METHODS OF USING ACYL-COA SYNTHETASE FOR BIOSYNTHETIC PRODUCTION OF ACYL-COAS

A biosynthetic method of making carboxyl CoA from long-chain carboxylic acid including expressing an ACS in a cellular system, feeding a long chain carboxylic acid to the cellular system, growing the cellular system in a medium, and producing carboxyl CoA.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
CROSS-REFERENCE TO RELATED APPLICATIONS

This disclosure is a PCT Patent application entitled Methods of Using Acyl-CoA Synthetase for Biosynthetic Production of Acyl-CoAs. This application claims priority to U.S. Provisional Patent application No. 61/898,944 filed on Nov. 1, 2013, which is incorporated by reference herein in its entirety.

TECHNICAL FIELD

This disclosure has applicability in the food, medicinal, and pharmacological industries. This disclosure relates generally to a method for the biosynthetic production of acyl-CoAs utilizing acyl-CoA synthetase (ACS).

BACKGROUND OF THE DISCLOSURE Background Art

Capsaicin, 8-methyl-N-vanillyl-trans-6-nonenamide, is a secondary metabolite produced in hot peppers (Capsicum spp.) that is responsible for their pungent flavor. As noted in FIG. 1, Capsaicin is believed to be synthesized by capsaicin synthase (CS), an acyltransferase that transfers the 8-methylnonenoyl moiety from 8-methylnonenoyl-CoA to vanillylamine to form an amide conjugate, although the gene encoding CS has not been unambiguously identified at the time of the filing of the correlative provisional application. Again, as detailed in FIG. 1, the substrate for CS, 8-methylnonenoyl-CoA, is derived from 8-methyl-trans-6-nonenoic acid through the activity of an acyl-CoA synthetase (ACS).

ACS catalyzes the conversion of a carboxylic acid to its acyl-CoA thioester through an ATP-dependent two-step reaction. In the first step, the free fatty acid is converted into an acyl-AMP intermediate with the release of pyrophosphate. In the second step, the activated acyl group is coupled to the thiol group of CoA, releasing AMP and the acyl-CoA product (Groot et al., 1976). ACS and other related proteins are characterized by a highly conserved 12-amino acid sequence that forms the core of an AMP binding motif (PROSITE PS00455). About 44 putative ACS genes have been identified in the model plant Arabidopsis thaliana (Shockey et al., 2003). Currently, about half of them have known biochemical functions which include long-chain acyl-CoA synthetases, acyl-ACP synthetases, 4-coumaroyl-CoA ligases, acetyl-CoA synthetase, OPC-8:0 CoA Ligase, succinylbenzoyl-CoA ligase, malonyl-CoA synthetase, and oxalyl-CoA synthetase (Shockey et al., 2003; Koo et al., 2005; Koo et al., 2006; Kim et al., 2008; Lin and Oliver, 2008; Chen et al., 2011; Foster et al., 2012). In Capsicum annuun, three full-length putative ACS genes have been cloned (Lee et al., 2001; Mazourek et al., 2009). However, no biochemical activity has been ascribed to any of these proteins.

Applicants set out to identify the genes involved in capsaicin biosynthesis, particularly ACS. Since the hot pepper genome sequence was not available at the time when the study was initiated, applicants employed RNA Sequencing (RNA-Seq) technology for transcriptome analysis of the green fruits of the ghost chili pepper, an interspecies hybrid of C. chinense and C. frutescens. RNAseq experiment was performed by MOgene, L C (St Louis, Mo.). Applicants obtained about 18,987 contigs through the de novo assembly of the raw RNAseq data, 33 of which were annotated as acyl-CoA synthetase-like proteins. Among these contigs, Comp2147-1 showed a good match to CaSIG4 (FIG. 2), a pathogen-inducible cDNA encoding a putative acyl-CoA synthetase from Capsicum annuum (Lee et al., 2001). In addition, Comp66462 and Comp79520 mapped to pepper ACS1 (GenBank: EU616571) (FIG. 3), and Comp 167_c0, Comp167_c1 and Comp 46218 mapped to pepper ACS2 (GenBank: EU616572) (FIG. 4). Accordingly, ACS1 and ACS2 are two candidates for the acyl-CoA synthetase that exports fatty acids from the plastid (Mazourek et al., 2009).

Applicants demonstrate that ACS1 is a medium/long-chain acyl-CoA synthetase that converts 8-methyl-trans-6-nonenoic acid to the corresponding 8-methyl-6-nonenoyl-CoA, a key intermediate in the capsaicin biosynthetic pathway. Applicants disclose in the application herein methods of using ACS, particularly ACS1, for the biosynthetic production of acyl-CoAs.

BRIEF SUMMARY OF DISCLOSURE

The disclosure addresses the technical issue of producing acyl-CoAs in a cellular system, such as yeast or bacteria. Applicants have isolated the gene for ACS and uniquely expressed it in a cellular system that facilitates the production of acyl-CoAs. A particular acyl-CoA, 8-methyl-6-nonenoyl-CoA, is a necessary substrate for capsaicin synthase (CS), which would then produce capsaicin. Thus, this disclosure provides for the industrial production of 8-methyl-6-nonenoyl-CoA and helps to facilitate subsequent production of capsaicin.

The present disclosure is a biosynthetic method of making carboxyl CoAs from medium/long-chain carboxylic acid including expressing an ACS in a cellular system, feeding a long-chain carboxylic acid to the cellular system, growing the cellular system in a medium, and producing carboxyl CoAs.

Another embodiment is a biosynthetic method of making 8-methylnonenoyl-CoA comprising expressing an ACS in a cellular system, feeding 8-methyl-trans-6-nonenoic acid to the cellular system, growing the cellular system in a medium, and producing 8-methylnonenoyl-CoA.

BRIEF DESCRIPTIONS OF THE DRAWINGS

For a better understanding of the present disclosure, reference may be made to the accompanying drawings in which:

FIG. 1 shows the capsaicin biosynthetic pathway, which includes the reaction by ACS of making 8-methyl-6-nonenoyl-CoA from 8-methyl-6-nonenoic acid. Adapted from Stewart et al. (2007).

FIG. 2 shows sequence comparison between Comp2147-1 and CaSIG4 (GenBank: AF354454).

FIG. 3 shows sequence comparison between Comp66462, Comp79520 and ACS1 (GenBank: EU616571).

FIG. 4 shows sequence comparison between Comp167_c0, Comp167_c1, Comp46218 and ACS2 (GenBank: EU616572).

FIG. 5 shows sequence comparison between ghost pepper ACS1 and ACS1 (GenBank: ACF17663).

FIG. 6 shows sequence alignment of ghost pepper ACS1, Arabidopsis LACS4 (GenBank: AEE84812) and LACS5 (GenBank: AAM28872).

FIG. 7 shows SDS-PAGE analysis of His-SUMO-ACS1 expression in BL21 (DE3) cells. 0, 20: total protein at the time after IPTG induction; C, soluble crude protein extract; E1 to E4, fractions from Ni-NTA column. The molecular weight of ACS1 is ca. 73.5 Kd and that of His-SUMO tag is ca. 12 Kd.

FIG. 8 shows activities of ACS1 against various carboxylic acids. C2, acetic acid; C4, butyric acid; C6, hexanoic acid, C8,caprylic acid; C10, capric acid; C12, lauric acid; C14, myristic acid; C16, palmitic acid; C18, stearic acid. The assay was performed in 100 mM Tri buffer, pH8.0.

FIG. 9 shows HPLC profiles of enzymatic products of ACS1 with 8-methyl -trans-6-nonenoic acid or 8-methyl nonanoic acid as a substrate, respectively.

FIG. 10 shows MS/MS analysis of purified 8-methyl-trans-6-noneoyl-CoA in negative mode.

FIG. 11 shows MS/MS analysis of purified 8-methylnonaoyl-CoA in negative mode.

FIG. 12 shows effect pH on the activity of ACS1 against 8-methylnonanoic acid. Four different buffer systems were used for different pH ranges.

While the disclosure is susceptible to various modifications and alternative forms, specific embodiments thereof are shown by way of example in the drawing and will herein be described in detail. It should be understood, however, that the drawings and detailed description presented herein are not intended to limit the disclosure to the particular embodiment disclosed, but on the contrary, the intention is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the present disclosure as defined by the appended claims.

DETAILED DESCRIPTIONS OF THE DISCLOSURE Definitions Cellular System

Cellular system is any cells that provide for the expression of ectopic proteins. It included bacteria, yeast, plant cells and animal cells. It includes both prokaryotic and eukaryotic cells. It also includes the in vitro expression of proteins based on cellular components, such as ribosomes.

Growing the Cellular System

Growing includes providing medium that would allow cells to multiply and divide. It also includes providing resources so that cells or cellular components can translate and make recombinant proteins.

Protein Expression

Protein production can occur after gene expression. It consists of the stages after DNA has been transcribed to messenger RNA (mRNA). The mRNA is then translated into polypeptide chains, which are ultimately folded into proteins. DNA is present in the cells through transfection—a process of deliberately introducing nucleic acids into cells. The term is often used for non-viral methods in eukaryotic cells. It may also refer to other methods and cell types, although other terms are preferred: “transformation” is more often used to describe non-viral DNA transfer in bacteria, non-animal eukaryotic cells, including plant cells. In animal cells, transfection is the preferred term as transformation is also used to refer to progression to a cancerous state (carcinogenesis) in these cells. Transduction is often used to describe virus-mediated DNA transfer. Transformation, transduction, and viral infection are included under the definition of transfection for this application.

An embodiment of the present disclosure is a biosynthetic method of making carboxyl CoAs from medium to long-chain carboxylic acids comprising expressing an ACS in a cellular system, feeding medium to long-chain carboxylic acids to the cellular system, growing the cellular system in a medium, and producing carboxyl CoAs.

A further embodiment is that the ACS is expressed from ACS1 cloned from ghost chili pepper. An alternative embodiment is that the ACS is expressed from Arabidopsis based on LCAS4 or LCAS5. In another embodiment, the ACS is expressed from ACS2 cloned from Capsicum spp. Further, the ACS is an ACS that shares a sequence identity of at least 66% with the ACS1 cloned from ghost chili pepper. In another variation, the ACS is an ACS that shares a sequence similarity of at least 97% with the ACS1 cloned from ghost chili pepper.

A further embodiment is that the medium or long-chain carboxylic acid is 8-methyl-trans-6-nonenoic acid. Long chain carboxylic acids generally have 14 to 18 carbons, while medium-chain carboxylic acids generally have 8 to 13 carbons. In one embodiment, the feeding of medium to long-chain carboxylic acid to the cellular system comprises adding the medium to long-chain carboxylic acid to the cellular system. In an alternative embodiment, the feeding of medium to long-chain carboxylic acid to the cellular system comprises expressing the medium to long-chain carboxylic acid from a biosynthetic pathway in the cellular system.

As for the cellular system in the embodiment, it is selected from the group consisting of bacteria, yeast, and a combination thereof, or any cellular system that would allow the biosynthetic production is provided.

An embodiment of the present disclosure is a biosynthetic method of making 8-methylnonenoyl-CoA comprising expressing an ACS in a cellular system, feeding 8-methyl -trans-6-nonenoic acid to the cellular system, growing the cellular system in a medium, and producing 8-methylnonenoyl-CoA. The ACS is expressed from ACS1 cloned from ghost chili pepper. The ACS can be expressed from LCAS4 or LCAS5 cloned from Arabidopsis. In another embodiment, the ACS is expressed from ACS2 cloned from Capsicum spp. Further, the ACS is an ACS that shares a sequence Identity of at least 66% with the ACS1 cloned from ghost chili pepper. In another variation, the ACS is an ACS that shares a sequence similarity of at least 97% with the ACS1 cloned from ghost chili pepper.

Example 1 Producing Acyl-CoAs Cloning

Applicants amplified ACS1 gene from the cDNA of the green fruits of the ghost chili pepper using the primers of ACS1-sumo-F: CGC GAA CAG ATT GGA GGT GCAACAGATAAATTTATTATTG and ACS1-sumo-R: GTG GCG GCC GCT CTA TTA TCACTTGGTACCCTTGTACAT. The resulting PCR product was purified on 1% agarose gel and mixed with linear pETite N-His SUMO Kan expression vector (Lucigen, Middleton, Wis.). The DNA mixture was used to transform HI-control 10G chemically competent cells by heat shock (Lucigen). The gene insertion was fully sequenced and the encoded amino acid sequence was aligned with that of ACS1 (FIG. 5). As shown in FIG. 5, these two sequences are almost identical except Ile476 in Capsicum annuum ACS1 is replaced by Val in ghost pepper ACS1. The sequence of ghost pepper ACS1 was used to blast Arabidopsis database (http://www.arabidopsis.org/) and identified LCAS4 and LACS5 as its homologues (FIG. 6). As shown in FIG. 6, these three sequences share a sequence identity of 66.7% and a sequence similarity of 97.1%. Both LACS4 and LACS5 have been biochemically characterized as long chain acyl-CoA synthetases that participate in fatty acid and glycerolipid metabolism (Shockey et al., 2002). Recently, LACS4 is demonstrated to be required for the formation of pollen coat lipids in Arabidopsis (Jessen et al., 2011).

Expression

Applicants used pETite N-His SUMO-ghost pepper ACS1 to transform HI -Control BL21(DE3) cells (Lucigen) and the expression of His-SUMO-ACS1 was induced by 0.5 mM IPTG at 16° C. for 20 hrs. The fusion protein was purified by Ni-NTA column (FIG. 7). ACS1 has a molecular weight of ca. 73.5 Kd and the size of His-SUMO tag is ca. 12 Kd. The His-SUMO-ghost pepper ACS1 fusion protein on SDS-PAGE migrated close to the predicted size (ca. 85 Kd) (FIG. 7).

Products

Applicants used an HPLC-based method to measure the activity of ghost pepper ACS1 (Chen et al., 2011). Briefly, reaction mixtures (400 μL) contained 0.1 M Tris-HCl, pH 7.5, 2 mM DTT, 5 mM ATP, 10 mM MgCl2, 0.5 mM CoA, 0.1% Triton and 200 μM carboxylic acids. The reaction was initiated by adding 20 μL of purified enzyme and stopped after 30 min by addition of 20 μl acetic acid. HPLC was performed with Dionex—UltiMate® 3000 LC Systems (Thermo Scientific) using an Acclaim® 120 C18 reversed-phase column (Thermo Scientific; 3 μ, 120 Å, 150×3 mm). The mobile phase consisted of solvent A (0.1% trifluoroacetic acid) and solvent B (acetonitrile). The gradient elution procedure was as follows: 0 to 5 min, 5% of B; 5 to 9 min, a linear gradient from 5 to 80% of B; 9 to 11 min, 80% of B; 11 to 12 min, 5% of B. The flow rate was 0.6 ml/min. The diode array detector collected data in the 200- to 400-nm range. For detection and quantification of substrate and products, peak areas were measured at 257 nm.

As shown in FIG. 8, ACS1 had activities in various medium against long chain carboxylic acids with the highest activity against capric acid (C10). In contrast, ACS1 did not show any activity against acetic acid (C2) or butyric acid (C4)—short chain carboxylic acid.

Applicants then used 8-methyl-trans-6-nonenoic acid (6E), the endogenous intermediate in capsaicin biosynthetic pathway or its reduced product, 8-methylnonanoic acid (8M), as a substrate to assay ACS1 activity. As shown in FIG. 9, ACS1 showed activities with both substrates with a higher activity for 6E. Applicants collected the corresponding HPLC fractions for the product peaks and dried them over a SpeedVac Concentrator for further MS/MS identification.

Confirmation of Product

Each dried sample was resuspended in 40 μL of 1:1:2 Methanol:Water:Acetonitrile buffer. 10 μL was used for direct infusion using the TriVersa Nanomate® (Advion, Ithaca, N.Y.). The mass spectrometer, LTQ-Orbitrap Velos (Thermo Fisher Scientific, Waltham, Mass.), was operated in negative ionization mode. The MS survey scan was performed in the FT cell from a mass range of 300 to 2,000 m/z. The resolution was set to 60,000 @ 400 m/z. CID fragmentation was used for MS/MS, and detection was done in the ion trap with an isolation window of 1.5 m/z Fragmentation was performed with normalized collision energies of 35%. As shown in FIGS. 10-11, the MS data match the molecular weight of 8-methyl-trans-6-nonenoyl-CoA and 8-methyl nonanoyl-CoA, respectively.

The pH optimal of ACS1 against 8-methylnonanoic acid was also studied. Acetate, phosphate, Tris and glycine/NaOH buffers were used to provide a pH range from 4.0 to 10.5. As shown in FIG. 12, the optical pH of ACS1 is ca. 9.5.

Accordingly, applicants have identified a novel medium/long chain acyl-CoA synthetase in ghost hot pepper which provides the substrate for capsaicin synthase. In addition, the novel enzyme may also have applications in biofuel industry for making medium-chain fatty acid derivatives.

Additional embodiments include the use of ACS1 to modify the levels of capsaicinoids in pepper plants by overexpressing ACS1 utilizing standard known techniques for overexpression of genes. Another embodiment includes the use of ACS1 to modulate the levels of capsaicinoids in pepper plants by knocking out or knocking down ACS1 utilizing standard known techniques for knocking out or knocking down expression of genes. Again, the overexpression or the knock out/knock down is by standard molecular cellular strategies and techniques known by a person of ordinary skill in the art. Another embodiment includes the use of ACS1 to generate acyl-CoAs and their downstream metabolites including fatty acids involving the expression or overexpression of ACS1. Another variation is the use of ACS1 to modulate the levels of acyl-CoAs and their downstream metabolites including fatty acids comprising knocking out or knocking down ACS1.

The acyl CoAs that are made by the methods could be utilized to make capsaicin, and they would generally be of the medium chain variety. Again, although ACS1 can mediate the conversion of both medium chain- and long chain-carboxylic acids to acyl-CoAs, the medium chain activity is far more important than long chain activity as medium chain activity is the essential component in today's biofuel industry. The other importance as mentioned above for ACS1 is that it can be used to modify the capsaicin levels in plants through transgenic technology. However, ACS1 is not precluded from usage in regards to long chain acyl-CoAs.

In an embodiment, a cellular system, such as a bacterial based system or a yeast based system can be modified to express ACS. The ACS could be ACS1 cloned from ghost pepper. Other ACSs suitable are one based on LCAS4 and LCAS5 from Arabidopsis. Other known ACS1 and ACS2 could also be expressed in the cellular systems. Appropriate substrate, such as 8-methyl-trans-6-nonenoic acid and 8-methylnonanoic acid, can then be fed to the cellular system. The substrates could also be expressed as part of a biosynthetic pathway within the cellular system. The cellular system is then incubated allowing for the biosynthetic production of 8-methyl-trans-6-nonenoyl-CoA or 8-methyl nonanoyl-CoA.

Identity and Similarity

Identity is the fraction of amino acids that are the same between a pair of sequences after an alignment of the sequences (which can be done using only sequence information or structural information or some other information, but usually it is based on sequence information alone), and similarity is the score assigned based on an alignment using some similarity matrix. The similarity index can be any one of the following BLOSUM62, PAM250, or GONNET, or any matrix used by one skilled in the art for the sequence alignment of proteins.

Identity is the degree of correspondence between two sub-sequences (no gaps between the sequences). An identity of 25% or higher implies similarity of function, while 18-25% implies similarity of structure or function. Keep in mind that two completely unrelated or random sequences (that are greater than 100 residues) can have higher than 20% identity. Similarity is the degree of resemblance between two sequences when they are compared. This is dependent on their identity.

As is evident from the foregoing description, certain aspects of the present disclosure are not limited by the particular details of the examples illustrated herein, and it is therefore contemplated that other modifications and applications, or equivalents thereof, will occur to those skilled in the art. It is accordingly intended that the claims shall cover all such modifications and applications that do not depart from the spirit and scope of the present disclosure.

Moreover, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure belongs. Although any methods and materials similar to or equivalent to or those described herein can be used in the practice or testing of the present disclosure, the preferred methods and materials are described above.

Other aspects, objects and advantages of the present disclosure can be obtained from a study of the drawings, the disclosure and the appended claims.

REFERENCES

  • Chen H, Kim H U, Weng H, Browse J. (2011) Malonyl-CoA synthetase, encoded by ACYL ACTIVATING ENZYME13, is essential for growth and development of Arabidopsis. Plant Cell 23: 2247-2262.
  • Foster J, Kim H U, Nakata P A, Browse J. (2012) A previously unknown oxalyl-CoA synthetase is important for oxalate catabolism in Arabidopsis. Plant Cell 24: 1217-1229.
  • Groot P H, Scholte H R, Hülsmann W C. (1976) Fatty acid activation: Specificity, localization, and function. Adv. Lipid Res. 14: 75-126.
  • Jessen D, Olbrich A, Knüfer J, Krüger A, Hoppert M, Polle A, Fulda M. (2011) Combined activity of LACS1 and LACS4 is required for proper pollen coat formation in Arabidopsis. Plant J. 68: 715-726.
  • Kim H U, van Oostende C, Basset G J, Browse J. (2008) The AAE14 gene encodes the Arabidopsis o-succinylbenzoyl-CoA ligase that is essential for phylloquinone synthesis and photosystem-I function. Plant J. 54: 272-283.
  • Kim S, Park M, Yeom S I, Kim Y M, Lee J M, Lee H A, Seo E, Choi J, Cheong K, Kim K T, Jung K, Lee G W, Oh S K, Bae C, Kim S B, Lee H Y, Kim S Y, Kim M S, Kang B C, Jo Y D, Yang H B, Jeong H J, Kang W H, Kwon J K, Shin C, Lim J Y, Park J H, Huh J H, Kim J S, Kim B D, Cohen O, Paran I, Suh M C, Lee S B, Kim Y K, Shin Y, Noh S J, Park J, Seo Y S, Kwon S Y, Kim H A, Park J M, Kim H J, Choi S B, Bosland P W, Reeves G, Jo S H, Lee B W, Cho H T, Choi H S, Lee M S, Yu Y, Do Choi Y, Park B S, van Deynze A, Ashrafi H, Hill T, Kim W T, Pai H S, Ahn H K, Yeam I, Giovannoni J J, Rose J K, Sorensen I, Lee S J, Kim R W, Choi I Y, Choi B S, Lim J S, Lee Y H, Choi D. (2014) Genome sequence of the hot pepper provides insights into the evolution of pungency in Capsicum species. Nature Genetics 46(3):270-278. doi: 10.1038/ng.2877. Epub 2014 Jan 19. Koo A J, Fulda M, Browse J, Ohlrogge J B. (2005) Identification of a plastid acyl-acyl carrier protein synthetase in Arabidopsis and its role in the activation and elongation of exogenous fatty acids. Plant J. 44: 620-632.
  • Koo A J, Chung H S, Kobayashi Y, Howe G A. (2006) Identification of a peroxisomal acyl-activating enzyme involved in the biosynthesis of jasmonic acid in Arabidopsis. J Biol Chem. 281: 33511-33520.
  • Lee S J, Suh M C, Kim S, Kwon J K, Kim M, Paek K H, Choi D, Kim B D. (2001) Molecular cloning of a novel pathogen-inducible cDNA encoding a putative acyl-CoA synthetase from Capsicum annuum L. Plant Mol Biol. 46: 661-671.
  • Lin M, Oliver D J. (2008) The role of acetyl-coenzyme a synthetase in Arabidopsis. Plant Physiol. 147: 1822-1829.
  • Mazourek M, Pujar A, Borovsky Y, Paran I, Mueller L, Jahn M M. (2009) A dynamic interface for capsaicinoid systems biology. Plant Physiol. 150: 1806-1821.
  • Qin C, Yu C, Shen Y, Fang X, Chen L, Min J, Cheng J, Zhao S, Xu M, Luo Y, Yang Y, Wu Z, Mao L, Wu H, Ling-Hu C, Zhou H, Lin H, Gonzalez-Morales S, Trejo-Saavedra D L, Tian H, Tang X, Zhao M, Huang Z, Zhou A, Yao X, Cui J, Li W, Chen Z, Feng Y, Niu Y, Bi S, Yang X, Li W, Cai H, Luo X, Montes-Hernandez S, Leyva-González M A, Xiong Z, He X, Bai L, Tan S, Tang X, Liu D, Liu J, Zhang S, Chen M, Zhang L, Zhang L, Zhang Y, Liao W, Zhang Y, Wang M, Lv X, Wen B, Liu H, Luan H, Zhang Y, Yang S, Wang X, Xu J, Li X, Li S, Wang J, Palloix A, Bosland P W, Li Y, Krogh A, Rivera-Bustamante R F, Herrera-Estrella L, Yin Y, Yu J, Hu K, Zhang Z. (2014)Whole-genome sequencing of cultivated and wild peppers provides insights into Capsicum domestication and specialization. Proc Natl Acad Sci USA. 111(14):5135-5140. doi: 10.1073/pnas.1400975111. Epub 2014 Mar. 3.
  • Shockey J M, Fulda M S, Browse J A. (2002) Arabidopsis contains nine long-chain acyl-coenzyme a synthetase genes that participate in fatty acid and glycerolipid metabolism. Plant Physiol. 129: 1710-1722.
  • Shockey J M, Fulda M S, Browse J. (2003) Arabidopsis contains a large superfamily of acyl-activating enzymes. Phylogenetic and biochemical analysis reveals a new class of acyl-coenzyme a synthetases. Plant Physiol. 132: 1065-1076.
  • Stewart C Jr, Mazourek M, Stellari G M, O'Connell M, Jahn M. (2007) Genetic control of pungency in C. chinense via the Pun1 locus. J Exp Bot. 58: 979-991.

Claims

1. A biosynthetic method of making carboxyl CoA from medium-chain carboxylic or long-chain carboxylic acid comprising:

expressing an ACS in a cellular system;
feeding a medium-chain carboxylic acid or a long-chain carboxylic acid or both to the cellular system;
growing the cellular system in a medium; and
producing carboxyl CoA.

2. The biosynthetic method of making carboxyl CoA from medium-chain carboxylic or long-chain carboxylic acid of claim 1, wherein the ACS is expressed from ACS1 cloned from ghost chili pepper, or CaSIG4 cloned from Capsicum annuum, or ACS1 cloned Capsicum annuum, or combination thereof.

3. The biosynthetic method of making carboxyl CoA from medium-chain carboxylic to long-chain carboxylic acid of claim 1, wherein the ACS is expressed from a gene cloned from Arabidopsis based on LCAS4 or LCAS5.

4. The biosynthetic method of making carboxyl CoA from medium-chain carboxylic or long-chain carboxylic acid of claim 1, wherein the ACS is expressed from ACS2 cloned from pepper plant.

5. The biosynthetic method of making carboxyl CoA from medium-chain carboxylic to long-chain carboxylic acid of claim 1, wherein the ACS is an ACS that shares a sequence identity of at least 66% with the ACS1 cloned from ghost chili pepper.

6. The biosynthetic method of making carboxyl CoA from medium-chain carboxylic or long-chain carboxylic acid of claim 1, wherein the ACS is an ACS that shares a sequence similarity of at least 97% with the ACS1 cloned from ghost chili pepper.

7. The biosynthetic method of making carboxyl CoA from medium-chain carboxylic or long-chain carboxylic acid of claim 1, wherein the long-chain carboxylic acid is 8-methyl-trans-6-nonenoic acid.

8. The biosynthetic method of making carboxyl CoA from medium-chain carboxylic or long-chain carboxylic acid of claim 1, wherein the feeding a medium-chain carboxylic acid or a long-chain carboxylic acid or both to the cellular system comprises adding medium-chain carboxylic acid or a long-chain carboxylic acid or both to the cellular system.

9. The biosynthetic method of making carboxyl CoA from medium-chain carboxylic or long-chain carboxylic acid of claim 1, wherein the feeding a medium-chain carboxylic acid or a long-chain carboxylic acid or both to the cellular system comprises expressing the medium-chain carboxylic acid or long-chain carboxylic acid or both in the cellular systems based on a biosynthetic pathway in the cellular system.

10. The biosynthetic method of making carboxyl CoA from medium-chain carboxylic to long-chain carboxylic acid of claim 1, wherein the cellular system is selected from the group consisting of bacteria, yeast, plant cells, animal cells, an in vitro translation system, and a combination thereof.

11. A biosynthetic method of making 8-methylnonenoyl-CoA comprising:

expressing an ACS in a cellular system;
feeding 8-methyl-trans-6-nonenoic acid to the cellular system;
growing the cellular system in a medium; and
producing 8-methylnonenoyl-CoA.

12. The biosynthetic method of making 8-methylnonenoyl-CoA of claim 11, wherein the ACS is expressed from ACS1 cloned from ghost chili pepper, or CaSIG4 cloned from Capsicum annuum, or ACS1 cloned Capsicum annuum, or combination thereof.

13. The biosynthetic method of making 8-methylnonenoyl-CoA of claim 11, wherein the ACS is expressed from a gene based on LCAS4 or LCAS5 cloned from Arabidopsis.

14. The biosynthetic method of making 8-methylnonenoyl-CoA of claim 11, wherein the ACS is expressed from ACS2 cloned from pepper plant.

15. The biosynthetic method of making 8-methylnonenoyl-CoA of claim 11, wherein the ACS is an ACS that shares a sequence identity of at least 66% with the ACS1 cloned from ghost chili pepper.

16. The biosynthetic method of making 8-methylnonenoyl-CoA of claim 11, wherein the ACS is an ACS that shares a sequence similarity of at least 97% with the ACS1 cloned from ghost chili pepper.

17. The biosynthetic method of making 8-methylnonenoyl-CoA of claim 11, wherein the feeding 8-methyl-trans-6-nonenoic acid to the cellular system comprises adding the 8-methyl-trans-6-nonenoic acid to the cellular system.

18. The biosynthetic method of making 8-methylnonenoyl-CoA of claim 11, wherein the feeding 8-methyl-trans-6-nonenoic acid to the cellular system comprises expressing the 8-methyl-trans-6-nonenoic acid in the cellular system based on a biosynthetic pathway in the cellular system.

19. The biosynthetic method of making 8-methylnonenoyl-CoA of claim 11, wherein the cellular system is selected from the group consisting of bacteria, yeast, plant cells, animal cells, an in vitro translation system and a combination thereof.

20. The use of ACS1 to modulate the levels of capsaicinoids in pepper plants comprising overexpressing ACS1; or knocking out or knocking down ACS1.

21. The use of ACS1 to modulate levels of acyl-CoAs and their downstream metabolites including fatty acids comprising overexpressing ACS1 in a cellular system; or knocking out or knocking down ACS1 in a cellular system.

Patent History
Publication number: 20170247733
Type: Application
Filed: Nov 3, 2014
Publication Date: Aug 31, 2017
Patent Grant number: 10392643
Applicant: Conagen Inc. (Bedford, MA)
Inventors: Xiaodan Yu (Lexington, MA), Hui Chen (Bedford, MA), Hongxue Wang (Wuxi, Jiangsu), Xiaodan Yu (Lexington, MA)
Application Number: 15/033,711
Classifications
International Classification: C12P 19/32 (20060101);