) Light Chain Chothia CDRs:


TCN-545 (5082_I15) Heavy Chain Variable Region Nucleotide Sequence:


TCN-545 (5082_I15) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in bold, Chothia CDRs underlined)


TCN-545 (5082_I15) Gamma Heavy Chain Kabat CDRs:


TCN-545 (5082_I15) Gamma Heavy Chain Chothia CDRs:


TCN-545 (5082_I15) Light Chain Variable Region Nucleotide Sequence:


TCN-545 (5082_I15) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-545 (5082_I15) Light Chain Kabat CDRs:


TCN-545 (5082_I15) Light Chain Chothia CDRs:


TCN-546 (5089_L08) Heavy Chain Variable Region Nucleotide Sequence:


TCN-546 (5089_L08) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-546 (5089_L08) Gamma Heavy Chain Kabat CDRs:


TCN-546 (5089_L08) Gamma Heavy Chain Chothia CDRs:


TCN-546 (5089_L08) Light Chain Variable Region Nucleotide Sequence:


TCN-546 (5089_L08) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-546 (5089_L08) Light Chain Kabat CDRs:


TCN-546 (5089_L08) Light Chain Chothia CDRs:


TCN-547 (5092_F11) Heavy Chain Variable Region Nucleotide Sequence:


TCN-547 (5092_F11) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-547 (5092_F11) Gamma Heavy Chain Kabat CDRs:


TCN-547 (5092_F11) Gamma Heavy Chain Chothia CDRs:


TCN-547 (5092_F11) Light Chain Variable Region Nucleotide Sequence:


TCN-547 (5092_F11) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-547 (5092_F11) Light Chain Kabat CDRs:


TCN-547 (5092_F11) Light Chain Chothia CDRs:


TCN-548 (5092_P01) Heavy Chain Variable Region Nucleotide Sequence:


TCN-548 (5092_P01) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-548 (5092_P01) Gamma Heavy Chain Kabat CDRs:


TCN-548 (5092_P01) Gamma Heavy Chain Chothia CDRs:


TCN-548 (5092_P01) Light Chain Variable Region Nucleotide Sequence:


TCN-548 (5092_P01) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-548 (5092_P01) Light Chain Kabat CDRs:


TCN-548 (5092_P01) Light Chain Chothia CDRs:


TCN-549 (5092_P04) Heavy Chain Variable Region Nucleotide Sequence:


TCN-549 (5092_P04) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-549 (5092_P04) Gamma Heavy Chain Kabat CDRs:


TCN-549 (5092_P04) Gamma Heavy Chain Chothia CDRs:


TCN-549 (5092_P04) Light Chain Variable Region Nucleotide Sequence:


TCN-549 (5092_P04) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-549 (5092_P04) Light Chain Kabat CDRs:


TCN-549 (5092_P04) Light Chain Chothia CDRs:


TCN-550 (5096_F06) Heavy Chain Variable Region Nucleotide Sequence:


TCN-550 (5096_F06) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-550 (5096_F06) Gamma Heavy Chain Kabat CDRs:


TCN-550 (5096_F06) Gamma Heavy Chain Chothia CDRs:


TCN-550 (5096_F06) Light Chain Variable Region Nucleotide Sequence:


TCN-550 (5096_F06) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-550 (5096_F06) Light Chain Kabat CDRs:


TCN-550 (5096_F06) Light Chain Chothia CDRs:


TCN-551 (5243_D01) Heavy Chain Variable Region Nucleotide Sequence:


TCN-551 (5243_D01) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-551 (5243_D01) Gamma Heavy Chain Kabat CDRs:


TCN-551 (5243_D01) Gamma Heavy Chain Chothia CDRs:


TCN-551 (5243_D01) Light Chain Variable Region Nucleotide Sequence:


TCN-551 (5243_D01) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-551 (5243_D01) Light Chain Kabat CDRs:


TCN-551 (5243_D01) Light Chain Chothia CDRs:


TCN-552 (52491123) Heavy Chain Variable Region Nucleotide Sequence:


TCN-552 (5249_I23) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-552 (5249_I23) gamma heavy chain Kabat CDRs:


TCN-552 (52491123) Gamma Heavy Chain Chothia CDRs:


TCN-552 (52491123) Light Chain Variable Region Nucleotide Sequence:


TCN-552 (5249_I23) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-552 (52491123) Light Chain Kabat CDRs:


TCN-552 (52491123) Light Chain Chothia CDRs:


TCN-553 (5261_C18) Heavy Chain Variable Region Nucleotide Sequence:


TCN-553 (5261_C18) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-553 (5261_C18) Gamma Heavy Chain Kabat CDRs:


TCN-553 (5261_C18) Gamma Heavy Chain Chothia CDRs:


TCN-553 (5261_C18) Light Chain Variable Region Nucleotide Sequence:


TCN-553 (5261_C18) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-553 (5261_C18) Light Chain Kabat CDRs:


TCN-553 (5261_C18) Light Chain Chothia CDRs:


TCN-554 (5277_M05) Heavy Chain Variable Region Nucleotide Sequence:


TCN-554 (5277_M05) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-554 (5277_M05) Gamma Heavy Chain Kabat CDRs:


TCN-554 (5277_M05) Gamma Heavy Chain Chothia CDRs:


TCN-554 (5277_M05) Light Chain Variable Region Nucleotide Sequence:


TCN-554 (5277_M05) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-554 (5277_M05) Light Chain Kabat CDRs:


TCN-554 (5277_M05) Light Chain Chothia CDRs:


TCN-555 (5246_L16) Heavy Chain Variable Region Nucleotide Sequence:


TCN-555 (5246_L16) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-555 (5246_L16) gamma heavy chain Kabat CDRs:


TCN-555 (5246_L16) Gamma Heavy Chain Chothia CDRs:


TCN-555 (5246_L16) Light Chain Variable Region Nucleotide Sequence:


TCN-555 (5246_L16) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-555 (5246_L16) Light Chain Kabat CDRs:


TCN-555 (5246_L16) Light Chain Chothia CDRs:


TCN-556 (5089_K12) Heavy Chain Variable Region Nucleotide Sequence:


TCN-556 (5089_K12) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-556 (5089_K12) gamma heavy chain Kabat CDRs:


TCN-556 (5089_K12) Gamma Heavy Chain Chothia CDRs:


TCN-556 (5089_K12) Light Chain Variable Region Nucleotide Sequence:


TCN-556 (5089_K12) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-556 (5089_K12) Light Chain Kabat CDRs:


TCN-556 (5089_K12) Light Chain Chothia CDRs:


TCN-557 (5081_A04) Heavy Chain Variable Region Nucleotide Sequence:


TCN-557 (5081_A04) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-557 (5081_A04) Gamma Heavy Chain Kabat CDRs:


TCN-557 (5081_A04) Gamma Heavy Chain Chothia CDRs:


TCN-557 (5081_A04) Light Chain Variable Region Nucleotide Sequence:


TCN-557 (5081_A04) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-557 (5081_A04) Light Chain Kabat CDRs:


TCN-557 (5081_A04) Light Chain Chothia CDRs:


TCN-558 (5248_H10b) Heavy Chain Variable Region Nucleotide Sequence:


TCN-558 (5248_H10b) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-558 (5248_H10b) Gamma Heavy Chain Kabat CDRs:


TCN-558 (5248_H10b) Gamma Heavy Chain Chothia CDRs:


TCN-558 (5248_H10b) Light Chain Variable Region Nucleotide Sequence:


TCN-558 (5248_H10b) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-558 (5248_H10b) Light Chain Kabat CDRs:


TCN-558 (5248_H10b) Light Chain Chothia CDRs:


TCN-559 (5097_G08) Heavy Chain Variable Region Nucleotide Sequence:


TCN-559 (5097_G08) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in bold, Chothia CDRs underlined)


TCN-559 (5097_G08) Gamma Heavy Chain Kabat CDRs:


TCN-559 (5097_G08) Gamma Heavy Chain Chothia CDRs:


TCN-559 (5097_G08) Light Chain Variable Region Nucleotide Sequence:


TCN-559 (5097_G08) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-559 (5097_G08) Light Chain Kabat CDRs:


TCN-559 (5097_G08) Light Chain Chothia CDRs:


TCN-560 (5084_P10) Heavy Chain Variable Region Nucleotide Sequence:


TCN-560 (5084_P10) Gamma Heavy Chain Variable Region Amino Acid Sequence: (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-560 (5084_P10) Gamma Heavy Chain Kabat CDRs:


TCN-560 (5084_P10) Gamma Heavy Chain Chothia CDRs:


TCN-560 (5084_P10) Light Chain Variable Region Nucleotide Sequence:


TCN-560 (5084_P10) Light Chain Variable Region Amino Acid Sequence (Kabat CDRs in Bold, Chothia CDRs Underlined)


TCN-560 (5084_P10) Light Chain Kabat CDRs:


TCN-560 (5084_P10) Light Chain Chothia CDRs:


The invention provides an isolated fully human monoclonal anti-HA antibody or fragment thereof, wherein said antibody includes a variable heavy chain (VH) region comprising CDR1 and CDR2, wherein the VH region is encoded by a human IGHV1 (or specifically, IGHV1-18, IGHV1-2, IGHV1-69, IGHV1-8), IGHV2 (or specifically, IGHV2-5), IGHV3 (or specifically, IGHV3-30, IGHV3-33, IGHV3-49, IGHV3-53, 66, IGHV3-7), IGHV4 (or specifically, IGHV4-31, IGHV4-34, IGHV4-39, IGHV4-59, IGHV4-61), or IGHV5 (or specifically, IGHV5-51) VH germline sequence or an allele thereof, or a nucleic acid sequence that is homologous to the IGHV1, IGHV2, IGHV3, IGHV4, or IGHV5 VH germline gene sequence or an allele thereof. In one aspect, the nucleic acid sequence that is homologous to the IGHV1, IGHV2, IGHV3, IGHV4, or IGHV5 VH germline sequence is at least 75% homologous to the IGHV1, IGHV2, IGHV3, IGHV4, or IGHV5 VH germline sequence or an allele thereof. Exemplary alleles include, but are not limited to, IGHV1-18*01, IGHV1-2*02, IGHV1-2*04, IGHV1-69*01, IGHV1-69*05, IGHV1-69*06, IGHV1-69*12, IGHV1-8*01, IGHV2-5*10, IGHV3-30-3*01, IGHV3-30*03, IGHV3-30*18, IGHV3-33*05, IGHV3-49*04, IGHV3-53*01, IGHV3-66*03, IGHV3-7*01, IGHV4-31*03, IGHV4-31*06, IGHV4-34*01, IGHV4-34*02, IGHV4-34*03, IGHV4-34*12, IGHV4-39*01, IGHV4-59*01, IGHV4-59*03, IGHV4-61*01, IGHV4-61*08, and IGHV5-51*01. Exemplary sequences for each allele are provided below.

IGHV1-18*01 Nucleotide Sequence (SEQ ID NO: 1198)


IGHV1-2*02 Nucleotide Sequence (SEQ ID NO: 1199)


IGHV1-2*04 Nucleotide Sequence (SEQ ID NO: 1200)


IGHV1-69*01 Nucleotide Sequence (SEQ ID NO: 1201)


IGHV1-69*05 Nucleotide Sequence (SEQ ID NO: 1202)


IGHV1-69*06 Nucleotide Sequence (SEQ ID NO: 1203)


IGHV1-69*12 Nucleotide Sequence (SEQ ID NO: 1204)


IGHV1-8*01 Nucleotide Sequence (SEQ ID NO: 1205)


IGHV2-5*10 Nucleotide Sequence (SEQ ID NO: 1206)


IGHV3-30-3*01 Nucleotide Sequence (SEQ ID NO: 1207)


IGHV3-30*03 Nucleotide Sequence (SEQ ID NO: 1208)


IGHV3-30*18 Nucleotide Sequence (SEQ ID NO: 1209)


IGHV3-33*05 Nucleotide Sequence (SEQ ID NO: 1210)


IGHV3-49*04 Nucleotide Sequence (SEQ ID NO: 1211)


IGHV3-53*01 Nucleotide Sequence (SEQ ID NO: 1212)


IGHV3-66*03 Nucleotide Sequence (SEQ ID NO: 1213)


IGHV3-7*01 Nucleotide Sequence (SEQ ID NO: 1214)


IGHV4-31*03 Nucleotide Sequence (SEQ ID NO: 1215)


IGHV4-31*06 Nucleotide Sequence (SEQ ID NO: 1216)


IGHV4-34*01 Nucleotide Sequence (SEQ ID NO: 1217)


IGHV4-34*02 Nucleotide Sequence (SEQ ID NO: 1218)


IGHV4-34*03 Nucleotide Sequence (SEQ ID NO: 1219)


IGHV4-34*12 Nucleotide Sequence (SEQ ID NO: 1220)


IGHV4-39*01 Nucleotide Sequence (SEQ ID NO: 1221)


IGHV4-59*01 Nucleotide Sequence (SEQ ID NO: 1222)


IGHV4-59*03 Nucleotide Sequence (SEQ ID NO: 1223)


IGHV4-61*01 Nucleotide Sequence (SEQ ID NO: 1224)


IGHV4-61*08 Nucleotide Sequence (SEQ ID NO: 1225)


IGHV5-51*01 Nucleotide Sequence (SEQ ID NO: 1226)


In certain embodiments of the invention, the antibody further includes a variable light chain (VL) region encoded by a human IGKV1 (or specifically, IGKV1-17, IGKV1-27, IGKV1-39, IGKV1D-39, IGKV1-5), IGKV2 (or specifically, IGKV2-30), IGKV3 (or specifically, IGKV3-11, IGKV3-15, IGKV3-20), IGKV4 (or specifically, IGKV4-1, IGKV4-1), IGLV1 (or specifically, IGLV1-40, IGLV1-44, IGLV1-55), IGLV2 (or specifically, IGLV2-11, IGLV2-14, IGLV2-8), IGLV3 (or specifically, IGLV3-21 or IGLV3-25), IGLV7 (or specifically, IGLV7-43 or IGLV7-46), or IGLV9 (or specifically, IGLV9-49) or an allele thereof. VL germline gene sequence IGKV1, IGKV2, IGKV3, IGKV4, IGLV1, IGLV2, IGLV3, IGLV7, or IGLV9 or an allele thereof, or a nucleotide acid sequence that is homologous to the IGKV1, IGKV2, IGKV3, IGKV4, IGLV1, IGLV2, IGLV3, IGLV7, or IGLV9 VL germline gene sequence or an allele thereof. Furthermore, the nucleic acid sequence that is homologous to the IGKV1, IGKV2, IGKV3, IGKV4, IGLV1, IGLV2, IGLV3, IGLV7, or IGLV9 VL germline sequence or an allele thereof is at least 65% homologous to the IGKV1, IGKV2, IGKV3, IGKV4, IGLV1, IGLV2, IGLV3, IGLV7, or IGLV9 VL germline sequence or an allele thereof.

IGKV1-17*01 Nucleotide Sequence (SEQ ID NO: 1227)


IGKV1-27*01 Nucleotide Sequence (SEQ ID NO: 1228)


IGKV1-39*01 Nucleotide Sequence (SEQ ID NO: 1229)


IGKV1D-39*01 Nucleotide Sequence (SEQ ID NO: 1230)


IGKV1-5*03 Nucleotide Sequence (SEQ ID NO: 1231)


IGKV2-30*02 Nucleotide Sequence (SEQ ID NO: 1232)


IGKV3-11*01 Nucleotide Sequence (SEQ ID NO: 1233)


IGKV3-15*01 Nucleotide Sequence (SEQ ID NO: 1234)


IGKV3-20*01 Nucleotide Sequence (SEQ ID NO: 1235)


IGKV4-1*01 Nucleotide Sequence (SEQ ID NO: 1236)


IGLV1-40*01 Nucleotide Sequence (SEQ ID NO: 1237)


IGLV1-44*01 Nucleotide Sequence (SEQ ID NO: 1238)


IGLV1-51*02 Nucleotide Sequence (SEQ ID NO: 1239)


IGLV2-11*01 Nucleotide Sequence (SEQ ID NO: 1240)


IGLV2-14*01 Nucleotide Sequence (SEQ ID NO: 1241)


IGLV2-8*01 Nucleotide Sequence (SEQ ID NO: 1242)