BIOSYNTHETIC PATHWAYS AND METHODS

This disclosure describes a recombinant microbial cells and methods of making and using such recombinant microbial cells. Generally, the recombinant cells may be modified to exhibit increased biosynthesis of a TCA derivative compared to a wild-type control. In some embodiments, the TCA derivative can include 1,4-butanediol. In various embodiments, the microbial cell is a fungal cell or a bacterial cell. In some embodiments, the increased biosynthesis of the TCA derivative can include an increase in xylose dehydrogenase activity, xylonolactonase activity, xylonate dehydratase activity, or 2-keto-3-deoxyaldonic acid dehydratase activity.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
CROSS-REFERENCE TO RELATED APPLICATION

This application claims priority to U.S. Provisional Patent Application Ser. No. 61/738,752, filed Dec. 18, 2012 and U.S. Provisional Patent Application Ser. No. 61/821,490, filed May 9, 2013, each of which is incorporated herein by reference.

SUMMARY

This disclosure describes, in one aspect, a recombinant microbial cell modified to exhibit increased biosynthesis of a TCA derivative compared to a wild-type control. In some embodiments, the TCA derivative can include 1,4-butanediol. In various embodiments, the microbial cell is a fungal cell or a bacterial cell. In some embodiments, the increased biosynthesis of the TCA derivative can include an increase in xylose dehydrogenase activity, xylonolactonase activity, xylonate dehydratase activity, or 2-keto-3-deoxyaldonic acid dehydratase activity.

In another aspect, this disclosure describes a method that generally includes incubating any embodiments of the recombinant cell summarized above in medium that includes a carbon source under conditions effective for the recombinant cell to produce a TCA derivative. In some embodiments, the TCA derivative can include 1,4-butanediol. In some embodiments, the carbon source can include xylose, arabinose, glucaric acid, galactaric acid, or hydroxyproline. In some embodiments, the increased biosynthesis of the TCA derivative can include an increase in pentose dehydrogenase activity, pentonolactonase activity, aldonic acid dehydratase activity, or 2-keto-3-deoxyaldonic acid dehydratase activity. In other embodiments, the increased biosynthesis of the TCA derivative can include an increase in hexic acid dehydratase activity or 5-dehydro-4-deoxyglucarate dehydratase activity.

In another aspect, this disclosure describes a method that generally includes introducing into a host cell a heterologous polynucleotide encoding at least one polypeptide that catalyzes conversion of a carbon source to a TCA derivative, wherein the at least one polypeptide is operably linked to a promoter so that the modified host cell catalyzes conversion of the carbon source to TCA derivative. In some embodiments, the TCA derivative can include 1,4-butanediol. In some embodiments, the carbon source can include xylose.

The above summary of the present invention is not intended to describe each disclosed embodiment or every implementation of the present invention. The description that follows more particularly exemplifies illustrative embodiments. In several places throughout the application, guidance is provided through lists of examples, which examples can be used in various combinations. In each instance, the recited list serves only as a representative group and should not be interpreted as an exclusive list.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1. The 1,4-butanediol synthetic pathway in E. coli. (A) The synthetic pathway for 1,4-butanediol from glucose and xylose. Abbreviations: G-6P, glucose-6-phosphate; F-6P, fructose-6-phosphate; DHAP, dihydroxyacetone phosphate; GAP, glyceraldehyde-3-phosphate. (B) Synthetic operon for protein overexpression to drive the xylose towards 2,5-dioxopentanoic acid (left), and then drive 2,5-dioxopentanoic acid towards to 1,4-butanediol (right).

FIG. 2. A, scheme of the organization of conserved genetic clusters involved in the pentose, hexaric acid, and hydroxyproline degradation. Analogous functions are indicated in the same degree of shading. Coding region sizes and distances are not to scale. Protein family numbers are displayed below each coding region according to Clusters of Orthologous Groups of proteins classification system. The coding regions indicated in white or gray encode the following proteins: araA, transcriptional regulator; araF-araH, 1-Ara ABC transporter (periplasmic 1-Ara binding protein, ATP-binding protein, permease); rrnAC3038, heat shock protein X; ycbE, glucarate/galactarate permease; ycbG, transcriptional regulator; PP1249, hydroxyproline permease. B, schematic representation of the convergence of catabolic pathways for pentoses, hexaric acids, and hydroxyproline at the level of 2,5-dioxopentanoate. Enzymatic activities are indicated by their EC number. Dashed lines indicate proposed spontaneous reactions.

FIG. 3. An engineered 1,4-butanediol synthetic pathway in E. coli.

FIG. 4. An exemplary engineered metabolic pathway from 2,5-dioxopentanoic acid to 1,4-butanediol.

FIG. 5. An exemplary engineered metabolic pathway from 2,5-dioxopentanoic acid to 1,4-butanediol.

FIG. 6. An exemplary engineered metabolic pathway from D-arabonose to 2,5-dioxopentanoic acid.

FIG. 7. An exemplary engineered metabolic pathway from D-xylose to 2,5-dioxopentanoic acid.

FIG. 8. An exemplary engineered metabolic pathway from L-arabinose to 2,5-dioxopentanoic acid.

FIG. 9. An exemplary engineered metabolic pathway from D-glucaric acid to 2,5-dioxopentanoic acid.

FIG. 10. An exemplary engineered metabolic pathway from D-galactaric acid to 2,5-dioxopentanoic acid.

FIG. 11. An exemplary engineered metabolic pathway from 4(R)-hydroxy-L-proline to 2,5-dioxopentanoic acid.

FIG. 12. A plasmid map of YEplac195-xylBCDX (13945 bp).

FIG. 13. A plasmid map of YEplac11-KivDyqhD (9687 bp).

FIG. 14. Gas chromatography data showing production of 1,4-butanediol by genetically engineered S. cerevisiae.

DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

This disclosure describes a novel full biosynthetic pathway to biosynthesize high-volume TCA derivatives such as succinate, amino acids, and 1,4-butanediol from xylose by an engineered microbe. The TCA cycle can lead to many commercially important biobased chemicals such as, for example, amino acids (e.g., glutamate, threonine and lysine) and organic acids (e.g., succinate, maleate and fumarate). Here we report the engineering of a shortcut metabolic pathway to TCA cycle. The process from xylose to TCA only involves five steps as compared to conventional published pathways that include more than 20 steps. Because our pathway includes fewer steps from xylose to the TCA cycle, our pathway can produce TCA derivatives with the production of less by-product and, therefore, achieve higher yields than conventional biosynthetic pathways.

We have selected the TCA derivative 1,4-butanediol as a model product to demonstrate the generality of our novel biosynthetic pathway. 1,4-butanediol is a major commodity chemical; 2.5 million tons of 1,4-butanediol are used per year to make, for example, plastics, polyesters, and spandex fibers. 1,4-butanediol also can react, for example, with dicarboxylic acids to yield polyesters, with diisocyanates to yield polyurethanes, and with phosgene to yield chloroformates. Because our pathway permits the biosynthesis of 1,4-butanediol from, for example, xylose in only six steps from xylose to 1,4-butanediol, 1,4-butanediol may be biosynthesized with less by-product being formed and, therefore, a higher yield. For example, our pathway can produce produce 1.0 g/L 1,4-butanediol from 20 g/L xylose.

1,4-butanediol currently is manufactured from petroleum-based feedstocks such as acetylene, butane, propylene, and butadiene. Given the industrial importance of 1,4-butanediol as a chemical intermediate and the issues associated with petroleum feedstocks, alternative low-cost renewable biosynthetic routes from sugars have been sought. However, the highly reduced nature of 1,4-butanediol relative to carbohydrates has thwarted attempts thus far to develop effective pathways and organisms for direct production.

1,4-butanediol has been reported to be synthesized from glucose and xylose by engineered E. coli in which the succinyl-CoA intermediate was converted into succinate semialdehyde, 4-hydroxybutyrate, 4-hydroxybutyryl-CoA, 4-hydroxybutyraldehyde, and 1,4-butanediol by multiple enzymes from various organisms. This process involves around 20 chemical steps that include the pentose phosphate pathway, glycolysis, the TCA cycle, and designed artificial downstream metabolic steps. In contrast, this disclosure describes a shortcut pathway that requires only six steps (FIG. 1A).

D-xylose is converted by Caulobacter crescentus sequentially to D-xylonolactone, D-xylonate (D-xylonoic acid), 2-keto-3-deoxy-xylonate (2-oxo-4(S),5-dihydroxy-pentanoic acid), then α-ketoglutaric semialdehyde (2,5-dioxopentanoic acid) by, respectively, xylose dehydrogenase (xylB), xylonolactonase (xylC), xylonate dehydrogenase (xylD), Kda dehydratase (xylX). We cloned the coding regions of these enzymes into a single plasmid (pBDO-1), which was then transformed into an E. coli host cell. The host cell was then further modified to include a second plasmid that included a decarboxylase and an alcohol dehydrogenase. The decarboxylase converts the α-ketoglutaric semialdehyde to succinaldehyde; the alcohol dehydrogenase reduces the succinaldehyde to 1,4-butanediol (FIG. 1A). In some embodiments, the second plasmid was identified as pBDO-3 and included the coding regions of benzoylformate decarboxylase BFD (Pseudomonas putida) and an alcohol dehydrogenase of yqhD (E. coli). In other embodiments, the second plasmid was identified as pBDO-4 and included the decarboxylase of KIVD (Lactococcus lactis) and alcohol dehydrogenase of yqhD (E. coli).

The E. coli host cell possesses an endogenous xylose metabolism pathway that includes xylA, yjhH and yagE. To improve the product yield from xylose to 1,4-butanediol, expression of these three coding regions were inhibited. The host cell strain SBDO-1 is based on E. coli BW25113 in which xylA, yjhH, and yagE are knocked out so that SBDO-1 cannot metabolize xylose. Strain SBDO-2, carrying plasmid pBDO-1, also cannot metabolize xylose.

The strain SBDO-3, which is based on SBDO-2 but carries plasmid pBDO-2 that expresses α-ketoglutaric semialdehyde dehydrogenase xylA, can consume xylose quickly. These results indicate that the endogenous xylose utilization pathway in E. coli was blocked fully by the ΔxylA, ΔyjhH, and ΔyagE deletions in SBDO-1. Moreover, these results demonstrate that the C. crescentus enzymes function in E. coli. Consequently, xylose metabolism observed in SBDO-4 and SBDO-5 is attributable to the xylose pathway from C. crescentus that we engineered into the host cell. To produce 1,4-butanediol, plasmids pBDO-3 or pBDO-4, each of which expresses the same alcohol dehydrogenase but a different decarboxylase, were introduced into strain SBDO-2 strain. After two days of fermentation, strain SBDO-4 (carrying pBDO-3) produced 0.25 g/L 1,4-butanediol with 0.1 g/L 1,2,4-butanetriol (a by-product); strain SBDO-5 (carrying pBDP-4) produced 1.0 g/L 1,4-butanediol with 4.0 g/L 1,2,4-butanetriol. Thus, the kivD encoded on pBDO-4 and carried by strain SBDO-5 provides better yield of 1,4-butanediol than BFD. Other than 1,2,4-butanetriol, no other byproducts were detected in significant amounts in the fermentation broth, suggesting that our new 1,4-butanediol producing pathway has higher 1,4-butanediol yield as compared with the published pathway (Yim et al., 2011. Nat. Chem. Biol. 7:445-452).

Thus, in one aspect, the invention provides recombinant microbial cell modified to exhibit increased biosynthesis of a TCA derivative compared to a wild-type control.

While described above in the context of an exemplary embodiment in which the TCA derivative is a 1,4-butanediol, the recombinant cells and methods described herein can provide TCA derivatives other than 1,4-butanediol. Exemplary alternative TCA derivatives include, for example, succinate, fumarate, malate, glutamate, lysine, threonine, 4-hydroxybutyrate, and products synthesizable from a product of the TCA cycle in one, two, three, four, or five enzymatic steps. In some of these embodiments, one or more enzymes involved in the synthesis of the TCA derivative may be heterologous to the host cell and, therefore, provided recombinantly. Exemplary TCA derivative products and exemplary enzymes involved in the synthesis of the exemplary TCA derivative products are listed in Table 1. For any embodiment in which the identified enzyme is not endogenous to a host cell, the enzyme may be introduced into the host cell to produce a recombinant cell as described herein.

TABLE 1 Exemplary enzymes, enzyme sources, native substrates, and TCA derivative products SEQ Encoding Accession No.: Native TCA derivative ID Common Name Organism gene GI No. Substrate product NO D-arabinose dehydrogenase alcohol Sulfolobus SSO1300 NP_342747.1; D-arabinose D-arabinonic 1 dehydrogenase solfataricus GI: 15898142 acid from D- (AraDH) arabinose D-arabinonate dehydratase arabinonate Sulfolobus SSO3124 NP_344435.1; D-arabinonic 2-oxo-4(S),5- 6 dehydratase (AraD) solfataricus GI: 15899830 acid dihydroxy- pentanoic acid 2-Keto-3-deoxy-D-arabinonate Dehydratase 2-keto-4- Sulfolobus SSO3118 NP_344431.1; 2-oxo-4(S),5- 2,5- 11 pentenoate solfataricus GI: 15899826 dihydroxy- dioxopentanoic hydratase (KdaD) pentanoic acid acid 2,5-dioxopentanoate dehydrogenase aldehyde Sulfolobus SSO3117 NP_344430.1; 2,5- 2-oxoglutaric 16 dehydrogenase solfataricus GI: 15899825 dioxopentanoic acid (DopDH) acid 2,5-dioxovalerate dehydrogenase 2,5-dioxovalerate Bacillus YcbD NP_388129.1; 2,5- 2-oxoglutaric 21 dehydrogenase subtilis GI: 16077316 dioxopentanoic acid (YcbD) acid D-xylose dehydrogenase D-Xylose Caulobacter CC0821 YP_002516237.1; D-xylose D-xylonolactone 26 dehydrogenase crescentus GI: 221233801 (XylB) D-xylonolactonase D-xylonolactonase Caulobacter CC0820 YP_002516236.1; D-xylonolactone D-xylonic acid 31 (XylC) crescentus GI: 221233800 D-xylonate dehydratase D-xylonate Caulobacter CC0819 NP_419636.1 D-xylonic acid 2-oxo-4(S),5- 36 dehydratase (XylD) crescentus GI: 16125072 dihydroxy- pentanoic acid 2-Keto-3-deoxy-D-arabinonate dehydratase 2-keto-4- Caulobacter CC0823 NP_419640.1; 2-oxo-4(S),5- 2,5- 41 pentenoate crescentus GI: 16125076 dihydroxy- dioxopentanoic hydratase (XylX) pentanoic acid acid L-arabinose dehydrogenase dehydrogenase Burkholderia BTH_II1629 YP_439823.1; L-arabinose L- 46 (AraE) thailandensis GI: 83716868 arabinonolactone E264 from L-arabinose L-arabinonolactonase L- Burkholderia BTH_II1625 YP_439819.1; L- L-arabinonic acid 51 arabinonolactonase thailandensis GI: 83717359 arabinonolactone (Aral) E264 L-arabinonate dehydiatase L-arabinonate Burkholderia BTH_II1632 YP_439826.1; L-arabinonic acid 2-oxo-4(R),5- 56 dehydratase (AraB) thailandensis GI: 83718062 dihydroxy- E264 pentanoic acid 2-Keto-3-deoxy-L-arabinonate Dehydratase dihydrodipicolinate Burkholderia BTH_II1630 YP_439824.1; 2-oxo-4(R),5- 2,5- 61 synthase (AraD) thailandensis GI: 83717217 dihydroxy- dioxopentanoic E264 pentanoic acid acid D-glucarate dehydratase D-glucarate Bacillus YcbF NP_388131.2; D-glucaric acid 4-deoxy-5-keto- 66 dehydratase subtilis GI: 255767063 D-glucaric acid (YcbF) D-galactarate dehydratase D-galactarate Bacillus YcbH NP_388133.2; D-galactaric acid 4-deoxy-5-keto- 71 dehydratase subtilis GI: 255767065 D-glucaric acid (YcbH) 5-dehydro-4-deoxyglucarate dehydratase 5-dehydro-4- Bacillus YcbC NP_388128.2; 4-deoxy-5-keto- 2,5- 76 deoxyglucarate subtilis GI: 255767061 D-glucaric acid dioxopentanoic dehydratase acid (YcbC) Amino acid transporter LysE Amino acid Pseudomonas PP_1248 NP_743408.1; 4(R)-hydroxy-L- 4(R)-hydroxy-D- 81 transporter LysE putida GI: 26987983 proline proline (HypE) PP_1245 Hypothetical Pseudomonas PP_1245 NP_743405.1; 4(R)-hydroxy-D- 2-carboxy-4(R)- 86 protein of PP_1245 putida GI: 26987980 proline hydroxy-pyrroline PP_1247 Hypothetical Pseudomonas PP_1247 NP_743407.1; 2-carboxy-4(R)- 2,5- 91 protein of PP_1247 putida GI: 26987982 hydroxy-pyrroline dioxopentanoic acid PP_1246 Hypothetical Pseudomonas PP_1246 NP_743406.1; 2,5- 2-oxoglutaric 93 protein of PP_1246 putida GI: 6987981 dioxopentanoic acid acid Alpha-ketolsoyalerate decarboxylase alpha- Lactococcus KivD YP_003353820.1; 2,5- Succinaldehyde 98 ketolsoyalerate lactis GI: 281491840 dioxopentanoic decarboxylase acid Alcohol dehydrogenase (YqhD) alcohol E.coli yqhD YP_001459806.1; Succinaldehyde 1,4-butanediol 103 dehydrogenase GI: 157162488

In addition to the enzymes listed in Table 1, homologs of the listed enzymes may be used. Thus, as an alternative to AraDH (SEQ ID NO:1), one may use, for example, any of the polypeptides depicted in SEQ ID NO:2-5; as an alternative to AraD (SEQ ID NO:6), one may use, for example, any of the polypeptides depicted in SEQ ID NO: 7-10; as an alternative to Kda (SEQ ID NO:11), one may use, for example, any of the polypeptides depicted in SEQ ID NO: 12-15; as an alternative to DopDH (SEQ ID NO:16), one may use, for example, any of the polypeptides depicted in SEQ ID NO:17-20; as an alternative to YcbD (SEQ ID NO:21), one may use, for example, any of the polypeptides depicted in SEQ ID NO:22-25; as an alternative to XylB (SEQ ID NO:26), one may use, for example, any of the polypeptides depicted in SEQ ID NO:27-30; as an alternative to XylC (SEQ ID NO:31), one may use, for example, any of the polypeptides depicted in SEQ ID NO:32-35; as an alternative to XylD (SEQ ID NO:36), one may use, for example, any of the polypeptides depicted in SEQ ID NO:37-40; as an alternative to XylX (SEQ ID NO:41), one may use, for example, any of the polypeptides depicted in SEQ ID NO:42-45; as an alternative to AraE (SEQ ID NO:46), one may use, for example, any of the polypeptides depicted in SEQ ID NO:47-50; as an alternative to AraI (SEQ ID NO:51), one may use, for example, any of the polypeptides depicted in SEQ ID NO:52-55; as an alternative to AraB (SEQ ID NO:56), one may use, for example, any of the polypeptides depicted in SEQ ID NO:57-60; as an alternative to AraD (SEQ ID NO:61), one may use, for example, any of the polypeptides depicted in SEQ ID NO:62-65; as an alternative to YcbF (SEQ ID NO:66), one may use, for example, any of the polypeptides depicted in SEQ ID NO:67-70; as an alternative to YcbH (SEQ ID NO:71), one may use, for example, any of the polypeptides depicted in SEQ ID NO:72-75; as an alternative to YcbC (SEQ ID NO:76), one may use, for example, any of the polypeptides depicted in SEQ ID NO:77-80; as an alternative to HypE (SEQ ID NO:81), one may use, for example, any of the polypeptides depicted in SEQ ID NO:82-85; as an alternative to PP_1245 (SEQ ID NO:86), one may use, for example, any of the polypeptides depicted in SEQ ID NO:87-90; as an alternative to PP_1247 (SEQ ID NO:91), one may use, for example, the polypeptide depicted in SEQ ID NO:92; as an alternative to PP_1246 (SEQ ID NO:93), one may use, for example, any of the polypeptides depicted in SEQ ID NO:94-97; as an alternative to alpha-ketoisovalerate decarboxylase (SEQ ID NO:98), one may use, for example, any of the polypeptides depicted in SEQ ID NO:99-102; as an alternative to YqhD (SEQ ID NO:103), one may use, for example, any of the polypeptides depicted in SEQ ID NO:104-107.

In some cases, the wild-type control may be unable to produce the TCA derivative and, therefore, an increase in the biosynthesis of a particular product may reflect any measurable biosynthesis of that product. In certain embodiments, an increase in the biosynthesis of a TCA derivative can include biosynthesis sufficient for a culture of the microbial cell to accumulate the TCA derivative to a predetermine concentration.

The predetermined concentration may be any predetermined concentration of the product suitable for a given application. Thus, a predetermined concentration may be, for example, a concentration of at least 0.1 g/L such as, for example, at least 0.25 g/L, at least 0.5 g/L, at least 1.0 g/L, at least 2.0 g/L, at least 3.0 g/L, at least 4.0 g/L, at least 5.0 g/L, at least 6.0 g/L, at least 7.0 g/L, at least 8.0 g/L, at least 9.0 g/L, at least 10 g/L, at least 20 g/L, at least 50 g/L, at least 100 g/L, or at least 200 g/L.

While described above in the context of an exemplary embodiment in which the host cell is E. coli, the recombinant cells described herein can be constructed, and the methods of making and using the recombinant cells can be performed, using any suitable host cell.

Thus, the recombinant cell can be, or be derived from, any suitable microbe including, for example, a prokaryotic microbe or a eukaryotic microbe. As used herein, the term “or derived from” in connection with a microbe simply allows for the “host cell” to possess one or more genetic modifications before being modified to exhibit the indicated increased biosynthetic activity. Thus, the term “recombinant cell” encompasses a “host cell” that may contain nucleic acid material from more than one species before being modified to exhibit the indicated biosynthetic activity.

In some embodiments, the host cell may be selected to possess one or more natural physiological activities. For example, the host cell may be photosynthetic (e.g., cyanobacteria) or may be cellulolytic (e.g., Clostridium cellulolyticum).

In some embodiments, the recombinant cell may be, or be derived from, a eukaryotic microbe such as, for example, a fungal cell. In some of these embodiments, the fungal cell may be, or be derived from, a member of the Saccharomycetaceae family such as, for example, Saccharomyces cerevisiae, Candida rugosa, or Candida albicans.

In other embodiments, the recombinant cell may be, or be derived from, a prokaryotic microbe such as, for example, a bacterium. In some of these embodiments, the bacterium may be a member of the phylum Protobacteria. Exemplary members of the phylum Protobacteria include, for example, members of the Enterobacteriaceae family (e.g., Escherichia coli) and, for example, members of the Pseudomonaceae family (e.g., Pseudomonas putida). In other cases, the bacterium may be a member of the phylum Firmicutes. Exemplary members of the phylum Firmicutes include, for example, members of the Bacillaceae family (e.g., Bacillus subtilis), members of the Clostridiaceae family (e.g., Clostridium cellulolyticum) and, for example, members of the Streptococcaceae family (e.g., Lactococcus lactis). In other cases, the bacterium may be a member of the phylum Cyanobacteria.

In some embodiments, the increased biosynthesis of the TCA derivative compared to a wild-type control can include an increase in activity of one or more enzymes involved in the metabolism of the carbon source (e.g., xylose or arabinose). Such enzymes may be found in the proteome of microbes such as, for example, Sulfolobus solfataricus, Caulobacter crescentus, Burkholderia thailandensis, Haloarcula marismortui, Bacillus subtilis, and Pseudomonas putida. Exemplary enzymes, shown in the context of their native metabolic pathways, are shown in FIG. 2. So, for example, increased biosynthesis of the TCA derivative can include an increase in activity of one or more enzymes involved in the metabolism of D-xylose in Caulobacter crescentus such as, for example, xylose dehydrogenase (FIG. 2, CC0821) activity, xylonolactonase (FIG. 2, CC0819) activity, xylonate dehydrogenase (FIG. 2, CC0822) activity, and 2-keto-3-deoxyaldonic acid dehydratase (FIG. 2, CC0823) activity compared to the wild-type control.

In some embodiments, the increased biosynthesis of the TCA derivative compared to a wild-type control can further include an increase in benzoylformate decarboxylase activity and an increase in alcohol dehydrogenase activity. In some of these embodiments, the benzoylformate decarboxylase can include BFD of Pseudomonas putida. In some of these embodiments, the alcohol dehydrogenase can include yqhD of E. coli.

In some embodiments, the increased biosynthesis of the TCA derivative compared to a wild-type control can further include an increase in decarboxylase activity and an increase in alcohol dehydrogenase activity. In some of these embodiments, the decarboxylase can include KIVD of Lactococcus lactis. In some of these embodiments, the alcohol dehydrogenase can include yqhD of E. coli. See, e.g., Example 2 and FIGS. 12-14.

In some embodiments, the recombinant cell can include an engineered metabolic pathway designed to permit the recombinant cell to increase its consumption of a particular carbon source compared to a wild-type control. Exemplary metabolic pathways are illustrated in, for example, FIG. 6 through FIG. 11. Accordingly, exemplary carbon sources include, for example, arabinose, xylose, arabinose, glucaric acid, galactaric acid, or hydroxyproline. In other embodiments, the recombinant cell may be designed to consume a uronic acid such as, for example, galacturonic acid and/or glucuronic acid as a carbon source. In such embodiments, a heterologous polynucleotide that encodes a uronate dehydrogenase enzyme may be introduced into the recombinant cell to confer to the recombinant cell the ability to convert uronic acid to aldonic acid. In still other embodiments, the recombinant cell can utilize a carbon source that includes, for example, glucose, cellulose, galacturonic acid, glucuronic acid, CO2, or glycerol. In some of these embodiments, the recombinant cell may be further modified to convert the carbon source (e.g., glucose) to one or more of the carbon sources (e.g., xylose and/or a hexaric acid such as, e.g., glucaric acid) that is an entry point to one or more of the engineered pathways described herein.

FIG. 6 shows an exemplary metabolic pathway that permits a recombinant cell to use D-arabinose as a carbon source for the production of 2,5-dioxopentanoic acid. In this example, the recombinant cell can include an enzyme that can convert D-arabinose into D-arabinolactone such as, for example, a pentose dehydrogenase. One example of a suitable pentose dehydrogenase includes AraDH from Sulfolobus solfataricus. The pentose dehydrogenase can provide catalytic conversion of D-arabinose into D-arabinolactone that is, for example, at least 110% greater than that exhibited by a wild-type control.

The exemplary metabolic pathway illustrated in FIG. 6 also includes an enzyme that can convert D-arabinonic acid to 2-oxo-4(S),5-dihydroxy-pentanoic acid such as, for example, an aldonic acid dehydratase. One example of a suitable aldonic acid dehydratase includes AraD from Sulfolobus solfataricus. The aldonic acid dehydratase can provide catalytic conversion of D-arabinonic acid into 2-oxo-zhS),5-dihydroxy-peritanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

The exemplary metabolic pathway illustrated in FIG. 6 also includes an enzyme that can convert 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid such as, for example, a 2-keto-3-deoxyaldonic acid dehydratase. On example of a suitable 2-keto-3-deoxyaldonic add dehydratase includes KdaD from Sulfolobus solfataricus. The 2-keto-3-deoxyaldonic acid dehydratase can provide catalytic conversion of 2-oxo-4(S) 5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

FIG. 7 shows an exemplary metabolic pathway that permits a recombinant cell to use D-xylose as a carbon source for the production of 2,5-dioxopentanoic acid. In this example, the recombinant cell can include an enzyme that can convert. D-xylose to D-xylonolactone such as, for example, a pentose dehydrogenase. Exemplary suitable pentose dehydrogenases include XylB from Caulobacter crescentus or rmAC3034 from Haloarcula marismortui. The pentose dehydrogenase can provide catalytic conversion of D-xylose to D-xylonolactone that is, for example, at least 110% greater than that exhibited by a wild-type control.

The exemplary metabolic pathway illustrated in FIG. 7 also includes an enzyme that can convert D-xylonolactone to D-xylonic acid such as, for example, a pentonolactonase. Exemplary suitable pentonolactonases include XylC from Caulobacter crescentus or rmAC3033 from Haloarcula marismortui. The pentonolactonase can provide catalytic conversion of D-xylonolactone to D-xylonic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

The exemplary metabolic pathway illustrated in FIG. 7 also includes an enzyme that can convert D-xylonic acid to 2-oxo-4(S),5-dihydroxy-pentanoic acid such as, for example, an aldonic acid dehydratase. Exemplary suitable aldonic acid dehydratases include XylD from Caulobacter crescentus or rrnAC3032 from Haloarcula marismortui. The aldonic acid dehydratase can provide catalytic conversion of D-xylonic acid into 2-oxo-4(S),5-dihydroxy-pentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

The exemplary metabolic pathway illustrated in FIG. 7 also includes an enzyme that can convert 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid such as, for example, a 2-keto-3-deoxyaldonic acid dehydratase. Exemplary suitable 2-keto-3-deoxyaldonic acid dehydratases include XylX from Caulobacter crescentus or rrnAC3039 from Haloarcula marismortui. The 2-keto-3-deoxyaldonic acid dehydratase can provide catalytic conversion of 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

FIG. 8 shows an exemplary metabolic pathway that permits a recombinant cell to use L-arabinose as a carbon source for the production of 2,5-dioxopentanoic acid. In this example, the recombinant cell can include an enzyme that can convert L-arabinose to L-arabinol actone such as, for example, a pentose dehydrogenase. One example of a suitable pentose dehydrogenase includes AraE from Burkholderia thailandensis. The pentose dehydrogenase can provide catalytic conversion of L-arabinose to L-arabinolactone that is, for example, at least 110% greater than that exhibited by a wild-type control.

The exemplary metabolic pathway illustrated in FIG. 8 also includes an enzyme that can convert L-arabinolactone to L-arabinonic acid such as, for example, a pentonolactonase. One example of a suitable pentonolactonase includes AraI from Burkhoideria thailandensis. The pentonolactonase can provide catalytic conversion of L-arabinolactone to L-arabinonic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

The exemplary metabolic pathway illustrated in FIG. 8 also includes an enzyme that can convert L-arabinonic acid to 2-oxo-4(R),5-dihydroxy-pentanoic acid such as, for example, an aldonic acid dehydratase. One example of a suitable aldonic acid dehydratase includes AraB from Burkholderia thailandensis. The aldonic acid dehydratase can provide catalytic conversion of L-arabinonic add to 2-oxo-4(R),5-dihydroxy-pentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

The exemplary metabolic pathway illustrated in FIG. 8 also includes an enzyme that can convert 2-oxo-4(1t),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid such as, for example, a 2-keto-3-deoxyaldonic acid dehydratase. One example of a suitable 2-keto-3-deoxyaldonic acid dehydratase includes AraD from Burkholderia thailandensis. The 2-keto-3-deoxyaldonic acid dehydratase can provide catalytic conversion of 2-oxo-4(R),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic add that is, for example, at least 110% greater than that exhibited by a wild-type control.

FIG. 9 shows an exemplary metabolic pathway that permits a recombinant cell to use D-glucaric acid as a carbon source for the production of 2,5-dioxopentanoic acid. In this example, the recombinant cell can include an enzyme that can convert D-glucaric acid to 4-deoxy-5-keto-D-glucaric acid such as, for example, an aldonic acid dehydratase. Suitable exemplary aldonic acid dehydratases include YcbF from Bacillus subtilis. The aldonic acid dehydratase can provide catalytic conversion of D-glucaric acid to 4-deoxy-5-keto-D-glucaric acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

The exemplary metabolic pathway illustrated in FIG. 9 also includes an enzyme that can convert 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid such as, for example, a 2-keto-3-deoxyaldonic acid dehydratase. One example of a suitable 2-keto-3-deoxyaldonic acid dehydratase includes YcbC from Bacillus subtilis. The 2-keto-3-deoxyaldonic acid dehydratase can provide catalytic conversion of 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

FIG. 10 shows an exemplary metabolic pathway that permits a recombinant cell to use D-galactaric acid as a carbon source for the production of 2,5-dioxopentanoic acid. In this example, the recombinant cell can include an enzyme that can convert D-galactaric acid to 4-deoxy-5-keto-D-glucaric acid such as, for example, an aldonic acid dehydratase. Suitable exemplary aldonic acid dehydratases include YcbH from Bacillus subtilis. The aldonic acid dehydratase can provide catalytic conversion of D-galactaric acid to 4-deoxy-5-keto-D-glucaric acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

The exemplary metabolic pathway illustrated in FIG. 9 also includes an enzyme that can convert 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid such as, for example, a 2-keto-3-deoxyaldonic acid dehydratase. One example of a suitable 2-keto-3-deoxyaldonic acid dehydratase includes YcbC from Bacillus subtilis. The 2-keto-3-deoxyaldonic acid dehydratase can provide catalytic conversion of 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

FIG. 11 shows an exemplary metabolic pathway that permits a recombinant cell to use 4(R)-hydroxy-D-proline as a carbon source for the production of 2,5-dioxopentanoic acid. In this example, the recombinant cell can include an enzyme that can convert 4(R)-hydroxy-D-proline to 4(R)-hydroxy-D-proline. One suitable exemplary enzyme for this embodiment includes, amino acid transporter LysE (HypE) from Pseudomonas. The enzyme can provide catalytic conversion of 4(R)-hydroxy-D-proline to 4(R)-hydroxy-D-proline that is, for example, at least 110% greater than that exhibited by a wild-type control.

The exemplary metabolic pathway illustrated in FIG. 11 also includes an enzyme that can convert 4(R)-hydroxy-D-proline to 2-carboxy-4(R)-hydroxy-δ-pyrroline. One suitable exemplary enzyme for this embodiment includes, for example, HypOX from Psendomonas. The enzyme can provide catalytic conversion of 4(R)-hydroxy-D-proline to 2-carboxy-4(R)-hydroxy-δ-pyrroline that is, for example, at least 110% greater than that exhibited by a wild-type control.

The exemplary metabolic pathway illustrated in FIG. 11 also includes an enzyme that can convert 2-oxo-4(R)-5-aminopentanoic acid to 2,5-dioxopentanoic acid such as, for example, a 2-keto-3-deoxyaldonic acid dehydratase. One exemplary 2-keto-3-deoxyaldonic acid dehydratase includes PP 1247 from Pseucionionas. The 2-keto-3-deoxyaldonic acid dehydratase can provide catalytic conversion of 2-oxo-4(R)-5-aminopentanoic acid to 2,5-dioxopentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

The recombinant cell can be engineered to convert the 2,5-dioxopentanoic acid to any desirable TCA derivative. In some embodiments, the recombinant cell can include an α-ketoglutaric semialdehyde dehydrogenase to shunt the 2,5-dioxopentanoic acid into the TCA cycle. In this manner, TCA cycle derivatives such as, for example, succinate, fumarate, malate, glutamate, lysine, threonine, 4-hydroxybutyrate may be produced.

In some embodiments, however, the recombinant cell may be further modified to possess a metabolic pathway for the conversion of 2,5-dioxopentanoic acid to 1,4-butanediol. Exemplary metabolic pathways are illustrated, for example, in FIG. 4 and FIG. 5. The exemplary pathway illustrated in FIG. 4 includes an enzyme that can convert 2,5-dioxopentonoic acid to succinaldehyde such as, for example, a 2-ketoacid decarboxylase or a 2-oxoglutarate decarboxylase. Suitable exemplary enzymes include, for example, Kivd, BFD, and IPDC. The exemplary pathway illustrated in FIG. 4 also includes an enzyme that can convert succinaldehyde to 1,4-butanediol such as, for example, an alcohol dehydrogenase. Suitable exemplary alcohol dehydrogenases include YqhD, ADH6, YjgB, and YahK.

The exemplary pathway illustrated in FIG. 5 includes an enzyme that can convert 2,5-dioxopentonoic acid to 2-keto-5-hydroxy-pentonate such as, for example, an alcohol dehydrogenase. Here again, suitable exemplary alcohol dehydrogenases include, for example, YqhD, ADH6, YjgB, and YahK. The exemplary pathway illustrated in FIG. 5 includes an enzyme that can convert 2-keto-5-hydroxy-pentonate to 4-hydroxy-1-butyraldehyde such as, for example, a 2-ketoacid decarboxylase or a 2-oxoglutarate decarboxylase. Suitable exemplary enzymes include, for example, Kivd, BFD, and IPDC. The exemplary pathway illustrated in FIG. 5 includes conversion of 4-hydroxy-1-butyraldehyde into 1,4-butanediol. This conversion may be catalyzed by an alcohol dehydrogenase such as, for example, YqhD, ADH6, YjgB, and YahK. For the metabolic pathway illustrated in FIG. 5, therefore, the recombinant cell can include one or more alcohol dehydrogenases.

In some embodiments, the host cell can include one or more genetic modifications to reduce endogenous metabolism of the carbon source so that metabolism of the carbon source is directed toward the production of the TCA derivative. For example, in embodiments in which the carbon source is xylose and the host cell is E. coli, the host cell can include one or more modifications to decrease endogenous metabolism of xylose. In the case of E. coli, such modifications can include for example, a decrease in α-ketoglutaric semialdehyde dehydrogenase activity, aldolase activity, and/or 2-keto-3-deoxy gluconate aldolase activity. Such modifications can include modifications to coding regions of, or regulatory regions that control expression of, xylA, yjhH, and/or yagE. Such modifications can include, for example, a deletion of a sufficient amount of one or more coding regions that the enzymatic activity is reduced.

As used herein, the terms “activity” with regard to particular enzyme refers to the ability of a polypeptide, regardless of its common name or native function, to catalyze the conversion of the enzyme's substrate to a product, regardless of whether the “activity” as less than, equal to, or greater than the native activity of the identified enzyme. Methods for measuring the biosynthetic activities of cells are routine and well known to those of ordinary skill in the art.

As used herein, an increase in catalytic activity can be quantitatively measured and described as a percentage of the catalytic activity of an appropriate wild-type control. The catalytic activity exhibited by a genetically-modified polypeptide can be, for example, at least 110%, at least 125%, at least 150%, at least 175%, at least 200% (two-fold), at least 250%, at least 300% (three-fold), at least 400% (four-fold), at least 500% (five-fold), at least 600% (six-fold), at least 700% (seven-fold), at least 800% (eight-fold), at least 900% (nine-fold), at least 1000% (10-fold), at least 2000% (20-fold), at least 3000% (30-fold), at least 4000% (40-fold), at least 5000% (50-fold), at least 6000% (60-fold), at least 7000% (70-fold), at least 8000% (80-fold), at least 9000% (90-fold), at least 10,000% (100-fold), or at least 100,000% (1000-fold) of the activity of an appropriate wild-type control.

Alternatively, an increase in catalytic activity may be expressed as at an increase in kcat such as, for example, at least a two-fold increase, at least a three-fold increase, at least a four-fold increase, at least a five-fold increase, at least a six-fold increase, at least a seven-fold increase, at least an eight-fold increase, at least a nine-fold increase, at least a 10-fold increase, at least a 15-fold increase, or at least a 20-fold increase in the kcat value of the enzymatic conversion.

An increase in catalytic activity also may be expressed in terms of a decrease in Km such as, for example, at least a two-fold decrease, at least a three-fold decrease, at least a four-fold decrease, at least a five-fold decrease, at least a six-fold decrease, at least a seven-fold decrease, at least an eight-fold decrease, at least a nine-fold decrease, at least a 10-fold decrease, at least a 15-fold decrease, or at least a 20-fold decrease in the Km value of the enzymatic conversion.

A decrease in catalytic activity can be quantitatively measured and described as a percentage of the catalytic activity of an appropriate wild-type control. The catalytic activity exhibited by a genetically-modified polypeptide can be, for example, no more than 95%, no more than 90%, no more than 85%, no more than 80%, no more than 75%, no more than 70%, no more than 65%, no more than 60%, no more than 55%, no more than 50%, no more than 45%, no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, no more than 5%, no more than 4%, no more than 3%, no more than 2%, no more than 1% of the activity, or 0% of the activity of a suitable wild-type control.

Alternatively, a decrease in catalytic activity can be expressed as an appropriate change in a catalytic constant. For example, a decrease in catalytic activity may be expressed as at a decrease in kcat such as, for example, at least a two-fold decrease, at least a three-fold decrease, at least a four-fold decrease, at least a five-fold decrease, at least a six-fold decrease, at least a seven-fold decrease, at least an eight-fold decrease, at least a nine-fold decrease, at least a 10-fold decrease, at least a 15-fold decrease, or at least a 20-fold decrease in the kcat value of the enzymatic conversion.

A decrease in catalytic activity also may be expressed in terms of an increase in Km such as, for example, an increase in Km of at least two-fold, at least three-fold, at least four-fold, at least five-fold, at least six-fold, at least seven-fold, at least an eight-fold, at least nine-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 35-fold, at least 40-fold, at least 45-fold, at least 50-fold, at least 75-fold, at least 100-fold, at least 150-fold, at least 200-fold, at least 230-fold, at least 250-fold, at least 300-fold, at least 350-fold, or at least 400-fold.

Thus, in another aspect, we describe herein methods for biosynthesis of a TCA derivative. Generally, the methods includes incubating a recombinant cell as described herein in medium that includes a carbon source under conditions effective for the recombinant cell to produce the TCA derivative. The carbon source can include, for example, saccharides (e.g., xylose, arabinose, glucose, cellulose), a uronic acid (e.g., galacturonic acid or glucuronic acid), CO2, glycerol, or a native substrate of an enzyme that is part of the engineered metabolic pathway. Exemplary native substrates of exemplary enzymes are shown in Table 1 and include, for example, glucaric acid, galactaric acid, hydroxyproline, arabinonic acid, 2-oxo-4(S),5-dihydroxy-pentanoic acid, 2-oxo-4(R),5-dihydroxy-pentanoic acid, 2,5-dioxopentanoic acid, xylonolactone, xylonic acid, arabinonolactone, 4-deoxy-5-keto-D-glucaric acid, 4(R)-hydroxy-L-proline, 4(R)-hydroxy-D-proline, 2-carboxy-4(R)-hydroxy-pyrroline, 2,5-dioxopentanoic acid, succinaldehyde.

In yet another aspect, we describe herein methods for introducing a heterologous polynucleotide into cell so that the host cell exhibits an increased ability to convert a carbon source to a TCA derivative. The heterologous polynucleotide can encode a polypeptide operably linked to a promoter so that modified cell catalyzes conversion of the carbon source to the TCA derivative. In some of these embodiments, the carbon source can include xylose. The host cells for such methods can include, for example, any of the microbial species identified above with regard to the recombinant cells described herein.

In some embodiments, the heterologous polynucleotide may be inserted into a vector. A vector is a replicating polynucleotide such as, for example, a plasmid, phage, or cosmid, to which another polynucleotide may be inserted so as to bring about the replication of the inserted polynucleotide. Construction of vectors containing a polynucleotide of the invention employs standard ligation techniques known in the art. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual., Cold Spring Harbor Laboratory Press (1989). A vector can permit, for example, further cloning—i.e., a cloning vector—or expression of the polypeptide encoded by the coding region—i.e., an expression vector. The term vector includes, but is not limited to, plasmid vectors, viral vectors, cosmid vectors, or artificial chromosome vectors. In one embodiment, the vector is a plasmid. Selection of a vector can depend upon a variety of desired characteristics in the resulting construct, such as a selection marker, vector replication rate, and the like.

An expression vector optionally includes regulatory sequences operably linked to the coding region. The polynucleotides described herein are not limited by the use of any particular promoter, and a wide variety of promoters are known. Promoters act as regulatory signals that bind RNA polymerase in a cell to initiate transcription of a downstream (3′ direction) coding region. The promoter used can be a constitutive or an inducible promoter. It can be, but need not be, heterologous with respect to the host cell. Exemplary promoters include, for example, trp, tac, and T7.

“Coding sequence” or “coding region” refers to a nucleotide sequence that encodes a polypeptide and, when placed under the control of appropriate regulatory sequences, expresses the encoded polypeptide. The boundaries of a coding region are generally determined by a translation start codon at its 5′ end and a translation stop codon at its 3′ end. As used herein, the term “polypeptide” refers broadly to a polymer of two or more amino acids joined together by peptide bonds. The term “polypeptide” also includes molecules that contain more than one polypeptide joined by disulfide bonds, ionic bonds, or hydrophobic interactions, or complexes of polypeptides that are joined together, covalently or noncovalently, as multimers (e.g., dimers, tetramers). Thus, the terms peptide, oligopeptide, and protein are all included within the definition of polypeptide and these terms are used interchangeably. The term “polypeptide” does not connote a specific length of a polymer of amino acids, nor does it imply or distinguish whether the polypeptide is produced using recombinant techniques, chemical or enzymatic synthesis, or is naturally occurring.

“Regulatory sequence” refers to a nucleotide sequence that regulates expression of a coding region to which it is operably linked. Nonlimiting examples of regulatory sequences include, for example, promoters, transcription initiation sites, translation start sites, translation stop sites, and terminators. “Operably linked” refers to a juxtaposition wherein the components are in a relationship permitting them to function in their intended manner. A regulatory sequence is “operably linked” to a coding region when it is joined in such a way that expression of the coding region is achieved under conditions compatible with the regulatory sequence.

As used in the preceding description, the term “and/or” means one or all of the listed elements or a combination of any two or more of the listed elements; the term “comprises” and variations thereof do not have a limiting meaning where these terms appear in the description and claims; unless otherwise specified, “a,” “an,” “the,” and “at least one” are used interchangeably and mean one or more than one; and the recitations of numerical ranges by endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).

In the preceding description, particular embodiments may be described in isolation for clarity. Unless otherwise expressly specified that the features of a particular embodiment are incompatible with the features of another embodiment, certain embodiments can include a combination of compatible features described herein in connection with one or more embodiments.

For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.

The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.

EXAMPLES Example 1 Bacterial Strains and Plasmids

All the primers were ordered from Eurofins MWG Operon and are listed in Table 1. The E. coli strains used in this study are listed in Table 2, which were all derived from E. coli K-12 strain BW25113.

TABLE 2 Strains, plasmids and primers used in this study Name Relevant genotype Reference Strains BW25113 rrnBT14 ΔlacZWJ16 hsdR514 ΔaraBADAH33 ΔrhaBADLD78 A SBDO-1 BW25113 ΔxylA ΔyjhH ΔyagE This work SBDO-2 SBDO-1 + pBDO-1 This work SBDO-3 SBDO-1 + pBDO-1 and pBDO-2 This work SBDO-4 SBDO-1 + pBDO-1 and pBDO-3 This work SBDO-5 SBDO-1 + pBDO-1 and pBDO-4 This work Plasmids pIBA7 ColE1 ori, AmpR, PLlacO1::kivD padA B pBDO-1 p15A ori, KanR, PLlacO1::xylBCDX This work pBDO-2 ColE1 ori, AmpR, PLlacO1::xylA This work pBDO-3 ColE1 ori, AmpR, PLlacO1::BFD-yqhD This work pBDO-4 ColE1 ori, AmpR, PLlacO1::kivD-yqhD This work SEQ ID Primers  NO: xylBAcc-F GGGCCCggtaccatgtcctcagccatctatcccagcct 108 xylBHinNheBa- GGGCCCGCTCAGCAAGCTTGCTAGCggatcctTaacgccagccggcgtcgatccagt 109 R xylCBamHI-F GGGCCCggatccAGGAGAAATTAACTatgaccgctcaagtcacttgcgtatg 110 xylCHindNhe- GGGCCCAAGCTTgctagcttagacaaggcggacctcatgctggg 111 R xylDNheI-F GGGCCCgctagcAGGAGAAATTAACTatgaggtccgccttgtctaaccgcac 112 xylDHind-R GGGCCCaagctttTagtggttgtggcggggcagcttgg 113 xylXHind-F GGGCCCaagcttAGGAGAAATTAACTAtggtttgtcggcggcttctagcatg 114 xylXBIpRem-R gcgcagctggcgttgttgtccttggccttTctgagcagcagggccgaacgaccttcgaa 115 XylXBIpI-R GGGCCCGCTCAGCttagaggaggccgcggccggccaggt 116 pZEkivD-F actgaccgaattcattaaagaggagaaaggtaccatgtatacagtaggagattacctatt 117 kivD-R ttatgatttattttgttcagcaaata 118 YqhDkivD-F ctgaacaaaataaatcataaAGGAGAAATTAACTATGAACAACTTTAATCTGCACACCCC 119 BFDpZE-F actgaccgaattcattaaagaggagaaaggtaccatggcttcggtacacggcaccacata 120 BFD-R tTacttcaccgggcttacggtgctta 121 CC0822Acc-F GGGCCCggtaccatgaccgacaccctgcgccattacat 122 CC0822Xba-R GGGCCCtctagattacgaccacgagtaggaggttttgg 123 A. Datsenko et al., 2000 Proc. Natl. Acad. Sci. U.S.A. 97: 6640-5. B. Zhang et al., 2011 ChemSusChem 4: 1068-1070.

All cloning procedures were carried out in the E. coli strain XL10-gold (Stratagene, Agilent Technologies, Santa Clara, Calif.). To build the plasmid pBDO-1, the coding regions of xylB, xylC, xylD, and xy/X were amplified by PCR with oligos of xylBAcc-F and xylBHinNheBa-R, xylCBamHI-F and xylCHindNhe-R, xylDNheI-F and xylDHind-R, xylXHind-F and xylXBlpRem-R, using genomic DNA of Caulobacter crescentus strain as template, and then these four coding regions of xylB, xylC, xylD, and xy/X were inserted into the corresponding restriction sites of pZA vector after digestion.

To make the plasmid pBDO-2, the coding region of xylA was PCR amplified by oligos of CC0822Acc-F and CC0822Xba-R using genomic DNA of C. crescentus strain as template, and then this coding region was inserted into the site between Acc65I and XbaI of vector pZE after digestion.

To construct the plasmids pBDO-3 and pBDO-4, four coding regions of BFD (using Pseudomonas putida genomic DNA as template), yqhD-1 (using E. coli genomic DNA as template), KIVD (from Lactococcus lactis, using plasmid pIBA7 as template) and yqhD-2 (using E. coli genomic DNA as template), were PCR amplified with oligos of BFDpZE-F and BFD-R, yqhDBFD-F and yqhDpZE-R, pZEkivD-F and kivD-R, yqhDkivD-F and yqhDpZE-R, and then pBDO-3 and pBDO-4 were completed by Gibson cloning method (Gibson et al., 2009. Nat. Meth. 6:343-345). P1 phages of xylA, yjhH and yagE and were obtained from the Keio collection (Baba et al., 2006 Mol. Syst. Biol. 2:10.1038). The phages were used to transfect the BW25113 strain to construct triple knockout strains. All the knockout strains were then transformed with pCP20 plasmid to remove the kanamycin marker. The correct knockouts were verified by PCR.

Cell Cultivation and Shake Flask Fermentation

Unless otherwise stated, cells were grown in test tubes at 37° C. in 2X YT rich medium (16 g/L Bacto-tryptone, 10 g/L yeast extract, and 5 g/L NaCl) supplemented with 100 mg/L ampicillin and 50 mg/L kanamycin. 200 μL of overnight cultures incubated in 2X YT medium were transferred into 5 mL M9 minimal medium supplemented with 5 g/L yeast extract, 5 g/L glucose, 40 g/L xylose, 100 mg/L ampicillin, and 50 mg/L kanamycin in 125 mL conical flasks. Isopropyl-β-D-thiogalactoside (IPTG) was added at a concentration of 0.1 mM to induce protein expression. The fermentation broth was buffered by the presence of 0.5 g CaCO3.

Metabolite Analysis and Dry Cell Weight Determination

Fermentation products were analyzed using an Agilent 1260 Infinity HPLC equipped with an Aminex HPX 87H column (Bio-Rad Laboratories, Inc., Hercules, Calif.) and a refractive-index detector. The mobile phase was 5 mM H2SO4 with a flow rate 0.6 mL/min. The column temperature and detection temperature were 35° C. and 50° C., respectively. Cell dry weight was determined by filtering 5 mL culture through a 0.45 μm glass fiber filter (Pall Life Sciences, Ann Arbor, Mich.). After removal of medium, the filter was washed with 15 mL of MilliQ water (EMD Millipore Corp., Billerica, Mass.), dried in an oven and then weighed. Cell dry weight was determined in triplicate.

Example 2

To produce 1,4-butanediol from xylose in yeast, one artificial synthetic pathway was introduced into the wild type Saccharomyces cerevisiae strain W303. To generate the artificial pathway we cloned a polynucleotide that encodes enzymes that convert xylose into 2,5-dioxopentanoic acid into the host yeast cell. We also cloned a polynucleotide that encoded enzymes that convert 2,5-dioxopentanoic acid into 1,4-butanediol. These enzymes were cloned into plasmids YEplac195-xylBCDX and YEplac112-KivdDyqhD as described in more detail below.

The transformed yeast were grown under fermentation conditions as described in more detail below for two day. After the fermentation, 1,4-butanediol was accumulated to a concentration of 20 mg/L. (FIG. 14).

Plasmid Construction in the Yeast 1,4-butanediol Synthetic Pathway

The construction of plasmid YEplac195-xylBCDX was finished by Gibson assembly. All of the primers are listed in Table 3.

The coding region for HXT7p was PCR amplified with the primer pair Hxt7p195-1F and Hxt7pXylB-R, using S. cerevisiae W303 genomic DNA as a template. Similarly, the PGK1p coding region was PCR amplified with the primer pair PGK1Phxt7t-F and PGK1PxylC-R; the ADH1p coding region was PCR amplified with the primer pair ADH1Ppgk1t-F and ADH1PxylD-R; the PDC1p coding region was PCR amplified with the primer pair PDC1PADH1T-F and PDC1PxylX-R; the HXT7t coding region was PCR amplified with the primer pair Hxt7tXylB-F and Hxt7tPGK1P-R; the PGK1t coding region was PCR amplified with the primer pair PGK1tXylC-F and PGK1tADH1p-R; the ADH1t coding region was PCR amplified with the primer pair ADH1TxylD-F and ADH1TPDC1P-R; and the PDC1t coding region was PCR amplified with primer pairs PDC1TxylX-F and PDC1T195-R, each by using S. cerevisiae W303 genomic DNA as template.

Caulobacter crescentus xylB coding region was PCR amplified with primer pair xylBhxt7p-F and xylBhxt7t-R using C. crescentus genomic DNA as template. Similarly, the xylC coding region was PCR amplified with primer pair xylCPGK1P-F and xylCPGK1t-R; the xylD coding region was PCR amplified with primer pair xylDADH1P-F/xylDADH1T-R; and the xylX coding region was PCR amplified with primer pair xylXPDC1P-F/xylXPDC1T-R; each using C. crescentus genomic DNA as template.

The combined fragment of HXT7p-xylB-HXT7t was amplified by overlapping PCR with the primer pair Hxt7p195-1F and Hxt7tPGK1P-R using the HXT7p/xylB/HXT7t DNA as a PCR template. The combined fragment PGK1p-xylC-PGK1t was amplified by overlapping PCR with the primer pair PGK1Phxt7t-F and PGK1tADH1p-R using the PGK1p/xylC/PGK1t DNA as a PCR template. The combined fragment ADH1p-xylD-ADH1t was amplified by overlapping PCR with the primer pair ADH1Ppgk1t-F and ADH1TPDC1P-R using the fragment ADH1p/xylD/ADH1t DNA as a PCR template. The combined fragment PDC1p-xylX-PDC1t was amplified by overlapping PCR with the primer pair PDC1PADH1T-F and PDC1T195-R using the PDC1p/xylX/PDC1t DNA as a PCR template.

The vector fragment YEp195v was amplified with primer pair 195HindIII-2F and 195EcoRI-2R by using YEplac195 as template. The fragments of YEp195v, HXT7p-xylB-HXT7t, PGK1p-xylC-PGK1t, ADH1p-xylD-ADH1t, and PDC1p-xylX-PDC1t were assembled by Gibson method to form the plasmid of YEplac195-xylBCDX (FIG. 12).

To build the plasmid of YEplac112-KivD-yqhD, the fragments of HXT7P2, HXT7T2, PGK1P2 and PGK1T2 were PCR amplified using S. cerevisiae W303 genmic DNA as a template. The HXT7P2 fragment was PCR amplified using the primer pair Hxt7p195-1F and HXT7PkivD-R; the HXT7T2 fragment was PCR amplified using the primer pair HXT7TKIVD-F and HXT7TPGK1P-R; the PGK1P2 fragment was PCR amplified using the primer pair PGK1PHXT7T-F/PGK1PyqhD-R; and the PGK1T2 fragment was PCR amplified using the primer pair PGK1TyqhD-F and PGK1T112-R.

The KIVD coding region from Lactococcus lactis was amplified with the primer pair KIVDHXT7P-F and KIVDHXT7T-R using L. lactis genomic DNA as template. The E. coli YqhD coding region was amplified with the primer pair yqhDPGK1P-F and yqhDPGK1T-R using E. coli genomic DNA as template.

The vector fragment YEp112v was amplified with primer pair 195HindIII-2F and 195EcoRI-2R by using YEplac112 as template. The fragments of YEp112v, HXT7P2, KIVD, HXT7T2, PGK1P2, yqhD and PGK1T2 were assembled by Gibson method to generate the plasmid of YEplac112-KivDyqhD. (FIG. 13).

TABLE 3 The used primers in this study SEQ ID Primer NO: 195HindIII-2F attgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagctt 124 Hxt7p195-1F cagctatgaccatgattacgccaagcttGGTACCtcgtaggaacaatttcgggcccctgc 125 Hxt7pXylB-R cttcaggctgggatagatggctgaggacattttttgattaaaattaaaaaaactttttgt 126 XylBhxt7p-F acaaaaagtttttttaattttaatcaaaaaatgtcctcagccatctatcccagcctgaag 127 XylBhxt7t-R tgatcatgaattaataaaagtgttcgcaaatTaacgccagccggcgtcgatccagtattc 128 Hxt7tXylB-F gaatactggatcgacgccggctggcgttAatttgcgaacacttttattaattcatgatca 129 Hxt7tPGK1P-R actcacgagtaattcttgcaaatgcctCCTAGGagacactttttgaagcgggatacagaa 130 PGK1Phxt7t-F ttctgtatcccgcttcaaaaagtgtctCCTAGGaggcatttgcaagaattactcgtgagt 131 PGK1PxylC-R atcccatacgcaagtgacttgagcggtcattgttttatatttgttgtaaaaagtagataa 132 xylCPGK1P-F ttatctactttttacaacaaatataaaacaatgaccgctcaagtcacttgcgtatgggat 133 XylCPGK1t-R attgatctatcgatttcaattcaattcaatttagacaaggcggacctcatgctggggttg 134 PGK1tXy1C-F caaccccagcatgaggtccgccttgtctaaattgaattgaattgaaatcgatagatcaat 135 PGK1tADH1p-R ccgatgtatgggtttggttgccagaaGCtgagcttggagcaggaagaatacactatactg 136 ADH1Ppgk1t-F cagtatagtgtattcttcctgctccaagctcaGCttctggcaaccaaacccatacatcgg 137 ADH1PxylD-R gggcgtgcggttagacaaggcggacctcattgtatatgagatagttgattgtatgcttgg 138 xylDADH1P-F ccaagcatacaatcaactatctcatatacaatgaggtccgccttgtctaaccgcacgccc 139 xylDADH1T-R aataaaaatcataaatcataagaaattcgctTagtggttgtggcggggcagcttggccgc 140 ADH1TxylD-F gcggccaagctgccccgccacaaccactAagcgaatttcttatgatttatgatttttatt 141 ADH1TPDC1P-R gaaggtatgggtgcagtgtgcttatctACTAGTtgtggaagaacgattacaacaggtgtt 142 PDC1PADH1T-F aacacctgttgtaatcgttcttccacaACTAGTagataagcacactgcacccataccttc 143 PDC1PxylX-R ggtccatgctagaagccgccgacaaaccaTtttgattgatttgactgtgttattttgcgt 144 xylXPDC1P-F acgcaaaataacacagtcaaatcaatcaaaAtggtttgtcggcggcttctagcatggacc 145 xylXPDC1T-R actttaactaataattagagattaaatcgcttagaggaggccgcggccggccaggttgcg 146 PDC1TxylX-F cgcaacctggccggccgcggcctcctctaagcgatttaatctctaattattagttaaagt 147 PDC1T195-R acgttgtaaaacgacggccagtgaattcTCTAGAgcttgtcttgagcaattgcagagtcg 148 195EcoRI-2R agttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattc 149 HXT7PkivD-R ctaataggtaatctcctactgtatacatGGATCCtttttgattaaaattaaaaaaacttt 150 KIVDHXT7P-F aaagtttttttaattttaatcaaaaaGGATCCatgtatacagtaggagattacctattag 151 KIVDHXT7T-R tcatgaattaataaaagtgttcgcaaaGGTACCttatgatttattttgttcagcaaatag 152 HXT7TKIVD-F ctatttgctgaacaaaataaatcataaGGTACCtttgcgaacacttttattaattcatga 153 HXT7TPGK1P-R cttactcacgagtaattcttgcaaatgcctagacactttttgaagcgggatacagaaaaa 154 PGK1PHXT7T-F tttttctgtatcccgcttcaaaaagtgtctaggcatttgcaagaattactcgtgagtaag 155 PGK1PyqhD-R TGGGGTGTGCAGATTAAAGTTGTTCATTCTAGAtgttttatatttgttgtaaaaagtaga 156 yqhDPGK1P-F tctactttttacaacaaatataaaacaTCTAGAATGAACAACTTTAATCTGCACACCCCA 157 yqhDPGK1T-R gatctatcgatttcaattcaattcaatCTCGAGTTAGCGGGCGGCTTCGTATATACGGCG 158 PGK1TyqhD-F CGCCGTATATACGAAGCCGCCCGCTAACTCGAGattgaattgaattgaaatcgatagatc 159 PGK1T181-R gtcacgacgttgtaaaacgacggccagtgaattctgagcttggagcaggaagaatacact 160

1,4-butanediol Fermentation by Yeast in Shake Flask

The W303 yeast strain carrying plasmids of YEplac195-xylBCDX and YEplac112-KivDyqhD was cultured overnight in the Complete Minimal medium without uracil and tryptophan supplements at 30° C. with shaking at 200 rpm. The yeast cells were harvested and washed in the next day, and then inoculated into 10 mL fresh medium identical to the overnight culture medium except that it further contained 20 g/L xylose. The shake flask was then sealed with parafilm, and cultured for two days at 30° C. with shaking at 200 rpm. The fermentation broth was analyzed by gas chromatography to measure the amount of 1,4-butanediol. Results are shown in FIG. 14.

Exemplary Embodiments

Embodiment 1. A recombinant microbial cell modified to exhibit increased biosynthesis of a TCA derivative compared to a wild-type control.

Embodiment 2. The recombinant cell of Embodiment 1 wherein the TCA derivative comprises 1,4-butanediol.

Embodiment 3. The recombinant microbial cell any preceding Embodiment wherein the microbial cell is a fungal cell.

Embodiment 4. The recombinant cell of Embodiment 3 wherein the fungal cell is a member of the Saccharomycetaceae family.

Embodiment 5. The recombinant cell of Embodiment 3 wherein the fungal cell is Saccharomyces cerevisiae, Candida rugosa, or Candida albicans.

Embodiment 6. The recombinant cell of Embodiment 1 or Embodiment 2 wherein the microbial cell is a bacterial cell.

Embodiment 7. The recombinant cell of Embodiment 6 wherein the bacterial cell is a member of the phylum Protobacteria.

Embodiment 8. The recombinant cell of Embodiment 7 wherein the bacterial cell is a member of the Enterobacteriaceae family.

Embodiment 9. The recombinant cell of Embodiment 8 wherein the bacterial cell is Escherichia coli.

Embodiment 10. The recombinant cell of Embodiment 7 wherein the bacterial cell is a member of the Pseudomonaceae family.

Embodiment 11. The recombinant cell of Embodiment 10 wherein the bacterial cell is Pseudomonas putida.

Embodiment 12. The recombinant cell of Embodiment 6 wherein the bacterial cell is a member of the phylum Firmicutes.

Embodiment 13. The recombinant cell of Embodiment 12 wherein the bacterial cell is a member of the Bacillaceae family.

Embodiment 14. The recombinant cell of Embodiment 13 wherein the bacterial cell is Bacillus subtilis.

Embodiment 15. The recombinant cell of Embodiment 12 wherein the bacterial cell is a member of the Streptococcaceae family.

Embodiment 16. The recombinant cell of Embodiment 15 wherein the bacterial cell is Lactococcus lactis.

Embodiment 17. The recombinant cell of Embodiment 12 wherein the bacterial cell is a member of the Clostridiaceae family.

Embodiment 18. The recombinant cell of Embodiment 17 wherein the bacterial cell is Clostridium cellulolyticum.

Embodiment 19. The recombinant cell of Embodiment 6 wherein the bacterial cell is a member of the phylum Cyanobacteria.

Embodiment 20. The recombinant cell of any preceding Embodiment wherein the microbial cell is photosynthetic.

Embodiment 21. The recombinant cell of any preceding Embodiment wherein the microbial cell is cellulolytic.

Embodiment 22. The recombinant cell of any preceding Embodiment wherein the increased biosynthesis of the TCA derivative comprises an increase in xylose dehydrogenase activity, xylonolactonase activity, xylonate dehydratase activity, or 2-keto-3-deoxyaldonic acid dehydratase activity.

Embodiment 23. The recombinant cell of Embodiment 22 wherein the increased biosynthesis of the TCA derivative further comprises an increase in benzoylformate decarboxylase activity and an increase in alcohol dehydrogenase activity.

Embodiment 24. The recombinant cell of Embodiment 23 wherein the benzoylformate decarboxylase comprises BFD of Pseudomonas putida.

Embodiment 25. The recombinant cell of Embodiment 23 wherein the alcohol dehydrogenase comprises yqhD of E. coli.

Embodiment 26. The recombinant cell of Embodiment 22 wherein the increased biosynthesis of the TCA derivative further comprises an increase in decarboxylase activity and an increase in alcohol dehydrogenase activity.

Embodiment 27. The recombinant cell of Embodiment 26 wherein the decarboxylase comprises KIVD of Lactococcus lactis.

Embodiment 28. The recombinant cell of Embodiment 26 wherein the alcohol dehydrogenase comprises yqhD of E. coli.

Embodiment 29. The recombinant cell of preceding Embodiment wherein the increased biosynthesis of the TCA derivative comprises a decrease in α-ketoglutaric semialdehyde dehydrogenase activity.

Embodiment 30. The recombinant cell of preceding Embodiment wherein the increased biosynthesis of the TCA derivative comprises a decrease in aldolase activity.

Embodiment 31. The recombinant cell of preceding Embodiment wherein the increased biosynthesis of the TCA derivative comprises a decrease in 2-keto-3-deoxy gluconate aldolase activity.

Embodiment 32. The recombinant cell of any preceding Embodiment comprising an engineered metabolic pathway for converting 2,5-dioxopentanoic acid to 1,4-butanediol.

Embodiment 33. The recombinant cell of Embodiment 32 wherein the engineered metabolic pathway for converting 2,5-dioxopentanoic acid to 1,4-butanediol comprises an enzyme that converts 2,5-dioxopentonoic acid into succinaldehyde.

Embodiment 34. The recombinant cell of Embodiment 33 wherein the enzyme that converts 2,5-dioxopentonoic acid into succinaldehyde comprises a 2-ketoacid decareboxylase or a 2-oxoglutarate decarboxylase.

Embodiment 35. The recombinant cell of Embodiment 33 or 34 wherein the enzyme that converts 2,5-dioxopentonoic acid into succinaldehyde comprises KIVD, BFD, or IPDC.

Embodiment 36. The recombinant cell of any one of Embodiments 32-35 wherein the engineered metabolic pathway for converting 2,5-dioxopentanoic acid to 1,4-butanediol comprises an enzyme that converts succinaldehyde to 1,4-butanediol.

Embodiment 37. The recombinant cell of Embodiment 36 wherein the enzyme that converts succinaldehyde to 1,4-butanediol comprises an alcohol dehydrogenase.

Embodiment 38. The recombinant cell of Embodiment 36 or Embodiment 37 wherein the enzyme that converts succinaldehyde to 1,4-butanediol comprises YqhD, ADH6, YjgB, or YahK.

Embodiment 39. The recombinant cell of Embodiment 32 wherein the engineered metabolic pathway for converting 2,5-dioxopentanoic acid to 1,4-butanediol comprises an enzyme that converts 2,5-dioxopentonoic acid into 2-keto-5-hydroxy-pentanoic acid.

Embodiment 40. The recombinant cell of Embodiment 39 wherein the enzyme that converts 2,5-dioxopentonoic acid into 2-keto-5-hydroxy-pentanoic acid comprises an alcohol dehydrogenase.

Embodiment 41. The recombinant cell of Embodiment 39 or Embodiment 40 wherein the enzyme that converts 2,5-dioxopentonoic acid into 2-keto-5-hydroxy-pentanoic acid comprises YqhD, ADH6, YjgB, or YahK.

Embodiment 42. The recombinant cell of any one of Embodiments 39-41 wherein the engineered metabolic pathway for converting 2,5-dioxopentanoic acid to 1,4-butanediol comprises an enzyme that converts 2-keto-5-hydroxy-pentanoic acid to 4-hydroxy-1-butyraldehyde.

Embodiment 43. The recombinant cell of Embodiment 42 wherein the enzyme that converts 2-keto-5-hydroxy-pentanoic acid to 4-hydroxy-1-butyraldehyde comprises a 2-ketoacid decareboxylase or a 2-oxoglutarate decarboxylase.

Embodiment 44. The recombainant cell of Embodiment 42 or Embodiment 43 wherein the enzyme that converts 2-keto-5-hydroxy-pentanoic acid to 4-hydroxy-1-butyraldehyde comprises Kivd, BFD, or IPDC.

Embodiment 45. The recombinant cell of any one of Embodiments 42-44 wherein the engineered metabolic pathway for converting 2,5-dioxopentanoic acid to 1,4-butanediol comprises an enzyme that converts 4-hydroxy-1-butyraldehyde to 1,4-butanediol.

Embodiment 46. The recombinant cell of Embodiment 45 wherein the enzyme that converts 4-hydroxy-1-butyraldehyde to 1,4-butanediol comprises an alcohol dehydrogenase.

Embodiment 47. The recombinant cell of Embodiment 45 or Embodiment 46 wherein the enzyme that converts 4-hydroxy-1-butyraldehyde to 1,4-butanediol comprises YqhD, ADH6, YjgB, or YahK.

Embodiment 48. The recombinant cell of any preceding Embodiment comprising an engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid.

Embodiment 49. The recombinant cell of Embodiment 48 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-arabinose into D-arabinolactone.

Embodiment 50. The recombinant cell of Embodiment 49 wherein the enzyme that can convert D-arabinose into D-arabinolactone comprises a pentose dehydrogenase.

Embodiment 51. The recombinant cell of Embodiment 49 or Embodiment 50 wherein the enzyme that can convert D-arabinose into D-arabinonolactone comprises AraDH.

Embodiment 52. The recombinant cell of any one of Embodiments 49-51 wherein the recombinant cell exhibits conversion of D-arabinose into D-arabinonolactone at a level at least 110% of a wild-type control cell.

Embodiment 53. The recombinant cell of any one of Embodiments 49-52 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-arabononic acid to 2-oxo-4(s),5-dihydroxy-pentanoic acid.

Embodiment 54. The recombinant cell of Embodiment 53 wherein the enzyme that converts D-arabononic acid to 2-oxo-4(s),5-dihydroxy-pentanoic acid comprises an aldonic acid dehydratase.

Embodiment 55. The recombinant cell of Embodiment 53 or Embodiment 54 wherein the enzyme that converts D-arabononic acid to 2-oxo-4(s),5-dihydroxy-pentanoic acid comprises AraD.

Embodiment 56. The recombinant cell of any one of Embodiments 53-55 wherein the recombinant cell exhibits conversion of D-arabononic acid to 2-oxo-4(s),5-dihydroxy-pentanoic acid at a level at least 110% of a wild-type control cell.

Embodiment 57. The recombinant cell of any one of Embodiments 49-56 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 2-oxo-4(s),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid.

Embodiment 58. The recombinant cell of Embodiment 57 wherein the enzyme that converts 2-oxo-4(s),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid comprises a 2-keto-3-deoxyaldonic acid dehydratase.

Embodiment 59. The recombinant cell of Embodiment 57 or Embodiment 58 wherein the enzyme that converts 2-oxo-4(s),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid comprises KdaD.

Embodiment 60. The recombinant cell of any one of Embodiments 57-59 wherein the recombinant cell exhibits conversion of 2-oxo-4(s),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid at a level at least 110% of a wild-type control cell.

Embodiment 61. The recombinant cell of Embodiment 48 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-xylose to D-xylonolactone.

Embodiment 62. The recombinant cell of Embodiment 61 wherein the enzyme that converts D-xylose to D-xylonolactone comprises a pentose dehydrogenase.

Embodiment 63. The recombinant cell of Embodiment 61 or Embodiment 62 wherein enzyme that converts D-xylose to D-xylonolactone comprises XylB or rrnAC3034.

Embodiment 64. The recombinant cell of any one of Embodiments 61-63 wherein the recombinant cell exhibits conversion of D-xylose to D-xylonolactone at a level at least 110% of a wild-type control.

Embodiment 65. The recombinant cell of any one of Embodiments 61-64 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-xylonolactone to D-xylonic acid.

Embodiment 66. The recombinant cell of Embodiment 65 wherein the enzyme that converts D-xylonolactone to D-xylonic acid comprises a pentonolactonase.

Embodiment 67. The recombinant cell of Embodiment 65 or Embodiment 66 wherein the enzyme that converts D-xylonolactone to D-xylonic acid comprises XylC or rrnAC3033.

Embodiment 68. The recombinant cell of any one of Embodiments 65-67 wherein the recombinant cell exhibits conversion of D-xylonolactone to D-xylonic acid at a level at least 110% of a wild-type control.

Embodiment 69. The recombinant cell of any one of Embodiments 61-68 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-xylonic acid to 2-oxo-4(S),5-dihydroxy-pentanoic acid.

Embodiment 70. The recombinant cell of Embodiment 69 wherein the enzyme that converts D-xylonic acid to 2-oxo-4(S),5-dihydroxy-pentanoic acid comprises an aldonic acid dehydratase.

Embodiment 71. The recombinant cell of Embodiment 69 or Embodiment 70 wherein the enzyme that converts D-xylonic acid to 2-oxo-4(S),5-dihydroxy-pentanoic acid comprises XylD or rrnAC3032.

Embodiment 72. The recombinant cell of any one of Embodiments 69-71 wherein the recombinant cell exhibits conversion of D-xylonic acid to 2-oxo-4(S),5-dihydroxy-pentanoic acid at a level at least 110% of a wild-type control.

Embodiment 73. The recombinant cell of any one of Embodiments 61-72 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopenatnoic acid.

Embodiment 74. The recombinant cell of Embodiment 73 wherein the enzyme that converts 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopenatnoic acid comprises a 2-keto-3-deoxyaldonic acid dehydratase.

Embodiment 75. The recombinant cell of Embodiment 73 or Embodiment 74 wherein the enzyme that converts 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopenatnoic acid comprises XylX or rrnAC3039.

Embodiment 76. The recombinant cell of any one of Embodiments 73-75 wherein the recombinant cell exhibits conversion of 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopenatnoic acid at a level at least 110% of a wild-type control.

Embodiment 77. The recombinant cell of Embodiment 48 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts L-arabinose to L-arabinolactone.

Embodiment 78. The recombinant cell of Embodiment 77 wherein the enzyme that converts L-arabinose to L-arabinolactone comprises a pentose dehydrogenase.

Embodiment 79. The recombinant cell of Embodiment 77 or Embodiment 78 wherein the enzyme that converts L-arabinose to L-arabinolactone comprises AraE.

Embodiment 80. The recombinant cell of any one of Embodiments 77-79 wherein the recombinant cell exhibits conversion of L-arabinose to L-arabinolactone at a level at least 110% of a wild-type control.

Embodiment 81. The recombinant cell of any one of Embodiments 77-80 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts L-arabinolactone to L-arabinonic acid.

Embodiment 82. The recombinant cell of Embodiment 81 wherein the enzyme that converts L-arabinolactone to L-arabinonic acid comprises a pentonolactonase.

Embodiment 83. The recombinant cell of Embodiment 81 or Embodiment 82 wherein the enzyme that converts L-arabinolactone to L-arabinonic acid comprises AraI.

Embodiment 84. The recombinant cell of any one of Embodiments 81-83 wherein the recombinant cell exhibits conversion of L-arabinolactone to L-arabinonic acid at a level at least 110% of a wild-type control.

Embodiment 85. The recombinant cell of any one of Embodiments 77-84 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts L-arabinonic acid to 2-oxo-4(R),5-dihydroxy-pentanoic acid.

Embodiment 86. The recombinant cell of Embodiment 85 wherein the enzyme that converts L-arabinonic acid to 2-oxo-4(R),5-dihydroxy-pentanoic acid comprises an aldonic acid dehydratase.

Embodiment 87. The recombinant cell of Embodiment 85 or Embodiment 86 wherein the enzyme that converts L-arabinonic acid to 2-oxo-4(R),5-dihydroxy-pentanoic acid comprises AraB.

Embodiment 88. The recombinant cell of any one of Embodiments 81-87 wherein the recombinant cell exhibits conversion of L-arabinonic acid to 2-oxo-4(R),5-dihydroxy-pentanoic acid at a level at least 110% of a wild-type control.

Embodiment 89. The recombinant cell of any one of Embodiments 77-88 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 2-oxo-4(R),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid.

Embodiment 90. The recombinant cell of Embodiments 89 wherein the enzyme that converts 2-oxo-4(R),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid comprises a 2-keto-3-deoxyaldonic acid dehydratase.

Embodiment 91. The recombinant cell of Embodiments 89 wherein the enzyme that converts 2-oxo-4(R),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid comprises AraD.

Embodiment 92. The recombinant cell of any one of Embodiments 89-90 wherein the recombinant cell exhibits conversion of 2-oxo-4(R),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid at a level at least 110% of a wild-type control.

Embodiment 93. The recombinant cell of Embodiment 48 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-glucaric acid to 4-deoxy-5-keto-D-glucaric acid.

Embodiment 94. The recombinant cell of Embodiment 93 wherein the enzyme that converts D-glucaric acid to 4-deoxy-5-keto-D-glucaric acid comprises an aldonic acid dehydratase.

Embodiment 95. The recombinant cell of Embodiment 93 or Embodiment 94 wherein the enzyme that converts D-glucaric acid to 4-deoxy-5-keto-D-glucaric acid comprises YcbF.

Embodiment 96. The recombinant cell of any one of Embodiments 93-95 wherein the recombinant cell exhibits conversion of D-glucaric acid to 4-deoxy-5-keto-D-glucaric acid at a level at least 110% of a wild-type control.

Embodiment 97. The recombinant cell of any one of Embodiments 93-96 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid.

Embodiment 98. The recombinant cell of Embodiment 97 wherein the enzyme that converts 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid comprises a 2-keto-3-deoxyaldonic acid dehydratase.

Embodiment 99. The recombinant cell of Embodiment 97 or Embodiment 98 wherein the enzyme that converts 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid comprises YcbC.

Embodiment 100. The recombinant cell of Embodiment 48 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-galactaric acid to 4-deoxy-5-keto-D-glucaric acid.

Embodiment 101. The recombinant cell of Embodiment 100 wherein the enzyme that converts D-galactaric acid to 4-deoxy-5-keto-D-glucaric acid comprises an aldonic acid dehydratase.

Embodiment 102. The recombinant cell of Embodiment 100 or Embodiment 101 wherein the enzyme that converts D-galactaric acid to 4-deoxy-5-keto-D-glucaric acid comprises YcbH.

Embodiment 103. The recombinant cell of any one of Embodiments 100-102 wherein the recombinant cell exhibits conversion of D-galactaric acid to 4-deoxy-5-keto-D-glucaric acid at a level at least 110% of a wild-type control.

Embodiment 104. The recombinant cell of any one of Embodiments 100-103 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid.

Embodiment 105. The recombinant cell of Embodiment 104 wherein the enzyme that converts 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid comprises a 2-keto-3-deoxyaldonic acid dehydratase.

Embodiment 106. The recombinant cell of Embodiment 104 or Embodiment 105 wherein the enzyme that converts 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid comprises YcbC.

Embodiment 107. The recombinant cell of Embodiment 48 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 4(R)-hydroxy-L-proline to 4(R)-hydroxy-D-proline.

Embodiment 108. The recombinant cell of Embodiment 107 wherein the enzyme that converts 4(R)-hydroxy-L-proline to 4(R)-hydroxy-D-proline comprises an amino acid transporter.

Embodiment 109. The recombinant cell of Embodiment 107 or Embodiment 108 wherein the enzyme that converts 4(R)-hydroxy-L-proline to 4(R)-hydroxy-D-proline comprises LysE or HypE.

Embodiment 110. The recombinant cell of any one of Embodiments 107-109 wherein the recombinant cell exhibits conversion of 4(R)-hydroxy-L-proline to 4(R)-hydroxy-D-proline at a level at least 110% of a wild-type control.

Embodiment 111. The recombinant cell of any one of Embodiments 107-110 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 4(R)-hydroxy-D-proline to 2-carboxy-4(R)-hydroxy-δ-pyrroline.

Embodiment 112. The recombinant cell of Embodiment 111 wherein the enzyme that converts 4(R)-hydroxy-D-proline to 2-carboxy-4(R)-hydroxy-δ-pyrroline comprises HypOX.

Embodiment 113. The recombinant cell of Embodiment 111 or Embodiment 112 wherein the recombinant cell exhibits conversion of 4(R)-hydroxy-D-proline to 2-carboxy-4(R)-hydroxy-δ-pyrroline at a level at least 110% of a wild-type control.

Embodiment 114. The recombinant cell of any one of Embodiments 107-113 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 2-oxo-4(R),5-hydroxy-5-aminopentanoic acid to 2,5-dioxopentanoic acid.

Embodiment 115. The recombinant cell of Embodiment 114 wherein the enzyme that converts 2-oxo-4(R),5-hydroxy-5-aminopentanoic acid to 2,5-dioxopentanoic acid comprises a 2-keto-3-deoxyaldonic acid dehydratase.

Embodiment 116. The recombinant cell of Embodiment 114 or Embodiment 115 wherein the enzyme that converts 2-oxo-4(R),5-hydroxy-5-aminopentanoic acid to 2,5-dioxopentanoic acid comprises PP1247.

Embodiment 117. The recombinant cell of any one of Embodiments 114-116 wherein the recombinant cell exhibits conversion of 2-oxo-4(R),5-hydroxy-5-aminopentanoic acid to 2,5-dioxopentanoic acid at a level at least 110% of a wild-type control.

Embodiment 118. The recombinant cell of any one of Embodiments 48-117 modified to exhibit increased α-ketoglutaric semialdehyde dehydrogenase activity compared to a wild-type control.

Embodiment 119. The recombinant cell of Embodiment 118 exhibiting increased conversion of 2,5-dioxopentanoic acid to a TCA derivative compared to a wild-type control.

Embodiment 120. The recombinant cell of Embodiment 119 wherein the TCA derivative comprises succinate, fumarate, malate, glutamate, lysine, threonine, or 4-hydroxybutyrate.

Embodiment 121. The recombinant cell of any preceding Embodiment genetically modified to increase consumption of xylose, arabinose, glucaric acid, galactaric acid, or hydroxyproline compared to a wild-type control.

Embodiment 122. The recombinant cell of any preceding Embodiment genetically modified to in crease consumption of a uronic acid compared to a wild-type control.

Embodiment 123. The recombinant cell of Embodiment 122 wherein the urnic acid comprises galacturonic acid or glucuronic acid.

Embodiment 124. The recombinant cell of Embodiment 122 or Embodiment 123 genetically modified to increase conversion of the uronic acid to an aldonic acid compared to a wild-type control.

Embodiment 125. The recombinant cell of any one of Embodiments 122-124 wherein the recombinant cell comprises an exogenous urinate dehydrogenase.

Embodiment 126. A method comprising:

incubating a recombinant cell of any preceding Embodiment in medium that comprises a carbon source under conditions effective for the recombinant cell to produce a TCA derivative.

Embodiment 127. The method of Embodiment 126 wherein the TCA derivative comprises 1,4-butanediol.

Embodiment 128. The method of Embodiment 126 wherein the carbon source comprises xylose, arabinose, glucaric acid, galactaric acid, or hydroxyproline.

Embodiment 129. The method of any one of Embodiments 126-128 wherein the increased biosynthesis of the TCA derivative comprises an increase in pentose dehydrogenase activity, pentonolactonase activity, aldonic acid dehydratase activity, or 2-keto-3-deoxyaldonic acid dehydratase activity.

Embodiment 130. The method of any one of Embodiments 126-129 wherein the increased biosynthesis of the TCA derivative comprises an increase in hexic acid dehydratase activity or 5-dehydro-4-deoxyglucarate dehydratase activity.

Embodiment 131. A method comprising:

introducing into a host cell a heterologous polynucleotide encoding at least one polypeptide that catalyzes conversion of a carbon source to a TCA derivative, wherein the at least one polypeptide is operably linked to a promoter so that the modified host cell catalyzes conversion of the carbon source to TCA derivative.

Embodiment 132. The method of Embodiment 131 wherein the TCA derivative comprises 1,4-butanediol.

Embodiment 133. The method of Embodiment 131 wherein the carbon source comprises xylose.

Embodiment 134. The method of Embodiment 131 wherein the TCA derivative comprises succinate, fumarate, malate, glutamate, lysine, threonine, 4-hydroxybutyrate.

The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference in their entirety. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.

Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about.” Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.

All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.

Sequence Listing Free Text D-arabinose dehydrogenase (AraDH) (NP_342747.1; GI: 15898142; Zinc-containing alcohol dehydrogenase (Sulfolobus solfataricus P2)) SEQ ID NO: 1   1 menvnmvksk aallkkfsep lsiedvnipe pqgeevliri ggagvcrtdl rvwkgveakq  61 gfrlpiilgh enagtivevg elakvkkgdn vvvyatwgdl tcrycregkf nicknqiipg 121 qttnggfsey mlvkssrwlv klnslspvea apladagtts mgairqalpf iskfaepvvi 181 vngigglavy tiqilkalmk nitivgisrs kkhrdfalel gadyvsemkd aeslinkltd 241 glgasiaidl vgteettynl gkllaqegai ilvgmegkrv sleafdtavw nkkllgsnyg 301 slndledvvr lsesgkikpy iikvplddin kaftnldegr vdgrqvit (Chain A, D-arabinose dehydrogenase (Sulfolobus solfataricus)) SEQ ID NO: 2   1 mvkskaallk kfseplsied vnipepqgee vliriggagv crtdlrvwkg veakqgfrlp  61 iilghenagt ivevgelakv kkgdnvvvya twgdltcryc regkfnickn qiipgqttng 121 gfseymlvks srwlvklnsl spveaaplad agttsmgair qalpfiskfa epvvivngig 181 glavytiqil kalmknitiv gisrskkhrd falelgadyv semkdaesli nkltdglgas 241 iaidlvgtee ttynlgklla qegaiilvgm egkrvsleaf dtavwnkkll gsnygslndl 301 edvvrlsesg kikpyiikvp lddinkaftn ldegrvdgrq vitp (Alcohol dehydrogenase GroES domain-containing protein (Sulfolobus islandicus M.14.25)) SEQ ID NO: 3   1 mfgitfysam rknismvksk aallkkfsep lsiedveipe pkgeevlvri ggagvcrtdl  61 rvwkgveakq gfrlpiilgh enagtvvevg elakakkgdn vvvyatwgdm tcrycregkf 121 nicknqvipg qttnggfsey mlvksyrwlv kldslspvda spladagtts mgairqalpf 181 mnkfaepvvi vngigglavy tiqilkalmk nivivgisrs kkhrdlalel gadyavemke 241 aesliskltd glgasvaidl vgteetsynl gkllaqegai ilvgmegkrv sleafdtavw 301 nkkllgsnyg slndledvvr lsesgkikpy vvkipldein kafkdldegr vegrqvitp (Alcohol dehydrogenase GroES domain-containing protein (Sulfolobus islandicus M.16.27)) SEQ ID NO: 4   1 mfgitfysam rknismvksk aallkkfsep lsiedveipe pkgeevlvri ggagvcrtdl  61 rvwkgveakq gfrlpiilgh enagtvvevg elakakkgdn vvvyatwgdm tcrycregkf 121 nicknqvipg qttnggfsey mlvksyrwlv kldslspvda spladagtts mgairqalpf 181 mnkfaepvvi vngigglavy tiqilkalmk nivivgisrs rkhrdlalel gadyavemke 241 aesliskltd glgasvaidl vgteetsynl gkllagegai ilvgmegkrv sleafdtavw 301 nkkllgsnyg slndledvvr lsesgkikpy vvkipldein kafkdldegr vegrqvitp (Alcohol dehydrogenase GroES domain-containing protein (Sulfolobus islandicus L.S.2,15)) SEQ ID NO: 5   1 mfgitfysam rknismvksk aallkkfsep lsiedveipe pkgeevlvri ggagvcrtdl  61 rvwkgveakq gfrlpiilgh enagtvvevg elakakkgdn vvvyatwgdm tcrycregkf 121 nicknqvipg qttnggfsey mlvksyrwlv kldslspvda spladagtts mgairqalpf 181 mnkfaepvvi vngigglavy tiqilkalmk nivivgisrs kkhrdlalel gadhavemke 241 aesliskltd glgasvaidl vgteetsynl gkllaqegai ilvgmegkrv sleafdtavw 301 nkkllgsnyg slndledvvr lsesgkikpy vvkipldein kafkdldegr vegrqvitp Arabinonate dehydratase (AraD) (NP_344435.1; GI: 15899830; Mandelate racemase/muconate lactonizing family protein (Sulfolobus solfataricus P2)) SEQ ID NO: 6   1 mikdirtykl cyeginderd alaikglaeh pmeivateie tsdgyvgyge slaygcsdav  61 qvtiekilkp lllkedeeli eylwdkmyka tlrfgrrgia iagisgvdta lwdimgkkak 121 kpiykllggs krkvrayitg gyysekkdle klrdeeayyv kmgfkgikvk igaksmeedi 181 erlkairevv gedvkiavda nnvytfeeal emgrrleklg iwffeepiqt dyldlsarla 241 eelevpiagy etaytrwefy eimrkravdi vqtdvmwtgg isemmkignm akvmgyplip 301 hysaggisli gnlhvaaaln spwiemhlrk ndlrdkifke sieidnghlv vpdrpglgyt 361 irdgvfeeyk cks (Mandelate racemase/muconate lactonizing protein (Sulfolobus islandicus Y.G.57.14)) SEQ ID NO: 7   1 mikdirtykl cyeginderd alaikglaeh pmeivvteie tsdgyvgyge slaygcsdav  61 qvtiekilkp lllkedeeli eylwdkmyka tlrfgrrgia iagisgvdta lwdimgkkak 121 kpiykllggs krkvrayitg gyysekkdle klrdeeayyv kmgfkgikvk igaksmeedi 181 erlkairevv gedvkiavda nnvytfeeal emgrrleklg iwffeepiqt dyldlsarla 241 eelevpiagy etaytrwefy eimrkravdi vqtdvmwtgg isemmkignm akvmgyplip 301 hysaggisli gnlhvaaaln spwiemhlrk ndlrdkifke sieidnghlv vpdrpglgyt 361 irdgvfeeyk cks (Mandelate racemase/muconate lactonizing domain-containing protein (Sulfolobus islandicus L.D.8.5)) SEQ ID NO: 8   1 mikdirtykl cyeginderd alaikglaeh pmeivvteie tsdgyvgyge slaygcsdav  61 qvtiekilkp lllkedeefi eylwdkmyka tlrfgrrgia iagisgvdta lwdimgkkak 121 kpiykllggs krkvrayitg gyysekkdle klrdeeayyv kmgfkgikvk igaksmeedi 181 erlkairevv gedvkiavda nnvytfeeal emgrrleklg iwffeepiqt dyldlsarla 241 eelevpiagy etaytrwefy eimrkravdi vqtdvmwtgg isemmkignm akvmgyslip 301 hysaggisli gnlhvaaaln spwiemhlrk ndlrdkifke sieidnghlv vpdrpglgyt 361 irdgvfeeyk cks (Mandelate racemase/muconate lactonizing protein (Sulfolobus islandicus M.14.25)) SEQ ID NO: 9   1 mikdirtykl cyeginderd alaikglaeh pmeivvteie tsdgyvgyge slaygcsdav  61 qvtiekilkp lllkedeeli eylwdkmyka tlrfgrrgia iagisgvdtg lwdimgkkak 121 kpiykllggs krkvrayitg gyysekkdle klrdeeayyv kmgfkgikvk igaksmeedi 181 erlkairevv gedvkiavda nnvytfeeal emgrrleklg iwffeepiqt dyldlsarla 241 eelevpiagy etaytrwefy eimrkravdi vqtdvmwtgg isemmkignm akvmgyplip 301 hysaggisli gnlhvaaaln spwiemhlrk ndlrdkifke sieidnghlv vpdrpglgyt 361 irdgvfeeyk cks (Mandelate racemase/muconate lactonizing protein (Sulfolobus islandicus L.S.2.15)) SEQ ID NO: 10   1 mikdirtykl cyeginderd alaikglaeh pmeivvteie tsdgyvgyge slaygcsdav  61 qvtiekilkp lllkedeeli eylwdkmyka tlrfgrrgia iagisgvdta lwdimgkkak 121 kpiykllggs krkvrayitg gyysekkdle klrdeeayyv kmgfkgikik igaksmeedi 181 erlkairevv gedvkiavda nnvytfeeal emgrrleklg iwffeepiqt dyldlsarla 241 eelevpiagy etaytrwefy eimrkravdi vqtdvmwtgg isemmkignm akvmgyplip 301 hysaggisli gnlhvaaaln spwiemhlrk ndlrdkifke sieidnghlv vpdrpglgyt 361 irdgvfeeyk cks 2-Keto-3-deoxy-D-arabinonate Dehydratase (KdaD) (NP_344431.1; GI: 15899826; Hypothetical protein SSO3118  (Sulfolobussolfataricus P2) SEQ ID NO: 11   1 mhfimmklfr vvkrgyyisy aildnstiir ldedpikalm rysenkevlg drvtgidyqs  61 llksfqindi ritkpidppe vwgsgisyem areryseenv akilgktiye kvydavrpei 121 ffkatpnrcv ghgeaiavrs dsewtlpepe lavvldsngk ilgytimddv sardleaenp 181 lylpqskiya gccafgpviv tsdeiknpys lditlkivre grvffegsvn tnkmrrkiee 241 gigylirdnp ipdgtilttg taivpgrdkg lkdediveit isnigtlitp vkkrrkit (Fumarylacetoacetate (FAA) hydrolase (Sulfolobus islandicus Y.N.15.51)) SEQ ID NO: 12   1 mltcllptll yakcifimmk lfrvvkrgyy isyaildnst iirldedpik almrysenke  61 vlgdrvtgid yqsllksfqi ndiritkpid ppevwgsgis yemareryse envakilgkt 121 iyekvydavr peiffkatpn rcvghgeaia vrsdsewtlp epelavvlds ngkilgytim 181 ddvsardlea enplylpqsk iyagccafgp vivtsdeikn pyslditlki vregrvffeg 241 svntnkmrrk ieegigylir dnpipdgtil ttgtaivpgr dkglkdediv eitisnigtl 301 itpvkkrrki t (Fumarylacetoacetate (FAA) hydrolase (Sulfolobus solfataricus 98/2)) SEQ ID NO: 13   1 mmklfrvvkr gyyisyaild nstiirlded pikalmryse nkevlgdrvt gidyqsllks  61 fqindiritk pidppevwgs gisyemarer yseenvakil gktiyekvyd avrpeiffka 121 tpnrcvghge aiavrsdsew tlpepelavv ldsngkilgy timddvsard leaenplylp 181 qskiyagcca fgpvivtsde iknpysldit lkivregrvf fegsvntnkm rrkieegiqy 241 lirdnpipdg tilttgtaiv pgrdkglkde diveitisni gtlitpvkkr rkit (Chain X, 2-keto-3-deoxy4)-arabinonate dehydratase) SEQ ID NO: 14   1 mklfrvvkrg yyisyaildn stiirldedp ikalmrysen kevlgdrvtg idyqsllksf  61 qindiritkp idppevwgsg isyemarery seenvakilg ktiyekvyda vrpeiffkat 121 pnrcvghgea iavrsdsewt lpepelavvl dsngkilgyt imddvsardl eaenplylpq 181 skiyagccaf gpvivtsdei knpyslditl kivregrvff egsvntnkmr rkieeqiqyl 241 irdnpipdgt ilttgtaivp grdkglkded iveitisnig tlitpvkkrr kit (Fumarylacetoacetate (FAA) hydrolase (Sulfolobus islandicus HVE10/4)) SEQ ID NO: 15   1 mmklfrvvkr gyyisyaild nstiirlded pikalmryse nkevlgdrvt gidyqsllks  61 fqindiritk pidppevwgs gisyemarer yseenvakil gktiyekvyd avrpeiffka 121 tpnrcvghge aiavrsdsew tlpepelavv ldsngkilgy timddvsard leaenplylp 181 qskiyagcca fgpvivtsde iknpysldit lkivrkdrvf fegsvntnkm rrkieeqiqy 241 lirdnpipdg tilttgtaiv pgrdkglkde diveitisni gtlitpvkkr rkit 2,5-dioxopentanoate dehydrogenase (DopDH) (NP_344430.1; GI: 15899825; Aldehyde dehydrogenase (Sulfolobus solfataricus P2) SEQ ID NO: 16   1 mksyqgladk wikgsgeeyl dinpadkdhv lakirlytkd dvkeainkav akfdewsrtp  61 apkrgsillk agelmeqeaq efallmtlee gktlkdsmfe vtrsynllkf ygalafkisg 121 ktlpsadpnt riftvkeplg vvalitpwnf plsipvwkla palaagntav ikpatktplm 181 vaklvevlsk aglpegvvnl vvgkgsevgd tivsddniaa vsftgstevg kriyklvgnk 241 nrmtriqlel ggknalyvdk sadltlaael avrggfgltg qsctatsrli inkdvytqfk 301 qrllervkkw rvgpgtedvd mgpvvdegqf kkdleyieyg knvgakliyg gniipgkgyf 361 leptifegvt sdmrlfkeei fgpvlsvtea kdldeairlv navdyghtag ivasdikain 421 efvsrveagv ikvnkptvgl elqapfggfk nsgattwkem gedalefylk ektvyegw (Aldehyde dehydrogenase (Sulfolobus islandicus HVE10/4)) SEQ ID NO: 17   1 mksyqgladk wikgsgeeyl dinpadkdhv lakirlytkd dvkeainkav akfdewsrtp  61 apkrgsillk agelmeqeaq efallmtlee gktlkdsmfe vtrsynllkf ygalgfkisg 121 ktlpsadpnt riftvkeplg vvalitpwnf plsipvwkla palaagntav ikpatktplm 181 vaklvevlsk aglpegvvnl vvgkgsevgd tivsddniaa vsftgstevg kriyklvgnk 241 nrmtriqlel ggknalyvdk sadltlaael avrggfgltg qsctatsrli ihkdvytqfk 301 qrllervkkw rvgpgtedvd mgpvvdegqf kkdleyieyg knagakliyg gniipgkgyf 361 leptifegvt shmrlfkeei fgpvlsvtea kdldeairlv navdyghtag ivasdikain 421 efvsrveagv ikvnkptvgl elqapfggfk nsgattwkem gedalefylk ektvyegw (Aldehyde dehydrogenase (Sulfolobus islandicus Y.G.57.14)) SEQ ID NO: 18   1 mksyqgladk wikgsgeeyl dinpadkdhv lakirlytkd dvkeainkav akfdewsrtp  61 apkrgsillk agelmeqeaq efallmtlee gktlkdsmfe vtrsynllkf ygalafkisg 121 ktlpsadpnt riftvkeplg vvalitpwnf plsipvwkla palaagntav ikpatktplm 181 vaklvevlsk aglpegvvnl vvgkgsevgd tivsddniaa vsftgstevg kriyklvgnk 241 nrmtriqlel ggknalyvdk sadltlaael avrggfgltg qsctatsrli inkdvytqfk 301 qrllervkkw rvgpgtedvd mgpvvdegqf kkdleyieyg knvgakliyg gniipgkgyf 361 leptifegvt sdmrlfkeei fgpvlsvtea kdldeairlv navdyghtag ivasdinain 421 efvsrveagv ikvnkptvgl elqapfggfk nsgattwkem gedalefylk ektvyegw (Aldehyde dehydrogenase (Sulfolobus islandicus Y.N.15.51)) SEQ ID NO: 19   1 mksyqgladk wikgsgeeyl dinpadkdhv lakirlytkd dvkeainkav akfdewsrtp  61 apkrgsillk agelmeqeaq efallmtlee gktlkdsmfe vtrsynllkf ygalafkisg 121 ktlpsadpnt riftvkeplg vvalitpwnf plsipvwkla palaagntai ikpatktplm 181 vaklvevlsk aglpegvvnl vvgkgsevgd tivsddniaa vsftgstevg kriyklvgnk 241 nrmtriqlel ggknalyvdk sadltlaael avrggfgltg qsctatsrli inkdvytqfk 301 qrllervkkw rvgpgtedvd mgpvvdegqf kkdleyieyg knvgakliyg gniipgkgyf 361 leptifegvt sdmrlfkeei fgpvlsvtea kdldeairlv navdyghtag ivasdikain 421 efvsrveagv ikvnkptvgl elqapfggfk nsgattwkem gedalefylk ektvyegw (Aldehyde dehydrogenase (Sulfolobus islandicus L.S.2.15)) SEQ ID NO: 20   1 mksyqgladk wikgsgeeyl dinpadkdhv lakirlytkd dvkeainkav akfdewsrtp  61 apkrgsillk agelmeqeaq efallmtlee gktlkdsmfe vtrsynllkf ygalafkisg 121 ktlpsadpnt riftvkeplg vvalitpwnf plsipvwkla palaagntav ikpatktplm 181 vaklvevlsk aglpegvvnl vvgkgsevgd tivsddniaa vsftgstevg kriyklvgnk 241 nrmtriqlel ggknalyvdk sadltlaael airggfgltg qsctatsrli inkdvytqfk 301 qrllervkkw rvgpgtedvd mgpvvdegqf kkdleyieyg knvgakliyg gniipgkgyf 361 leptifegvt sdmrlfkeei fgpvlsvtea kdldeairlv navdyghtag ivasdikain 421 efvsrveagv ikvnkptvgl elqapfggfk nsgattwkem gedalefylk ektvyegw 2,5-dioxovalerate dehydrogenase (YcbD) (NP_388129.1; GI: 16077316; 2,5-dioxovalerate dehydrogenase  (Bacillussubtilis subsp. subtilis str. 168)) SEQ ID NO: 21   1 msviteqnty lnfingewvk sqsgdmvkve npadvndivg yvqnstaedv eravtaanea  61 ktawrkltga ergqylykta dimeqrleei aacatremgk tlpeakgeta rgiailryya 121 gegmrktgdv ipstdkdalm fttrvplgvv gvispwnfpv aipiwkmapa lvygntvvik 181 patetavtca kiiacfeeag lpagvinlvt gpgsvvgqgl aehdgvnavt ftgsnqvgki 241 igqaalarga kyqlemggkn pvivaddadl eaaaeavitg afrstgqkct atsrvivqsg 301 iyerfkekll qrtkditigd slkedvwmgp iasknqldnc lsyiekgkqe gaslliggek 361 lengkyqngy yvqpaifdnv tsemtiaqee ifgpvialik vdsieealni andvkfglsa 421 siftenigrm lsfideidag lvrinaesag velqapfggm kgssshsreq geaakdffta 481 iktvfvkp (Aldehyde dehydrogenase, thermostable (Bacillus subtilis subsp. subtilis str. RO-NN-1)) SEQ ID NO: 22   1 msviteqnty lnfingewvk sqsgdmvkve npadvndivg yvqnstaedv eravaaanea  61 ktawrkltga ergqylykta dimeqrleei aacatremgk tlpeakgeta rgiailryya 121 gegmrktgdv ipstdkdalm fttrvplgvv gvispwnfpv aipiwkmapa lvygntvvik 181 patetavtca kiiacfeeag lpagvinlvt gpgsvvgqgl aehegvnavt ftgsnqvgki 241 igqaalarga kyqlemggkn pvivaddadl eaaaeavitg afrstgqkct atsraivqsg 301 iyerfkekll qrtkditigd slkedvwmgp iasknqldnc lsyiekgkqe gaslliggek 361 lengkyqngy yvqpaifdnv tsemtiaqee ifgpvialik vdsmeealni andvkfglsa 421 siftenigrm lsfideidag lvrinaesag velqapfggm kgssshsreq geaakdffta 481 iktvfvkp (Hypothetical protein BSNT_00439 (Bacillus subtilis subsp natto BEST195)) SEQ ID NO: 23   1 msviteqnty lnfikgewvk sqsgdmvkve npadvndivg yvqnstaedv eravaaanea  61 ktawrkltga ergqylykta dimeqrleei aacatremgk tlpeakgeta rgiailryya 121 gegmrktgdv ipstdkaalm fttrvplgvv gvispwnfpv aipiwkmapa lvygntvvik 181 patetavtca kiiacfeeag lpagvinlvt gpgsvvgqgl aehdgvnavt ftgsnqvgki 241 igqaalarga kyqlemggkn pvivaddadl eaaaeavitg afrstgqkct atsrvivqse 301 iyerfkekll qrtkditigd slkedvwmgp iasknqldnc lsyiekgkqe gaslliggek 361 lengkyqngy yvqpaifdnv tsemtiaqee ifgpvialik vdsmeealni andvkfglsa 421 siftenigrm lsfideidag lvrinaesag velqapfggm kgssshsreq geaakdffta 481 iktvfvkp (Aldehyde dehydrogenase (Bacillus subtilis subsp. spizizenii TU-B-10)) SEQ ID NO: 24   1 msviteqnty lnfingewvk sqsgdmvkve npadvndivg yvqnstaddv eravaaanea  61 ktawrkltga ergqylykta dimeqrleei aacatremgk tlpeakgeta rgiailryya 121 gegmrktgdv ipstdkdalm fttrvplgvv gvispwnfpv aipiwkmapa lvygntvvik 181 patetavtca kiiacfeeag lpagvinlvt gpgsvvgqgl aehegvnait ftgsnqvgki 241 igqaalarga kyqlemggkn pvivaddadl eaaaeavitg afrstgqkct atsrvivqsg 301 iydrfkekll qrtkdikigd slkedvwmgp iasknqldnc lsyiekgkqe gaslliggek 361 ledgkyqngy yvqpaifdnv tsemtiaqee ifgpvialik vdsmeealdi andvkfglsa 421 siftqnigrm lsfvdeidag lvrinaesag velqapfggm kqssshsreq geaakdffta 481 iktvfvkp (Aldehyde dehydrogenase (Bacillus sp. JS)) SEQ ID NO: 25   1 msviteqnty lnfingewvq sqsgdmvkve npadvndivg yvqnstaedv eravaaanka  61 ktawrkltga ergqylykta dimerrleei aacatremgk tlpeakgeta rgiailryya 121 gegmrktgdv ipstdkdalm fttrvplgvv gvispwnfpv aipiwkmapa lvygntvvik 181 patetavtca kiiacfeeag lpagvinlvt gpgsvvgqgl aehdsvnavt ftgsnqvgki 241 igqaalarga kyqlemggkn pvivaddadl eaaaeavitg afrstgqkct atsrvivqsg 301 iyerfkekll qrtkditigd slkedvwmgp iasknqldnc lsyiekgkre gasllmggek 361 lenekyqngy yvqpaifdnv tsemtiaqee ifgpvialik vdsmeealdi andvkfglsa 421 siftenigkm lsfideidag lvrvnaesag velqapfggm kgssshsreq geaakdffta 481 iktvfvkp Xylose dehydrogenase (xylB) (YP_002516237.1; GI: 221233801; Xylose dehydrogenase xylB (Caulobacter crescentus NA1000)) SEQ ID NO: 26   1 mssaiypslk gkrvvitggg sgigagltag farqgaevif ldiadedsra leaelagspi  61 ppvykrcdlm nleaikavfa eigdvdvlvn nagnddrhkl advtgaywde rinvnlrhml 121 fctqavapgm kkrgggavin fgsiswhlgl edlvlyetak agiegmtral arelgpddir 181 vtcvvpgnvk tkrqekwytp egeaqivaaq clkgrivpen vaalvlflas ddaslctghe 241 ywidagwr (Oxidoreductase, short-chain dehydrogenase/reductase (Phenylobacterium zucineum HLK1)) SEQ ID NO: 27   1 mgvtsaiyps lkgkrvvvtg ggsgigaglv eafvrqgaev hfldvletes rvletslaga  61 evppvfhrcd ltdagaiegc fakigpvqvl vnnagnddrh tldevtpayf ddriavnlrh 121 mvfcakavvp amkaagegai infgsiswhl glpdlvlyet akagiegmtr alarelgpfg 181 irvtcvapgn vktlrqmkwy tpegeaeiva qqclksriep advaalvlfl asddarmctg 241 heywidagwr (Dehydrogenase of unknown specificity, short-chain alcohol dehydrogenase (Caulobacter sp. AP07)) SEQ ID NO: 28   1 mssaiypslq gkrvvvtggg sgigagivaa farqgaevif ldvvdadsea laaklsdspi  61 aptymrcdlt dleamaetfa rigpidvlvn nagnddrhgl aeitpaywdq rmavnlrhml 121 fatqavapgm kargggavin fgsiswhlgl pdlvlyetak agiegmtral arelgpddir 181 vtcvvpgnvk tkrqekwytp egeaeivaaq alkgrlvpdh vaslvlflas ddaalctghe 241 ywidagwr (Short-chain dehydrogenase/reductase SDR (Caulobacter sp. K31)) SEQ ID NO: 29   1 mnievkrpqv stssaiypsl kgkrvvvtgg gsgigagiva gfarqgsevi fldvadqdsk  61 alaeqlsgae iapvylrcdl tdldavaktf adigpvdvlv nnagnddrhg laqitpaywd 121 ermsvnlrhm lfatqavapg mkargggaii nfgsiswhlg lpdlvlyeta kagiegmtra 181 larelgpddi rvtcvvpgni ktkrqekwyt pegeaeivaa galkgrlvpd hvaslvmfla 241 sddaslctgh eywidagwr (Short-chain dehydrogenase/reductase SDR (Caulobacter segnis ATCC 21756)) SEQ ID NO: 30   1 mssaiypslk gkrvvitggg sgigaglvag fvrqgaevif ldivdadsqa lvaelskdav  61 iapvykrcdl mdidalkatf aeigdvdvlv nnagnddrhs ladltpaywd nrigvnlrhm 121 vfaaqavagg mkkrgggaii nfgsiswhlg ledlvlyeta kagiegmtra larelgpddi 181 rvtcvvpgnv ktkrqekwyt pegeaeivka gclkgrilpd hvaslvlfla sddaslctgh 241 eywidagwr Xylonolactonase (xylC) (YP_002516236.1; GI: 221233800; Xylonolactonase xylC (Caulobacter crescentus NA1000)) SEQ ID NO: 31   1 mtaqvtcvwd lkatlgegpi whgdtlwfvd ikqrkihnyh patgerfsfd apdqvtflap  61 ivgatgfvvg lktgihrfhp atgfslllev edaalnnrpn datvdaggrl wfgtmhdgee 121 nnsgslyrmd ltgvarmdrd icitngpcvs pdgktfyhtd tlektiyafd laedgllsnk 181 rvfvqfalgd dvypdgsvvd segylwtalw ggfgavrfsp qgdavtriel papnvtkpcf 241 ggpdlktlyf ttarkglsde tlaqyplagg vfavpvdvag qpqhevrlv (SMP-30/gluconolaconase/LRE domain-containing protein (Caulobacter segnis ATCC 21756)) SEQ ID NO: 32   1 mtaevtcvwd lkatlgegpi whgdalwfvd ikqrkihnyk pttgehfsfd apdqvtflap  61 iadaggfvvg lktgihrfhp itgfrlliev edsaldnrpn datvdangrl wfgtmhdgee 121 aksgslyrmd aegvarmdkd icitngpcvs pdgktfyhtd tlektvwayd laedgtlsnk 181 rafvhvklgd diypdgtvvd segclwialw ggfgvirvsp ageivgriev papnvtkvcf 241 ggpdlktlfl ttarkglsde tlaqyplagg lfaigvniag qpqhevrlv (Gluconolactonase (Cautobacter sp. AP07)) SEQ ID NO: 33   1 mpepicvwdl katlgegpiw iaaeqalwfv dikshkvhrf hpesgetksf dapdqvtfla  61 pragggfvag lksglhhfhp etgfaylgei epadlnnrpn datvdaegrl wfgtmhdgee 121 tptgalyrlg adgqpvqqdq gvcitngpcv spdgktfyht dtlekviway dlgadgelsn 181 krqffrleid dawpdgsvvd aegyvwaalw gghgairisp agelvdrvtl painvtkpcf 241 ggpdlktlyf ttarkglgde glaayplcgg vfalpvavag qpgyevrldl p (SMP-30/gluconolaconase/LRE domain-containing protein (Cautobacter sp. K31)) SEQ ID NO: 34   1 mpepicvwdl katlgegpiw saeeqavwfv dikghkvhrf hpasgatasf dapdqvtfla  61 phaggggfva glksglhrfd pttgafvfla qieppelnnr pndatvdaeg rlwfgtmhdg 121 emtptgalyr lsadgkpiqg degvcitngp caspdgktfy htdtlekviw aydlgadgsl 181 snkreffrle iadawpdgsv vdsegfvwta lwgghgalrl spageivdrv ilpainvtkp 241 cfggpdlktv yftsarkgls deqlaaypqc gglfalpvav agqpqyevrl dlr (Gluconolactonase (Phenylobacterium zucineum HLK1)) SEQ ID NO: 35   1 mkvlsepdcv lradaelgeg pvwradddav wfvdikgrri hryepvtgaa wswaapaqpg  61 fiapvagggw vaglktglhr feprggrfel itavedpsld nrindgfvda kgrlwfgsmh 121 dgetaltgal yrlderglqr cdtgycitng paaspdgrtl yhtdtlqkti yafdlspage 181 lsnkrvfari eegggypdgp avdaegcvwt glfagwhvrr yspkgellak vgfpvanitk 241 lafggddlts vyattawkgl saderekqpl agglfrfevd vpglpqnqma ha D-xylonate dehydratase (xylD) (NP_419636.1; GI: 16125072; Dihydroxy-acid dehydratase)Caulobacter crescentus CB15)) SEQ ID NO: 36   1 mrsalsnrtp rrfrsrdwfd npdhidmtal ylerfmnygi tpeelrsgkp iigiaqtgsd  61 ispcnrihld lvqrvrdgir daggipmefp vhpifencrr ptaaldrnls ylglvetlhg 121 ypidavvltt gcdkttpagi maattvnipa ivlsggpmld gwhenelvgs gtviwrsrrk 181 laageiteee fidraassap saghcntmgt astmnavaea lglsltgcaa ipapyrergq 241 mayktgqriv dlayddvkpl diltkqafen aialvaaagg stnaqphiva marhagveit 301 addwraaydi plivnmqpag kylgerfhra ggapavlwel lqqgrlhgdv ltvtgktmse 361 nlqgretsdr evifpyhepl aekagflvlk gnlfdfaimk ssvigeefrk rylsqpggeg 421 vfearaivfd gsddyhkrin dpaleiderc ilvirgagpi gwpgsaevvn mqppdhllkk 481 gimslptlgd grqsgtadsp silnaspesa iggglswlrt gdtiridlnt grcdalvdea 541 tiaarkqdgi pavpatmtpw qeiyrahasq ldtggvlefa vkyqdlaakl prhnh (Dihydroxy-acid dehydratase (Caulobacter sp. K31)) SEQ ID NO: 37   1 mtsantpsgr pprrfrsrdw fdnpdhidmt alylerfmny gitpeelrsg kpiigiaqtg  61 sdispcnrih ldlvtrirdg irdaggipme fpvhpifenc rrptaaldrn lsylglvevl 121 hgypidavvl ttgcdkttpa gimaattvni paivlsggpm ldgwhdgelv gsgtviwrsr 181 rklaageine eefiqrasds apsaghcntm gtastmnava ealglsltgc aaipapyrer 241 gqmayktgqr ivdlayedvk pldiltkkaf enaialvaaa ggstnaqphi vamarhagld 301 itaddwraay diplilnmqp agkylgerfh raggapavlw ellqagrlhg dvmtvtgktm 361 genlegretk drevvfpygq pmseragflv lkgnlfdfai mktsvisqef rqrylsepgk 421 edsfearavv fdgsddyhar indpslnide rtilvirgag pigwpgsaev vnmqppdall 481 krgimslptl gdgrqsgtad spsilnaspe saiggglswl rtgdmiridl ntgrcdalvd 541 eatiaerrke gvppvpatmt pwqeiyraht gqletggvle favkyqdlas klprhnh (Dihydroxyacid dehydratase/phosphogluconate dehydratase (Caulobacter sp. AP07)) SEQ ID NO: 38   1 mtspnrtprr frsrdwfdnp dhidmtalyl erfmnygitp eelrsgkpii giaqtgsdis  61 pcnrihldlv trirdgirda ggipmefpvh pifencrrpt aaldrnlsyl glvetlhgyp 121 idavvlttgc dkttpagima attvnipaiv lsggpmldgw hdgelvgsgt viwrsrrkla 181 ageiteeefi qrasdsapsa ghcntmgtas tmnavaealg lsltgcaaip apyrergqma 241 yrtggrivdl ayedikpkdi ltkqafenai alvaaaggst naqphivama rhagldvtad 301 dwraaydipl ilnmqpagky lgerfhragg apavlwellq agrlhgdamt vtgktmaenl 361 egretrdrev vfpyaapmse ragflvlkgn lfdfaimkts visqefrdry lsepgqegaf 421 earavvfdgs gdyharindp slgidertil virgagpigw pgsaevvnmq ppdallkkgi 481 mslptlgdgr qsgtadspsi lnaspesavg gglswlrtgd viridlntgr cdalvdeati 541 aarkleglpp vpetmtpwqe iyrahtgqle tggvlefavk yqdlaaklpr hnh (Dihydroxy-acid dehydratase (Caulobacter segnis ATCC 21756)) SEQ ID NO: 39   1 msertprrfr srdwfdnpdh idmtalyler fmnygitpee lrsgkpiigi aqtgsdispc  61 nrihldlvtr irdgirdagg ipmefpvhpi fencrrptaa ldrnlsylgl vetlhgypid 121 avvittgcdk ttpagimaat tvnipaivls ggpmldgwhe gelvgsgtvi wrsrrklaag 181 eiteeefidr aassapsagh cntmgtastm navaealgls ltgcaaipap yrergqmayk 241 tgqrivdlay edvkpldilt kkafqnaial vaaaggstna qphivamarh agveitaddw 301 raaydipliv nmqpagkylg erfhraggap avlwellqqg rlhgdvltvt gktmgenlqg 361 retsdrevif pyhqplaeka gflvlkgnlf dfaimkssvi geefrkryls epgkegvfea 421 raivfdgsdd yhkrindpal eidercilvi rgagpigwpg saevvnmqpp dhllkkgims 481 lptlgdgrqs gtadspsiln aspesaiggg lswlrtgdti ridintgrcd alvdeatiae 541 rkkegipavp atmtpwqeiy rahtgqlesg gvlefavkyq dlasklprhn h (Dihydroxy-acid dehydratase (Caulobacter crescentus NA1000)) SEQ ID NO: 40   1 msnrtprrfr srdwfdnpdh idmtalyler fmnygitpee lrsgkpiigi aqtgsdispc  61 nrihldlvqr vrdgirdagg ipmefpvhpi fencrrptaa ldrnlsylgl vetlhgypid 121 avvlttgcdk ttpagimaat tvnipaivls ggpmldgwhe nelvgsgtvi wrsrrklaag 181 eiteeefidr aassapsagh cntmgtastm navaealgls ltgcaaipap yrergqmayk 241 tgqrivdlay ddvkpldilt kqafenaial vaaaggstna qphivamarh agveitaddw 301 raaydipliv nmqpagkylg erfhraggap avlwellqqg rlhgdvltvt gktmsenlqg 361 retsdrevif pyheplaeka gflvlkgnlf dfaimkssvi geefrkryls qpgqegvfea 421 raivfdgsdd yhkrindpal eidercilvi rgagpigwpg saevvnmqpp dhllkkgims 481 lptlgdgrqs gtadspsiln aspesaiggg lswlrtgdti ridlntgrcd alvdeatiaa 541 rkqdgipavp atmtpwqeiy rahasqldtg gvlefavkyq dlaaklprhn h 2-Keto-3-deoxy-D-arabinonate Dehydratase (xylX) (NP_419640.1; GI: 16125076; Hypothetical protein CC_0823  (Caulobactercrescentus CB15)) SEQ ID NO: 41   1 mvcrrllawt arareaedfa lvrqptcrph mlalpsader apptvsalqt lefwgddavg  61 vseflpedwk aatllgridf gegptpvlvr ggrvedvski aptvadlmna fqpgaviprg 121 edkgpleald irpvwedpdg aapvkllapv dlqclkaagv tfavstlerv ieerargdag 181 ealkirtlla ermggdlksv epgsggagrl kdaliadglw sqylevaigp daeiftkgpt 241 lssmgwgdqv gvrydshwnn pepevvalcd gsglirgaal gndvnlrdfe grsalllska 301 kdnnascaig pffrlfdetf glddvrsaev elkitgrdnf vldgksnmsl isrdpavlag 361 qaygkqhqyp dgfalflgtm fapiqdrdtp gqgfthkvgd rvrvstpklg vlenevttcd 421 kakpwtfgis alirnlagrg ll (Fumarylacetoacetate hydrolase family protein (Caulobacter  crescentus NA1000)) SEQ ID NO: 42   1 mgvseflped wkaatllgri dfgegptpvl vrggrvedvs kiaptvadlm nafqpgavip  61 rgedkgplea ldirpvwedp dgaapvklla pvdlqclkaa gvtfavstle rvieerargd 121 agealkirtl laermggdlk svepgsqgaq rlkdaliadg lwsqylevai gpdaeiftkg 181 ptlssmgwgd qvgvrydshw nnpepevyll cdgsglirga algndvnlrd fegrsallls 241 kakdnnasca igpffrlfde tfglddvrsa evelkitgrd nfvldgksnm slisrdpavl 301 agqaygkqhq ypdgfalflg tmfapiqdrd tpgqgfthkv gdrvrvstpk lgvlenevtt 361 cdkakpwtfg isalirnlag rgll (Fumarylacetoacetate (FAA) hydrolase (Caulobacter segnis ATCC 22756)) SEQ ID NO: 43   1 mgvseflpdd wknatllgri dfgegptpvl vrggrvedms kvaptvadlm nafgpgaaip  61 rgedkgples ldirpvwedp dgaapvklla pvdlqclkaa gvtfavstle rvieerargd 121 aaaalkireq lsasmggdlr svnpgsegae rlkqtlikdg lwsqylevai gpdaeiftkg 181 ptlssmgwgd hvgvrydshw nnpepevvll cdgagqirga slgndvnlrd fegrsallls 241 kakdnnasca igpffrlfde tfalddvrsa evelkitgrd nfvldgksnm slisrdpavl 301 agqaygkqhq ypdgfalflg tmfapiqdrd tpgqgfthkv gdrvrvstpk lgvlenevtt 361 cdkakpwtfg isalirnlag rgll (Hypothetical protein Caul_4000 (Caulobacter sp. K31)) SEQ ID NO: 44   1 malsdflpdd wrdatllgri dfgqgptpvl irggriedvs kiapttsdlm nafapgaaip  61 rgedlgplea ldvravwenp qgaaakllap vdlqvlkaag vtfavstler vieerargda 121 aealkiraql adsmggdlrs vnpgsdgaer lkqtlikdgl wsqylevaig pdaeiftkgp 181 tlssmgwgdh vgvrsdshwn npepevvllc dgsgqirgaa lgndvnlrdf egrsalllsk 241 akdnnascai gpffrlfddg fslddvrsae vtlkitgrdn fvldghsnms lisrdpavla 301 gqafgkqhqy pdgfalflgt mfapiqdrda agqgfthkvg drvrvatpkl gvlenevttc 361 dlaapwtfgv salirnlagr gll (Fumarylacetoacetate (FAA) hydrolase family protein (Cautobacter sp. AP07)) SEQ ID NO: 45   1 malsdflpdd wrdatllgrv dfgdgptpvl vrggriedvs riapttsdlm nafapgaaip  61 agadlgplea ldvrpvwenp dgaaakllap vdlqvlkaag vtfavstler vieerargda 121 aealkiraql adsmggdlrg vnpgsegaar lketlikggl wsqylevaig pdaeiftkgp 181 tlssmgwgdq vgvrsdshwn npepevvllc dgsgrirgas lgndvnlrdf egrsalllsk 241 akdnnascai gpffrlfddg fglddvrsae vtlkitgrdn fvldghsnms lisrdpavla 301 gqafgkqhqy pdgfvlflgt mfapiqdrdt agqgfthkvg drvrvatpkl gvlenevttc 361 dvappwtfgv salirnlagr gll L-arabinose dehydrogenase (AraE) (YP_439823.1; GI: 83716868; Dehydrogenase (Burkholderia  thailandensis E264)) SEQ ID NO: 46   1 mnsvytlglv gigkiardqh lpaiaaepgf dllacasrha qvrgvrnypd idallaaepa  61 ldayslaapp qvryaqaraa lgagkhvmle kppgatagei aalralarer grtlfaawhs 121 rhasavepar awlatrtira vqarwkedvr rwhpgqqwiw epgglgvfdp ginalsivtr 181 ilprelvlra atlvvpanah tpiaaeldcv dtagvpvrae fdwrhgpveq wdiavdtdgg 241 vlsigaggar lsiagepval ppereypsly arfraligeg asdvddrplr lvadafmigr 301 riaadpfqr (Dehydrogenase (Burkholderia thailandensis TXDOH)) SEQ ID NO: 47   1 mnsvytlglv gigkiardqh lpaiaaepgf dllacasrha qvrgvrnypd idallaaepa  61 ldavslaapp qvryaqaraa lgagkhvmle kppgatagei aalhalarer grtlfaawhs 121 rhasavepar awlatrtira vqvrwkedvr rwhpgqqwiw epgglgvfdp ginalsivtr 181 ilprelvlra ativvpanah tpiaaeldcv dtagvpvrae fdwrhgpveq wdiavdtdgg 241 vlsigaggar lsiagepval ppereypsly arfraligeg asdvddrplr lvadafmigr 301 riaadpfqr (Galactose 1-dehydrogenase (Burkholderia ambfiaria IOP40-10)) SEQ ID NO: 48   1 mskvislgvi gigkiardqh lpaiaaepgf altacasrha evngvrnype lgallaaepe  61 leavslcapp qvryaqaraa leagkhvmle kppgatlgev aaldalarer gltlfatwhs 121 rcasavepar awlatrtira vqvrwkedvr rwhpgqqwiw epgglgvfdp ginalsivtr 181 ilprelvlre atlyvpsdvq tpiaaeldca dtdgvpvhae fdwrhgpveq weiavdtsdg 241 vlaisrggaq lsiggepvei gpqreypaly ahfraliarg esdvdvrplr lvadaflfgr 301 rvgtdafgr (Galactose 1-dehydrogenase (Burkholderia ambifaria MC40-6)) SEQ ID NO: 49   1 mskvislgvi gigkiardqh lpaiaaepgf altacasrha evngvrnype lgallaaepe  61 leavslcapp qvryagaraa leagkhvmle kppgatlgev aaldalarer gltlfatwhs 121 rcasavepar awlatrtira vqvrwkedvr rwhpgqqwiw epgglgvfdp ginalsivtr 181 ilprelvlre atlyvpsdvq tpiaaeldca dtdgvpvhae fdwrhgpveq weiavdtsdg 241 vlaisrggaq lsiagepvei gpqreypaly ahfraliarg esdvdvrplr lvadaflfgr 301 rvgtdafgr (Dehydrogenase (Burkholderia thailandensis MSMB43)) SEQ ID NO: 50   1 mntvytlglv gigkiardqh lpaiaaepgf dlracasrha evrgvrnhpd igallaaepa  61 ldavslaapp qvryaqaraa ldagkhvmle kppgatvgei aalralarer grtlfaswhs 121 rharavepar awlatrtira vqvrwkedvr rwhpgqqwiw epgglgvfdp ginalsivtr 181 ilprelvlra ativvpanvh tpiaaefdcv dtagvpvrae fdwrhgpveq wdiavdtdgg 241 vlaigaggar lsiagepval ppeceypsly arfhaliaar esdvddrplr lvadafmvgr 301 riaadpfhr L-arabinonolactonase (AraI) (YP_439819.1; GI: 83717359; Senescence marker protein-30 family protein (Burkholderia thailandensis E264)) SEQ ID NO: 51   1 messnrpart gaasaatlrv dcrnalgega twcdatraly wvdiegarlw rwraagaqgg  61 aatdswempe rigcfaltdd pdvllvglas rlaffdarrr aftpivdvep dlptrindgr 121 cdragafvfg mkdegggspr avggyyrlnp dlslqrlalp laaiangitf spdgsamyfc 181 dsptreiqvc dyrpggdvdr irsfvrladd cgepdgsavd adggvwnaqw ggarivryda 241 qgveteriav ptpqpscval ddggrlyvts arvglddgal arspgaggvf vadtrhagla 301 tsrfalarna (Senescence marker protein-3O family protein (Burkholderia thailandensis TXDOH)) SEQ ID NO: 52   1 messsrpart gaasaatlrv dcrnalgega twcdatraly wvdiegarlw rwraagaqgg  61 aatdswempe rigcfaltdd pdvllvglas rlaffdarrr aftpivdvep dlptrindgr 121 cdragafvfg mkdegggspr avggyyrinp dlslqrlalp paaiangiaf spdgsamyfc 181 dsptreiqvc dyrpggdvdr irpfvrladd cgepdgstvd adggvwsaqw ggarivryda 241 qgveteriav ptpqpscval ddggrlyvts arvglddgal arspgaggvf vadtrhagla 301 tsrfalarna (Senescence marker protein-30 family protein (Burkholderia thailandensis Bt4) SEQ ID NO: 53   1 messnrpart gaasaatlrv dcrnalgega twcdatraly wvdiegarlw rwraagaqgg  61 aatdswempe rigcfaltdd pdvllvglas rlaffdarrr aftpivdvep dlptrindgr 121 cdragafvfg mkdegggspr avggyyrlnp dlslqrlalp laaiangiaf spdgsamyfc 181 dsptreiqvc dyrpggdvdr irsfvrladd cgepdgsavd adggvwnaqw ggarivryda 241 qgveteriav ptpqpscval ddggrlyvts arvglddgal arspgaggvf vadtrhagla (Hypothetical protein BPSS0776 (Burkholderia pseudomallei K96243)) SEQ ID NO: 54   1 messnrpart heasaatllv dcrnalgega twcdaahaly wvdiegarlw rwraagahgg  61 ercdswempe riacfaltgd pdvllvglas rlaffdtrrr altpivdvep drptrindgr 121 cdragafvfg tkdesggasp raiggyyrln adlslqrlal ppaaiangia fspdgsamyf 181 cdsptreiqv cdyrpggdvd rvrsfvrlad ahgepdgstv dasggvwnaq wggarvvryd 241 aqgvetdria vptpqpscvt ldaagrlyvt sarvglddga lagnpgaggv fvahtrhsgs 301 atprfalarh a (Gluconolactonase (Burkholderia pseudomallei NCTC 13177)) SEQ ID NO: 55   1 messnrpart heasaatllv dcrnalgega twcdaahaly wvdiegarlw rwraagahgg  61 ercdswempe riacfaltgd pdvllvglas rlaffdtrrr altpivdvep drptrlndgr 121 cdragafvfg tkdesggasp raiggyyrln adlslqrlal ppaaiangia fspdgsamyf 181 cdsptreiqv cdyrpggdvd rvrsfvrlad ehgepdgstv dasggvwnaq wggarvvryd 241 aqgvetdria vptpqpscvt ldaagrlyvt sarvglddga lagnpgaggv fvahtrhpgg 301 atprfalarh a L-arabinonate dehydratase (AraB) (YP_439826.1; GI: 83718062; Dihydroxy-acid dehydratase (Burkholderia thailandensis E264)) SEQ ID NO: 56   1 msaskpklrs aqwfgthdkn gfmyrswmkn qgipdhefdg rpivgicntw seltpcnahf  61 rklaehvkrg vyeaggfpve fpvfsngesn lrpsamltrn lasmdveeai rgnpidavvl 121 lagcdkttpa llmgaascdv paivvsggpm lngkldgkni gsgtavwqlh ealkageidl 181 hrflsaeagm srsagtcntm gtastmacla ealgvalphn aaipavdarr yvlahmsgmr 241 ivgmaheglv lskiltraaf enairvnaai ggstnavihl kaiagrlgvp leledwlrlg 301 rgtptivdlm psgrflmeef yyagglpavl rrlgeanllp hpgaltvngq slwdnvrdap 361 shddevirpl drpliadggi rilrgnlapr gavlkpsaas pellkhrgra vvfenfehyk 421 atiddealdv dansvlvlkn cgprgypgma evgnmglppk llrqgvkdmv risdarmsgt 481 aygtvvlhva peaaaggpla avrngdwiel dgeagtltld vsddelarrl sdhdpasapg 541 vaehaagggy arlyvdhvlq adegcdldfl vgrrgaavpr hsh (Dihydroxy-acid dehydratase (Burkholderia thailandensis TXDOH)) SEQ ID NO: 57   1 msaskpklrs aqwfgthdkn gfmyrswmkn qgipdhefdg rpivgicntw seltpcnahf  61 rklaehvkrg vyeaggfpve fpvfsngesn lrpsamltrn lasmdveeai rgnpidavvl 121 lagcdkttpa llmgaascdv paivvsggpm lngkldgrni gsgtavwqlh ealkageidl 181 hrflsaeagm srsagtcntm gtastmacla ealgvalphn aaipavdarr yvlahmsgmr 241 ivgmaheglv lskiltraaf enairvnaai ggstnavihl kaiagrlgvp leledwlrlg 301 rgtptivdlm psgrflmeef yyagglpavl rrlgeanllp hpgaltvngq slwdnvrdap 361 shddevirpl drpliadggi rilrgnlapr gavlkpsaas pellkhrgra vvfenfehyk 421 atiddealev dansvlvlkn cgprgypgma evgnmglppk llrqgvkdmv risdarmsgt 481 aygtvvlhva peaaaggpla avrngdwiel dceagtltld vsddelarrl sdhdpasapg 541 vaehaagggy arlyvdhvlq adegcdldfl vgrrgaavpr hsh (Dihydroxy-acid dehydratase (Burkholderia multivorans ATCC 17616)) SEQ ID NO: 58   1 msatkprlrs aqwfgtndkn gfmyrswmkn qgipdhefdg rpiigicntw seltpcnahf  61 rklaehvkrg ifeaggfpve fpvfsngesn lrpsamltrn lasmdveeai rgnpidavvl 121 lagcdkttpa llmgaascdv paivvsggpm lngklegkni gsgtavwqlh ealkageidl 181 hhflsaeagm srsagtcntm gtastmacma ealgvalphn aaipavdsrr yvlahmsgir 241 ivemaleglv lskvltraaf enairvnaai ggstnavihl kaiagrigvp leledwmrig 301 rdtptivdlm psgrflmeef yyagglpavl rrlgeggllp hpdaltvngk tlwdnvreap 361 nyddevirpl drpliadggi rilrgnlapr gavlkpsaas pellkhrgra vvfenfdhyk 421 atindesldv dansvlvlkn cgprgypgma evgnmglppk llrqgvkdmv risdarmsgt 481 aygtvvlhva peaaaggpla avrngdwiel dceagtlhld ipddelqrrl sdvdpaaapg 541 vagqagkggy arlyldhvlq adegcdldfl vgtrgaevps hsh (Dihydroxy-acid dehydratase (Burkholderia multivorans CGD2M)) SEQ ID NO: 59   1 msatkprlrs aqwfgtndkn gfmyrswmkn qgipdhefdg rpiigicntw seltpcnahf  61 rklaehvkrg ifeaggfpve fpvfsngesn lrpsamltrn lasmdveeai rgnpidavvl 121 lagcdkttpa llmgaascdv paivvsggpm lngklegkni gsgtavwqlh ealkageidl 181 hhflsaeagm srsagtcntm gtastmacma ealgvalphn aaipavdsrr yvlahmsgir 241 ivemaleglv lskvltraaf enairvnaai ggstnavihl kaiagrigvp leledwmrig 301 rdtptivdlm psgrflmeef yyagglpavl rrlgeggllp hpdaltvngk tlwdnvrdap 361 nyddevirpl drpliadggi rilrgnlapr gavlkpsaas pellkhrgra vvfenfdhyk 421 atindealdv dansvlvlkn cgprgypgma evgnmglppk llrqgvkdmv risdarmsgt 481 aygtvvlhva peaaaggpla avrngdwiel dceagtlhld ipddelqrrl sdvdpaaapg 541 vagqagkggy arlyldhvlq adegcdldfl vgtrgaevps hsh (Dihydroxy-acid dehydratase (Burkholderia thailandensis MSMB43)) SEQ ID NO: 60   1 msaskpklrs aqwfgthdkn gfmyrswmkn qgipdhefdg rpivgicntw seltpcnahf  61 rklaehvkrg vyeaggfpve fpvfsngesn lrpsamltrn lasmdveeai rgnpidavvl 121 lagcdkttpa llmgaascdv paivvsggpm lngkldgkni gsgtavwqlh ealkageidl 181 hrflsaeagm srsagtcntm gtastmacla ealgvalphn aaipavdarr yvlahlsgar 241 ivemahegla lstiltraaf enairanaai ggstnavihl kaiagrlgvp leledwmrig 301 rdtptivdlm psgrflmeef yyagglpavl rrlgeanllp hpgaltvngk slwenvrdap 361 nhddevirpl arpliadggi rvlrgnlapr gavlkpsaas pellrhrgra vvfenfehyk 421 atiddealdv dassvlvlkn cgprgypgma evgnmglppk llrqgvkdmv risdarmsgt 481 aygtvvlhva peaaaggpla avrngdwial dceagtltld vsddelarrl sdldpasapg 541 aagqagsggy arlyvdhvlq adegcdldfl vgrrgaavpr hsh 2-Keto-3-deoxy-L-arabinonate Dehydratase AraD) (YP_439824.1; GI: 83717217; Dihydrodipicolinate synthase (Burkholderia thailandensis E264)) SEQ ID NO: 61   1 mntsrspryr gvfpvvpttf aeageldlps qkravdfmid agseglcila nfseqfalad  61 derdvltrti lehvagrvpv ivttthystq vcaarsrraq elgaamvmam ppyhgatfrv 121 pdtqihafya rlsdaldipi miqdapasgt vlsapflarm areieqvsyf kietpgaank 181 lrelirlggd aiegpwdgee aitlladlna gatgamtgga ypdgirpive ahregradda 241 falygrwlpl inhenrqtgl laakalmreg gviacerprh plppihpdsr aeliaiarrl 301 dplvlrwar (Dihydrodipicolinate synthase, putative (Burkholderia thailandensis TXDOH)) SEQ ID NO: 62   1 mntsrspryr gvfpvvpttf teageldlps qkravdfmid agseglcila nfseqfalad  61 derdvltrti lehvagrvpv ivttthystq vcaarsrraq elgaamvmam ppyhgatfrv 121 pdtqihafya rlsdaldipi miqdapasgt vlsapflarm areieqvsyf kietpgaank 181 lrelirlggd aiegpwdgee aitlladlna gatgamtgga ypdgirpive ahregradda 241 falyqrwlpl inhenrqtgl laakalmreg gviacerprh plppihpdsr aeliaiarrl 301 dplvlrwar (Dihydrodipicolinate synthase, putative (Burkholderia thailandensis MSMB43)) SEQ ID NO: 63   1 mntsrspryr gvfpvvpttf tetgeldlps qmravdfmid agseglcila nfseqfalad  61 derdvltrti lehvagrvpv ivttthystr vcaarsrraq elgaamvmam ppyhgatfrv 121 pdtqihafya rlsdaldipi miqdapasgt vlsapflarm areieqvsyf kietpgaank 181 lrelirlggd aiegpwdgee aitlladlna gatgamtgga ypdgirpivd ahrdgradda 241 falygrwlpl inhenrqtgl vaakalmreg gviacerprh plppihpdsr aelieiarrl 301 dplvlrwar (Dihydrodipicolinate synthase/N-acetylneuraminate lyase  (Burkholderiadolosa AUO158)) SEQ ID NO: 64   1 mtssrtpryr gifpvvpttf tdtgeldlas qkravdfmid agsdglcila nfseqfaitd  61 derdvltrti lehvagrvpv ivttthystq vcaarslraq qlgaamvmam ppyhgatfrv 121 peaqiydfya rvsdaidipi miqdapasgt vlsapllarm areieqvsyf kietpgaank 181 lrelirlggd avegpwdgee aitlladlna gatgamtgga ypdgirpile ahregrhdda 241 fahyqrwlpl inhenrqsgi lsakalmreg gviacerprh pmpelhpdtr aeliaiarrl 301 dplvlrwar (Dihydrodipicolinate synthetase family protein (Burkholder  multivorans ATCC BAA-247)) SEQ ID NO: 65   1 mtssrtpryr gifpvvpttf tetgeldlas qkravdfmid agsdglcila nfseqfalad  61 derdvltrti lehvagrvpv ivttshystq tciarsvraq qlgaamvmvm ppyhgatfrv 121 peaqihafya rlsdalsipi miqdapasgt vlsapflaql areiehvayf kietpgaank 181 lrelirlggd aiegpwdgee aitlladlha gatgamtgga ypdgirpile ahregrhdda 241 faryqtwlpl inhenrqsgi ltakalmreg gviaceaprh pmpalhpdtr aeliaiarrl 301 dplvlrwar D-glucarate dehydratase (YcbF) (NP_388131.2; GI: 255767063; Glucarate dehydratase (Bacillus subtilis subsp. subtilis str.168)) SEQ ID NO: 66   1 msspiqeqvq kekrsnipsi semkvipvag hdsmllnlsg ahspfftrni viltdssgnq  61 gvgevpggeh irrtlelsep lvvgksigay qailqtvrkq fgdqdrggrg nqtfdlrttv 121 havtaleaal ldllgkflqe pvaallgegk qrdevkmlgy lfyigdrnrt tlpyqsdeqs 181 dcawfrlrhe ealtpeaivr laesaqeryg fqdfklkggv lrgeeeieav talskrfpea 241 ritldpngaw sleeaialck gkqdvlayae dpcgdengys arevmaefrr atglptatnm 301 iatdwremgh aiqlhavdip ladphfwtmq gsvrvaqmch dwgltwgshs nnhfdislam 361 fthvaaaapg ritaidthwi wqdgqrltkq pfeissgcvk vpdkpglgvd idmeqvekah 421 eiyrkmnlga rndaipmqfl isnwefdrkr pclvr (Glucarate dehydratase (Bacillus subtilis)) SEQ ID NO: 67   1 msspiqeqvq kekrsnipsi semkvipvag hdsmllnlsg ahspfftrni viltdssgnq  61 gvgevpggeh irrtlelsep lvvgksigay qailqtvrkq fgdqdrggrg nqtfdlrttv 121 havtaleaal ldflgkflqe pvaallgegk qrdevkmlgy lfyigdrnrt tlpyqsdeqs 181 dcawfrlrhe ealtpeaivr laesaqeryg fqdfklkggv lrgeeeieav talskrfpea 241 ritldpngaw sleeaialck gkqdvlayae dpcgdengys arevmaefrr atglptatnm 301 iatdwremgh aiqlhavdip ladphfwtmq gsvrvaqmch dwgltwgshs nnhfdislam 361 fthvaaaapg ritaidthwi wqdgqrltkq pfeissgcvk vpdkpglgvd idmeqvekah 421 eiyrkmnlga rndaipmqfl isnwefdrkr pclvr (Hypothetical protein BSNT_00441 (Bacillus subtilis subsp. natto BEST195)) SEQ ID NO: 68   1 msspiqeqvq kekrsnipsi temkvipvag hdsmllnlsg ahspfftrni viltdssgnq  61 gvgevpggeh irrtlelsep lvvgksigay qailqtvrkq fgdqdrggrg nqtfdlrttv 121 havtaleaal ldllgkflqe pvaallgegk qrdevkmlgy lfyigdrkrt tlpyqsdeqs 181 dcawfrlrhe ealtpeaivr laesaqeryg fqdfklkggv lqgeeeieav talskrfpea 241 ritldpngaw sleeaialck gkqdvlayae dpcgdengys arevmaefrr atglptatnm 301 iatdwremgh aiqlhavdip ladphfwtmq gsvrvaqmch dwgltwgshs nnhfdislam 361 fthvaaaapg ritaidthwi wqdgqrltkq pfeissgcvk vpdkpglgid idmeqvekah 421 eiyrkmnlga rndaipmqfl isnwefdrkr pclvr (Glucarate dehydratase (Bacillus subtilis subsp. spizizenii TU-B-10)) SEQ ID NO: 69   1 msspiqeqvq kekrsnipsi cemkvipvag hdsmllnlsg ahspfftrni viltdssgnq  61 gvgevpggeq irrtlelaep lvvgksigay qsilqtvrkq fadqdrggrg iqtfdlrttv 121 havtaleaal ldllgkflqe pvaallgegk qrdevkmlgy lfyigdrkqt tlpyqsdeqs 181 dcgwfrlrhe ealtpeaivr laesaqeryg fqdfklkggv lrgedeieav talakrfpea 241 ritldpngaw sleeaialck gkhdvlayae dpcgdengys arevmaefrr atglptatnm 301 iatdwremgh aiqlhavdip ladphfwtmq gsvrvaqmch dwgltwgshs nnhfdislam 361 fthvaaaapg ritaidthwi wqdgqrltkq pfeisegcvk vpnkpglgid idmeqvekah 421 elyrkmnlga rndavpmqfl isnwefdrkr pclvr (Glucarate dehydratase (Bacillus subtilis subsp. subtilis str. RO-NN-1)) SEQ ID NO: 70   1 msspmqeqiq kekrsnvpsi semkvipvag hdsmllnlsg ahspfftrni viltdssgnq  61 gvgevpggeh irrtlelsep lvvgksigay qailqtvrkq fgdqdrggrg nqtfdlrttv 121 havtaleaal ldllgkflqe pvaallgegk grdevkmlgy lfyigdrkrt tlpyqsdeqs 181 ycawfrlrhe ealtpeaivr laesaqeryg fqdfklkggv lrgeeeieav talskrfpea 241 ritldpngaw sleeaialck gkqdvlayae dpcgdengys arevmaefrr atglptatnm 301 iatdwremgh aiqlhavdip ladphfwtmq gsvrvaqmcn dwgltwgshs nnhfdislam 361 fthvaaaapg ritaidthwi wqdgqrltkq pfeissgcvk vpdkpglgvd idmeqvekah 421 eiyrkmnlga rndaipmqsl isnwefdrkr pclvr D-galactarate dehydratase (YcbH) (NP_388133.2; GI: 255767065; D-galactarate dehydratase (Bacillus subtilis subsp. subtilis str.168)) SEQ ID NO: 71   1 mamnlrknqa plyikvheid ntaiivndgg lpkgtvfscg lvleedvpqg hkvaltdlnq  61 gdeivrygev igfadetikr gswirealvr mpappalddl planrvpqpr pplegytfeg 121 yrnadgsagt knilgittsv qcvvgvldya vkrikeellp kypnvddvvp lhhqygcgva 181 inapdavipi rtiqnlakhp nfggevmvig lgcekllper iasendddil slqdhrgfaa 241 miqsilemae erlirlnsrt rvscpvsdlv iglqcggsda fsgvtanpav gyaadllvra 301 gatvlfsevt evrdaihllt prayseevgq slikemkwyd sylrrgdadr sanpspgnkk 361 gglsnvveka lgsvaksgts pisgvlgpge rakqkgllfa atpasdfvcg tlqlaagmnl 421 qvfttgrgtp yglaaapvlk vstrhslseh wadlidinag riatgeasie dvgweifrti 481 ldvasgrkqt wadrwglhnd lclfnpapvt (Hypothetical protein BSNT_00443 (Bacillus subtilis subsp. natto BEST195)) SEQ ID NO: 72   1 mamnlrknqa plyikvheid ntaiivndgg lpkgtvfscg lvleedvpqg hkvaltdlnq  61 gdeivrygev igfadetikr gswirealvr mpappalddl planrvpqpr pplegytfeg 121 yrnadgsagt knilgittsv qcvvgvldya vkrikeellp kypnvddvvp lhhqygcgva 181 inapdavipi rtiqnlakhp nfggevmvig lgcekllper iasendddil slqdhrgfaa 241 miqsilemae erlirinsrt rvscpvsdlv iglqcggsda fsgvtanpav gyaadllvra 301 gatvlfsevt evrdaihllt prayseevgq slikemkwyd sylrrgdadr sanpspgnkk 361 gglsnvveka lgsvaksgts pisgvlgpge raeqkgllfa atpasdfvcg tlglaagmnl 421 qvfttgrgtp yglaaapvlk vstrhslseh wadlidinag riatgeasie dvgweifrti 481 ldvasgrkqt wadrwglhnd lclfnpapvt (D-galactarate dehydratase (Bacillus subtilis subsp. subtilis str. RO-NN-1)) SEQ ID NO: 73   1 mamnlrknqa plyikvheid ntaiivndgg lpkgtvfscg lvleedvpqg hkvaltdlnq  61 gdeivrygev igfadetikr gswirealvr mpappalddl planrvpqpr pplegytfeg 121 yrnadgsagt knilgittsv qcvvgvldya vkrikeellp kypnvddvvp lhhqygcgva 181 inapdavipi rtiqnlakhp nfggevmvig lgcekllper iasendddil slqdhrgfaa 241 miqsilemae erlirinsrt rvscpvsdlv iglqcggsda fsgvtanpav gyaadllvra 301 gatvlfsevt evrdaihllt prayseevgq slieemkwyd sylrrgdadr sanpspgnkk 361 gglsnvveka lgsvaksgts pisgvlgpge raeqkgllfa atpasdfvcg tlqlaagmnl 421 qvfttgrgtp yglaaapvlk vstrhslseh wadlidinag riatgeasie dvgweifrti 481 ldvasgrkqt wadrwglhnd lclfnpapvt (Hypothetical protein BSSC8_40810 (Bacillus subtilis subsp. subtilis str. SC-8)) SEQ ID NO: 74   1 mamnlrknqa plyikvheid ntaiivnegg lpkgtvfscg lvleedvpqg hkvaltdlnq  61 gdeivrygev igfadetikr gswirealvr mpappalddl plenrvpqpr pplegytfeg 121 yrnadgsagt knilgittsv qcvvgvldya vkrikeellp kypnvddvvp lhhqygcgva 181 inapdavipi rtiqnlakhp nfggevmvig lgcekllper iasendddil slqdhrgfaa 241 miqsilemae erlirinsrt rvscpvsdlv iglqcggsda fsgvtanpav gyaadllvra 301 gatvlfsevt evrdaihllt pravseevgq slikemkwyd sylrrgdadr sanpspgnkk 361 gglsnvveka lgsvaksgts pisgvlgpge raeqkgllfa atpasdfvcg tlqlaagmnl 421 qvfttgrgtp yglaaapvlk vstrhslseh wadlidinag qiatgeasie dvgweifrti 481 ldvasgrkqt wadrwglhnd lclfnpapvt (Galactarate dehydratase (Bacillus subtilis BSn5)) SEQ ID NO: 75   1 mamnlrknqa plyikvheid ntaiivndgg lpkgtvfscg lvleedvpqg hkvaltdlnq  61 gdeivrygev igfadetikr gswiredlvr mpappalddl planrvpqpr pslegytfeg 121 yrnadgstgt knilgittsv qcvvgvldya vkrikeellp kypnvddvvp lhhqygcgva 181 inapdavipi rtiqnlakhp nfggevmvig lgcekllper iasengddil slqdhrgfaa 241 miqsilemae erlirlnsrt rvscpvsdlv iglqcggsda fsgvtanpav gyaadllvra 301 gatvlfsevt evrdaihllt pravseevgq slikemkwyd sylrrgdadr sanpspgnkk 361 gglsnvveka lgsvaksgts pisgvlgpge rakqkgllfa atpasdfvcg tlqlaagmnl 421 qvfttgrgtp yglaaapvlk vstrhslseh wadlidinag riatgeasie dvgweifrti 481 ldvasgrkqt wadrwglhnd lclfnpapvt 5-dehydro-4-deoxyglucarate dehydratase (YcbC) (NP_388128.2; GI: 255767061; 5-dehydro-4-deoxyglucarate dehydratase (Bacillus subtilis subsp. subtilis str.168)) SEQ ID NO: 76   1 msrirkapag ilgfpvapfn tqgkleeeal fqniefllne gleaifiacg sgefqslsqk  61 eyeqmvevav saaggkvpvy tgvggnlsta ldwaqlsekk gadgylilpp ylvhgegegl 121 yqyaktiies tdlnailyqr dnavlsveqi krlteceqlv gvkdgvgnmd lninlvytig 181 drlgwlngmp maevtmpayl pigfhsyssa isnyiphisr mfydalkngn delvkelyrh 241 vilpindirk qrkgyaysli kagmeimgln vrntarppvg pvekdhyqql eailkqaadr 301 fpkkaatv (Putative 5-dehydro-4-deoxyglucarate dehydratase (Bacillus subtilis subsp. subtilis str. RO-NN-1)) SEQ ID NO: 77   1 msrirkapag ilgfpvapfn tqgkleeeal fqniefllne gleaifiacg sgefqslsqk  61 eyeqmvevav saaggkvpvy tgvggnlsta lewaqlsekk gadgylilpp ylvhgeqegl 121 yqyaktiies tdlnailyqr dnavlsveqi krlteceqlv gvkdgvgnmd lninlvytig 181 drlgwlngmp maevtmpayl pigfhsyssa isnyiphisr mfydalkngn delvkelyrh 241 vilpindirk qrkgyaysli kagmeimgln vrntarppvg pvekdhyqql eailkqaadr 301 fpkkaatv (5-dehydro-4-deoxyglucarate dehydratase (Bacillus vallismortis DV1-F-3)) SEQ ID NO: 78   1 mnrirkaptg ilgfpvapfn tqgqleeeal fqniefllee gleaifiacg sgefqslsqk  61 eyeqmvevav saaegkvpvy tgvggnlsta lewarlsekk gadgylilpp ylvhgegegl 121 yqyaktiies tdlnailyqr dnavlsleqi krlteceqlv gvkdgvgnmd lninlvytlg 181 drlgwlngmp maevtmpayl pigfhsyssa isnyiphisr mfydalkngn delvkelyqh 241 vilpindirk qrkgyaysli kagmeimgln vrntarppvg pvekehyrql eailkqaadr 301 fpkkaatv (5-dehydro-4-deoxyglucarate dehydratase (Bacillus subtilis subsp. spizizenii TU-B-10)) SEQ ID NO: 79   1 msrirkapag ilgfpvapfn tqgkleeeal fqniefllee gleaifiacg sgefqslsqk  61 eyeqmvevai saaggkvpvy tgvggnlsta lewaqlsekk gadgylilpp ylvhgegegl 121 yqyaktiies tdlnailyqr dnavlsveqi krltefeqlv gvkdgvgnmd lninlvytlg 181 drlgwlngmp maevtmpayl pigfhsyssa isnyiphisr mfydalkngd delvkelyqh 241 vilpindirk qrkgyaysli kagmeimgln vrntarppvg pvekdhyqql eailkqaadr 301 fpkkaatv (ycbC (Bacillus subtilis)) SEQ ID NO: 80   1 msrirkapag ilgfpvapfn tqgtleeeal fqniefllne gleaifiacg sgefqslsqk  61 eyeqmvevav saaggkvpvy tgvggnlsta ldwaqlsekk gadgylilpp ylvhgegegl 121 yqyaktiies tdlnailyqr dnavlsveqi krlteceqlv gvkdgvgnmd lninlvytig 181 drlgwlngmp maevtmpayl pigfhsyssa isnyiphisr mfydalkngn delvkelyrh 241 vilpindirk qrkgyaysli kagmeimgln vrntarppvg pvekdhyqql eailkqpadr 301 fpkkaatv Amino acid transporter LysE (HypE) (NP_743408.1; GI: 26987983; Amino acid transporter LysE (Pseudomonas putida KT2440)) SEQ ID NO: 81   1 maaesyrlqa ldpsrawhrf fatvqqqvek rafgddsseh clrnaqqelt mlgvtdygaf  61 viaflillai pgpgnfalit atgkggikag laatcgvivg dqvllwlava gvatllatyp 121 aafhmvqwag aaylaylglr mllskpggaa htcrmdngqy lrqtmmitll npkaimfyma 181 ffplfvdpvk hqglvtfgfm aatvavvtfl ygliavvlth qlaermrasp rianmferla 241 gaclvgfgik laamr (Amino acid transporter LysE (Pseudomonas putida BIRD-1)) SEQ ID NO: 82   1 mqqqvekraf gddssahclr naqweltmlg vtdygafvia flillaipgp gnfalitatg  61 kggikaglaa tcgvivgdqv llwlavagva tllatypaaf hvvqwagaay laylglrmll 121 skpggaahtc rmdngqylrq tmmitllnpk aimfymaffp lfvdpvkhqg lvtfgfmaat 181 vavvtflygl iavv1thqla ermraspria nmferlagac lvgfgiklaa mr (Amino acid transporter LysE (Pseudomonas putida ND6)) SEQ ID NO: 83   1 mqqqvekrav gddssahclr naqqeltmlg vtdygafvia flillaipgp gnfalitatg  61 kggikaglaa tcgvivgdqv llwlavagva tllatypaaf hmvqwagaay laylglrmll 121 skpggaahtc rmdngqylrq tmmitllnpk aimfymaffp lfvdpvkhqg lvtfgfmaat 181 vavvtflygl iavvlthgla ermranpria nmferlagac lvgfgiklaa mr (Lysine exporter protein LysE/YggA (Pseudomonas putida F1)) SEQ ID NO: 84   1 mlgvtdygaf viaflillai pgpgnfalit atgkggikag laatcgvivg dqvllwlava  61 gvatllatyp aafhmvqwag aaylaylglr mllskpggaa htcrmdngqy lrqtmmitll 121 npkaimfyma ffplfvdpvk hqglvtfgfm aatvavvtfl ygliavvlth qlaermranp 181 rianmferla gaclvgfgik laamr (Unknown (Pseudomonas putida)) SEQ ID NO: 85   1 mlgvtdygaf viafiillai pgpgnfalit atgkggikag laatcgvivg dqvllwlava  61 gvatllatyp aafhivqwag aaylaylglr mllskpgdap rtsrmdngqy lrqtmlitll 121 npkaimfyma ffplfidpvk hqglvtfgfm aatvavitfl ygliavvlth rlaermranp 181 ritnmferla gaclvgfgik laamr PP_1245 (NP_743405.1; GI: 26987980; Hypothetical protein PP_1245 (Pseudomonas putida KT2440)) SEQ ID NO: 86   1 mrptengvlh lrkkfvasll avaiasttac aqlgiskeqa gtvigglagv aigstmgsgn  61 gkiaaaliag gigayvgnri ghmldekdqq alalrtqevl sqqqttasaq pvtwksdhsg 121 ataqivpgke ytktkqvevk rapkiqavps mklinepyvt isdnlnvraa pngagekvgs 181 lknhteftav gstgdwilvg rkgvtvgyvh knyvepkaqa vakrvtpavn ldeldvaask 241 etqgfdldsv qslptqtvaa eaacrpvtvs lksgsgqteq eqntfckqan gtweli (SH3 type 3 domain-containing protein (Pseudomonas putida W619)) SEQ ID NO: 87   1 mrkkfvasll avaiatttac aqlgiskeqa gtvigglagv aigstmgsgn gkiaaaliag  61 gigayvgnri ghmldekdqq alalrtqevl sqsatasaqp vtwksdhsga taqitpgkey 121 tqtkkvevkr apkiqavpsm klinepyvti sdnlnvraap nttgekvgsl kshteftavg 181 stgdwilvgr kgvtvgyvhk nyvepkawai akraapavnl ddldvaanke tqgfdldsiq 241 slptetvaae aacrpvtvsl ksgsgqteqe qntfckqang tweli (Hypothetical protein G1E_03180 (Pseudomonas sp. TJI-51)) SEQ ID NO: 88   1 mrkkfvasll avaiasttac aqlgiskeqa gtvigglagv aigstlgsgn gkiaaaliag  61 gigayvgnri gnmldekdqq alalrtqevl sqqqatasaq pvtwksdhsg asaqivpgke 121 ytktkqvevk rapkiqavps mklinepyvt tsdnlnvraa pnasgekvgs lknhteftav 181 gatgdwilvg rkgvtvgyvh kdyvepkaqa vakrvtpavn ldeldvaask etqafdldsl 241 qslptqtvaa eaacrpvtvs lkaqngkteq eqntfckqan gtweli (SH3 type 3 domain-containing protein (Pseudomonas putida GB-1)) SEQ ID NO: 89   1 mrkkfvasll avaiasttac aqlgiskeqa gtvigglagv aigstmgsgn gkiaaaliag  61 gigayvgnri ghmldekdqq alalrtqevl sqqqatasaq pvtwksdhsg ataqivpgke 121 ytqtkkvevk rapkiqavps mklinepyvt vsdnlnvraa pnqsgekvgs lknhteftav 181 gstgdwilvg rkgvtvgyvh knyvepkaqa vakrvtpavn ldeldvaask etqgfdldsv 241 qslptetvaa eaacrpvtvs lksgsgqteq eqntfckqan gtweli (SH3 type 3 domain-containing protein (Pseudomonas putida F1)) SEQ ID NO: 90   1 mrkkfvasll avaiasttac aqlgiskeqa gtvigglagv aigstmgsgn gkiaaaliag  61 gigayvgnri ghmldekdqq alalrtqevl sqqqttasaq pvtwksdhsg ataqivpgke 121 ytktkqvevk rapkiqavps mklinepyvt isdnlnvraa pnqagekvgs lknhteftav 181 gstgdwilvg rkgvtvgyvh knyvepkaqa vakrvtpavn ldeldvaask etqgfdldsv 241 qslptqtvaa eaacrpvtvs lksgsgqteg eqntfckgan gtweli PP_1247 (NP_743407.1; GI: 26987982; Hypothetical protein PP_1247 (Pseudomonas putida KT2440)) SEQ ID NO: 91   1 mpicssgwrg lawwdsasnw rrcadpkpds vrarltatlk kppathgsrg lvhsaitqsi  61 gfqliglahe grrkgalafl egvllferav fdqllpdgaf rvavvlglga kvtaprrqpn 121 llaegcelcl gdlllvfaes lfqrfeaava hrvvldlgla gkaahrfsqh rlagvravra 181 nqhraggtle lgfdivqfrq rlevglandf phlgavvavg dherhrafai agaldgevqv 241 drgtkvtgaa dqkragywla hrhvgapgev rrggptiggq lgtwldfvad irhqhdfgpl 301 ggnvrvahlh aqqldmnaai laysvmgqlq rislqvhpgh iaadielvlg parqaffsrt 361 tlyglhgarq aahellgaig lrrrhadlry gyrqvagkrr vgnvplrqhi lkeiallevv 421 vvgqrsllar agdhriatte hqhrcghtan qqlllvhlfd hgvcltgpwr krcssrsrtv 481 grprgss (Uncharacterized protein LOC100789425 (Glycine max)) SEQ ID NO: 92   1 msniafrsti vfllfsavls tppedpikca tsenttctit nsygafpdrs ickaaqvlyp  61 tteqelvsvv asatrnktkm kvatrfshsi pklvopegen gllistkyln kilkvdvetr 121 tmtvesgvtl qqlineaakv glalpyapyw wgltigglmg tgahgstlrg kgsavhdyvv 181 elrivrpagp edgyamvenl neqhedlnaa kvslgvlgvi sqitlklepl fkrsityvak 241 ddsdlggqvv afgdahefad itwypsqhka iyrvddrvpi ntsgnglydf ipfrptpsla 301 svfirtteei qestndangk civastasnt litaaygltn ngiifagypi igfqnrlqss 361 gscldslqda littcawdpr mkglffhqtt fsirlsfvks fiedvqklve lepkglcvlg 421 lyngmlmryv tassaylghq enaldidity yrskdpmtpr lyedileeve qlgifkyggl 481 phwgknrnla fegaikkyks aeyflkvkek ydldglfsst wtdqvlglkd gvtilkdgca 541 leglciclqd shcnpskgyy crpgkvykea rvctnlk PP_1246 (NP_743406.1; GI: 26987981; Hypothetical protein PP_1246 (Pseudomonas putida KT2440)) SEQ ID NO: 93   1 mkkhalalav igacglvpqa fahelafskk dnikvevpgd atswckpqvd ltitrpawdn  61 gellaglitk lpfvfakdcs takvswkavd akgnlyasgs gnasnigivt laaapataap 121 apaaaptptp apapapapap aaaaapavve aapaqakpap apapapapav aaepapapea 181 paaapvvppa papatavaaa ptsdfgrsvv lenrnlmqvt dgtgckwvis tsiigdgdti 241 sfgttpampc pasgfgegsf dkiswkavgt yrgdnwtrvy ahpsglifnk nlepavkdka 301 vsyltpqadq aaflvgeipg rqmkvyltft rssygvlrpf ssdpyyvavt pdesfaldat 361 kykeaaleif dlikttsptt tdvanlfivk dlsaisnniw gndaqkitrn riginrqglf 421 fdvrdganwa vgreqqrvre grqrqqelar vhtrvieryq qlqdgmsdfk gretealaqm 481 agikvrfasp leqqnpatsa svvpmmvhvt gkkgdfysid fpsngrlvad eeysegwyvt 541 qvanatpyyp lddgravpty raysagepea ckqdhcadry sfgavlakef pnagidfswt 601 pevsqqyvnd wnnasamvq (Hypothetical protein TIE_4663 (Pseudomonas putida DOT-T1E)) SEQ ID NO: 94   1 mvienrnimq vtdgtgckwv lstsiigdgd tlsfgttpam pcpasgfgeg sfdkiswkav  61 gtyrgdnwtr vyahpsglif nkhlepavkd kaysyltpqa dqaafivgei pgrqmkvylt 121 ftrssygvlr pfgsdpyyva vtpdesfald atkykeaale ifdlikttsp tttdvanlfi 181 vkdlsaisnn iwgndaqkit rnriginrqg iffdvrdgan wavgreqqry reqrqrqqe1 241 arvhtrvier yqqlqdgmsd fkgreteala qmagikvrfa spleqqnpat sasvvpmmvh 301 vtgkkgdfys idfpsngrlv adeeysegwy vtqvanatpy yplddgravp tyraysagep 361 eackqdhcad rvsfgavlak efpnagidfs wtpevsqqyv ndwnnasamv q (Hypothetical protein YSA_07676 (Pseudomonas putida ND6)) SEQ ID NO: 95   1 mkkhalalav igacglvpqa fahelafskk dnikvevpgd attwckpqvd ltitrpawdn  61 gellsglitk lpfvfakdcs takvswkavd akgnlyasgs gnasnlgivt laaapataap 121 apaaavapap apagpeapaa aaptpapapa papapaaaaa pavveaapaq akpapapapa 181 pavaaepapt peapaaapvv ppapapatav aaaptsdfgr svvienrnlm qvtdgtgckw 241 vlstsiigdg dtlsfgttpa mpcpasgfge gsfdkiswka vgtyrgdnwt rvyahpsgli 301 fnkhlepavk dkaysyltpq adqaafivge ipgrqmkvyl tftrssygvl rpfgsdpyyv 361 avtpdesfal datkykeaal eifdliktts ptttdvanlf ivkdlsaisn niwgndaqki 421 trnriginrq glffdvrdga nwavqreqqr vreqrqrqqe larvhtrvle ryqqlqdgms 481 dfkgreteal aqmagikvrf aspleqqnpa tsasvvpmmv hvtgkkgdfy sidfpsngrl 541 vadeeysegw yvtqvanatp yyplddgrav ptyraysage peackqdhca drvsfgavla 601 kefpnagidf swtpevsqqy vndwnnasam vq (Hypothetical protein Pput_1275 (Pseudomonas putida F1)) SEQ ID NO: 96   1 mkkhalalav igacglvpqa fahelafskk dnikvevpgd attwckpqvd ltitrpawdn  61 qellsglltk lpfvfakdcs takvswkavd akgnlyasgs gnasnlglvt laaapapapa 121 papapapaaa apapaaavap apapagpeap aaaaptpapa papapaaaaa pavveaaaaq 181 akpapapapa pavaaepapt peapaaapvv ppapapatav aaaptsdfgr svvlenrnlm 241 qvtdgtgckw vlstsiigdg dtlsfgttpa mpcpasgfge gsfdkiswka vgtyrgdnwt 301 rvyahpsgli fnknlepavk dkaysyltpq adqaaflvge ipgrqmkvyl tftrssygvl 361 rpfgsdpyyv avtpdesfal datkykeaal eifdliktts ptttdvanlf ivkdlsaisn 421 niwgndaqki trnriginrq glffdvrdga nwavqreqqr vreqrqrqqe larvhtrvle 481 ryqqlqdgms dfkgreteal aqmagikvrf aspleqqnpa tsasvvpmmv hvtgkkgdfy 541 sidfpsngrl vadeeysegw yvtqvanatp yyplddgrav ptyraysage peackqdhca 601 drvsfgavla kefpnagidf swtpevsqqy vndwnnasam vg (Hypothetical protein PputGB1_4145 (Pseudomonas putida GB-1)) SEQ ID NO: 97   1 mkkhalalav vgacglvpqa fahelafskk enikvevpgd aatwckpeve ltitrpawdk  61 qellsglltk lpfvfakdca takvswkavd akgnlyasgs gnatnlglvt avapaaasa 121 apapapapap apapapapap avaalapaap avpapaeapa avaaapapav vepapakaev 181 apapvvaaep apapvaetpv aapvappvpa padavaaapt sdfgravvlq nrnlmqvtdg 241 tgckwvlsts iisdgdtlsf gttpvmpcpa sgfgegsfek iswkavgtyr gdnwtrvyah 301 psglifnknl esavkdkays yltadadqaa flvgeipsrq mkvyltftrs sygvlrpfss 361 dpyyvavtpd esfaldaaky keaaleifdl ikatsptttd vanlfivkdi saitnsmwgn 421 daqkitrnri gitrqglffd vreganwavq reqqrvreer grqqelarvh trvleryqql 481 qdgmsdfkgr etealaqmag ikvrfaspla qqdpatsary apmmvhvtgk kgdfytldfp 541 skgrlvadee ysegwyvtqv anatpyypld dgravptyra ysagepeacq qdhcadrvsf 601 gavlakefpn agidfswtpe vsqkyvndwn nasamvq Alpha-ketoisovalerate decarboxylase (YP_003353820.1; GI: 281491840; Alpha-ketoisovalerate decarboxylase (Lactococcus lactis subsp. lactis KF147)) SEQ ID NO: 98   1 mytvgdylld rlhelgieei fgvpgdynlq fldqiisrkd mkwvgnanel nasymadgya  61 rtkkaaaflt tfgvgelsav nglagsyaen lpvveivgsp tskvqnegkf vhhtladgdf 121 khfmkmhepv taartlltae natveidrvl sallkerkpv yinlpvdvaa akaekpslpl 181 kkenptsnts dgeilnkige slknakkpiv itgheiisfg lentvtqfis ktklpittln 241 fgkssvdetl psflgiyngk lsepnlkefv esadfilmlg vkltdsstga fthhlnenkm 301 islnidegki fnesiqnfdf eslisslldl sgieykgkyi dkkqedfvps nallsqdrlw 361 qavenitqsn etivaeggts ffgassiflk pkshfiggpl wgsigytfpa algsqiadke 421 srhllfigdg slqltvgelg lairekinpi cfiinndgyt vereihgpnq syndipmwny 481 sklpesfgat eervvskivr tenefvsvmk eaqadpnrmy wielvlaked apkvlkkmgk 541 lfaeqnks (Indole-3-pyruvate decarboxylase (Lactococcus lactis subsp. lactis IO-1)) SEQ ID NO: 99   1 mytvgdylld rlhelgieei fgvpgdynlq fldqiisrkd mkwvgnanel nasymadgya  61 rtkkaaaflt tfgvgelsav nglagsyaen lpvveivgsp tskvqnegkf vhhtladgdf 121 khfvkmhepv taartlltae natveidrvl svllkerkpv yinlpvdvaa akaekpslpl 181 kkenpnsnts dgeilnkige slknakkpiv itgheiisfg lektvtqfis ktklpittln 241 fgkssvdeal psflgiyngk lsepnlkefv esadfilmlg vkltdsstga fthhlnenkm 301 islninegki fsesiqnfdf eslisslldl sgieykgkyi dkkqenfvps nallsqdrlw 361 qavenitqsn etivaeggts ffgassiflk pkshfiggpl wgsigftfpa algsqiadke 421 srhllfigdg slqltvgelg lairekinpi cfiinndgyt vereihgpnq syndipmwny 481 sklpesfgat edrvvskivr tenefvsvmk eaqadpnrmy wielvlaked apkvlkkmgk 541 lfaeqnks (Branched-chain alpha-ketoacid decarboxylase Lactococcus lactis)) SEQ ID NO: 100   1 mytvgdylld rlhelgieei fgvpgdynlq fldqiisred mkwignanel nasymadgya  61 rtkkaaaflt tfgvgelsai nglagsyaen lpvveivgsp tskvqndgkf vhhtladgdf 121 khfmkmhepv taartlltae natyeidrvl sqllkerkpv yinlpvdvaa akaekpals1 181 ekessttntt eqvilskiee slknaqkpvv iaghevisfg lektvtqfvs etklpittln 241 fgksavdesl psflgiyngk lseislknfv esadfilmlg vkltdsstga fthhldenkm 301 islnidegii fnkvvedfdf ravvsslsel kgieyegqyi dkqyeefips saplsqdrlw 361 qavesltqsn etivaeggts ffgastiflk snsrfiggpl wgsigytfpa algsqiadke 421 srhllfigdg slqltvgelg lsireklnpi cfiinndgyt vereihgptq syndipmwny 481 sklpetfgat edrvvskivr tenefvsvmk eaqadvnrmy wielvleked apkllkkmgk 541 lfaeqnk (Chain A, branched-chain ketoacid decarboxylase (Kdca) (Lactococcus Lactis)) SEQ ID NO: 101   1 mgsshhhhhh ssglvprgsh masmytvgdy lldrlhelgi eeifgvpgdy nlqfldqiis  61 redmkwigna nelnasymad gyartkkaaa flttfgvgel sainglagsy aenlpvveiv 121 gsptskvqnd gkfvhhtlad gdfkhfmkmh epvtaartll taenatyeid rvlsqllker 181 kpvyinlpvd vaaakaekpa lslekesstt ntteqvilsk ieeslknaqk pvviaghevi 241 sfglektvtq fvsetklpit tlnfgksavd eslpsflgiy ngklseislk nfvesadfil 301 mlgvkltdss tgafthhlde nkmislnide giifnkvved fdfravvssl selkgieyeg 361 gyidkgyeef ipssaplsqd rlwqaveslt qsnetivaeg gtsffgasti flksnsrfig 421 qplwgsigyt fpaalgsqia dkesrhllfi gdgslqltvg elglsirekl npicfiinnd 481 gytvereihg ptqsyndipm wnysklpetf gatedrvvsk ivrtenefvs vmkeaqadvn 541 rmywielvle kedapkllkk mgklfaeqnk (Indole-3-pyruvate decarboxylase (Lactococcus lactis subsp. lactis II1403)) SEQ ID NO: 102   1 mytvgdylld rlhelgieei fgvpgdynlq fldqiisrkd mkwvgnanel nasymadgya  61 rtkkaaaflt tfgvgelsav nglagsyaen lpvveivgsp tskvqnegkf vhhtladgdf 121 khfmkmhepv taartlltae natveidrvl sallkerkpv yinlpvdvaa akaekpslp1 181 kkenptsnts dgeilnkige slknakkpiv itgheiisfg lektvtqfis ktklpittln 241 fgkssvdetl psflgiyngk lsepnlkefv esadfilmlg vkltdsstga fthhlnenkm 301 islninegki fnerignfdf eslisslldl sgieykgkyi dkkqedfvps nallsqdrlw 361 qavenitqsn etivaeqgts ffgassiflk pkshfigqpl wgsigytfpa algsqiadke 421 srhllfigd slqltvgerk lqvqvscipss shmnsys Alcohol dehydrogenase yqhD (YP_001459806.1; GI: 157162488; Alcohol dehydrogenase yqhD (Escherichia coli HS)) SEQ ID NO: 103   1 mnnfnlhtpt rilfgkgaia glreqiphda rvlitygggs vkktgvldqv ldalkgmdvl  61 efggiepnpa yetlmnavkl vreqkvtfll avgggsvldg tkfiaaaany penidpwhil 121 qtggkeiksa ipmgcvltlp atgsesnaga visrkttgdk qafhsahvqp vfavldpvyt 181 ytlpprqvan gvvdafvhtv eqyvtkpvda kiqdrfaegi lltliedgpk alkepenydv 241 ranvmwaatq alngligagv pqdwathmlg heltamhgld haqtlaivlp alwnekrdtk 301 rakllqyaer vwnitegsdd eridaaiaat rnffeqlgvp thlsdygldg ssipallkkl 361 eehgmtqlge nhditldvsr riyeaar (Alcohol dehydrogenase, iron-dependent (Escherichia coli 97.0259)) SEQ ID NO: 104   1 mnnfnlhtpt rilfgkgaia glreqiphda rvlitygggs vkktgvldqv ldalkgmdvl  61 efggiepnpa yetlmnavkl vreqkvtfll avgggsvldg tkfiaaaany penidpwhil 121 qtggkeiksa ipmgcvltlp atgsesnaga visrkttgdk qafhsahvqp vfavldpvyt 181 ytlpprqvan gvvdafvhtv eqyvtkpvda kiqdrfaegi lltliedgpk alkepenydv 241 ranvmwaatq alngligagv pqdwathmlg heltamhgld haqtlaivlp alwnekrdtk 301 rakllqyaer iwnitegsdd eridaaiaat rnffeqlgvp thlsdygldg ssipallkkl 361 eehgmtqlge nhditldvsr riyeaar (Alcohol dehydrogenase (Escherichia coli MS 200-1)) SEQ ID NO: 105   1 mnnfnlhtpt rilfgkgaia glreqiphda rvlitygggs vkktgvldqv lnalkgmdvl  61 efggiepnpa yetlmnavkl vreqkvtfll avgggsvldg tkfiaaaany penidpwhil 121 qtggkeiksa ipmgcvltlp atgsesnaga visrkttgdk qafhsahvqp vfavldpvyt 181 ytlpprqvan gvvdafvhtv eqyvtkpvda kiqdrfaegi lltliedgpk alkepenydv 241 ranvmwaatq alngligagv pqdwathmlg heltamhgld haqtlaivlp alwnekrdtk 301 rakllqyaer vwnitegsdd eridaaiaat rnffeqlgvp thlsdygldg ssipallkkl 361 eehgmtqlge nhditldvsr riyeaar (Alcohol dehydrogenase yqhD (Escherichia coli B7A)) SEQ ID NO: 106   1 mnnfnlhtpt rilfgkgaia glreqiphda rvlitygggs vkktgvldqv ldalkgmdvl  61 efggiepnpa yetlmnavkl vreqkvtfll avgggsvldg tkfiaaaany penidpwhil 121 qtggkeiksa ipmgcvltlp atgsesnaga visrkttgdk qafhsahvqp vfavldpvyt 181 ytlpprqvan gvvdafvhtv eqyvtkpvda kiqdrfaegi lltliedgpk alkepenydv 241 ranvmwaatq alngligagv pqdwathmlg heltamhgld haqtlaivlp alwnekretk 301 rakllqyaer vwnitegsdd eridaaiaat rnffeqlgvp thlsdygldg ssipallkkl 361 eehgmtqlge nhditldvsr riyeaar (Alcohol dehydrogenase (Escherichia coli MS 196-1)) SEQ ID NO: 107   1 mnnfnlhtpt rilfgkgaia glreqiphda rvlitygggs vkktgvldqv ldalkgmdvl  61 efggiepnpa yetlmnavkl vreqkvtfll avgggsvldg tkfiaaaany penidpwhil 121 qtggkeiksa ipmgcvltlp atgsesnaga visrkttgdk qafhsahvqp vfavldpvyt 181 ytlpprqvan gvvdafvhtv eqyvtkpvda kiqdrfaegi lltliedgpk alkepenydv 241 ranvmwaatq alngligagv pqdwathmlg hkltamhgld haqtlaivlp alwnekrdtk 301 rakllqyaer vwnitegsdd eridaaiaat rnffeqlgvp thlsdygldg ssipallkkl 361 eehgmtqlge nhditldvsr riyeaar

Claims

1. A recombinant microbial cell modified to exhibit increased biosynthesis of a TCA derivative compared to a wild-type control.

2-134. (canceled)

Patent History
Publication number: 20180080032
Type: Application
Filed: Dec 4, 2017
Publication Date: Mar 22, 2018
Inventors: Kechun ZHANG (Roseville, MN), Mingyong XIONG (Manitowoc, WI)
Application Number: 15/830,765
Classifications
International Classification: C12N 15/52 (20060101); C12N 9/02 (20060101); C12N 9/88 (20060101); C12N 9/18 (20060101); C12N 9/04 (20060101); C12P 7/18 (20060101);