CROSS-REFERENCE TO RELATED APPLICATION This application claims priority to U.S. Provisional Patent Application Ser. No. 61/738,752, filed Dec. 18, 2012 and U.S. Provisional Patent Application Ser. No. 61/821,490, filed May 9, 2013, each of which is incorporated herein by reference.
SUMMARY This disclosure describes, in one aspect, a recombinant microbial cell modified to exhibit increased biosynthesis of a TCA derivative compared to a wild-type control. In some embodiments, the TCA derivative can include 1,4-butanediol. In various embodiments, the microbial cell is a fungal cell or a bacterial cell. In some embodiments, the increased biosynthesis of the TCA derivative can include an increase in xylose dehydrogenase activity, xylonolactonase activity, xylonate dehydratase activity, or 2-keto-3-deoxyaldonic acid dehydratase activity.
In another aspect, this disclosure describes a method that generally includes incubating any embodiments of the recombinant cell summarized above in medium that includes a carbon source under conditions effective for the recombinant cell to produce a TCA derivative. In some embodiments, the TCA derivative can include 1,4-butanediol. In some embodiments, the carbon source can include xylose, arabinose, glucaric acid, galactaric acid, or hydroxyproline. In some embodiments, the increased biosynthesis of the TCA derivative can include an increase in pentose dehydrogenase activity, pentonolactonase activity, aldonic acid dehydratase activity, or 2-keto-3-deoxyaldonic acid dehydratase activity. In other embodiments, the increased biosynthesis of the TCA derivative can include an increase in hexic acid dehydratase activity or 5-dehydro-4-deoxyglucarate dehydratase activity.
In another aspect, this disclosure describes a method that generally includes introducing into a host cell a heterologous polynucleotide encoding at least one polypeptide that catalyzes conversion of a carbon source to a TCA derivative, wherein the at least one polypeptide is operably linked to a promoter so that the modified host cell catalyzes conversion of the carbon source to TCA derivative. In some embodiments, the TCA derivative can include 1,4-butanediol. In some embodiments, the carbon source can include xylose.
The above summary of the present invention is not intended to describe each disclosed embodiment or every implementation of the present invention. The description that follows more particularly exemplifies illustrative embodiments. In several places throughout the application, guidance is provided through lists of examples, which examples can be used in various combinations. In each instance, the recited list serves only as a representative group and should not be interpreted as an exclusive list.
BRIEF DESCRIPTION OF THE FIGURES FIG. 1. The 1,4-butanediol synthetic pathway in E. coli. (A) The synthetic pathway for 1,4-butanediol from glucose and xylose. Abbreviations: G-6P, glucose-6-phosphate; F-6P, fructose-6-phosphate; DHAP, dihydroxyacetone phosphate; GAP, glyceraldehyde-3-phosphate. (B) Synthetic operon for protein overexpression to drive the xylose towards 2,5-dioxopentanoic acid (left), and then drive 2,5-dioxopentanoic acid towards to 1,4-butanediol (right).
FIG. 2. A, scheme of the organization of conserved genetic clusters involved in the pentose, hexaric acid, and hydroxyproline degradation. Analogous functions are indicated in the same degree of shading. Coding region sizes and distances are not to scale. Protein family numbers are displayed below each coding region according to Clusters of Orthologous Groups of proteins classification system. The coding regions indicated in white or gray encode the following proteins: araA, transcriptional regulator; araF-araH, 1-Ara ABC transporter (periplasmic 1-Ara binding protein, ATP-binding protein, permease); rrnAC3038, heat shock protein X; ycbE, glucarate/galactarate permease; ycbG, transcriptional regulator; PP1249, hydroxyproline permease. B, schematic representation of the convergence of catabolic pathways for pentoses, hexaric acids, and hydroxyproline at the level of 2,5-dioxopentanoate. Enzymatic activities are indicated by their EC number. Dashed lines indicate proposed spontaneous reactions.
FIG. 3. An engineered 1,4-butanediol synthetic pathway in E. coli.
FIG. 4. An exemplary engineered metabolic pathway from 2,5-dioxopentanoic acid to 1,4-butanediol.
FIG. 5. An exemplary engineered metabolic pathway from 2,5-dioxopentanoic acid to 1,4-butanediol.
FIG. 6. An exemplary engineered metabolic pathway from D-arabonose to 2,5-dioxopentanoic acid.
FIG. 7. An exemplary engineered metabolic pathway from D-xylose to 2,5-dioxopentanoic acid.
FIG. 8. An exemplary engineered metabolic pathway from L-arabinose to 2,5-dioxopentanoic acid.
FIG. 9. An exemplary engineered metabolic pathway from D-glucaric acid to 2,5-dioxopentanoic acid.
FIG. 10. An exemplary engineered metabolic pathway from D-galactaric acid to 2,5-dioxopentanoic acid.
FIG. 11. An exemplary engineered metabolic pathway from 4(R)-hydroxy-L-proline to 2,5-dioxopentanoic acid.
FIG. 12. A plasmid map of YEplac195-xylBCDX (13945 bp).
FIG. 13. A plasmid map of YEplac11-KivDyqhD (9687 bp).
FIG. 14. Gas chromatography data showing production of 1,4-butanediol by genetically engineered S. cerevisiae.
DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS This disclosure describes a novel full biosynthetic pathway to biosynthesize high-volume TCA derivatives such as succinate, amino acids, and 1,4-butanediol from xylose by an engineered microbe. The TCA cycle can lead to many commercially important biobased chemicals such as, for example, amino acids (e.g., glutamate, threonine and lysine) and organic acids (e.g., succinate, maleate and fumarate). Here we report the engineering of a shortcut metabolic pathway to TCA cycle. The process from xylose to TCA only involves five steps as compared to conventional published pathways that include more than 20 steps. Because our pathway includes fewer steps from xylose to the TCA cycle, our pathway can produce TCA derivatives with the production of less by-product and, therefore, achieve higher yields than conventional biosynthetic pathways.
We have selected the TCA derivative 1,4-butanediol as a model product to demonstrate the generality of our novel biosynthetic pathway. 1,4-butanediol is a major commodity chemical; 2.5 million tons of 1,4-butanediol are used per year to make, for example, plastics, polyesters, and spandex fibers. 1,4-butanediol also can react, for example, with dicarboxylic acids to yield polyesters, with diisocyanates to yield polyurethanes, and with phosgene to yield chloroformates. Because our pathway permits the biosynthesis of 1,4-butanediol from, for example, xylose in only six steps from xylose to 1,4-butanediol, 1,4-butanediol may be biosynthesized with less by-product being formed and, therefore, a higher yield. For example, our pathway can produce produce 1.0 g/L 1,4-butanediol from 20 g/L xylose.
1,4-butanediol currently is manufactured from petroleum-based feedstocks such as acetylene, butane, propylene, and butadiene. Given the industrial importance of 1,4-butanediol as a chemical intermediate and the issues associated with petroleum feedstocks, alternative low-cost renewable biosynthetic routes from sugars have been sought. However, the highly reduced nature of 1,4-butanediol relative to carbohydrates has thwarted attempts thus far to develop effective pathways and organisms for direct production.
1,4-butanediol has been reported to be synthesized from glucose and xylose by engineered E. coli in which the succinyl-CoA intermediate was converted into succinate semialdehyde, 4-hydroxybutyrate, 4-hydroxybutyryl-CoA, 4-hydroxybutyraldehyde, and 1,4-butanediol by multiple enzymes from various organisms. This process involves around 20 chemical steps that include the pentose phosphate pathway, glycolysis, the TCA cycle, and designed artificial downstream metabolic steps. In contrast, this disclosure describes a shortcut pathway that requires only six steps (FIG. 1A).
D-xylose is converted by Caulobacter crescentus sequentially to D-xylonolactone, D-xylonate (D-xylonoic acid), 2-keto-3-deoxy-xylonate (2-oxo-4(S),5-dihydroxy-pentanoic acid), then α-ketoglutaric semialdehyde (2,5-dioxopentanoic acid) by, respectively, xylose dehydrogenase (xylB), xylonolactonase (xylC), xylonate dehydrogenase (xylD), Kda dehydratase (xylX). We cloned the coding regions of these enzymes into a single plasmid (pBDO-1), which was then transformed into an E. coli host cell. The host cell was then further modified to include a second plasmid that included a decarboxylase and an alcohol dehydrogenase. The decarboxylase converts the α-ketoglutaric semialdehyde to succinaldehyde; the alcohol dehydrogenase reduces the succinaldehyde to 1,4-butanediol (FIG. 1A). In some embodiments, the second plasmid was identified as pBDO-3 and included the coding regions of benzoylformate decarboxylase BFD (Pseudomonas putida) and an alcohol dehydrogenase of yqhD (E. coli). In other embodiments, the second plasmid was identified as pBDO-4 and included the decarboxylase of KIVD (Lactococcus lactis) and alcohol dehydrogenase of yqhD (E. coli).
The E. coli host cell possesses an endogenous xylose metabolism pathway that includes xylA, yjhH and yagE. To improve the product yield from xylose to 1,4-butanediol, expression of these three coding regions were inhibited. The host cell strain SBDO-1 is based on E. coli BW25113 in which xylA, yjhH, and yagE are knocked out so that SBDO-1 cannot metabolize xylose. Strain SBDO-2, carrying plasmid pBDO-1, also cannot metabolize xylose.
The strain SBDO-3, which is based on SBDO-2 but carries plasmid pBDO-2 that expresses α-ketoglutaric semialdehyde dehydrogenase xylA, can consume xylose quickly. These results indicate that the endogenous xylose utilization pathway in E. coli was blocked fully by the ΔxylA, ΔyjhH, and ΔyagE deletions in SBDO-1. Moreover, these results demonstrate that the C. crescentus enzymes function in E. coli. Consequently, xylose metabolism observed in SBDO-4 and SBDO-5 is attributable to the xylose pathway from C. crescentus that we engineered into the host cell. To produce 1,4-butanediol, plasmids pBDO-3 or pBDO-4, each of which expresses the same alcohol dehydrogenase but a different decarboxylase, were introduced into strain SBDO-2 strain. After two days of fermentation, strain SBDO-4 (carrying pBDO-3) produced 0.25 g/L 1,4-butanediol with 0.1 g/L 1,2,4-butanetriol (a by-product); strain SBDO-5 (carrying pBDP-4) produced 1.0 g/L 1,4-butanediol with 4.0 g/L 1,2,4-butanetriol. Thus, the kivD encoded on pBDO-4 and carried by strain SBDO-5 provides better yield of 1,4-butanediol than BFD. Other than 1,2,4-butanetriol, no other byproducts were detected in significant amounts in the fermentation broth, suggesting that our new 1,4-butanediol producing pathway has higher 1,4-butanediol yield as compared with the published pathway (Yim et al., 2011. Nat. Chem. Biol. 7:445-452).
Thus, in one aspect, the invention provides recombinant microbial cell modified to exhibit increased biosynthesis of a TCA derivative compared to a wild-type control.
While described above in the context of an exemplary embodiment in which the TCA derivative is a 1,4-butanediol, the recombinant cells and methods described herein can provide TCA derivatives other than 1,4-butanediol. Exemplary alternative TCA derivatives include, for example, succinate, fumarate, malate, glutamate, lysine, threonine, 4-hydroxybutyrate, and products synthesizable from a product of the TCA cycle in one, two, three, four, or five enzymatic steps. In some of these embodiments, one or more enzymes involved in the synthesis of the TCA derivative may be heterologous to the host cell and, therefore, provided recombinantly. Exemplary TCA derivative products and exemplary enzymes involved in the synthesis of the exemplary TCA derivative products are listed in Table 1. For any embodiment in which the identified enzyme is not endogenous to a host cell, the enzyme may be introduced into the host cell to produce a recombinant cell as described herein.
TABLE 1
Exemplary enzymes, enzyme sources, native substrates, and TCA derivative products
SEQ
Encoding Accession No.: Native TCA derivative ID
Common Name Organism gene GI No. Substrate product NO
D-arabinose dehydrogenase
alcohol Sulfolobus SSO1300 NP_342747.1; D-arabinose D-arabinonic 1
dehydrogenase solfataricus GI: 15898142 acid from D-
(AraDH) arabinose
D-arabinonate dehydratase
arabinonate Sulfolobus SSO3124 NP_344435.1; D-arabinonic 2-oxo-4(S),5- 6
dehydratase (AraD) solfataricus GI: 15899830 acid dihydroxy-
pentanoic acid
2-Keto-3-deoxy-D-arabinonate Dehydratase
2-keto-4- Sulfolobus SSO3118 NP_344431.1; 2-oxo-4(S),5- 2,5- 11
pentenoate solfataricus GI: 15899826 dihydroxy- dioxopentanoic
hydratase (KdaD) pentanoic acid acid
2,5-dioxopentanoate dehydrogenase
aldehyde Sulfolobus SSO3117 NP_344430.1; 2,5- 2-oxoglutaric 16
dehydrogenase solfataricus GI: 15899825 dioxopentanoic acid
(DopDH) acid
2,5-dioxovalerate dehydrogenase
2,5-dioxovalerate Bacillus YcbD NP_388129.1; 2,5- 2-oxoglutaric 21
dehydrogenase subtilis GI: 16077316 dioxopentanoic acid
(YcbD) acid
D-xylose dehydrogenase
D-Xylose Caulobacter CC0821 YP_002516237.1; D-xylose D-xylonolactone 26
dehydrogenase crescentus GI: 221233801
(XylB)
D-xylonolactonase
D-xylonolactonase Caulobacter CC0820 YP_002516236.1; D-xylonolactone D-xylonic acid 31
(XylC) crescentus GI: 221233800
D-xylonate dehydratase
D-xylonate Caulobacter CC0819 NP_419636.1 D-xylonic acid 2-oxo-4(S),5- 36
dehydratase (XylD) crescentus GI: 16125072 dihydroxy-
pentanoic acid
2-Keto-3-deoxy-D-arabinonate dehydratase
2-keto-4- Caulobacter CC0823 NP_419640.1; 2-oxo-4(S),5- 2,5- 41
pentenoate crescentus GI: 16125076 dihydroxy- dioxopentanoic
hydratase (XylX) pentanoic acid acid
L-arabinose dehydrogenase
dehydrogenase Burkholderia BTH_II1629 YP_439823.1; L-arabinose L- 46
(AraE) thailandensis GI: 83716868 arabinonolactone
E264 from L-arabinose
L-arabinonolactonase
L- Burkholderia BTH_II1625 YP_439819.1; L- L-arabinonic acid 51
arabinonolactonase thailandensis GI: 83717359 arabinonolactone
(Aral) E264
L-arabinonate dehydiatase
L-arabinonate Burkholderia BTH_II1632 YP_439826.1; L-arabinonic acid 2-oxo-4(R),5- 56
dehydratase (AraB) thailandensis GI: 83718062 dihydroxy-
E264 pentanoic acid
2-Keto-3-deoxy-L-arabinonate Dehydratase
dihydrodipicolinate Burkholderia BTH_II1630 YP_439824.1; 2-oxo-4(R),5- 2,5- 61
synthase (AraD) thailandensis GI: 83717217 dihydroxy- dioxopentanoic
E264 pentanoic acid acid
D-glucarate dehydratase
D-glucarate Bacillus YcbF NP_388131.2; D-glucaric acid 4-deoxy-5-keto- 66
dehydratase subtilis GI: 255767063 D-glucaric acid
(YcbF)
D-galactarate dehydratase
D-galactarate Bacillus YcbH NP_388133.2; D-galactaric acid 4-deoxy-5-keto- 71
dehydratase subtilis GI: 255767065 D-glucaric acid
(YcbH)
5-dehydro-4-deoxyglucarate dehydratase
5-dehydro-4- Bacillus YcbC NP_388128.2; 4-deoxy-5-keto- 2,5- 76
deoxyglucarate subtilis GI: 255767061 D-glucaric acid dioxopentanoic
dehydratase acid
(YcbC)
Amino acid transporter LysE
Amino acid Pseudomonas PP_1248 NP_743408.1; 4(R)-hydroxy-L- 4(R)-hydroxy-D- 81
transporter LysE putida GI: 26987983 proline proline
(HypE)
PP_1245
Hypothetical Pseudomonas PP_1245 NP_743405.1; 4(R)-hydroxy-D- 2-carboxy-4(R)- 86
protein of PP_1245 putida GI: 26987980 proline hydroxy-pyrroline
PP_1247
Hypothetical Pseudomonas PP_1247 NP_743407.1; 2-carboxy-4(R)- 2,5- 91
protein of PP_1247 putida GI: 26987982 hydroxy-pyrroline dioxopentanoic
acid
PP_1246
Hypothetical Pseudomonas PP_1246 NP_743406.1; 2,5- 2-oxoglutaric 93
protein of PP_1246 putida GI: 6987981 dioxopentanoic acid
acid
Alpha-ketolsoyalerate decarboxylase
alpha- Lactococcus KivD YP_003353820.1; 2,5- Succinaldehyde 98
ketolsoyalerate lactis GI: 281491840 dioxopentanoic
decarboxylase acid
Alcohol dehydrogenase (YqhD)
alcohol E.coli yqhD YP_001459806.1; Succinaldehyde 1,4-butanediol 103
dehydrogenase GI: 157162488
In addition to the enzymes listed in Table 1, homologs of the listed enzymes may be used. Thus, as an alternative to AraDH (SEQ ID NO:1), one may use, for example, any of the polypeptides depicted in SEQ ID NO:2-5; as an alternative to AraD (SEQ ID NO:6), one may use, for example, any of the polypeptides depicted in SEQ ID NO: 7-10; as an alternative to Kda (SEQ ID NO:11), one may use, for example, any of the polypeptides depicted in SEQ ID NO: 12-15; as an alternative to DopDH (SEQ ID NO:16), one may use, for example, any of the polypeptides depicted in SEQ ID NO:17-20; as an alternative to YcbD (SEQ ID NO:21), one may use, for example, any of the polypeptides depicted in SEQ ID NO:22-25; as an alternative to XylB (SEQ ID NO:26), one may use, for example, any of the polypeptides depicted in SEQ ID NO:27-30; as an alternative to XylC (SEQ ID NO:31), one may use, for example, any of the polypeptides depicted in SEQ ID NO:32-35; as an alternative to XylD (SEQ ID NO:36), one may use, for example, any of the polypeptides depicted in SEQ ID NO:37-40; as an alternative to XylX (SEQ ID NO:41), one may use, for example, any of the polypeptides depicted in SEQ ID NO:42-45; as an alternative to AraE (SEQ ID NO:46), one may use, for example, any of the polypeptides depicted in SEQ ID NO:47-50; as an alternative to AraI (SEQ ID NO:51), one may use, for example, any of the polypeptides depicted in SEQ ID NO:52-55; as an alternative to AraB (SEQ ID NO:56), one may use, for example, any of the polypeptides depicted in SEQ ID NO:57-60; as an alternative to AraD (SEQ ID NO:61), one may use, for example, any of the polypeptides depicted in SEQ ID NO:62-65; as an alternative to YcbF (SEQ ID NO:66), one may use, for example, any of the polypeptides depicted in SEQ ID NO:67-70; as an alternative to YcbH (SEQ ID NO:71), one may use, for example, any of the polypeptides depicted in SEQ ID NO:72-75; as an alternative to YcbC (SEQ ID NO:76), one may use, for example, any of the polypeptides depicted in SEQ ID NO:77-80; as an alternative to HypE (SEQ ID NO:81), one may use, for example, any of the polypeptides depicted in SEQ ID NO:82-85; as an alternative to PP_1245 (SEQ ID NO:86), one may use, for example, any of the polypeptides depicted in SEQ ID NO:87-90; as an alternative to PP_1247 (SEQ ID NO:91), one may use, for example, the polypeptide depicted in SEQ ID NO:92; as an alternative to PP_1246 (SEQ ID NO:93), one may use, for example, any of the polypeptides depicted in SEQ ID NO:94-97; as an alternative to alpha-ketoisovalerate decarboxylase (SEQ ID NO:98), one may use, for example, any of the polypeptides depicted in SEQ ID NO:99-102; as an alternative to YqhD (SEQ ID NO:103), one may use, for example, any of the polypeptides depicted in SEQ ID NO:104-107.
In some cases, the wild-type control may be unable to produce the TCA derivative and, therefore, an increase in the biosynthesis of a particular product may reflect any measurable biosynthesis of that product. In certain embodiments, an increase in the biosynthesis of a TCA derivative can include biosynthesis sufficient for a culture of the microbial cell to accumulate the TCA derivative to a predetermine concentration.
The predetermined concentration may be any predetermined concentration of the product suitable for a given application. Thus, a predetermined concentration may be, for example, a concentration of at least 0.1 g/L such as, for example, at least 0.25 g/L, at least 0.5 g/L, at least 1.0 g/L, at least 2.0 g/L, at least 3.0 g/L, at least 4.0 g/L, at least 5.0 g/L, at least 6.0 g/L, at least 7.0 g/L, at least 8.0 g/L, at least 9.0 g/L, at least 10 g/L, at least 20 g/L, at least 50 g/L, at least 100 g/L, or at least 200 g/L.
While described above in the context of an exemplary embodiment in which the host cell is E. coli, the recombinant cells described herein can be constructed, and the methods of making and using the recombinant cells can be performed, using any suitable host cell.
Thus, the recombinant cell can be, or be derived from, any suitable microbe including, for example, a prokaryotic microbe or a eukaryotic microbe. As used herein, the term “or derived from” in connection with a microbe simply allows for the “host cell” to possess one or more genetic modifications before being modified to exhibit the indicated increased biosynthetic activity. Thus, the term “recombinant cell” encompasses a “host cell” that may contain nucleic acid material from more than one species before being modified to exhibit the indicated biosynthetic activity.
In some embodiments, the host cell may be selected to possess one or more natural physiological activities. For example, the host cell may be photosynthetic (e.g., cyanobacteria) or may be cellulolytic (e.g., Clostridium cellulolyticum).
In some embodiments, the recombinant cell may be, or be derived from, a eukaryotic microbe such as, for example, a fungal cell. In some of these embodiments, the fungal cell may be, or be derived from, a member of the Saccharomycetaceae family such as, for example, Saccharomyces cerevisiae, Candida rugosa, or Candida albicans.
In other embodiments, the recombinant cell may be, or be derived from, a prokaryotic microbe such as, for example, a bacterium. In some of these embodiments, the bacterium may be a member of the phylum Protobacteria. Exemplary members of the phylum Protobacteria include, for example, members of the Enterobacteriaceae family (e.g., Escherichia coli) and, for example, members of the Pseudomonaceae family (e.g., Pseudomonas putida). In other cases, the bacterium may be a member of the phylum Firmicutes. Exemplary members of the phylum Firmicutes include, for example, members of the Bacillaceae family (e.g., Bacillus subtilis), members of the Clostridiaceae family (e.g., Clostridium cellulolyticum) and, for example, members of the Streptococcaceae family (e.g., Lactococcus lactis). In other cases, the bacterium may be a member of the phylum Cyanobacteria.
In some embodiments, the increased biosynthesis of the TCA derivative compared to a wild-type control can include an increase in activity of one or more enzymes involved in the metabolism of the carbon source (e.g., xylose or arabinose). Such enzymes may be found in the proteome of microbes such as, for example, Sulfolobus solfataricus, Caulobacter crescentus, Burkholderia thailandensis, Haloarcula marismortui, Bacillus subtilis, and Pseudomonas putida. Exemplary enzymes, shown in the context of their native metabolic pathways, are shown in FIG. 2. So, for example, increased biosynthesis of the TCA derivative can include an increase in activity of one or more enzymes involved in the metabolism of D-xylose in Caulobacter crescentus such as, for example, xylose dehydrogenase (FIG. 2, CC0821) activity, xylonolactonase (FIG. 2, CC0819) activity, xylonate dehydrogenase (FIG. 2, CC0822) activity, and 2-keto-3-deoxyaldonic acid dehydratase (FIG. 2, CC0823) activity compared to the wild-type control.
In some embodiments, the increased biosynthesis of the TCA derivative compared to a wild-type control can further include an increase in benzoylformate decarboxylase activity and an increase in alcohol dehydrogenase activity. In some of these embodiments, the benzoylformate decarboxylase can include BFD of Pseudomonas putida. In some of these embodiments, the alcohol dehydrogenase can include yqhD of E. coli.
In some embodiments, the increased biosynthesis of the TCA derivative compared to a wild-type control can further include an increase in decarboxylase activity and an increase in alcohol dehydrogenase activity. In some of these embodiments, the decarboxylase can include KIVD of Lactococcus lactis. In some of these embodiments, the alcohol dehydrogenase can include yqhD of E. coli. See, e.g., Example 2 and FIGS. 12-14.
In some embodiments, the recombinant cell can include an engineered metabolic pathway designed to permit the recombinant cell to increase its consumption of a particular carbon source compared to a wild-type control. Exemplary metabolic pathways are illustrated in, for example, FIG. 6 through FIG. 11. Accordingly, exemplary carbon sources include, for example, arabinose, xylose, arabinose, glucaric acid, galactaric acid, or hydroxyproline. In other embodiments, the recombinant cell may be designed to consume a uronic acid such as, for example, galacturonic acid and/or glucuronic acid as a carbon source. In such embodiments, a heterologous polynucleotide that encodes a uronate dehydrogenase enzyme may be introduced into the recombinant cell to confer to the recombinant cell the ability to convert uronic acid to aldonic acid. In still other embodiments, the recombinant cell can utilize a carbon source that includes, for example, glucose, cellulose, galacturonic acid, glucuronic acid, CO2, or glycerol. In some of these embodiments, the recombinant cell may be further modified to convert the carbon source (e.g., glucose) to one or more of the carbon sources (e.g., xylose and/or a hexaric acid such as, e.g., glucaric acid) that is an entry point to one or more of the engineered pathways described herein.
FIG. 6 shows an exemplary metabolic pathway that permits a recombinant cell to use D-arabinose as a carbon source for the production of 2,5-dioxopentanoic acid. In this example, the recombinant cell can include an enzyme that can convert D-arabinose into D-arabinolactone such as, for example, a pentose dehydrogenase. One example of a suitable pentose dehydrogenase includes AraDH from Sulfolobus solfataricus. The pentose dehydrogenase can provide catalytic conversion of D-arabinose into D-arabinolactone that is, for example, at least 110% greater than that exhibited by a wild-type control.
The exemplary metabolic pathway illustrated in FIG. 6 also includes an enzyme that can convert D-arabinonic acid to 2-oxo-4(S),5-dihydroxy-pentanoic acid such as, for example, an aldonic acid dehydratase. One example of a suitable aldonic acid dehydratase includes AraD from Sulfolobus solfataricus. The aldonic acid dehydratase can provide catalytic conversion of D-arabinonic acid into 2-oxo-zhS),5-dihydroxy-peritanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.
The exemplary metabolic pathway illustrated in FIG. 6 also includes an enzyme that can convert 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid such as, for example, a 2-keto-3-deoxyaldonic acid dehydratase. On example of a suitable 2-keto-3-deoxyaldonic add dehydratase includes KdaD from Sulfolobus solfataricus. The 2-keto-3-deoxyaldonic acid dehydratase can provide catalytic conversion of 2-oxo-4(S) 5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.
FIG. 7 shows an exemplary metabolic pathway that permits a recombinant cell to use D-xylose as a carbon source for the production of 2,5-dioxopentanoic acid. In this example, the recombinant cell can include an enzyme that can convert. D-xylose to D-xylonolactone such as, for example, a pentose dehydrogenase. Exemplary suitable pentose dehydrogenases include XylB from Caulobacter crescentus or rmAC3034 from Haloarcula marismortui. The pentose dehydrogenase can provide catalytic conversion of D-xylose to D-xylonolactone that is, for example, at least 110% greater than that exhibited by a wild-type control.
The exemplary metabolic pathway illustrated in FIG. 7 also includes an enzyme that can convert D-xylonolactone to D-xylonic acid such as, for example, a pentonolactonase. Exemplary suitable pentonolactonases include XylC from Caulobacter crescentus or rmAC3033 from Haloarcula marismortui. The pentonolactonase can provide catalytic conversion of D-xylonolactone to D-xylonic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.
The exemplary metabolic pathway illustrated in FIG. 7 also includes an enzyme that can convert D-xylonic acid to 2-oxo-4(S),5-dihydroxy-pentanoic acid such as, for example, an aldonic acid dehydratase. Exemplary suitable aldonic acid dehydratases include XylD from Caulobacter crescentus or rrnAC3032 from Haloarcula marismortui. The aldonic acid dehydratase can provide catalytic conversion of D-xylonic acid into 2-oxo-4(S),5-dihydroxy-pentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.
The exemplary metabolic pathway illustrated in FIG. 7 also includes an enzyme that can convert 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid such as, for example, a 2-keto-3-deoxyaldonic acid dehydratase. Exemplary suitable 2-keto-3-deoxyaldonic acid dehydratases include XylX from Caulobacter crescentus or rrnAC3039 from Haloarcula marismortui. The 2-keto-3-deoxyaldonic acid dehydratase can provide catalytic conversion of 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.
FIG. 8 shows an exemplary metabolic pathway that permits a recombinant cell to use L-arabinose as a carbon source for the production of 2,5-dioxopentanoic acid. In this example, the recombinant cell can include an enzyme that can convert L-arabinose to L-arabinol actone such as, for example, a pentose dehydrogenase. One example of a suitable pentose dehydrogenase includes AraE from Burkholderia thailandensis. The pentose dehydrogenase can provide catalytic conversion of L-arabinose to L-arabinolactone that is, for example, at least 110% greater than that exhibited by a wild-type control.
The exemplary metabolic pathway illustrated in FIG. 8 also includes an enzyme that can convert L-arabinolactone to L-arabinonic acid such as, for example, a pentonolactonase. One example of a suitable pentonolactonase includes AraI from Burkhoideria thailandensis. The pentonolactonase can provide catalytic conversion of L-arabinolactone to L-arabinonic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.
The exemplary metabolic pathway illustrated in FIG. 8 also includes an enzyme that can convert L-arabinonic acid to 2-oxo-4(R),5-dihydroxy-pentanoic acid such as, for example, an aldonic acid dehydratase. One example of a suitable aldonic acid dehydratase includes AraB from Burkholderia thailandensis. The aldonic acid dehydratase can provide catalytic conversion of L-arabinonic add to 2-oxo-4(R),5-dihydroxy-pentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.
The exemplary metabolic pathway illustrated in FIG. 8 also includes an enzyme that can convert 2-oxo-4(1t),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid such as, for example, a 2-keto-3-deoxyaldonic acid dehydratase. One example of a suitable 2-keto-3-deoxyaldonic acid dehydratase includes AraD from Burkholderia thailandensis. The 2-keto-3-deoxyaldonic acid dehydratase can provide catalytic conversion of 2-oxo-4(R),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic add that is, for example, at least 110% greater than that exhibited by a wild-type control.
FIG. 9 shows an exemplary metabolic pathway that permits a recombinant cell to use D-glucaric acid as a carbon source for the production of 2,5-dioxopentanoic acid. In this example, the recombinant cell can include an enzyme that can convert D-glucaric acid to 4-deoxy-5-keto-D-glucaric acid such as, for example, an aldonic acid dehydratase. Suitable exemplary aldonic acid dehydratases include YcbF from Bacillus subtilis. The aldonic acid dehydratase can provide catalytic conversion of D-glucaric acid to 4-deoxy-5-keto-D-glucaric acid that is, for example, at least 110% greater than that exhibited by a wild-type control.
The exemplary metabolic pathway illustrated in FIG. 9 also includes an enzyme that can convert 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid such as, for example, a 2-keto-3-deoxyaldonic acid dehydratase. One example of a suitable 2-keto-3-deoxyaldonic acid dehydratase includes YcbC from Bacillus subtilis. The 2-keto-3-deoxyaldonic acid dehydratase can provide catalytic conversion of 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.
FIG. 10 shows an exemplary metabolic pathway that permits a recombinant cell to use D-galactaric acid as a carbon source for the production of 2,5-dioxopentanoic acid. In this example, the recombinant cell can include an enzyme that can convert D-galactaric acid to 4-deoxy-5-keto-D-glucaric acid such as, for example, an aldonic acid dehydratase. Suitable exemplary aldonic acid dehydratases include YcbH from Bacillus subtilis. The aldonic acid dehydratase can provide catalytic conversion of D-galactaric acid to 4-deoxy-5-keto-D-glucaric acid that is, for example, at least 110% greater than that exhibited by a wild-type control.
The exemplary metabolic pathway illustrated in FIG. 9 also includes an enzyme that can convert 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid such as, for example, a 2-keto-3-deoxyaldonic acid dehydratase. One example of a suitable 2-keto-3-deoxyaldonic acid dehydratase includes YcbC from Bacillus subtilis. The 2-keto-3-deoxyaldonic acid dehydratase can provide catalytic conversion of 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.
FIG. 11 shows an exemplary metabolic pathway that permits a recombinant cell to use 4(R)-hydroxy-D-proline as a carbon source for the production of 2,5-dioxopentanoic acid. In this example, the recombinant cell can include an enzyme that can convert 4(R)-hydroxy-D-proline to 4(R)-hydroxy-D-proline. One suitable exemplary enzyme for this embodiment includes, amino acid transporter LysE (HypE) from Pseudomonas. The enzyme can provide catalytic conversion of 4(R)-hydroxy-D-proline to 4(R)-hydroxy-D-proline that is, for example, at least 110% greater than that exhibited by a wild-type control.
The exemplary metabolic pathway illustrated in FIG. 11 also includes an enzyme that can convert 4(R)-hydroxy-D-proline to 2-carboxy-4(R)-hydroxy-δ-pyrroline. One suitable exemplary enzyme for this embodiment includes, for example, HypOX from Psendomonas. The enzyme can provide catalytic conversion of 4(R)-hydroxy-D-proline to 2-carboxy-4(R)-hydroxy-δ-pyrroline that is, for example, at least 110% greater than that exhibited by a wild-type control.
The exemplary metabolic pathway illustrated in FIG. 11 also includes an enzyme that can convert 2-oxo-4(R)-5-aminopentanoic acid to 2,5-dioxopentanoic acid such as, for example, a 2-keto-3-deoxyaldonic acid dehydratase. One exemplary 2-keto-3-deoxyaldonic acid dehydratase includes PP 1247 from Pseucionionas. The 2-keto-3-deoxyaldonic acid dehydratase can provide catalytic conversion of 2-oxo-4(R)-5-aminopentanoic acid to 2,5-dioxopentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.
The recombinant cell can be engineered to convert the 2,5-dioxopentanoic acid to any desirable TCA derivative. In some embodiments, the recombinant cell can include an α-ketoglutaric semialdehyde dehydrogenase to shunt the 2,5-dioxopentanoic acid into the TCA cycle. In this manner, TCA cycle derivatives such as, for example, succinate, fumarate, malate, glutamate, lysine, threonine, 4-hydroxybutyrate may be produced.
In some embodiments, however, the recombinant cell may be further modified to possess a metabolic pathway for the conversion of 2,5-dioxopentanoic acid to 1,4-butanediol. Exemplary metabolic pathways are illustrated, for example, in FIG. 4 and FIG. 5. The exemplary pathway illustrated in FIG. 4 includes an enzyme that can convert 2,5-dioxopentonoic acid to succinaldehyde such as, for example, a 2-ketoacid decarboxylase or a 2-oxoglutarate decarboxylase. Suitable exemplary enzymes include, for example, Kivd, BFD, and IPDC. The exemplary pathway illustrated in FIG. 4 also includes an enzyme that can convert succinaldehyde to 1,4-butanediol such as, for example, an alcohol dehydrogenase. Suitable exemplary alcohol dehydrogenases include YqhD, ADH6, YjgB, and YahK.
The exemplary pathway illustrated in FIG. 5 includes an enzyme that can convert 2,5-dioxopentonoic acid to 2-keto-5-hydroxy-pentonate such as, for example, an alcohol dehydrogenase. Here again, suitable exemplary alcohol dehydrogenases include, for example, YqhD, ADH6, YjgB, and YahK. The exemplary pathway illustrated in FIG. 5 includes an enzyme that can convert 2-keto-5-hydroxy-pentonate to 4-hydroxy-1-butyraldehyde such as, for example, a 2-ketoacid decarboxylase or a 2-oxoglutarate decarboxylase. Suitable exemplary enzymes include, for example, Kivd, BFD, and IPDC. The exemplary pathway illustrated in FIG. 5 includes conversion of 4-hydroxy-1-butyraldehyde into 1,4-butanediol. This conversion may be catalyzed by an alcohol dehydrogenase such as, for example, YqhD, ADH6, YjgB, and YahK. For the metabolic pathway illustrated in FIG. 5, therefore, the recombinant cell can include one or more alcohol dehydrogenases.
In some embodiments, the host cell can include one or more genetic modifications to reduce endogenous metabolism of the carbon source so that metabolism of the carbon source is directed toward the production of the TCA derivative. For example, in embodiments in which the carbon source is xylose and the host cell is E. coli, the host cell can include one or more modifications to decrease endogenous metabolism of xylose. In the case of E. coli, such modifications can include for example, a decrease in α-ketoglutaric semialdehyde dehydrogenase activity, aldolase activity, and/or 2-keto-3-deoxy gluconate aldolase activity. Such modifications can include modifications to coding regions of, or regulatory regions that control expression of, xylA, yjhH, and/or yagE. Such modifications can include, for example, a deletion of a sufficient amount of one or more coding regions that the enzymatic activity is reduced.
As used herein, the terms “activity” with regard to particular enzyme refers to the ability of a polypeptide, regardless of its common name or native function, to catalyze the conversion of the enzyme's substrate to a product, regardless of whether the “activity” as less than, equal to, or greater than the native activity of the identified enzyme. Methods for measuring the biosynthetic activities of cells are routine and well known to those of ordinary skill in the art.
As used herein, an increase in catalytic activity can be quantitatively measured and described as a percentage of the catalytic activity of an appropriate wild-type control. The catalytic activity exhibited by a genetically-modified polypeptide can be, for example, at least 110%, at least 125%, at least 150%, at least 175%, at least 200% (two-fold), at least 250%, at least 300% (three-fold), at least 400% (four-fold), at least 500% (five-fold), at least 600% (six-fold), at least 700% (seven-fold), at least 800% (eight-fold), at least 900% (nine-fold), at least 1000% (10-fold), at least 2000% (20-fold), at least 3000% (30-fold), at least 4000% (40-fold), at least 5000% (50-fold), at least 6000% (60-fold), at least 7000% (70-fold), at least 8000% (80-fold), at least 9000% (90-fold), at least 10,000% (100-fold), or at least 100,000% (1000-fold) of the activity of an appropriate wild-type control.
Alternatively, an increase in catalytic activity may be expressed as at an increase in kcat such as, for example, at least a two-fold increase, at least a three-fold increase, at least a four-fold increase, at least a five-fold increase, at least a six-fold increase, at least a seven-fold increase, at least an eight-fold increase, at least a nine-fold increase, at least a 10-fold increase, at least a 15-fold increase, or at least a 20-fold increase in the kcat value of the enzymatic conversion.
An increase in catalytic activity also may be expressed in terms of a decrease in Km such as, for example, at least a two-fold decrease, at least a three-fold decrease, at least a four-fold decrease, at least a five-fold decrease, at least a six-fold decrease, at least a seven-fold decrease, at least an eight-fold decrease, at least a nine-fold decrease, at least a 10-fold decrease, at least a 15-fold decrease, or at least a 20-fold decrease in the Km value of the enzymatic conversion.
A decrease in catalytic activity can be quantitatively measured and described as a percentage of the catalytic activity of an appropriate wild-type control. The catalytic activity exhibited by a genetically-modified polypeptide can be, for example, no more than 95%, no more than 90%, no more than 85%, no more than 80%, no more than 75%, no more than 70%, no more than 65%, no more than 60%, no more than 55%, no more than 50%, no more than 45%, no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, no more than 5%, no more than 4%, no more than 3%, no more than 2%, no more than 1% of the activity, or 0% of the activity of a suitable wild-type control.
Alternatively, a decrease in catalytic activity can be expressed as an appropriate change in a catalytic constant. For example, a decrease in catalytic activity may be expressed as at a decrease in kcat such as, for example, at least a two-fold decrease, at least a three-fold decrease, at least a four-fold decrease, at least a five-fold decrease, at least a six-fold decrease, at least a seven-fold decrease, at least an eight-fold decrease, at least a nine-fold decrease, at least a 10-fold decrease, at least a 15-fold decrease, or at least a 20-fold decrease in the kcat value of the enzymatic conversion.
A decrease in catalytic activity also may be expressed in terms of an increase in Km such as, for example, an increase in Km of at least two-fold, at least three-fold, at least four-fold, at least five-fold, at least six-fold, at least seven-fold, at least an eight-fold, at least nine-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 35-fold, at least 40-fold, at least 45-fold, at least 50-fold, at least 75-fold, at least 100-fold, at least 150-fold, at least 200-fold, at least 230-fold, at least 250-fold, at least 300-fold, at least 350-fold, or at least 400-fold.
Thus, in another aspect, we describe herein methods for biosynthesis of a TCA derivative. Generally, the methods includes incubating a recombinant cell as described herein in medium that includes a carbon source under conditions effective for the recombinant cell to produce the TCA derivative. The carbon source can include, for example, saccharides (e.g., xylose, arabinose, glucose, cellulose), a uronic acid (e.g., galacturonic acid or glucuronic acid), CO2, glycerol, or a native substrate of an enzyme that is part of the engineered metabolic pathway. Exemplary native substrates of exemplary enzymes are shown in Table 1 and include, for example, glucaric acid, galactaric acid, hydroxyproline, arabinonic acid, 2-oxo-4(S),5-dihydroxy-pentanoic acid, 2-oxo-4(R),5-dihydroxy-pentanoic acid, 2,5-dioxopentanoic acid, xylonolactone, xylonic acid, arabinonolactone, 4-deoxy-5-keto-D-glucaric acid, 4(R)-hydroxy-L-proline, 4(R)-hydroxy-D-proline, 2-carboxy-4(R)-hydroxy-pyrroline, 2,5-dioxopentanoic acid, succinaldehyde.
In yet another aspect, we describe herein methods for introducing a heterologous polynucleotide into cell so that the host cell exhibits an increased ability to convert a carbon source to a TCA derivative. The heterologous polynucleotide can encode a polypeptide operably linked to a promoter so that modified cell catalyzes conversion of the carbon source to the TCA derivative. In some of these embodiments, the carbon source can include xylose. The host cells for such methods can include, for example, any of the microbial species identified above with regard to the recombinant cells described herein.
In some embodiments, the heterologous polynucleotide may be inserted into a vector. A vector is a replicating polynucleotide such as, for example, a plasmid, phage, or cosmid, to which another polynucleotide may be inserted so as to bring about the replication of the inserted polynucleotide. Construction of vectors containing a polynucleotide of the invention employs standard ligation techniques known in the art. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual., Cold Spring Harbor Laboratory Press (1989). A vector can permit, for example, further cloning—i.e., a cloning vector—or expression of the polypeptide encoded by the coding region—i.e., an expression vector. The term vector includes, but is not limited to, plasmid vectors, viral vectors, cosmid vectors, or artificial chromosome vectors. In one embodiment, the vector is a plasmid. Selection of a vector can depend upon a variety of desired characteristics in the resulting construct, such as a selection marker, vector replication rate, and the like.
An expression vector optionally includes regulatory sequences operably linked to the coding region. The polynucleotides described herein are not limited by the use of any particular promoter, and a wide variety of promoters are known. Promoters act as regulatory signals that bind RNA polymerase in a cell to initiate transcription of a downstream (3′ direction) coding region. The promoter used can be a constitutive or an inducible promoter. It can be, but need not be, heterologous with respect to the host cell. Exemplary promoters include, for example, trp, tac, and T7.
“Coding sequence” or “coding region” refers to a nucleotide sequence that encodes a polypeptide and, when placed under the control of appropriate regulatory sequences, expresses the encoded polypeptide. The boundaries of a coding region are generally determined by a translation start codon at its 5′ end and a translation stop codon at its 3′ end. As used herein, the term “polypeptide” refers broadly to a polymer of two or more amino acids joined together by peptide bonds. The term “polypeptide” also includes molecules that contain more than one polypeptide joined by disulfide bonds, ionic bonds, or hydrophobic interactions, or complexes of polypeptides that are joined together, covalently or noncovalently, as multimers (e.g., dimers, tetramers). Thus, the terms peptide, oligopeptide, and protein are all included within the definition of polypeptide and these terms are used interchangeably. The term “polypeptide” does not connote a specific length of a polymer of amino acids, nor does it imply or distinguish whether the polypeptide is produced using recombinant techniques, chemical or enzymatic synthesis, or is naturally occurring.
“Regulatory sequence” refers to a nucleotide sequence that regulates expression of a coding region to which it is operably linked. Nonlimiting examples of regulatory sequences include, for example, promoters, transcription initiation sites, translation start sites, translation stop sites, and terminators. “Operably linked” refers to a juxtaposition wherein the components are in a relationship permitting them to function in their intended manner. A regulatory sequence is “operably linked” to a coding region when it is joined in such a way that expression of the coding region is achieved under conditions compatible with the regulatory sequence.
As used in the preceding description, the term “and/or” means one or all of the listed elements or a combination of any two or more of the listed elements; the term “comprises” and variations thereof do not have a limiting meaning where these terms appear in the description and claims; unless otherwise specified, “a,” “an,” “the,” and “at least one” are used interchangeably and mean one or more than one; and the recitations of numerical ranges by endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).
In the preceding description, particular embodiments may be described in isolation for clarity. Unless otherwise expressly specified that the features of a particular embodiment are incompatible with the features of another embodiment, certain embodiments can include a combination of compatible features described herein in connection with one or more embodiments.
For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.
The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.
EXAMPLES Example 1 Bacterial Strains and Plasmids All the primers were ordered from Eurofins MWG Operon and are listed in Table 1. The E. coli strains used in this study are listed in Table 2, which were all derived from E. coli K-12 strain BW25113.
TABLE 2
Strains, plasmids and primers used in this study
Name Relevant genotype Reference
Strains
BW25113 rrnBT14 ΔlacZWJ16 hsdR514 ΔaraBADAH33 ΔrhaBADLD78 A
SBDO-1 BW25113 ΔxylA ΔyjhH ΔyagE This work
SBDO-2 SBDO-1 + pBDO-1 This work
SBDO-3 SBDO-1 + pBDO-1 and pBDO-2 This work
SBDO-4 SBDO-1 + pBDO-1 and pBDO-3 This work
SBDO-5 SBDO-1 + pBDO-1 and pBDO-4 This work
Plasmids
pIBA7 ColE1 ori, AmpR, PLlacO1::kivD padA B
pBDO-1 p15A ori, KanR, PLlacO1::xylBCDX This work
pBDO-2 ColE1 ori, AmpR, PLlacO1::xylA This work
pBDO-3 ColE1 ori, AmpR, PLlacO1::BFD-yqhD This work
pBDO-4 ColE1 ori, AmpR, PLlacO1::kivD-yqhD This work
SEQ ID
Primers NO:
xylBAcc-F GGGCCCggtaccatgtcctcagccatctatcccagcct 108
xylBHinNheBa- GGGCCCGCTCAGCAAGCTTGCTAGCggatcctTaacgccagccggcgtcgatccagt 109
R
xylCBamHI-F GGGCCCggatccAGGAGAAATTAACTatgaccgctcaagtcacttgcgtatg 110
xylCHindNhe- GGGCCCAAGCTTgctagcttagacaaggcggacctcatgctggg 111
R
xylDNheI-F GGGCCCgctagcAGGAGAAATTAACTatgaggtccgccttgtctaaccgcac 112
xylDHind-R GGGCCCaagctttTagtggttgtggcggggcagcttgg 113
xylXHind-F GGGCCCaagcttAGGAGAAATTAACTAtggtttgtcggcggcttctagcatg 114
xylXBIpRem-R gcgcagctggcgttgttgtccttggccttTctgagcagcagggccgaacgaccttcgaa 115
XylXBIpI-R GGGCCCGCTCAGCttagaggaggccgcggccggccaggt 116
pZEkivD-F actgaccgaattcattaaagaggagaaaggtaccatgtatacagtaggagattacctatt 117
kivD-R ttatgatttattttgttcagcaaata 118
YqhDkivD-F ctgaacaaaataaatcataaAGGAGAAATTAACTATGAACAACTTTAATCTGCACACCCC 119
BFDpZE-F actgaccgaattcattaaagaggagaaaggtaccatggcttcggtacacggcaccacata 120
BFD-R tTacttcaccgggcttacggtgctta 121
CC0822Acc-F GGGCCCggtaccatgaccgacaccctgcgccattacat 122
CC0822Xba-R GGGCCCtctagattacgaccacgagtaggaggttttgg 123
A. Datsenko et al., 2000 Proc. Natl. Acad. Sci. U.S.A. 97: 6640-5.
B. Zhang et al., 2011 ChemSusChem 4: 1068-1070.
All cloning procedures were carried out in the E. coli strain XL10-gold (Stratagene, Agilent Technologies, Santa Clara, Calif.). To build the plasmid pBDO-1, the coding regions of xylB, xylC, xylD, and xy/X were amplified by PCR with oligos of xylBAcc-F and xylBHinNheBa-R, xylCBamHI-F and xylCHindNhe-R, xylDNheI-F and xylDHind-R, xylXHind-F and xylXBlpRem-R, using genomic DNA of Caulobacter crescentus strain as template, and then these four coding regions of xylB, xylC, xylD, and xy/X were inserted into the corresponding restriction sites of pZA vector after digestion.
To make the plasmid pBDO-2, the coding region of xylA was PCR amplified by oligos of CC0822Acc-F and CC0822Xba-R using genomic DNA of C. crescentus strain as template, and then this coding region was inserted into the site between Acc65I and XbaI of vector pZE after digestion.
To construct the plasmids pBDO-3 and pBDO-4, four coding regions of BFD (using Pseudomonas putida genomic DNA as template), yqhD-1 (using E. coli genomic DNA as template), KIVD (from Lactococcus lactis, using plasmid pIBA7 as template) and yqhD-2 (using E. coli genomic DNA as template), were PCR amplified with oligos of BFDpZE-F and BFD-R, yqhDBFD-F and yqhDpZE-R, pZEkivD-F and kivD-R, yqhDkivD-F and yqhDpZE-R, and then pBDO-3 and pBDO-4 were completed by Gibson cloning method (Gibson et al., 2009. Nat. Meth. 6:343-345). P1 phages of xylA, yjhH and yagE and were obtained from the Keio collection (Baba et al., 2006 Mol. Syst. Biol. 2:10.1038). The phages were used to transfect the BW25113 strain to construct triple knockout strains. All the knockout strains were then transformed with pCP20 plasmid to remove the kanamycin marker. The correct knockouts were verified by PCR.
Cell Cultivation and Shake Flask Fermentation Unless otherwise stated, cells were grown in test tubes at 37° C. in 2X YT rich medium (16 g/L Bacto-tryptone, 10 g/L yeast extract, and 5 g/L NaCl) supplemented with 100 mg/L ampicillin and 50 mg/L kanamycin. 200 μL of overnight cultures incubated in 2X YT medium were transferred into 5 mL M9 minimal medium supplemented with 5 g/L yeast extract, 5 g/L glucose, 40 g/L xylose, 100 mg/L ampicillin, and 50 mg/L kanamycin in 125 mL conical flasks. Isopropyl-β-D-thiogalactoside (IPTG) was added at a concentration of 0.1 mM to induce protein expression. The fermentation broth was buffered by the presence of 0.5 g CaCO3.
Metabolite Analysis and Dry Cell Weight Determination Fermentation products were analyzed using an Agilent 1260 Infinity HPLC equipped with an Aminex HPX 87H column (Bio-Rad Laboratories, Inc., Hercules, Calif.) and a refractive-index detector. The mobile phase was 5 mM H2SO4 with a flow rate 0.6 mL/min. The column temperature and detection temperature were 35° C. and 50° C., respectively. Cell dry weight was determined by filtering 5 mL culture through a 0.45 μm glass fiber filter (Pall Life Sciences, Ann Arbor, Mich.). After removal of medium, the filter was washed with 15 mL of MilliQ water (EMD Millipore Corp., Billerica, Mass.), dried in an oven and then weighed. Cell dry weight was determined in triplicate.
Example 2 To produce 1,4-butanediol from xylose in yeast, one artificial synthetic pathway was introduced into the wild type Saccharomyces cerevisiae strain W303. To generate the artificial pathway we cloned a polynucleotide that encodes enzymes that convert xylose into 2,5-dioxopentanoic acid into the host yeast cell. We also cloned a polynucleotide that encoded enzymes that convert 2,5-dioxopentanoic acid into 1,4-butanediol. These enzymes were cloned into plasmids YEplac195-xylBCDX and YEplac112-KivdDyqhD as described in more detail below.
The transformed yeast were grown under fermentation conditions as described in more detail below for two day. After the fermentation, 1,4-butanediol was accumulated to a concentration of 20 mg/L. (FIG. 14).
Plasmid Construction in the Yeast 1,4-butanediol Synthetic Pathway
The construction of plasmid YEplac195-xylBCDX was finished by Gibson assembly. All of the primers are listed in Table 3.
The coding region for HXT7p was PCR amplified with the primer pair Hxt7p195-1F and Hxt7pXylB-R, using S. cerevisiae W303 genomic DNA as a template. Similarly, the PGK1p coding region was PCR amplified with the primer pair PGK1Phxt7t-F and PGK1PxylC-R; the ADH1p coding region was PCR amplified with the primer pair ADH1Ppgk1t-F and ADH1PxylD-R; the PDC1p coding region was PCR amplified with the primer pair PDC1PADH1T-F and PDC1PxylX-R; the HXT7t coding region was PCR amplified with the primer pair Hxt7tXylB-F and Hxt7tPGK1P-R; the PGK1t coding region was PCR amplified with the primer pair PGK1tXylC-F and PGK1tADH1p-R; the ADH1t coding region was PCR amplified with the primer pair ADH1TxylD-F and ADH1TPDC1P-R; and the PDC1t coding region was PCR amplified with primer pairs PDC1TxylX-F and PDC1T195-R, each by using S. cerevisiae W303 genomic DNA as template.
Caulobacter crescentus xylB coding region was PCR amplified with primer pair xylBhxt7p-F and xylBhxt7t-R using C. crescentus genomic DNA as template. Similarly, the xylC coding region was PCR amplified with primer pair xylCPGK1P-F and xylCPGK1t-R; the xylD coding region was PCR amplified with primer pair xylDADH1P-F/xylDADH1T-R; and the xylX coding region was PCR amplified with primer pair xylXPDC1P-F/xylXPDC1T-R; each using C. crescentus genomic DNA as template.
The combined fragment of HXT7p-xylB-HXT7t was amplified by overlapping PCR with the primer pair Hxt7p195-1F and Hxt7tPGK1P-R using the HXT7p/xylB/HXT7t DNA as a PCR template. The combined fragment PGK1p-xylC-PGK1t was amplified by overlapping PCR with the primer pair PGK1Phxt7t-F and PGK1tADH1p-R using the PGK1p/xylC/PGK1t DNA as a PCR template. The combined fragment ADH1p-xylD-ADH1t was amplified by overlapping PCR with the primer pair ADH1Ppgk1t-F and ADH1TPDC1P-R using the fragment ADH1p/xylD/ADH1t DNA as a PCR template. The combined fragment PDC1p-xylX-PDC1t was amplified by overlapping PCR with the primer pair PDC1PADH1T-F and PDC1T195-R using the PDC1p/xylX/PDC1t DNA as a PCR template.
The vector fragment YEp195v was amplified with primer pair 195HindIII-2F and 195EcoRI-2R by using YEplac195 as template. The fragments of YEp195v, HXT7p-xylB-HXT7t, PGK1p-xylC-PGK1t, ADH1p-xylD-ADH1t, and PDC1p-xylX-PDC1t were assembled by Gibson method to form the plasmid of YEplac195-xylBCDX (FIG. 12).
To build the plasmid of YEplac112-KivD-yqhD, the fragments of HXT7P2, HXT7T2, PGK1P2 and PGK1T2 were PCR amplified using S. cerevisiae W303 genmic DNA as a template. The HXT7P2 fragment was PCR amplified using the primer pair Hxt7p195-1F and HXT7PkivD-R; the HXT7T2 fragment was PCR amplified using the primer pair HXT7TKIVD-F and HXT7TPGK1P-R; the PGK1P2 fragment was PCR amplified using the primer pair PGK1PHXT7T-F/PGK1PyqhD-R; and the PGK1T2 fragment was PCR amplified using the primer pair PGK1TyqhD-F and PGK1T112-R.
The KIVD coding region from Lactococcus lactis was amplified with the primer pair KIVDHXT7P-F and KIVDHXT7T-R using L. lactis genomic DNA as template. The E. coli YqhD coding region was amplified with the primer pair yqhDPGK1P-F and yqhDPGK1T-R using E. coli genomic DNA as template.
The vector fragment YEp112v was amplified with primer pair 195HindIII-2F and 195EcoRI-2R by using YEplac112 as template. The fragments of YEp112v, HXT7P2, KIVD, HXT7T2, PGK1P2, yqhD and PGK1T2 were assembled by Gibson method to generate the plasmid of YEplac112-KivDyqhD. (FIG. 13).
TABLE 3
The used primers in this study
SEQ
ID
Primer NO:
195HindIII-2F attgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagctt 124
Hxt7p195-1F cagctatgaccatgattacgccaagcttGGTACCtcgtaggaacaatttcgggcccctgc 125
Hxt7pXylB-R cttcaggctgggatagatggctgaggacattttttgattaaaattaaaaaaactttttgt 126
XylBhxt7p-F acaaaaagtttttttaattttaatcaaaaaatgtcctcagccatctatcccagcctgaag 127
XylBhxt7t-R tgatcatgaattaataaaagtgttcgcaaatTaacgccagccggcgtcgatccagtattc 128
Hxt7tXylB-F gaatactggatcgacgccggctggcgttAatttgcgaacacttttattaattcatgatca 129
Hxt7tPGK1P-R actcacgagtaattcttgcaaatgcctCCTAGGagacactttttgaagcgggatacagaa 130
PGK1Phxt7t-F ttctgtatcccgcttcaaaaagtgtctCCTAGGaggcatttgcaagaattactcgtgagt 131
PGK1PxylC-R atcccatacgcaagtgacttgagcggtcattgttttatatttgttgtaaaaagtagataa 132
xylCPGK1P-F ttatctactttttacaacaaatataaaacaatgaccgctcaagtcacttgcgtatgggat 133
XylCPGK1t-R attgatctatcgatttcaattcaattcaatttagacaaggcggacctcatgctggggttg 134
PGK1tXy1C-F caaccccagcatgaggtccgccttgtctaaattgaattgaattgaaatcgatagatcaat 135
PGK1tADH1p-R ccgatgtatgggtttggttgccagaaGCtgagcttggagcaggaagaatacactatactg 136
ADH1Ppgk1t-F cagtatagtgtattcttcctgctccaagctcaGCttctggcaaccaaacccatacatcgg 137
ADH1PxylD-R gggcgtgcggttagacaaggcggacctcattgtatatgagatagttgattgtatgcttgg 138
xylDADH1P-F ccaagcatacaatcaactatctcatatacaatgaggtccgccttgtctaaccgcacgccc 139
xylDADH1T-R aataaaaatcataaatcataagaaattcgctTagtggttgtggcggggcagcttggccgc 140
ADH1TxylD-F gcggccaagctgccccgccacaaccactAagcgaatttcttatgatttatgatttttatt 141
ADH1TPDC1P-R gaaggtatgggtgcagtgtgcttatctACTAGTtgtggaagaacgattacaacaggtgtt 142
PDC1PADH1T-F aacacctgttgtaatcgttcttccacaACTAGTagataagcacactgcacccataccttc 143
PDC1PxylX-R ggtccatgctagaagccgccgacaaaccaTtttgattgatttgactgtgttattttgcgt 144
xylXPDC1P-F acgcaaaataacacagtcaaatcaatcaaaAtggtttgtcggcggcttctagcatggacc 145
xylXPDC1T-R actttaactaataattagagattaaatcgcttagaggaggccgcggccggccaggttgcg 146
PDC1TxylX-F cgcaacctggccggccgcggcctcctctaagcgatttaatctctaattattagttaaagt 147
PDC1T195-R acgttgtaaaacgacggccagtgaattcTCTAGAgcttgtcttgagcaattgcagagtcg 148
195EcoRI-2R agttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattc 149
HXT7PkivD-R ctaataggtaatctcctactgtatacatGGATCCtttttgattaaaattaaaaaaacttt 150
KIVDHXT7P-F aaagtttttttaattttaatcaaaaaGGATCCatgtatacagtaggagattacctattag 151
KIVDHXT7T-R tcatgaattaataaaagtgttcgcaaaGGTACCttatgatttattttgttcagcaaatag 152
HXT7TKIVD-F ctatttgctgaacaaaataaatcataaGGTACCtttgcgaacacttttattaattcatga 153
HXT7TPGK1P-R cttactcacgagtaattcttgcaaatgcctagacactttttgaagcgggatacagaaaaa 154
PGK1PHXT7T-F tttttctgtatcccgcttcaaaaagtgtctaggcatttgcaagaattactcgtgagtaag 155
PGK1PyqhD-R TGGGGTGTGCAGATTAAAGTTGTTCATTCTAGAtgttttatatttgttgtaaaaagtaga 156
yqhDPGK1P-F tctactttttacaacaaatataaaacaTCTAGAATGAACAACTTTAATCTGCACACCCCA 157
yqhDPGK1T-R gatctatcgatttcaattcaattcaatCTCGAGTTAGCGGGCGGCTTCGTATATACGGCG 158
PGK1TyqhD-F CGCCGTATATACGAAGCCGCCCGCTAACTCGAGattgaattgaattgaaatcgatagatc 159
PGK1T181-R gtcacgacgttgtaaaacgacggccagtgaattctgagcttggagcaggaagaatacact 160
1,4-butanediol Fermentation by Yeast in Shake Flask
The W303 yeast strain carrying plasmids of YEplac195-xylBCDX and YEplac112-KivDyqhD was cultured overnight in the Complete Minimal medium without uracil and tryptophan supplements at 30° C. with shaking at 200 rpm. The yeast cells were harvested and washed in the next day, and then inoculated into 10 mL fresh medium identical to the overnight culture medium except that it further contained 20 g/L xylose. The shake flask was then sealed with parafilm, and cultured for two days at 30° C. with shaking at 200 rpm. The fermentation broth was analyzed by gas chromatography to measure the amount of 1,4-butanediol. Results are shown in FIG. 14.
Exemplary Embodiments Embodiment 1. A recombinant microbial cell modified to exhibit increased biosynthesis of a TCA derivative compared to a wild-type control.
Embodiment 2. The recombinant cell of Embodiment 1 wherein the TCA derivative comprises 1,4-butanediol.
Embodiment 3. The recombinant microbial cell any preceding Embodiment wherein the microbial cell is a fungal cell.
Embodiment 4. The recombinant cell of Embodiment 3 wherein the fungal cell is a member of the Saccharomycetaceae family.
Embodiment 5. The recombinant cell of Embodiment 3 wherein the fungal cell is Saccharomyces cerevisiae, Candida rugosa, or Candida albicans.
Embodiment 6. The recombinant cell of Embodiment 1 or Embodiment 2 wherein the microbial cell is a bacterial cell.
Embodiment 7. The recombinant cell of Embodiment 6 wherein the bacterial cell is a member of the phylum Protobacteria.
Embodiment 8. The recombinant cell of Embodiment 7 wherein the bacterial cell is a member of the Enterobacteriaceae family.
Embodiment 9. The recombinant cell of Embodiment 8 wherein the bacterial cell is Escherichia coli.
Embodiment 10. The recombinant cell of Embodiment 7 wherein the bacterial cell is a member of the Pseudomonaceae family.
Embodiment 11. The recombinant cell of Embodiment 10 wherein the bacterial cell is Pseudomonas putida.
Embodiment 12. The recombinant cell of Embodiment 6 wherein the bacterial cell is a member of the phylum Firmicutes.
Embodiment 13. The recombinant cell of Embodiment 12 wherein the bacterial cell is a member of the Bacillaceae family.
Embodiment 14. The recombinant cell of Embodiment 13 wherein the bacterial cell is Bacillus subtilis.
Embodiment 15. The recombinant cell of Embodiment 12 wherein the bacterial cell is a member of the Streptococcaceae family.
Embodiment 16. The recombinant cell of Embodiment 15 wherein the bacterial cell is Lactococcus lactis.
Embodiment 17. The recombinant cell of Embodiment 12 wherein the bacterial cell is a member of the Clostridiaceae family.
Embodiment 18. The recombinant cell of Embodiment 17 wherein the bacterial cell is Clostridium cellulolyticum.
Embodiment 19. The recombinant cell of Embodiment 6 wherein the bacterial cell is a member of the phylum Cyanobacteria.
Embodiment 20. The recombinant cell of any preceding Embodiment wherein the microbial cell is photosynthetic.
Embodiment 21. The recombinant cell of any preceding Embodiment wherein the microbial cell is cellulolytic.
Embodiment 22. The recombinant cell of any preceding Embodiment wherein the increased biosynthesis of the TCA derivative comprises an increase in xylose dehydrogenase activity, xylonolactonase activity, xylonate dehydratase activity, or 2-keto-3-deoxyaldonic acid dehydratase activity.
Embodiment 23. The recombinant cell of Embodiment 22 wherein the increased biosynthesis of the TCA derivative further comprises an increase in benzoylformate decarboxylase activity and an increase in alcohol dehydrogenase activity.
Embodiment 24. The recombinant cell of Embodiment 23 wherein the benzoylformate decarboxylase comprises BFD of Pseudomonas putida.
Embodiment 25. The recombinant cell of Embodiment 23 wherein the alcohol dehydrogenase comprises yqhD of E. coli.
Embodiment 26. The recombinant cell of Embodiment 22 wherein the increased biosynthesis of the TCA derivative further comprises an increase in decarboxylase activity and an increase in alcohol dehydrogenase activity.
Embodiment 27. The recombinant cell of Embodiment 26 wherein the decarboxylase comprises KIVD of Lactococcus lactis.
Embodiment 28. The recombinant cell of Embodiment 26 wherein the alcohol dehydrogenase comprises yqhD of E. coli.
Embodiment 29. The recombinant cell of preceding Embodiment wherein the increased biosynthesis of the TCA derivative comprises a decrease in α-ketoglutaric semialdehyde dehydrogenase activity.
Embodiment 30. The recombinant cell of preceding Embodiment wherein the increased biosynthesis of the TCA derivative comprises a decrease in aldolase activity.
Embodiment 31. The recombinant cell of preceding Embodiment wherein the increased biosynthesis of the TCA derivative comprises a decrease in 2-keto-3-deoxy gluconate aldolase activity.
Embodiment 32. The recombinant cell of any preceding Embodiment comprising an engineered metabolic pathway for converting 2,5-dioxopentanoic acid to 1,4-butanediol.
Embodiment 33. The recombinant cell of Embodiment 32 wherein the engineered metabolic pathway for converting 2,5-dioxopentanoic acid to 1,4-butanediol comprises an enzyme that converts 2,5-dioxopentonoic acid into succinaldehyde.
Embodiment 34. The recombinant cell of Embodiment 33 wherein the enzyme that converts 2,5-dioxopentonoic acid into succinaldehyde comprises a 2-ketoacid decareboxylase or a 2-oxoglutarate decarboxylase.
Embodiment 35. The recombinant cell of Embodiment 33 or 34 wherein the enzyme that converts 2,5-dioxopentonoic acid into succinaldehyde comprises KIVD, BFD, or IPDC.
Embodiment 36. The recombinant cell of any one of Embodiments 32-35 wherein the engineered metabolic pathway for converting 2,5-dioxopentanoic acid to 1,4-butanediol comprises an enzyme that converts succinaldehyde to 1,4-butanediol.
Embodiment 37. The recombinant cell of Embodiment 36 wherein the enzyme that converts succinaldehyde to 1,4-butanediol comprises an alcohol dehydrogenase.
Embodiment 38. The recombinant cell of Embodiment 36 or Embodiment 37 wherein the enzyme that converts succinaldehyde to 1,4-butanediol comprises YqhD, ADH6, YjgB, or YahK.
Embodiment 39. The recombinant cell of Embodiment 32 wherein the engineered metabolic pathway for converting 2,5-dioxopentanoic acid to 1,4-butanediol comprises an enzyme that converts 2,5-dioxopentonoic acid into 2-keto-5-hydroxy-pentanoic acid.
Embodiment 40. The recombinant cell of Embodiment 39 wherein the enzyme that converts 2,5-dioxopentonoic acid into 2-keto-5-hydroxy-pentanoic acid comprises an alcohol dehydrogenase.
Embodiment 41. The recombinant cell of Embodiment 39 or Embodiment 40 wherein the enzyme that converts 2,5-dioxopentonoic acid into 2-keto-5-hydroxy-pentanoic acid comprises YqhD, ADH6, YjgB, or YahK.
Embodiment 42. The recombinant cell of any one of Embodiments 39-41 wherein the engineered metabolic pathway for converting 2,5-dioxopentanoic acid to 1,4-butanediol comprises an enzyme that converts 2-keto-5-hydroxy-pentanoic acid to 4-hydroxy-1-butyraldehyde.
Embodiment 43. The recombinant cell of Embodiment 42 wherein the enzyme that converts 2-keto-5-hydroxy-pentanoic acid to 4-hydroxy-1-butyraldehyde comprises a 2-ketoacid decareboxylase or a 2-oxoglutarate decarboxylase.
Embodiment 44. The recombainant cell of Embodiment 42 or Embodiment 43 wherein the enzyme that converts 2-keto-5-hydroxy-pentanoic acid to 4-hydroxy-1-butyraldehyde comprises Kivd, BFD, or IPDC.
Embodiment 45. The recombinant cell of any one of Embodiments 42-44 wherein the engineered metabolic pathway for converting 2,5-dioxopentanoic acid to 1,4-butanediol comprises an enzyme that converts 4-hydroxy-1-butyraldehyde to 1,4-butanediol.
Embodiment 46. The recombinant cell of Embodiment 45 wherein the enzyme that converts 4-hydroxy-1-butyraldehyde to 1,4-butanediol comprises an alcohol dehydrogenase.
Embodiment 47. The recombinant cell of Embodiment 45 or Embodiment 46 wherein the enzyme that converts 4-hydroxy-1-butyraldehyde to 1,4-butanediol comprises YqhD, ADH6, YjgB, or YahK.
Embodiment 48. The recombinant cell of any preceding Embodiment comprising an engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid.
Embodiment 49. The recombinant cell of Embodiment 48 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-arabinose into D-arabinolactone.
Embodiment 50. The recombinant cell of Embodiment 49 wherein the enzyme that can convert D-arabinose into D-arabinolactone comprises a pentose dehydrogenase.
Embodiment 51. The recombinant cell of Embodiment 49 or Embodiment 50 wherein the enzyme that can convert D-arabinose into D-arabinonolactone comprises AraDH.
Embodiment 52. The recombinant cell of any one of Embodiments 49-51 wherein the recombinant cell exhibits conversion of D-arabinose into D-arabinonolactone at a level at least 110% of a wild-type control cell.
Embodiment 53. The recombinant cell of any one of Embodiments 49-52 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-arabononic acid to 2-oxo-4(s),5-dihydroxy-pentanoic acid.
Embodiment 54. The recombinant cell of Embodiment 53 wherein the enzyme that converts D-arabononic acid to 2-oxo-4(s),5-dihydroxy-pentanoic acid comprises an aldonic acid dehydratase.
Embodiment 55. The recombinant cell of Embodiment 53 or Embodiment 54 wherein the enzyme that converts D-arabononic acid to 2-oxo-4(s),5-dihydroxy-pentanoic acid comprises AraD.
Embodiment 56. The recombinant cell of any one of Embodiments 53-55 wherein the recombinant cell exhibits conversion of D-arabononic acid to 2-oxo-4(s),5-dihydroxy-pentanoic acid at a level at least 110% of a wild-type control cell.
Embodiment 57. The recombinant cell of any one of Embodiments 49-56 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 2-oxo-4(s),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid.
Embodiment 58. The recombinant cell of Embodiment 57 wherein the enzyme that converts 2-oxo-4(s),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid comprises a 2-keto-3-deoxyaldonic acid dehydratase.
Embodiment 59. The recombinant cell of Embodiment 57 or Embodiment 58 wherein the enzyme that converts 2-oxo-4(s),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid comprises KdaD.
Embodiment 60. The recombinant cell of any one of Embodiments 57-59 wherein the recombinant cell exhibits conversion of 2-oxo-4(s),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid at a level at least 110% of a wild-type control cell.
Embodiment 61. The recombinant cell of Embodiment 48 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-xylose to D-xylonolactone.
Embodiment 62. The recombinant cell of Embodiment 61 wherein the enzyme that converts D-xylose to D-xylonolactone comprises a pentose dehydrogenase.
Embodiment 63. The recombinant cell of Embodiment 61 or Embodiment 62 wherein enzyme that converts D-xylose to D-xylonolactone comprises XylB or rrnAC3034.
Embodiment 64. The recombinant cell of any one of Embodiments 61-63 wherein the recombinant cell exhibits conversion of D-xylose to D-xylonolactone at a level at least 110% of a wild-type control.
Embodiment 65. The recombinant cell of any one of Embodiments 61-64 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-xylonolactone to D-xylonic acid.
Embodiment 66. The recombinant cell of Embodiment 65 wherein the enzyme that converts D-xylonolactone to D-xylonic acid comprises a pentonolactonase.
Embodiment 67. The recombinant cell of Embodiment 65 or Embodiment 66 wherein the enzyme that converts D-xylonolactone to D-xylonic acid comprises XylC or rrnAC3033.
Embodiment 68. The recombinant cell of any one of Embodiments 65-67 wherein the recombinant cell exhibits conversion of D-xylonolactone to D-xylonic acid at a level at least 110% of a wild-type control.
Embodiment 69. The recombinant cell of any one of Embodiments 61-68 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-xylonic acid to 2-oxo-4(S),5-dihydroxy-pentanoic acid.
Embodiment 70. The recombinant cell of Embodiment 69 wherein the enzyme that converts D-xylonic acid to 2-oxo-4(S),5-dihydroxy-pentanoic acid comprises an aldonic acid dehydratase.
Embodiment 71. The recombinant cell of Embodiment 69 or Embodiment 70 wherein the enzyme that converts D-xylonic acid to 2-oxo-4(S),5-dihydroxy-pentanoic acid comprises XylD or rrnAC3032.
Embodiment 72. The recombinant cell of any one of Embodiments 69-71 wherein the recombinant cell exhibits conversion of D-xylonic acid to 2-oxo-4(S),5-dihydroxy-pentanoic acid at a level at least 110% of a wild-type control.
Embodiment 73. The recombinant cell of any one of Embodiments 61-72 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopenatnoic acid.
Embodiment 74. The recombinant cell of Embodiment 73 wherein the enzyme that converts 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopenatnoic acid comprises a 2-keto-3-deoxyaldonic acid dehydratase.
Embodiment 75. The recombinant cell of Embodiment 73 or Embodiment 74 wherein the enzyme that converts 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopenatnoic acid comprises XylX or rrnAC3039.
Embodiment 76. The recombinant cell of any one of Embodiments 73-75 wherein the recombinant cell exhibits conversion of 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopenatnoic acid at a level at least 110% of a wild-type control.
Embodiment 77. The recombinant cell of Embodiment 48 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts L-arabinose to L-arabinolactone.
Embodiment 78. The recombinant cell of Embodiment 77 wherein the enzyme that converts L-arabinose to L-arabinolactone comprises a pentose dehydrogenase.
Embodiment 79. The recombinant cell of Embodiment 77 or Embodiment 78 wherein the enzyme that converts L-arabinose to L-arabinolactone comprises AraE.
Embodiment 80. The recombinant cell of any one of Embodiments 77-79 wherein the recombinant cell exhibits conversion of L-arabinose to L-arabinolactone at a level at least 110% of a wild-type control.
Embodiment 81. The recombinant cell of any one of Embodiments 77-80 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts L-arabinolactone to L-arabinonic acid.
Embodiment 82. The recombinant cell of Embodiment 81 wherein the enzyme that converts L-arabinolactone to L-arabinonic acid comprises a pentonolactonase.
Embodiment 83. The recombinant cell of Embodiment 81 or Embodiment 82 wherein the enzyme that converts L-arabinolactone to L-arabinonic acid comprises AraI.
Embodiment 84. The recombinant cell of any one of Embodiments 81-83 wherein the recombinant cell exhibits conversion of L-arabinolactone to L-arabinonic acid at a level at least 110% of a wild-type control.
Embodiment 85. The recombinant cell of any one of Embodiments 77-84 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts L-arabinonic acid to 2-oxo-4(R),5-dihydroxy-pentanoic acid.
Embodiment 86. The recombinant cell of Embodiment 85 wherein the enzyme that converts L-arabinonic acid to 2-oxo-4(R),5-dihydroxy-pentanoic acid comprises an aldonic acid dehydratase.
Embodiment 87. The recombinant cell of Embodiment 85 or Embodiment 86 wherein the enzyme that converts L-arabinonic acid to 2-oxo-4(R),5-dihydroxy-pentanoic acid comprises AraB.
Embodiment 88. The recombinant cell of any one of Embodiments 81-87 wherein the recombinant cell exhibits conversion of L-arabinonic acid to 2-oxo-4(R),5-dihydroxy-pentanoic acid at a level at least 110% of a wild-type control.
Embodiment 89. The recombinant cell of any one of Embodiments 77-88 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 2-oxo-4(R),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid.
Embodiment 90. The recombinant cell of Embodiments 89 wherein the enzyme that converts 2-oxo-4(R),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid comprises a 2-keto-3-deoxyaldonic acid dehydratase.
Embodiment 91. The recombinant cell of Embodiments 89 wherein the enzyme that converts 2-oxo-4(R),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid comprises AraD.
Embodiment 92. The recombinant cell of any one of Embodiments 89-90 wherein the recombinant cell exhibits conversion of 2-oxo-4(R),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid at a level at least 110% of a wild-type control.
Embodiment 93. The recombinant cell of Embodiment 48 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-glucaric acid to 4-deoxy-5-keto-D-glucaric acid.
Embodiment 94. The recombinant cell of Embodiment 93 wherein the enzyme that converts D-glucaric acid to 4-deoxy-5-keto-D-glucaric acid comprises an aldonic acid dehydratase.
Embodiment 95. The recombinant cell of Embodiment 93 or Embodiment 94 wherein the enzyme that converts D-glucaric acid to 4-deoxy-5-keto-D-glucaric acid comprises YcbF.
Embodiment 96. The recombinant cell of any one of Embodiments 93-95 wherein the recombinant cell exhibits conversion of D-glucaric acid to 4-deoxy-5-keto-D-glucaric acid at a level at least 110% of a wild-type control.
Embodiment 97. The recombinant cell of any one of Embodiments 93-96 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid.
Embodiment 98. The recombinant cell of Embodiment 97 wherein the enzyme that converts 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid comprises a 2-keto-3-deoxyaldonic acid dehydratase.
Embodiment 99. The recombinant cell of Embodiment 97 or Embodiment 98 wherein the enzyme that converts 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid comprises YcbC.
Embodiment 100. The recombinant cell of Embodiment 48 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-galactaric acid to 4-deoxy-5-keto-D-glucaric acid.
Embodiment 101. The recombinant cell of Embodiment 100 wherein the enzyme that converts D-galactaric acid to 4-deoxy-5-keto-D-glucaric acid comprises an aldonic acid dehydratase.
Embodiment 102. The recombinant cell of Embodiment 100 or Embodiment 101 wherein the enzyme that converts D-galactaric acid to 4-deoxy-5-keto-D-glucaric acid comprises YcbH.
Embodiment 103. The recombinant cell of any one of Embodiments 100-102 wherein the recombinant cell exhibits conversion of D-galactaric acid to 4-deoxy-5-keto-D-glucaric acid at a level at least 110% of a wild-type control.
Embodiment 104. The recombinant cell of any one of Embodiments 100-103 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid.
Embodiment 105. The recombinant cell of Embodiment 104 wherein the enzyme that converts 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid comprises a 2-keto-3-deoxyaldonic acid dehydratase.
Embodiment 106. The recombinant cell of Embodiment 104 or Embodiment 105 wherein the enzyme that converts 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid comprises YcbC.
Embodiment 107. The recombinant cell of Embodiment 48 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 4(R)-hydroxy-L-proline to 4(R)-hydroxy-D-proline.
Embodiment 108. The recombinant cell of Embodiment 107 wherein the enzyme that converts 4(R)-hydroxy-L-proline to 4(R)-hydroxy-D-proline comprises an amino acid transporter.
Embodiment 109. The recombinant cell of Embodiment 107 or Embodiment 108 wherein the enzyme that converts 4(R)-hydroxy-L-proline to 4(R)-hydroxy-D-proline comprises LysE or HypE.
Embodiment 110. The recombinant cell of any one of Embodiments 107-109 wherein the recombinant cell exhibits conversion of 4(R)-hydroxy-L-proline to 4(R)-hydroxy-D-proline at a level at least 110% of a wild-type control.
Embodiment 111. The recombinant cell of any one of Embodiments 107-110 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 4(R)-hydroxy-D-proline to 2-carboxy-4(R)-hydroxy-δ-pyrroline.
Embodiment 112. The recombinant cell of Embodiment 111 wherein the enzyme that converts 4(R)-hydroxy-D-proline to 2-carboxy-4(R)-hydroxy-δ-pyrroline comprises HypOX.
Embodiment 113. The recombinant cell of Embodiment 111 or Embodiment 112 wherein the recombinant cell exhibits conversion of 4(R)-hydroxy-D-proline to 2-carboxy-4(R)-hydroxy-δ-pyrroline at a level at least 110% of a wild-type control.
Embodiment 114. The recombinant cell of any one of Embodiments 107-113 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 2-oxo-4(R),5-hydroxy-5-aminopentanoic acid to 2,5-dioxopentanoic acid.
Embodiment 115. The recombinant cell of Embodiment 114 wherein the enzyme that converts 2-oxo-4(R),5-hydroxy-5-aminopentanoic acid to 2,5-dioxopentanoic acid comprises a 2-keto-3-deoxyaldonic acid dehydratase.
Embodiment 116. The recombinant cell of Embodiment 114 or Embodiment 115 wherein the enzyme that converts 2-oxo-4(R),5-hydroxy-5-aminopentanoic acid to 2,5-dioxopentanoic acid comprises PP1247.
Embodiment 117. The recombinant cell of any one of Embodiments 114-116 wherein the recombinant cell exhibits conversion of 2-oxo-4(R),5-hydroxy-5-aminopentanoic acid to 2,5-dioxopentanoic acid at a level at least 110% of a wild-type control.
Embodiment 118. The recombinant cell of any one of Embodiments 48-117 modified to exhibit increased α-ketoglutaric semialdehyde dehydrogenase activity compared to a wild-type control.
Embodiment 119. The recombinant cell of Embodiment 118 exhibiting increased conversion of 2,5-dioxopentanoic acid to a TCA derivative compared to a wild-type control.
Embodiment 120. The recombinant cell of Embodiment 119 wherein the TCA derivative comprises succinate, fumarate, malate, glutamate, lysine, threonine, or 4-hydroxybutyrate.
Embodiment 121. The recombinant cell of any preceding Embodiment genetically modified to increase consumption of xylose, arabinose, glucaric acid, galactaric acid, or hydroxyproline compared to a wild-type control.
Embodiment 122. The recombinant cell of any preceding Embodiment genetically modified to in crease consumption of a uronic acid compared to a wild-type control.
Embodiment 123. The recombinant cell of Embodiment 122 wherein the urnic acid comprises galacturonic acid or glucuronic acid.
Embodiment 124. The recombinant cell of Embodiment 122 or Embodiment 123 genetically modified to increase conversion of the uronic acid to an aldonic acid compared to a wild-type control.
Embodiment 125. The recombinant cell of any one of Embodiments 122-124 wherein the recombinant cell comprises an exogenous urinate dehydrogenase.
Embodiment 126. A method comprising:
incubating a recombinant cell of any preceding Embodiment in medium that comprises a carbon source under conditions effective for the recombinant cell to produce a TCA derivative.
Embodiment 127. The method of Embodiment 126 wherein the TCA derivative comprises 1,4-butanediol.
Embodiment 128. The method of Embodiment 126 wherein the carbon source comprises xylose, arabinose, glucaric acid, galactaric acid, or hydroxyproline.
Embodiment 129. The method of any one of Embodiments 126-128 wherein the increased biosynthesis of the TCA derivative comprises an increase in pentose dehydrogenase activity, pentonolactonase activity, aldonic acid dehydratase activity, or 2-keto-3-deoxyaldonic acid dehydratase activity.
Embodiment 130. The method of any one of Embodiments 126-129 wherein the increased biosynthesis of the TCA derivative comprises an increase in hexic acid dehydratase activity or 5-dehydro-4-deoxyglucarate dehydratase activity.
Embodiment 131. A method comprising:
introducing into a host cell a heterologous polynucleotide encoding at least one polypeptide that catalyzes conversion of a carbon source to a TCA derivative, wherein the at least one polypeptide is operably linked to a promoter so that the modified host cell catalyzes conversion of the carbon source to TCA derivative.
Embodiment 132. The method of Embodiment 131 wherein the TCA derivative comprises 1,4-butanediol.
Embodiment 133. The method of Embodiment 131 wherein the carbon source comprises xylose.
Embodiment 134. The method of Embodiment 131 wherein the TCA derivative comprises succinate, fumarate, malate, glutamate, lysine, threonine, 4-hydroxybutyrate.
The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference in their entirety. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.
Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about.” Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.
All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.
Sequence Listing Free Text
D-arabinose dehydrogenase (AraDH)
(NP_342747.1; GI: 15898142; Zinc-containing alcohol dehydrogenase
(Sulfolobus solfataricus P2))
SEQ ID NO: 1
1 menvnmvksk aallkkfsep lsiedvnipe pqgeevliri ggagvcrtdl rvwkgveakq
61 gfrlpiilgh enagtivevg elakvkkgdn vvvyatwgdl tcrycregkf nicknqiipg
121 qttnggfsey mlvkssrwlv klnslspvea apladagtts mgairqalpf iskfaepvvi
181 vngigglavy tiqilkalmk nitivgisrs kkhrdfalel gadyvsemkd aeslinkltd
241 glgasiaidl vgteettynl gkllaqegai ilvgmegkrv sleafdtavw nkkllgsnyg
301 slndledvvr lsesgkikpy iikvplddin kaftnldegr vdgrqvit
(Chain A, D-arabinose dehydrogenase (Sulfolobus solfataricus))
SEQ ID NO: 2
1 mvkskaallk kfseplsied vnipepqgee vliriggagv crtdlrvwkg veakqgfrlp
61 iilghenagt ivevgelakv kkgdnvvvya twgdltcryc regkfnickn qiipgqttng
121 gfseymlvks srwlvklnsl spveaaplad agttsmgair qalpfiskfa epvvivngig
181 glavytiqil kalmknitiv gisrskkhrd falelgadyv semkdaesli nkltdglgas
241 iaidlvgtee ttynlgklla qegaiilvgm egkrvsleaf dtavwnkkll gsnygslndl
301 edvvrlsesg kikpyiikvp lddinkaftn ldegrvdgrq vitp
(Alcohol dehydrogenase GroES domain-containing protein (Sulfolobus
islandicus M.14.25))
SEQ ID NO: 3
1 mfgitfysam rknismvksk aallkkfsep lsiedveipe pkgeevlvri ggagvcrtdl
61 rvwkgveakq gfrlpiilgh enagtvvevg elakakkgdn vvvyatwgdm tcrycregkf
121 nicknqvipg qttnggfsey mlvksyrwlv kldslspvda spladagtts mgairqalpf
181 mnkfaepvvi vngigglavy tiqilkalmk nivivgisrs kkhrdlalel gadyavemke
241 aesliskltd glgasvaidl vgteetsynl gkllaqegai ilvgmegkrv sleafdtavw
301 nkkllgsnyg slndledvvr lsesgkikpy vvkipldein kafkdldegr vegrqvitp
(Alcohol dehydrogenase GroES domain-containing protein (Sulfolobus
islandicus M.16.27))
SEQ ID NO: 4
1 mfgitfysam rknismvksk aallkkfsep lsiedveipe pkgeevlvri ggagvcrtdl
61 rvwkgveakq gfrlpiilgh enagtvvevg elakakkgdn vvvyatwgdm tcrycregkf
121 nicknqvipg qttnggfsey mlvksyrwlv kldslspvda spladagtts mgairqalpf
181 mnkfaepvvi vngigglavy tiqilkalmk nivivgisrs rkhrdlalel gadyavemke
241 aesliskltd glgasvaidl vgteetsynl gkllagegai ilvgmegkrv sleafdtavw
301 nkkllgsnyg slndledvvr lsesgkikpy vvkipldein kafkdldegr vegrqvitp
(Alcohol dehydrogenase GroES domain-containing protein (Sulfolobus
islandicus L.S.2,15))
SEQ ID NO: 5
1 mfgitfysam rknismvksk aallkkfsep lsiedveipe pkgeevlvri ggagvcrtdl
61 rvwkgveakq gfrlpiilgh enagtvvevg elakakkgdn vvvyatwgdm tcrycregkf
121 nicknqvipg qttnggfsey mlvksyrwlv kldslspvda spladagtts mgairqalpf
181 mnkfaepvvi vngigglavy tiqilkalmk nivivgisrs kkhrdlalel gadhavemke
241 aesliskltd glgasvaidl vgteetsynl gkllaqegai ilvgmegkrv sleafdtavw
301 nkkllgsnyg slndledvvr lsesgkikpy vvkipldein kafkdldegr vegrqvitp
Arabinonate dehydratase (AraD)
(NP_344435.1; GI: 15899830; Mandelate racemase/muconate lactonizing
family protein (Sulfolobus solfataricus P2))
SEQ ID NO: 6
1 mikdirtykl cyeginderd alaikglaeh pmeivateie tsdgyvgyge slaygcsdav
61 qvtiekilkp lllkedeeli eylwdkmyka tlrfgrrgia iagisgvdta lwdimgkkak
121 kpiykllggs krkvrayitg gyysekkdle klrdeeayyv kmgfkgikvk igaksmeedi
181 erlkairevv gedvkiavda nnvytfeeal emgrrleklg iwffeepiqt dyldlsarla
241 eelevpiagy etaytrwefy eimrkravdi vqtdvmwtgg isemmkignm akvmgyplip
301 hysaggisli gnlhvaaaln spwiemhlrk ndlrdkifke sieidnghlv vpdrpglgyt
361 irdgvfeeyk cks
(Mandelate racemase/muconate lactonizing protein (Sulfolobus
islandicus Y.G.57.14))
SEQ ID NO: 7
1 mikdirtykl cyeginderd alaikglaeh pmeivvteie tsdgyvgyge slaygcsdav
61 qvtiekilkp lllkedeeli eylwdkmyka tlrfgrrgia iagisgvdta lwdimgkkak
121 kpiykllggs krkvrayitg gyysekkdle klrdeeayyv kmgfkgikvk igaksmeedi
181 erlkairevv gedvkiavda nnvytfeeal emgrrleklg iwffeepiqt dyldlsarla
241 eelevpiagy etaytrwefy eimrkravdi vqtdvmwtgg isemmkignm akvmgyplip
301 hysaggisli gnlhvaaaln spwiemhlrk ndlrdkifke sieidnghlv vpdrpglgyt
361 irdgvfeeyk cks
(Mandelate racemase/muconate lactonizing domain-containing protein
(Sulfolobus islandicus L.D.8.5))
SEQ ID NO: 8
1 mikdirtykl cyeginderd alaikglaeh pmeivvteie tsdgyvgyge slaygcsdav
61 qvtiekilkp lllkedeefi eylwdkmyka tlrfgrrgia iagisgvdta lwdimgkkak
121 kpiykllggs krkvrayitg gyysekkdle klrdeeayyv kmgfkgikvk igaksmeedi
181 erlkairevv gedvkiavda nnvytfeeal emgrrleklg iwffeepiqt dyldlsarla
241 eelevpiagy etaytrwefy eimrkravdi vqtdvmwtgg isemmkignm akvmgyslip
301 hysaggisli gnlhvaaaln spwiemhlrk ndlrdkifke sieidnghlv vpdrpglgyt
361 irdgvfeeyk cks
(Mandelate racemase/muconate lactonizing protein (Sulfolobus
islandicus M.14.25))
SEQ ID NO: 9
1 mikdirtykl cyeginderd alaikglaeh pmeivvteie tsdgyvgyge slaygcsdav
61 qvtiekilkp lllkedeeli eylwdkmyka tlrfgrrgia iagisgvdtg lwdimgkkak
121 kpiykllggs krkvrayitg gyysekkdle klrdeeayyv kmgfkgikvk igaksmeedi
181 erlkairevv gedvkiavda nnvytfeeal emgrrleklg iwffeepiqt dyldlsarla
241 eelevpiagy etaytrwefy eimrkravdi vqtdvmwtgg isemmkignm akvmgyplip
301 hysaggisli gnlhvaaaln spwiemhlrk ndlrdkifke sieidnghlv vpdrpglgyt
361 irdgvfeeyk cks
(Mandelate racemase/muconate lactonizing protein (Sulfolobus
islandicus L.S.2.15))
SEQ ID NO: 10
1 mikdirtykl cyeginderd alaikglaeh pmeivvteie tsdgyvgyge slaygcsdav
61 qvtiekilkp lllkedeeli eylwdkmyka tlrfgrrgia iagisgvdta lwdimgkkak
121 kpiykllggs krkvrayitg gyysekkdle klrdeeayyv kmgfkgikik igaksmeedi
181 erlkairevv gedvkiavda nnvytfeeal emgrrleklg iwffeepiqt dyldlsarla
241 eelevpiagy etaytrwefy eimrkravdi vqtdvmwtgg isemmkignm akvmgyplip
301 hysaggisli gnlhvaaaln spwiemhlrk ndlrdkifke sieidnghlv vpdrpglgyt
361 irdgvfeeyk cks
2-Keto-3-deoxy-D-arabinonate Dehydratase (KdaD)
(NP_344431.1; GI: 15899826; Hypothetical protein SSO3118
(Sulfolobus solfataricus P2)
SEQ ID NO: 11
1 mhfimmklfr vvkrgyyisy aildnstiir ldedpikalm rysenkevlg drvtgidyqs
61 llksfqindi ritkpidppe vwgsgisyem areryseenv akilgktiye kvydavrpei
121 ffkatpnrcv ghgeaiavrs dsewtlpepe lavvldsngk ilgytimddv sardleaenp
181 lylpqskiya gccafgpviv tsdeiknpys lditlkivre grvffegsvn tnkmrrkiee
241 gigylirdnp ipdgtilttg taivpgrdkg lkdediveit isnigtlitp vkkrrkit
(Fumarylacetoacetate (FAA) hydrolase (Sulfolobus islandicus
Y.N.15.51))
SEQ ID NO: 12
1 mltcllptll yakcifimmk lfrvvkrgyy isyaildnst iirldedpik almrysenke
61 vlgdrvtgid yqsllksfqi ndiritkpid ppevwgsgis yemareryse envakilgkt
121 iyekvydavr peiffkatpn rcvghgeaia vrsdsewtlp epelavvlds ngkilgytim
181 ddvsardlea enplylpqsk iyagccafgp vivtsdeikn pyslditlki vregrvffeg
241 svntnkmrrk ieegigylir dnpipdgtil ttgtaivpgr dkglkdediv eitisnigtl
301 itpvkkrrki t
(Fumarylacetoacetate (FAA) hydrolase (Sulfolobus solfataricus 98/2))
SEQ ID NO: 13
1 mmklfrvvkr gyyisyaild nstiirlded pikalmryse nkevlgdrvt gidyqsllks
61 fqindiritk pidppevwgs gisyemarer yseenvakil gktiyekvyd avrpeiffka
121 tpnrcvghge aiavrsdsew tlpepelavv ldsngkilgy timddvsard leaenplylp
181 qskiyagcca fgpvivtsde iknpysldit lkivregrvf fegsvntnkm rrkieegiqy
241 lirdnpipdg tilttgtaiv pgrdkglkde diveitisni gtlitpvkkr rkit
(Chain X, 2-keto-3-deoxy4)-arabinonate dehydratase)
SEQ ID NO: 14
1 mklfrvvkrg yyisyaildn stiirldedp ikalmrysen kevlgdrvtg idyqsllksf
61 qindiritkp idppevwgsg isyemarery seenvakilg ktiyekvyda vrpeiffkat
121 pnrcvghgea iavrsdsewt lpepelavvl dsngkilgyt imddvsardl eaenplylpq
181 skiyagccaf gpvivtsdei knpyslditl kivregrvff egsvntnkmr rkieeqiqyl
241 irdnpipdgt ilttgtaivp grdkglkded iveitisnig tlitpvkkrr kit
(Fumarylacetoacetate (FAA) hydrolase (Sulfolobus islandicus
HVE10/4))
SEQ ID NO: 15
1 mmklfrvvkr gyyisyaild nstiirlded pikalmryse nkevlgdrvt gidyqsllks
61 fqindiritk pidppevwgs gisyemarer yseenvakil gktiyekvyd avrpeiffka
121 tpnrcvghge aiavrsdsew tlpepelavv ldsngkilgy timddvsard leaenplylp
181 qskiyagcca fgpvivtsde iknpysldit lkivrkdrvf fegsvntnkm rrkieeqiqy
241 lirdnpipdg tilttgtaiv pgrdkglkde diveitisni gtlitpvkkr rkit
2,5-dioxopentanoate dehydrogenase (DopDH)
(NP_344430.1; GI: 15899825; Aldehyde dehydrogenase (Sulfolobus
solfataricus P2)
SEQ ID NO: 16
1 mksyqgladk wikgsgeeyl dinpadkdhv lakirlytkd dvkeainkav akfdewsrtp
61 apkrgsillk agelmeqeaq efallmtlee gktlkdsmfe vtrsynllkf ygalafkisg
121 ktlpsadpnt riftvkeplg vvalitpwnf plsipvwkla palaagntav ikpatktplm
181 vaklvevlsk aglpegvvnl vvgkgsevgd tivsddniaa vsftgstevg kriyklvgnk
241 nrmtriqlel ggknalyvdk sadltlaael avrggfgltg qsctatsrli inkdvytqfk
301 qrllervkkw rvgpgtedvd mgpvvdegqf kkdleyieyg knvgakliyg gniipgkgyf
361 leptifegvt sdmrlfkeei fgpvlsvtea kdldeairlv navdyghtag ivasdikain
421 efvsrveagv ikvnkptvgl elqapfggfk nsgattwkem gedalefylk ektvyegw
(Aldehyde dehydrogenase (Sulfolobus islandicus HVE10/4))
SEQ ID NO: 17
1 mksyqgladk wikgsgeeyl dinpadkdhv lakirlytkd dvkeainkav akfdewsrtp
61 apkrgsillk agelmeqeaq efallmtlee gktlkdsmfe vtrsynllkf ygalgfkisg
121 ktlpsadpnt riftvkeplg vvalitpwnf plsipvwkla palaagntav ikpatktplm
181 vaklvevlsk aglpegvvnl vvgkgsevgd tivsddniaa vsftgstevg kriyklvgnk
241 nrmtriqlel ggknalyvdk sadltlaael avrggfgltg qsctatsrli ihkdvytqfk
301 qrllervkkw rvgpgtedvd mgpvvdegqf kkdleyieyg knagakliyg gniipgkgyf
361 leptifegvt shmrlfkeei fgpvlsvtea kdldeairlv navdyghtag ivasdikain
421 efvsrveagv ikvnkptvgl elqapfggfk nsgattwkem gedalefylk ektvyegw
(Aldehyde dehydrogenase (Sulfolobus islandicus Y.G.57.14))
SEQ ID NO: 18
1 mksyqgladk wikgsgeeyl dinpadkdhv lakirlytkd dvkeainkav akfdewsrtp
61 apkrgsillk agelmeqeaq efallmtlee gktlkdsmfe vtrsynllkf ygalafkisg
121 ktlpsadpnt riftvkeplg vvalitpwnf plsipvwkla palaagntav ikpatktplm
181 vaklvevlsk aglpegvvnl vvgkgsevgd tivsddniaa vsftgstevg kriyklvgnk
241 nrmtriqlel ggknalyvdk sadltlaael avrggfgltg qsctatsrli inkdvytqfk
301 qrllervkkw rvgpgtedvd mgpvvdegqf kkdleyieyg knvgakliyg gniipgkgyf
361 leptifegvt sdmrlfkeei fgpvlsvtea kdldeairlv navdyghtag ivasdinain
421 efvsrveagv ikvnkptvgl elqapfggfk nsgattwkem gedalefylk ektvyegw
(Aldehyde dehydrogenase (Sulfolobus islandicus Y.N.15.51))
SEQ ID NO: 19
1 mksyqgladk wikgsgeeyl dinpadkdhv lakirlytkd dvkeainkav akfdewsrtp
61 apkrgsillk agelmeqeaq efallmtlee gktlkdsmfe vtrsynllkf ygalafkisg
121 ktlpsadpnt riftvkeplg vvalitpwnf plsipvwkla palaagntai ikpatktplm
181 vaklvevlsk aglpegvvnl vvgkgsevgd tivsddniaa vsftgstevg kriyklvgnk
241 nrmtriqlel ggknalyvdk sadltlaael avrggfgltg qsctatsrli inkdvytqfk
301 qrllervkkw rvgpgtedvd mgpvvdegqf kkdleyieyg knvgakliyg gniipgkgyf
361 leptifegvt sdmrlfkeei fgpvlsvtea kdldeairlv navdyghtag ivasdikain
421 efvsrveagv ikvnkptvgl elqapfggfk nsgattwkem gedalefylk ektvyegw
(Aldehyde dehydrogenase (Sulfolobus islandicus L.S.2.15))
SEQ ID NO: 20
1 mksyqgladk wikgsgeeyl dinpadkdhv lakirlytkd dvkeainkav akfdewsrtp
61 apkrgsillk agelmeqeaq efallmtlee gktlkdsmfe vtrsynllkf ygalafkisg
121 ktlpsadpnt riftvkeplg vvalitpwnf plsipvwkla palaagntav ikpatktplm
181 vaklvevlsk aglpegvvnl vvgkgsevgd tivsddniaa vsftgstevg kriyklvgnk
241 nrmtriqlel ggknalyvdk sadltlaael airggfgltg qsctatsrli inkdvytqfk
301 qrllervkkw rvgpgtedvd mgpvvdegqf kkdleyieyg knvgakliyg gniipgkgyf
361 leptifegvt sdmrlfkeei fgpvlsvtea kdldeairlv navdyghtag ivasdikain
421 efvsrveagv ikvnkptvgl elqapfggfk nsgattwkem gedalefylk ektvyegw
2,5-dioxovalerate dehydrogenase (YcbD)
(NP_388129.1; GI: 16077316; 2,5-dioxovalerate dehydrogenase
(Bacillus subtilis subsp. subtilis str. 168))
SEQ ID NO: 21
1 msviteqnty lnfingewvk sqsgdmvkve npadvndivg yvqnstaedv eravtaanea
61 ktawrkltga ergqylykta dimeqrleei aacatremgk tlpeakgeta rgiailryya
121 gegmrktgdv ipstdkdalm fttrvplgvv gvispwnfpv aipiwkmapa lvygntvvik
181 patetavtca kiiacfeeag lpagvinlvt gpgsvvgqgl aehdgvnavt ftgsnqvgki
241 igqaalarga kyqlemggkn pvivaddadl eaaaeavitg afrstgqkct atsrvivqsg
301 iyerfkekll qrtkditigd slkedvwmgp iasknqldnc lsyiekgkqe gaslliggek
361 lengkyqngy yvqpaifdnv tsemtiaqee ifgpvialik vdsieealni andvkfglsa
421 siftenigrm lsfideidag lvrinaesag velqapfggm kgssshsreq geaakdffta
481 iktvfvkp
(Aldehyde dehydrogenase, thermostable (Bacillus subtilis subsp.
subtilis str. RO-NN-1))
SEQ ID NO: 22
1 msviteqnty lnfingewvk sqsgdmvkve npadvndivg yvqnstaedv eravaaanea
61 ktawrkltga ergqylykta dimeqrleei aacatremgk tlpeakgeta rgiailryya
121 gegmrktgdv ipstdkdalm fttrvplgvv gvispwnfpv aipiwkmapa lvygntvvik
181 patetavtca kiiacfeeag lpagvinlvt gpgsvvgqgl aehegvnavt ftgsnqvgki
241 igqaalarga kyqlemggkn pvivaddadl eaaaeavitg afrstgqkct atsraivqsg
301 iyerfkekll qrtkditigd slkedvwmgp iasknqldnc lsyiekgkqe gaslliggek
361 lengkyqngy yvqpaifdnv tsemtiaqee ifgpvialik vdsmeealni andvkfglsa
421 siftenigrm lsfideidag lvrinaesag velqapfggm kgssshsreq geaakdffta
481 iktvfvkp
(Hypothetical protein BSNT_00439 (Bacillus subtilis subsp natto
BEST195))
SEQ ID NO: 23
1 msviteqnty lnfikgewvk sqsgdmvkve npadvndivg yvqnstaedv eravaaanea
61 ktawrkltga ergqylykta dimeqrleei aacatremgk tlpeakgeta rgiailryya
121 gegmrktgdv ipstdkaalm fttrvplgvv gvispwnfpv aipiwkmapa lvygntvvik
181 patetavtca kiiacfeeag lpagvinlvt gpgsvvgqgl aehdgvnavt ftgsnqvgki
241 igqaalarga kyqlemggkn pvivaddadl eaaaeavitg afrstgqkct atsrvivqse
301 iyerfkekll qrtkditigd slkedvwmgp iasknqldnc lsyiekgkqe gaslliggek
361 lengkyqngy yvqpaifdnv tsemtiaqee ifgpvialik vdsmeealni andvkfglsa
421 siftenigrm lsfideidag lvrinaesag velqapfggm kgssshsreq geaakdffta
481 iktvfvkp
(Aldehyde dehydrogenase (Bacillus subtilis subsp. spizizenii
TU-B-10))
SEQ ID NO: 24
1 msviteqnty lnfingewvk sqsgdmvkve npadvndivg yvqnstaddv eravaaanea
61 ktawrkltga ergqylykta dimeqrleei aacatremgk tlpeakgeta rgiailryya
121 gegmrktgdv ipstdkdalm fttrvplgvv gvispwnfpv aipiwkmapa lvygntvvik
181 patetavtca kiiacfeeag lpagvinlvt gpgsvvgqgl aehegvnait ftgsnqvgki
241 igqaalarga kyqlemggkn pvivaddadl eaaaeavitg afrstgqkct atsrvivqsg
301 iydrfkekll qrtkdikigd slkedvwmgp iasknqldnc lsyiekgkqe gaslliggek
361 ledgkyqngy yvqpaifdnv tsemtiaqee ifgpvialik vdsmeealdi andvkfglsa
421 siftqnigrm lsfvdeidag lvrinaesag velqapfggm kqssshsreq geaakdffta
481 iktvfvkp
(Aldehyde dehydrogenase (Bacillus sp. JS))
SEQ ID NO: 25
1 msviteqnty lnfingewvq sqsgdmvkve npadvndivg yvqnstaedv eravaaanka
61 ktawrkltga ergqylykta dimerrleei aacatremgk tlpeakgeta rgiailryya
121 gegmrktgdv ipstdkdalm fttrvplgvv gvispwnfpv aipiwkmapa lvygntvvik
181 patetavtca kiiacfeeag lpagvinlvt gpgsvvgqgl aehdsvnavt ftgsnqvgki
241 igqaalarga kyqlemggkn pvivaddadl eaaaeavitg afrstgqkct atsrvivqsg
301 iyerfkekll qrtkditigd slkedvwmgp iasknqldnc lsyiekgkre gasllmggek
361 lenekyqngy yvqpaifdnv tsemtiaqee ifgpvialik vdsmeealdi andvkfglsa
421 siftenigkm lsfideidag lvrvnaesag velqapfggm kgssshsreq geaakdffta
481 iktvfvkp
Xylose dehydrogenase (xylB)
(YP_002516237.1; GI: 221233801; Xylose dehydrogenase xylB
(Caulobacter crescentus NA1000))
SEQ ID NO: 26
1 mssaiypslk gkrvvitggg sgigagltag farqgaevif ldiadedsra leaelagspi
61 ppvykrcdlm nleaikavfa eigdvdvlvn nagnddrhkl advtgaywde rinvnlrhml
121 fctqavapgm kkrgggavin fgsiswhlgl edlvlyetak agiegmtral arelgpddir
181 vtcvvpgnvk tkrqekwytp egeaqivaaq clkgrivpen vaalvlflas ddaslctghe
241 ywidagwr
(Oxidoreductase, short-chain dehydrogenase/reductase
(Phenylobacterium zucineum HLK1))
SEQ ID NO: 27
1 mgvtsaiyps lkgkrvvvtg ggsgigaglv eafvrqgaev hfldvletes rvletslaga
61 evppvfhrcd ltdagaiegc fakigpvqvl vnnagnddrh tldevtpayf ddriavnlrh
121 mvfcakavvp amkaagegai infgsiswhl glpdlvlyet akagiegmtr alarelgpfg
181 irvtcvapgn vktlrqmkwy tpegeaeiva qqclksriep advaalvlfl asddarmctg
241 heywidagwr
(Dehydrogenase of unknown specificity, short-chain alcohol
dehydrogenase (Caulobacter sp. AP07))
SEQ ID NO: 28
1 mssaiypslq gkrvvvtggg sgigagivaa farqgaevif ldvvdadsea laaklsdspi
61 aptymrcdlt dleamaetfa rigpidvlvn nagnddrhgl aeitpaywdq rmavnlrhml
121 fatqavapgm kargggavin fgsiswhlgl pdlvlyetak agiegmtral arelgpddir
181 vtcvvpgnvk tkrqekwytp egeaeivaaq alkgrlvpdh vaslvlflas ddaalctghe
241 ywidagwr
(Short-chain dehydrogenase/reductase SDR (Caulobacter sp. K31))
SEQ ID NO: 29
1 mnievkrpqv stssaiypsl kgkrvvvtgg gsgigagiva gfarqgsevi fldvadqdsk
61 alaeqlsgae iapvylrcdl tdldavaktf adigpvdvlv nnagnddrhg laqitpaywd
121 ermsvnlrhm lfatqavapg mkargggaii nfgsiswhlg lpdlvlyeta kagiegmtra
181 larelgpddi rvtcvvpgni ktkrqekwyt pegeaeivaa galkgrlvpd hvaslvmfla
241 sddaslctgh eywidagwr
(Short-chain dehydrogenase/reductase SDR (Caulobacter segnis ATCC
21756))
SEQ ID NO: 30
1 mssaiypslk gkrvvitggg sgigaglvag fvrqgaevif ldivdadsqa lvaelskdav
61 iapvykrcdl mdidalkatf aeigdvdvlv nnagnddrhs ladltpaywd nrigvnlrhm
121 vfaaqavagg mkkrgggaii nfgsiswhlg ledlvlyeta kagiegmtra larelgpddi
181 rvtcvvpgnv ktkrqekwyt pegeaeivka gclkgrilpd hvaslvlfla sddaslctgh
241 eywidagwr
Xylonolactonase (xylC)
(YP_002516236.1; GI: 221233800; Xylonolactonase xylC (Caulobacter
crescentus NA1000))
SEQ ID NO: 31
1 mtaqvtcvwd lkatlgegpi whgdtlwfvd ikqrkihnyh patgerfsfd apdqvtflap
61 ivgatgfvvg lktgihrfhp atgfslllev edaalnnrpn datvdaggrl wfgtmhdgee
121 nnsgslyrmd ltgvarmdrd icitngpcvs pdgktfyhtd tlektiyafd laedgllsnk
181 rvfvqfalgd dvypdgsvvd segylwtalw ggfgavrfsp qgdavtriel papnvtkpcf
241 ggpdlktlyf ttarkglsde tlaqyplagg vfavpvdvag qpqhevrlv
(SMP-30/gluconolaconase/LRE domain-containing protein (Caulobacter
segnis ATCC 21756))
SEQ ID NO: 32
1 mtaevtcvwd lkatlgegpi whgdalwfvd ikqrkihnyk pttgehfsfd apdqvtflap
61 iadaggfvvg lktgihrfhp itgfrlliev edsaldnrpn datvdangrl wfgtmhdgee
121 aksgslyrmd aegvarmdkd icitngpcvs pdgktfyhtd tlektvwayd laedgtlsnk
181 rafvhvklgd diypdgtvvd segclwialw ggfgvirvsp ageivgriev papnvtkvcf
241 ggpdlktlfl ttarkglsde tlaqyplagg lfaigvniag qpqhevrlv
(Gluconolactonase (Cautobacter sp. AP07))
SEQ ID NO: 33
1 mpepicvwdl katlgegpiw iaaeqalwfv dikshkvhrf hpesgetksf dapdqvtfla
61 pragggfvag lksglhhfhp etgfaylgei epadlnnrpn datvdaegrl wfgtmhdgee
121 tptgalyrlg adgqpvqqdq gvcitngpcv spdgktfyht dtlekviway dlgadgelsn
181 krqffrleid dawpdgsvvd aegyvwaalw gghgairisp agelvdrvtl painvtkpcf
241 ggpdlktlyf ttarkglgde glaayplcgg vfalpvavag qpgyevrldl p
(SMP-30/gluconolaconase/LRE domain-containing protein (Cautobacter
sp. K31))
SEQ ID NO: 34
1 mpepicvwdl katlgegpiw saeeqavwfv dikghkvhrf hpasgatasf dapdqvtfla
61 phaggggfva glksglhrfd pttgafvfla qieppelnnr pndatvdaeg rlwfgtmhdg
121 emtptgalyr lsadgkpiqg degvcitngp caspdgktfy htdtlekviw aydlgadgsl
181 snkreffrle iadawpdgsv vdsegfvwta lwgghgalrl spageivdrv ilpainvtkp
241 cfggpdlktv yftsarkgls deqlaaypqc gglfalpvav agqpqyevrl dlr
(Gluconolactonase (Phenylobacterium zucineum HLK1))
SEQ ID NO: 35
1 mkvlsepdcv lradaelgeg pvwradddav wfvdikgrri hryepvtgaa wswaapaqpg
61 fiapvagggw vaglktglhr feprggrfel itavedpsld nrindgfvda kgrlwfgsmh
121 dgetaltgal yrlderglqr cdtgycitng paaspdgrtl yhtdtlqkti yafdlspage
181 lsnkrvfari eegggypdgp avdaegcvwt glfagwhvrr yspkgellak vgfpvanitk
241 lafggddlts vyattawkgl saderekqpl agglfrfevd vpglpqnqma ha
D-xylonate dehydratase (xylD)
(NP_419636.1; GI: 16125072; Dihydroxy-acid dehydratase)Caulobacter
crescentus CB15))
SEQ ID NO: 36
1 mrsalsnrtp rrfrsrdwfd npdhidmtal ylerfmnygi tpeelrsgkp iigiaqtgsd
61 ispcnrihld lvqrvrdgir daggipmefp vhpifencrr ptaaldrnls ylglvetlhg
121 ypidavvltt gcdkttpagi maattvnipa ivlsggpmld gwhenelvgs gtviwrsrrk
181 laageiteee fidraassap saghcntmgt astmnavaea lglsltgcaa ipapyrergq
241 mayktgqriv dlayddvkpl diltkqafen aialvaaagg stnaqphiva marhagveit
301 addwraaydi plivnmqpag kylgerfhra ggapavlwel lqqgrlhgdv ltvtgktmse
361 nlqgretsdr evifpyhepl aekagflvlk gnlfdfaimk ssvigeefrk rylsqpggeg
421 vfearaivfd gsddyhkrin dpaleiderc ilvirgagpi gwpgsaevvn mqppdhllkk
481 gimslptlgd grqsgtadsp silnaspesa iggglswlrt gdtiridlnt grcdalvdea
541 tiaarkqdgi pavpatmtpw qeiyrahasq ldtggvlefa vkyqdlaakl prhnh
(Dihydroxy-acid dehydratase (Caulobacter sp. K31))
SEQ ID NO: 37
1 mtsantpsgr pprrfrsrdw fdnpdhidmt alylerfmny gitpeelrsg kpiigiaqtg
61 sdispcnrih ldlvtrirdg irdaggipme fpvhpifenc rrptaaldrn lsylglvevl
121 hgypidavvl ttgcdkttpa gimaattvni paivlsggpm ldgwhdgelv gsgtviwrsr
181 rklaageine eefiqrasds apsaghcntm gtastmnava ealglsltgc aaipapyrer
241 gqmayktgqr ivdlayedvk pldiltkkaf enaialvaaa ggstnaqphi vamarhagld
301 itaddwraay diplilnmqp agkylgerfh raggapavlw ellqagrlhg dvmtvtgktm
361 genlegretk drevvfpygq pmseragflv lkgnlfdfai mktsvisqef rqrylsepgk
421 edsfearavv fdgsddyhar indpslnide rtilvirgag pigwpgsaev vnmqppdall
481 krgimslptl gdgrqsgtad spsilnaspe saiggglswl rtgdmiridl ntgrcdalvd
541 eatiaerrke gvppvpatmt pwqeiyraht gqletggvle favkyqdlas klprhnh
(Dihydroxyacid dehydratase/phosphogluconate dehydratase (Caulobacter
sp. AP07))
SEQ ID NO: 38
1 mtspnrtprr frsrdwfdnp dhidmtalyl erfmnygitp eelrsgkpii giaqtgsdis
61 pcnrihldlv trirdgirda ggipmefpvh pifencrrpt aaldrnlsyl glvetlhgyp
121 idavvlttgc dkttpagima attvnipaiv lsggpmldgw hdgelvgsgt viwrsrrkla
181 ageiteeefi qrasdsapsa ghcntmgtas tmnavaealg lsltgcaaip apyrergqma
241 yrtggrivdl ayedikpkdi ltkqafenai alvaaaggst naqphivama rhagldvtad
301 dwraaydipl ilnmqpagky lgerfhragg apavlwellq agrlhgdamt vtgktmaenl
361 egretrdrev vfpyaapmse ragflvlkgn lfdfaimkts visqefrdry lsepgqegaf
421 earavvfdgs gdyharindp slgidertil virgagpigw pgsaevvnmq ppdallkkgi
481 mslptlgdgr qsgtadspsi lnaspesavg gglswlrtgd viridlntgr cdalvdeati
541 aarkleglpp vpetmtpwqe iyrahtgqle tggvlefavk yqdlaaklpr hnh
(Dihydroxy-acid dehydratase (Caulobacter segnis ATCC 21756))
SEQ ID NO: 39
1 msertprrfr srdwfdnpdh idmtalyler fmnygitpee lrsgkpiigi aqtgsdispc
61 nrihldlvtr irdgirdagg ipmefpvhpi fencrrptaa ldrnlsylgl vetlhgypid
121 avvittgcdk ttpagimaat tvnipaivls ggpmldgwhe gelvgsgtvi wrsrrklaag
181 eiteeefidr aassapsagh cntmgtastm navaealgls ltgcaaipap yrergqmayk
241 tgqrivdlay edvkpldilt kkafqnaial vaaaggstna qphivamarh agveitaddw
301 raaydipliv nmqpagkylg erfhraggap avlwellqqg rlhgdvltvt gktmgenlqg
361 retsdrevif pyhqplaeka gflvlkgnlf dfaimkssvi geefrkryls epgkegvfea
421 raivfdgsdd yhkrindpal eidercilvi rgagpigwpg saevvnmqpp dhllkkgims
481 lptlgdgrqs gtadspsiln aspesaiggg lswlrtgdti ridintgrcd alvdeatiae
541 rkkegipavp atmtpwqeiy rahtgqlesg gvlefavkyq dlasklprhn h
(Dihydroxy-acid dehydratase (Caulobacter crescentus NA1000))
SEQ ID NO: 40
1 msnrtprrfr srdwfdnpdh idmtalyler fmnygitpee lrsgkpiigi aqtgsdispc
61 nrihldlvqr vrdgirdagg ipmefpvhpi fencrrptaa ldrnlsylgl vetlhgypid
121 avvlttgcdk ttpagimaat tvnipaivls ggpmldgwhe nelvgsgtvi wrsrrklaag
181 eiteeefidr aassapsagh cntmgtastm navaealgls ltgcaaipap yrergqmayk
241 tgqrivdlay ddvkpldilt kqafenaial vaaaggstna qphivamarh agveitaddw
301 raaydipliv nmqpagkylg erfhraggap avlwellqqg rlhgdvltvt gktmsenlqg
361 retsdrevif pyheplaeka gflvlkgnlf dfaimkssvi geefrkryls qpgqegvfea
421 raivfdgsdd yhkrindpal eidercilvi rgagpigwpg saevvnmqpp dhllkkgims
481 lptlgdgrqs gtadspsiln aspesaiggg lswlrtgdti ridlntgrcd alvdeatiaa
541 rkqdgipavp atmtpwqeiy rahasqldtg gvlefavkyq dlaaklprhn h
2-Keto-3-deoxy-D-arabinonate Dehydratase (xylX)
(NP_419640.1; GI: 16125076; Hypothetical protein CC_0823
(Caulobacter crescentus CB15))
SEQ ID NO: 41
1 mvcrrllawt arareaedfa lvrqptcrph mlalpsader apptvsalqt lefwgddavg
61 vseflpedwk aatllgridf gegptpvlvr ggrvedvski aptvadlmna fqpgaviprg
121 edkgpleald irpvwedpdg aapvkllapv dlqclkaagv tfavstlerv ieerargdag
181 ealkirtlla ermggdlksv epgsggagrl kdaliadglw sqylevaigp daeiftkgpt
241 lssmgwgdqv gvrydshwnn pepevvalcd gsglirgaal gndvnlrdfe grsalllska
301 kdnnascaig pffrlfdetf glddvrsaev elkitgrdnf vldgksnmsl isrdpavlag
361 qaygkqhqyp dgfalflgtm fapiqdrdtp gqgfthkvgd rvrvstpklg vlenevttcd
421 kakpwtfgis alirnlagrg ll
(Fumarylacetoacetate hydrolase family protein (Caulobacter
crescentus NA1000))
SEQ ID NO: 42
1 mgvseflped wkaatllgri dfgegptpvl vrggrvedvs kiaptvadlm nafqpgavip
61 rgedkgplea ldirpvwedp dgaapvklla pvdlqclkaa gvtfavstle rvieerargd
121 agealkirtl laermggdlk svepgsqgaq rlkdaliadg lwsqylevai gpdaeiftkg
181 ptlssmgwgd qvgvrydshw nnpepevyll cdgsglirga algndvnlrd fegrsallls
241 kakdnnasca igpffrlfde tfglddvrsa evelkitgrd nfvldgksnm slisrdpavl
301 agqaygkqhq ypdgfalflg tmfapiqdrd tpgqgfthkv gdrvrvstpk lgvlenevtt
361 cdkakpwtfg isalirnlag rgll
(Fumarylacetoacetate (FAA) hydrolase (Caulobacter segnis ATCC
22756))
SEQ ID NO: 43
1 mgvseflpdd wknatllgri dfgegptpvl vrggrvedms kvaptvadlm nafgpgaaip
61 rgedkgples ldirpvwedp dgaapvklla pvdlqclkaa gvtfavstle rvieerargd
121 aaaalkireq lsasmggdlr svnpgsegae rlkqtlikdg lwsqylevai gpdaeiftkg
181 ptlssmgwgd hvgvrydshw nnpepevvll cdgagqirga slgndvnlrd fegrsallls
241 kakdnnasca igpffrlfde tfalddvrsa evelkitgrd nfvldgksnm slisrdpavl
301 agqaygkqhq ypdgfalflg tmfapiqdrd tpgqgfthkv gdrvrvstpk lgvlenevtt
361 cdkakpwtfg isalirnlag rgll
(Hypothetical protein Caul_4000 (Caulobacter sp. K31))
SEQ ID NO: 44
1 malsdflpdd wrdatllgri dfgqgptpvl irggriedvs kiapttsdlm nafapgaaip
61 rgedlgplea ldvravwenp qgaaakllap vdlqvlkaag vtfavstler vieerargda
121 aealkiraql adsmggdlrs vnpgsdgaer lkqtlikdgl wsqylevaig pdaeiftkgp
181 tlssmgwgdh vgvrsdshwn npepevvllc dgsgqirgaa lgndvnlrdf egrsalllsk
241 akdnnascai gpffrlfddg fslddvrsae vtlkitgrdn fvldghsnms lisrdpavla
301 gqafgkqhqy pdgfalflgt mfapiqdrda agqgfthkvg drvrvatpkl gvlenevttc
361 dlaapwtfgv salirnlagr gll
(Fumarylacetoacetate (FAA) hydrolase family protein (Cautobacter
sp. AP07))
SEQ ID NO: 45
1 malsdflpdd wrdatllgrv dfgdgptpvl vrggriedvs riapttsdlm nafapgaaip
61 agadlgplea ldvrpvwenp dgaaakllap vdlqvlkaag vtfavstler vieerargda
121 aealkiraql adsmggdlrg vnpgsegaar lketlikggl wsqylevaig pdaeiftkgp
181 tlssmgwgdq vgvrsdshwn npepevvllc dgsgrirgas lgndvnlrdf egrsalllsk
241 akdnnascai gpffrlfddg fglddvrsae vtlkitgrdn fvldghsnms lisrdpavla
301 gqafgkqhqy pdgfvlflgt mfapiqdrdt agqgfthkvg drvrvatpkl gvlenevttc
361 dvappwtfgv salirnlagr gll
L-arabinose dehydrogenase (AraE)
(YP_439823.1; GI: 83716868; Dehydrogenase (Burkholderia
thailandensis E264))
SEQ ID NO: 46
1 mnsvytlglv gigkiardqh lpaiaaepgf dllacasrha qvrgvrnypd idallaaepa
61 ldayslaapp qvryaqaraa lgagkhvmle kppgatagei aalralarer grtlfaawhs
121 rhasavepar awlatrtira vqarwkedvr rwhpgqqwiw epgglgvfdp ginalsivtr
181 ilprelvlra atlvvpanah tpiaaeldcv dtagvpvrae fdwrhgpveq wdiavdtdgg
241 vlsigaggar lsiagepval ppereypsly arfraligeg asdvddrplr lvadafmigr
301 riaadpfqr
(Dehydrogenase (Burkholderia thailandensis TXDOH))
SEQ ID NO: 47
1 mnsvytlglv gigkiardqh lpaiaaepgf dllacasrha qvrgvrnypd idallaaepa
61 ldavslaapp qvryaqaraa lgagkhvmle kppgatagei aalhalarer grtlfaawhs
121 rhasavepar awlatrtira vqvrwkedvr rwhpgqqwiw epgglgvfdp ginalsivtr
181 ilprelvlra ativvpanah tpiaaeldcv dtagvpvrae fdwrhgpveq wdiavdtdgg
241 vlsigaggar lsiagepval ppereypsly arfraligeg asdvddrplr lvadafmigr
301 riaadpfqr
(Galactose 1-dehydrogenase (Burkholderia ambfiaria IOP40-10))
SEQ ID NO: 48
1 mskvislgvi gigkiardqh lpaiaaepgf altacasrha evngvrnype lgallaaepe
61 leavslcapp qvryaqaraa leagkhvmle kppgatlgev aaldalarer gltlfatwhs
121 rcasavepar awlatrtira vqvrwkedvr rwhpgqqwiw epgglgvfdp ginalsivtr
181 ilprelvlre atlyvpsdvq tpiaaeldca dtdgvpvhae fdwrhgpveq weiavdtsdg
241 vlaisrggaq lsiggepvei gpqreypaly ahfraliarg esdvdvrplr lvadaflfgr
301 rvgtdafgr
(Galactose 1-dehydrogenase (Burkholderia ambifaria MC40-6))
SEQ ID NO: 49
1 mskvislgvi gigkiardqh lpaiaaepgf altacasrha evngvrnype lgallaaepe
61 leavslcapp qvryagaraa leagkhvmle kppgatlgev aaldalarer gltlfatwhs
121 rcasavepar awlatrtira vqvrwkedvr rwhpgqqwiw epgglgvfdp ginalsivtr
181 ilprelvlre atlyvpsdvq tpiaaeldca dtdgvpvhae fdwrhgpveq weiavdtsdg
241 vlaisrggaq lsiagepvei gpqreypaly ahfraliarg esdvdvrplr lvadaflfgr
301 rvgtdafgr
(Dehydrogenase (Burkholderia thailandensis MSMB43))
SEQ ID NO: 50
1 mntvytlglv gigkiardqh lpaiaaepgf dlracasrha evrgvrnhpd igallaaepa
61 ldavslaapp qvryaqaraa ldagkhvmle kppgatvgei aalralarer grtlfaswhs
121 rharavepar awlatrtira vqvrwkedvr rwhpgqqwiw epgglgvfdp ginalsivtr
181 ilprelvlra ativvpanvh tpiaaefdcv dtagvpvrae fdwrhgpveq wdiavdtdgg
241 vlaigaggar lsiagepval ppeceypsly arfhaliaar esdvddrplr lvadafmvgr
301 riaadpfhr
L-arabinonolactonase (AraI)
(YP_439819.1; GI: 83717359; Senescence marker protein-30 family
protein (Burkholderia thailandensis E264))
SEQ ID NO: 51
1 messnrpart gaasaatlrv dcrnalgega twcdatraly wvdiegarlw rwraagaqgg
61 aatdswempe rigcfaltdd pdvllvglas rlaffdarrr aftpivdvep dlptrindgr
121 cdragafvfg mkdegggspr avggyyrlnp dlslqrlalp laaiangitf spdgsamyfc
181 dsptreiqvc dyrpggdvdr irsfvrladd cgepdgsavd adggvwnaqw ggarivryda
241 qgveteriav ptpqpscval ddggrlyvts arvglddgal arspgaggvf vadtrhagla
301 tsrfalarna
(Senescence marker protein-3O family protein (Burkholderia
thailandensis TXDOH))
SEQ ID NO: 52
1 messsrpart gaasaatlrv dcrnalgega twcdatraly wvdiegarlw rwraagaqgg
61 aatdswempe rigcfaltdd pdvllvglas rlaffdarrr aftpivdvep dlptrindgr
121 cdragafvfg mkdegggspr avggyyrinp dlslqrlalp paaiangiaf spdgsamyfc
181 dsptreiqvc dyrpggdvdr irpfvrladd cgepdgstvd adggvwsaqw ggarivryda
241 qgveteriav ptpqpscval ddggrlyvts arvglddgal arspgaggvf vadtrhagla
301 tsrfalarna
(Senescence marker protein-30 family protein (Burkholderia
thailandensis Bt4)
SEQ ID NO: 53
1 messnrpart gaasaatlrv dcrnalgega twcdatraly wvdiegarlw rwraagaqgg
61 aatdswempe rigcfaltdd pdvllvglas rlaffdarrr aftpivdvep dlptrindgr
121 cdragafvfg mkdegggspr avggyyrlnp dlslqrlalp laaiangiaf spdgsamyfc
181 dsptreiqvc dyrpggdvdr irsfvrladd cgepdgsavd adggvwnaqw ggarivryda
241 qgveteriav ptpqpscval ddggrlyvts arvglddgal arspgaggvf vadtrhagla
(Hypothetical protein BPSS0776 (Burkholderia pseudomallei K96243))
SEQ ID NO: 54
1 messnrpart heasaatllv dcrnalgega twcdaahaly wvdiegarlw rwraagahgg
61 ercdswempe riacfaltgd pdvllvglas rlaffdtrrr altpivdvep drptrindgr
121 cdragafvfg tkdesggasp raiggyyrln adlslqrlal ppaaiangia fspdgsamyf
181 cdsptreiqv cdyrpggdvd rvrsfvrlad ahgepdgstv dasggvwnaq wggarvvryd
241 aqgvetdria vptpqpscvt ldaagrlyvt sarvglddga lagnpgaggv fvahtrhsgs
301 atprfalarh a
(Gluconolactonase (Burkholderia pseudomallei NCTC 13177))
SEQ ID NO: 55
1 messnrpart heasaatllv dcrnalgega twcdaahaly wvdiegarlw rwraagahgg
61 ercdswempe riacfaltgd pdvllvglas rlaffdtrrr altpivdvep drptrlndgr
121 cdragafvfg tkdesggasp raiggyyrln adlslqrlal ppaaiangia fspdgsamyf
181 cdsptreiqv cdyrpggdvd rvrsfvrlad ehgepdgstv dasggvwnaq wggarvvryd
241 aqgvetdria vptpqpscvt ldaagrlyvt sarvglddga lagnpgaggv fvahtrhpgg
301 atprfalarh a
L-arabinonate dehydratase (AraB)
(YP_439826.1; GI: 83718062; Dihydroxy-acid dehydratase (Burkholderia
thailandensis E264))
SEQ ID NO: 56
1 msaskpklrs aqwfgthdkn gfmyrswmkn qgipdhefdg rpivgicntw seltpcnahf
61 rklaehvkrg vyeaggfpve fpvfsngesn lrpsamltrn lasmdveeai rgnpidavvl
121 lagcdkttpa llmgaascdv paivvsggpm lngkldgkni gsgtavwqlh ealkageidl
181 hrflsaeagm srsagtcntm gtastmacla ealgvalphn aaipavdarr yvlahmsgmr
241 ivgmaheglv lskiltraaf enairvnaai ggstnavihl kaiagrlgvp leledwlrlg
301 rgtptivdlm psgrflmeef yyagglpavl rrlgeanllp hpgaltvngq slwdnvrdap
361 shddevirpl drpliadggi rilrgnlapr gavlkpsaas pellkhrgra vvfenfehyk
421 atiddealdv dansvlvlkn cgprgypgma evgnmglppk llrqgvkdmv risdarmsgt
481 aygtvvlhva peaaaggpla avrngdwiel dgeagtltld vsddelarrl sdhdpasapg
541 vaehaagggy arlyvdhvlq adegcdldfl vgrrgaavpr hsh
(Dihydroxy-acid dehydratase (Burkholderia thailandensis TXDOH))
SEQ ID NO: 57
1 msaskpklrs aqwfgthdkn gfmyrswmkn qgipdhefdg rpivgicntw seltpcnahf
61 rklaehvkrg vyeaggfpve fpvfsngesn lrpsamltrn lasmdveeai rgnpidavvl
121 lagcdkttpa llmgaascdv paivvsggpm lngkldgrni gsgtavwqlh ealkageidl
181 hrflsaeagm srsagtcntm gtastmacla ealgvalphn aaipavdarr yvlahmsgmr
241 ivgmaheglv lskiltraaf enairvnaai ggstnavihl kaiagrlgvp leledwlrlg
301 rgtptivdlm psgrflmeef yyagglpavl rrlgeanllp hpgaltvngq slwdnvrdap
361 shddevirpl drpliadggi rilrgnlapr gavlkpsaas pellkhrgra vvfenfehyk
421 atiddealev dansvlvlkn cgprgypgma evgnmglppk llrqgvkdmv risdarmsgt
481 aygtvvlhva peaaaggpla avrngdwiel dceagtltld vsddelarrl sdhdpasapg
541 vaehaagggy arlyvdhvlq adegcdldfl vgrrgaavpr hsh
(Dihydroxy-acid dehydratase (Burkholderia multivorans ATCC 17616))
SEQ ID NO: 58
1 msatkprlrs aqwfgtndkn gfmyrswmkn qgipdhefdg rpiigicntw seltpcnahf
61 rklaehvkrg ifeaggfpve fpvfsngesn lrpsamltrn lasmdveeai rgnpidavvl
121 lagcdkttpa llmgaascdv paivvsggpm lngklegkni gsgtavwqlh ealkageidl
181 hhflsaeagm srsagtcntm gtastmacma ealgvalphn aaipavdsrr yvlahmsgir
241 ivemaleglv lskvltraaf enairvnaai ggstnavihl kaiagrigvp leledwmrig
301 rdtptivdlm psgrflmeef yyagglpavl rrlgeggllp hpdaltvngk tlwdnvreap
361 nyddevirpl drpliadggi rilrgnlapr gavlkpsaas pellkhrgra vvfenfdhyk
421 atindesldv dansvlvlkn cgprgypgma evgnmglppk llrqgvkdmv risdarmsgt
481 aygtvvlhva peaaaggpla avrngdwiel dceagtlhld ipddelqrrl sdvdpaaapg
541 vagqagkggy arlyldhvlq adegcdldfl vgtrgaevps hsh
(Dihydroxy-acid dehydratase (Burkholderia multivorans CGD2M))
SEQ ID NO: 59
1 msatkprlrs aqwfgtndkn gfmyrswmkn qgipdhefdg rpiigicntw seltpcnahf
61 rklaehvkrg ifeaggfpve fpvfsngesn lrpsamltrn lasmdveeai rgnpidavvl
121 lagcdkttpa llmgaascdv paivvsggpm lngklegkni gsgtavwqlh ealkageidl
181 hhflsaeagm srsagtcntm gtastmacma ealgvalphn aaipavdsrr yvlahmsgir
241 ivemaleglv lskvltraaf enairvnaai ggstnavihl kaiagrigvp leledwmrig
301 rdtptivdlm psgrflmeef yyagglpavl rrlgeggllp hpdaltvngk tlwdnvrdap
361 nyddevirpl drpliadggi rilrgnlapr gavlkpsaas pellkhrgra vvfenfdhyk
421 atindealdv dansvlvlkn cgprgypgma evgnmglppk llrqgvkdmv risdarmsgt
481 aygtvvlhva peaaaggpla avrngdwiel dceagtlhld ipddelqrrl sdvdpaaapg
541 vagqagkggy arlyldhvlq adegcdldfl vgtrgaevps hsh
(Dihydroxy-acid dehydratase (Burkholderia thailandensis MSMB43))
SEQ ID NO: 60
1 msaskpklrs aqwfgthdkn gfmyrswmkn qgipdhefdg rpivgicntw seltpcnahf
61 rklaehvkrg vyeaggfpve fpvfsngesn lrpsamltrn lasmdveeai rgnpidavvl
121 lagcdkttpa llmgaascdv paivvsggpm lngkldgkni gsgtavwqlh ealkageidl
181 hrflsaeagm srsagtcntm gtastmacla ealgvalphn aaipavdarr yvlahlsgar
241 ivemahegla lstiltraaf enairanaai ggstnavihl kaiagrlgvp leledwmrig
301 rdtptivdlm psgrflmeef yyagglpavl rrlgeanllp hpgaltvngk slwenvrdap
361 nhddevirpl arpliadggi rvlrgnlapr gavlkpsaas pellrhrgra vvfenfehyk
421 atiddealdv dassvlvlkn cgprgypgma evgnmglppk llrqgvkdmv risdarmsgt
481 aygtvvlhva peaaaggpla avrngdwial dceagtltld vsddelarrl sdldpasapg
541 aagqagsggy arlyvdhvlq adegcdldfl vgrrgaavpr hsh
2-Keto-3-deoxy-L-arabinonate Dehydratase AraD)
(YP_439824.1; GI: 83717217; Dihydrodipicolinate synthase
(Burkholderia thailandensis E264))
SEQ ID NO: 61
1 mntsrspryr gvfpvvpttf aeageldlps qkravdfmid agseglcila nfseqfalad
61 derdvltrti lehvagrvpv ivttthystq vcaarsrraq elgaamvmam ppyhgatfrv
121 pdtqihafya rlsdaldipi miqdapasgt vlsapflarm areieqvsyf kietpgaank
181 lrelirlggd aiegpwdgee aitlladlna gatgamtgga ypdgirpive ahregradda
241 falygrwlpl inhenrqtgl laakalmreg gviacerprh plppihpdsr aeliaiarrl
301 dplvlrwar
(Dihydrodipicolinate synthase, putative (Burkholderia thailandensis
TXDOH))
SEQ ID NO: 62
1 mntsrspryr gvfpvvpttf teageldlps qkravdfmid agseglcila nfseqfalad
61 derdvltrti lehvagrvpv ivttthystq vcaarsrraq elgaamvmam ppyhgatfrv
121 pdtqihafya rlsdaldipi miqdapasgt vlsapflarm areieqvsyf kietpgaank
181 lrelirlggd aiegpwdgee aitlladlna gatgamtgga ypdgirpive ahregradda
241 falyqrwlpl inhenrqtgl laakalmreg gviacerprh plppihpdsr aeliaiarrl
301 dplvlrwar
(Dihydrodipicolinate synthase, putative (Burkholderia thailandensis
MSMB43))
SEQ ID NO: 63
1 mntsrspryr gvfpvvpttf tetgeldlps qmravdfmid agseglcila nfseqfalad
61 derdvltrti lehvagrvpv ivttthystr vcaarsrraq elgaamvmam ppyhgatfrv
121 pdtqihafya rlsdaldipi miqdapasgt vlsapflarm areieqvsyf kietpgaank
181 lrelirlggd aiegpwdgee aitlladlna gatgamtgga ypdgirpivd ahrdgradda
241 falygrwlpl inhenrqtgl vaakalmreg gviacerprh plppihpdsr aelieiarrl
301 dplvlrwar
(Dihydrodipicolinate synthase/N-acetylneuraminate lyase
(Burkholderia dolosa AUO158))
SEQ ID NO: 64
1 mtssrtpryr gifpvvpttf tdtgeldlas qkravdfmid agsdglcila nfseqfaitd
61 derdvltrti lehvagrvpv ivttthystq vcaarslraq qlgaamvmam ppyhgatfrv
121 peaqiydfya rvsdaidipi miqdapasgt vlsapllarm areieqvsyf kietpgaank
181 lrelirlggd avegpwdgee aitlladlna gatgamtgga ypdgirpile ahregrhdda
241 fahyqrwlpl inhenrqsgi lsakalmreg gviacerprh pmpelhpdtr aeliaiarrl
301 dplvlrwar
(Dihydrodipicolinate synthetase family protein (Burkholder
multivorans ATCC BAA-247))
SEQ ID NO: 65
1 mtssrtpryr gifpvvpttf tetgeldlas qkravdfmid agsdglcila nfseqfalad
61 derdvltrti lehvagrvpv ivttshystq tciarsvraq qlgaamvmvm ppyhgatfrv
121 peaqihafya rlsdalsipi miqdapasgt vlsapflaql areiehvayf kietpgaank
181 lrelirlggd aiegpwdgee aitlladlha gatgamtgga ypdgirpile ahregrhdda
241 faryqtwlpl inhenrqsgi ltakalmreg gviaceaprh pmpalhpdtr aeliaiarrl
301 dplvlrwar
D-glucarate dehydratase (YcbF)
(NP_388131.2; GI: 255767063; Glucarate dehydratase (Bacillus
subtilis subsp. subtilis str.168))
SEQ ID NO: 66
1 msspiqeqvq kekrsnipsi semkvipvag hdsmllnlsg ahspfftrni viltdssgnq
61 gvgevpggeh irrtlelsep lvvgksigay qailqtvrkq fgdqdrggrg nqtfdlrttv
121 havtaleaal ldllgkflqe pvaallgegk qrdevkmlgy lfyigdrnrt tlpyqsdeqs
181 dcawfrlrhe ealtpeaivr laesaqeryg fqdfklkggv lrgeeeieav talskrfpea
241 ritldpngaw sleeaialck gkqdvlayae dpcgdengys arevmaefrr atglptatnm
301 iatdwremgh aiqlhavdip ladphfwtmq gsvrvaqmch dwgltwgshs nnhfdislam
361 fthvaaaapg ritaidthwi wqdgqrltkq pfeissgcvk vpdkpglgvd idmeqvekah
421 eiyrkmnlga rndaipmqfl isnwefdrkr pclvr
(Glucarate dehydratase (Bacillus subtilis))
SEQ ID NO: 67
1 msspiqeqvq kekrsnipsi semkvipvag hdsmllnlsg ahspfftrni viltdssgnq
61 gvgevpggeh irrtlelsep lvvgksigay qailqtvrkq fgdqdrggrg nqtfdlrttv
121 havtaleaal ldflgkflqe pvaallgegk qrdevkmlgy lfyigdrnrt tlpyqsdeqs
181 dcawfrlrhe ealtpeaivr laesaqeryg fqdfklkggv lrgeeeieav talskrfpea
241 ritldpngaw sleeaialck gkqdvlayae dpcgdengys arevmaefrr atglptatnm
301 iatdwremgh aiqlhavdip ladphfwtmq gsvrvaqmch dwgltwgshs nnhfdislam
361 fthvaaaapg ritaidthwi wqdgqrltkq pfeissgcvk vpdkpglgvd idmeqvekah
421 eiyrkmnlga rndaipmqfl isnwefdrkr pclvr
(Hypothetical protein BSNT_00441 (Bacillus subtilis subsp. natto
BEST195))
SEQ ID NO: 68
1 msspiqeqvq kekrsnipsi temkvipvag hdsmllnlsg ahspfftrni viltdssgnq
61 gvgevpggeh irrtlelsep lvvgksigay qailqtvrkq fgdqdrggrg nqtfdlrttv
121 havtaleaal ldllgkflqe pvaallgegk qrdevkmlgy lfyigdrkrt tlpyqsdeqs
181 dcawfrlrhe ealtpeaivr laesaqeryg fqdfklkggv lqgeeeieav talskrfpea
241 ritldpngaw sleeaialck gkqdvlayae dpcgdengys arevmaefrr atglptatnm
301 iatdwremgh aiqlhavdip ladphfwtmq gsvrvaqmch dwgltwgshs nnhfdislam
361 fthvaaaapg ritaidthwi wqdgqrltkq pfeissgcvk vpdkpglgid idmeqvekah
421 eiyrkmnlga rndaipmqfl isnwefdrkr pclvr
(Glucarate dehydratase (Bacillus subtilis subsp. spizizenii
TU-B-10))
SEQ ID NO: 69
1 msspiqeqvq kekrsnipsi cemkvipvag hdsmllnlsg ahspfftrni viltdssgnq
61 gvgevpggeq irrtlelaep lvvgksigay qsilqtvrkq fadqdrggrg iqtfdlrttv
121 havtaleaal ldllgkflqe pvaallgegk qrdevkmlgy lfyigdrkqt tlpyqsdeqs
181 dcgwfrlrhe ealtpeaivr laesaqeryg fqdfklkggv lrgedeieav talakrfpea
241 ritldpngaw sleeaialck gkhdvlayae dpcgdengys arevmaefrr atglptatnm
301 iatdwremgh aiqlhavdip ladphfwtmq gsvrvaqmch dwgltwgshs nnhfdislam
361 fthvaaaapg ritaidthwi wqdgqrltkq pfeisegcvk vpnkpglgid idmeqvekah
421 elyrkmnlga rndavpmqfl isnwefdrkr pclvr
(Glucarate dehydratase (Bacillus subtilis subsp. subtilis str.
RO-NN-1))
SEQ ID NO: 70
1 msspmqeqiq kekrsnvpsi semkvipvag hdsmllnlsg ahspfftrni viltdssgnq
61 gvgevpggeh irrtlelsep lvvgksigay qailqtvrkq fgdqdrggrg nqtfdlrttv
121 havtaleaal ldllgkflqe pvaallgegk grdevkmlgy lfyigdrkrt tlpyqsdeqs
181 ycawfrlrhe ealtpeaivr laesaqeryg fqdfklkggv lrgeeeieav talskrfpea
241 ritldpngaw sleeaialck gkqdvlayae dpcgdengys arevmaefrr atglptatnm
301 iatdwremgh aiqlhavdip ladphfwtmq gsvrvaqmcn dwgltwgshs nnhfdislam
361 fthvaaaapg ritaidthwi wqdgqrltkq pfeissgcvk vpdkpglgvd idmeqvekah
421 eiyrkmnlga rndaipmqsl isnwefdrkr pclvr
D-galactarate dehydratase (YcbH)
(NP_388133.2; GI: 255767065; D-galactarate dehydratase (Bacillus
subtilis subsp. subtilis str.168))
SEQ ID NO: 71
1 mamnlrknqa plyikvheid ntaiivndgg lpkgtvfscg lvleedvpqg hkvaltdlnq
61 gdeivrygev igfadetikr gswirealvr mpappalddl planrvpqpr pplegytfeg
121 yrnadgsagt knilgittsv qcvvgvldya vkrikeellp kypnvddvvp lhhqygcgva
181 inapdavipi rtiqnlakhp nfggevmvig lgcekllper iasendddil slqdhrgfaa
241 miqsilemae erlirlnsrt rvscpvsdlv iglqcggsda fsgvtanpav gyaadllvra
301 gatvlfsevt evrdaihllt prayseevgq slikemkwyd sylrrgdadr sanpspgnkk
361 gglsnvveka lgsvaksgts pisgvlgpge rakqkgllfa atpasdfvcg tlqlaagmnl
421 qvfttgrgtp yglaaapvlk vstrhslseh wadlidinag riatgeasie dvgweifrti
481 ldvasgrkqt wadrwglhnd lclfnpapvt
(Hypothetical protein BSNT_00443 (Bacillus subtilis subsp. natto
BEST195))
SEQ ID NO: 72
1 mamnlrknqa plyikvheid ntaiivndgg lpkgtvfscg lvleedvpqg hkvaltdlnq
61 gdeivrygev igfadetikr gswirealvr mpappalddl planrvpqpr pplegytfeg
121 yrnadgsagt knilgittsv qcvvgvldya vkrikeellp kypnvddvvp lhhqygcgva
181 inapdavipi rtiqnlakhp nfggevmvig lgcekllper iasendddil slqdhrgfaa
241 miqsilemae erlirinsrt rvscpvsdlv iglqcggsda fsgvtanpav gyaadllvra
301 gatvlfsevt evrdaihllt prayseevgq slikemkwyd sylrrgdadr sanpspgnkk
361 gglsnvveka lgsvaksgts pisgvlgpge raeqkgllfa atpasdfvcg tlglaagmnl
421 qvfttgrgtp yglaaapvlk vstrhslseh wadlidinag riatgeasie dvgweifrti
481 ldvasgrkqt wadrwglhnd lclfnpapvt
(D-galactarate dehydratase (Bacillus subtilis subsp. subtilis str.
RO-NN-1))
SEQ ID NO: 73
1 mamnlrknqa plyikvheid ntaiivndgg lpkgtvfscg lvleedvpqg hkvaltdlnq
61 gdeivrygev igfadetikr gswirealvr mpappalddl planrvpqpr pplegytfeg
121 yrnadgsagt knilgittsv qcvvgvldya vkrikeellp kypnvddvvp lhhqygcgva
181 inapdavipi rtiqnlakhp nfggevmvig lgcekllper iasendddil slqdhrgfaa
241 miqsilemae erlirinsrt rvscpvsdlv iglqcggsda fsgvtanpav gyaadllvra
301 gatvlfsevt evrdaihllt prayseevgq slieemkwyd sylrrgdadr sanpspgnkk
361 gglsnvveka lgsvaksgts pisgvlgpge raeqkgllfa atpasdfvcg tlqlaagmnl
421 qvfttgrgtp yglaaapvlk vstrhslseh wadlidinag riatgeasie dvgweifrti
481 ldvasgrkqt wadrwglhnd lclfnpapvt
(Hypothetical protein BSSC8_40810 (Bacillus subtilis subsp. subtilis
str. SC-8))
SEQ ID NO: 74
1 mamnlrknqa plyikvheid ntaiivnegg lpkgtvfscg lvleedvpqg hkvaltdlnq
61 gdeivrygev igfadetikr gswirealvr mpappalddl plenrvpqpr pplegytfeg
121 yrnadgsagt knilgittsv qcvvgvldya vkrikeellp kypnvddvvp lhhqygcgva
181 inapdavipi rtiqnlakhp nfggevmvig lgcekllper iasendddil slqdhrgfaa
241 miqsilemae erlirinsrt rvscpvsdlv iglqcggsda fsgvtanpav gyaadllvra
301 gatvlfsevt evrdaihllt pravseevgq slikemkwyd sylrrgdadr sanpspgnkk
361 gglsnvveka lgsvaksgts pisgvlgpge raeqkgllfa atpasdfvcg tlqlaagmnl
421 qvfttgrgtp yglaaapvlk vstrhslseh wadlidinag qiatgeasie dvgweifrti
481 ldvasgrkqt wadrwglhnd lclfnpapvt
(Galactarate dehydratase (Bacillus subtilis BSn5))
SEQ ID NO: 75
1 mamnlrknqa plyikvheid ntaiivndgg lpkgtvfscg lvleedvpqg hkvaltdlnq
61 gdeivrygev igfadetikr gswiredlvr mpappalddl planrvpqpr pslegytfeg
121 yrnadgstgt knilgittsv qcvvgvldya vkrikeellp kypnvddvvp lhhqygcgva
181 inapdavipi rtiqnlakhp nfggevmvig lgcekllper iasengddil slqdhrgfaa
241 miqsilemae erlirlnsrt rvscpvsdlv iglqcggsda fsgvtanpav gyaadllvra
301 gatvlfsevt evrdaihllt pravseevgq slikemkwyd sylrrgdadr sanpspgnkk
361 gglsnvveka lgsvaksgts pisgvlgpge rakqkgllfa atpasdfvcg tlqlaagmnl
421 qvfttgrgtp yglaaapvlk vstrhslseh wadlidinag riatgeasie dvgweifrti
481 ldvasgrkqt wadrwglhnd lclfnpapvt
5-dehydro-4-deoxyglucarate dehydratase (YcbC)
(NP_388128.2; GI: 255767061; 5-dehydro-4-deoxyglucarate dehydratase
(Bacillus subtilis subsp. subtilis str.168))
SEQ ID NO: 76
1 msrirkapag ilgfpvapfn tqgkleeeal fqniefllne gleaifiacg sgefqslsqk
61 eyeqmvevav saaggkvpvy tgvggnlsta ldwaqlsekk gadgylilpp ylvhgegegl
121 yqyaktiies tdlnailyqr dnavlsveqi krlteceqlv gvkdgvgnmd lninlvytig
181 drlgwlngmp maevtmpayl pigfhsyssa isnyiphisr mfydalkngn delvkelyrh
241 vilpindirk qrkgyaysli kagmeimgln vrntarppvg pvekdhyqql eailkqaadr
301 fpkkaatv
(Putative 5-dehydro-4-deoxyglucarate dehydratase (Bacillus subtilis
subsp. subtilis str. RO-NN-1))
SEQ ID NO: 77
1 msrirkapag ilgfpvapfn tqgkleeeal fqniefllne gleaifiacg sgefqslsqk
61 eyeqmvevav saaggkvpvy tgvggnlsta lewaqlsekk gadgylilpp ylvhgeqegl
121 yqyaktiies tdlnailyqr dnavlsveqi krlteceqlv gvkdgvgnmd lninlvytig
181 drlgwlngmp maevtmpayl pigfhsyssa isnyiphisr mfydalkngn delvkelyrh
241 vilpindirk qrkgyaysli kagmeimgln vrntarppvg pvekdhyqql eailkqaadr
301 fpkkaatv
(5-dehydro-4-deoxyglucarate dehydratase (Bacillus vallismortis
DV1-F-3))
SEQ ID NO: 78
1 mnrirkaptg ilgfpvapfn tqgqleeeal fqniefllee gleaifiacg sgefqslsqk
61 eyeqmvevav saaegkvpvy tgvggnlsta lewarlsekk gadgylilpp ylvhgegegl
121 yqyaktiies tdlnailyqr dnavlsleqi krlteceqlv gvkdgvgnmd lninlvytlg
181 drlgwlngmp maevtmpayl pigfhsyssa isnyiphisr mfydalkngn delvkelyqh
241 vilpindirk qrkgyaysli kagmeimgln vrntarppvg pvekehyrql eailkqaadr
301 fpkkaatv
(5-dehydro-4-deoxyglucarate dehydratase (Bacillus subtilis subsp.
spizizenii TU-B-10))
SEQ ID NO: 79
1 msrirkapag ilgfpvapfn tqgkleeeal fqniefllee gleaifiacg sgefqslsqk
61 eyeqmvevai saaggkvpvy tgvggnlsta lewaqlsekk gadgylilpp ylvhgegegl
121 yqyaktiies tdlnailyqr dnavlsveqi krltefeqlv gvkdgvgnmd lninlvytlg
181 drlgwlngmp maevtmpayl pigfhsyssa isnyiphisr mfydalkngd delvkelyqh
241 vilpindirk qrkgyaysli kagmeimgln vrntarppvg pvekdhyqql eailkqaadr
301 fpkkaatv
(ycbC (Bacillus subtilis))
SEQ ID NO: 80
1 msrirkapag ilgfpvapfn tqgtleeeal fqniefllne gleaifiacg sgefqslsqk
61 eyeqmvevav saaggkvpvy tgvggnlsta ldwaqlsekk gadgylilpp ylvhgegegl
121 yqyaktiies tdlnailyqr dnavlsveqi krlteceqlv gvkdgvgnmd lninlvytig
181 drlgwlngmp maevtmpayl pigfhsyssa isnyiphisr mfydalkngn delvkelyrh
241 vilpindirk qrkgyaysli kagmeimgln vrntarppvg pvekdhyqql eailkqpadr
301 fpkkaatv
Amino acid transporter LysE (HypE)
(NP_743408.1; GI: 26987983; Amino acid transporter LysE (Pseudomonas
putida KT2440))
SEQ ID NO: 81
1 maaesyrlqa ldpsrawhrf fatvqqqvek rafgddsseh clrnaqqelt mlgvtdygaf
61 viaflillai pgpgnfalit atgkggikag laatcgvivg dqvllwlava gvatllatyp
121 aafhmvqwag aaylaylglr mllskpggaa htcrmdngqy lrqtmmitll npkaimfyma
181 ffplfvdpvk hqglvtfgfm aatvavvtfl ygliavvlth qlaermrasp rianmferla
241 gaclvgfgik laamr
(Amino acid transporter LysE (Pseudomonas putida BIRD-1))
SEQ ID NO: 82
1 mqqqvekraf gddssahclr naqweltmlg vtdygafvia flillaipgp gnfalitatg
61 kggikaglaa tcgvivgdqv llwlavagva tllatypaaf hvvqwagaay laylglrmll
121 skpggaahtc rmdngqylrq tmmitllnpk aimfymaffp lfvdpvkhqg lvtfgfmaat
181 vavvtflygl iavv1thqla ermraspria nmferlagac lvgfgiklaa mr
(Amino acid transporter LysE (Pseudomonas putida ND6))
SEQ ID NO: 83
1 mqqqvekrav gddssahclr naqqeltmlg vtdygafvia flillaipgp gnfalitatg
61 kggikaglaa tcgvivgdqv llwlavagva tllatypaaf hmvqwagaay laylglrmll
121 skpggaahtc rmdngqylrq tmmitllnpk aimfymaffp lfvdpvkhqg lvtfgfmaat
181 vavvtflygl iavvlthgla ermranpria nmferlagac lvgfgiklaa mr
(Lysine exporter protein LysE/YggA (Pseudomonas putida F1))
SEQ ID NO: 84
1 mlgvtdygaf viaflillai pgpgnfalit atgkggikag laatcgvivg dqvllwlava
61 gvatllatyp aafhmvqwag aaylaylglr mllskpggaa htcrmdngqy lrqtmmitll
121 npkaimfyma ffplfvdpvk hqglvtfgfm aatvavvtfl ygliavvlth qlaermranp
181 rianmferla gaclvgfgik laamr
(Unknown (Pseudomonas putida))
SEQ ID NO: 85
1 mlgvtdygaf viafiillai pgpgnfalit atgkggikag laatcgvivg dqvllwlava
61 gvatllatyp aafhivqwag aaylaylglr mllskpgdap rtsrmdngqy lrqtmlitll
121 npkaimfyma ffplfidpvk hqglvtfgfm aatvavitfl ygliavvlth rlaermranp
181 ritnmferla gaclvgfgik laamr
PP_1245
(NP_743405.1; GI: 26987980; Hypothetical protein PP_1245
(Pseudomonas putida KT2440))
SEQ ID NO: 86
1 mrptengvlh lrkkfvasll avaiasttac aqlgiskeqa gtvigglagv aigstmgsgn
61 gkiaaaliag gigayvgnri ghmldekdqq alalrtqevl sqqqttasaq pvtwksdhsg
121 ataqivpgke ytktkqvevk rapkiqavps mklinepyvt isdnlnvraa pngagekvgs
181 lknhteftav gstgdwilvg rkgvtvgyvh knyvepkaqa vakrvtpavn ldeldvaask
241 etqgfdldsv qslptqtvaa eaacrpvtvs lksgsgqteq eqntfckqan gtweli
(SH3 type 3 domain-containing protein (Pseudomonas putida W619))
SEQ ID NO: 87
1 mrkkfvasll avaiatttac aqlgiskeqa gtvigglagv aigstmgsgn gkiaaaliag
61 gigayvgnri ghmldekdqq alalrtqevl sqsatasaqp vtwksdhsga taqitpgkey
121 tqtkkvevkr apkiqavpsm klinepyvti sdnlnvraap nttgekvgsl kshteftavg
181 stgdwilvgr kgvtvgyvhk nyvepkawai akraapavnl ddldvaanke tqgfdldsiq
241 slptetvaae aacrpvtvsl ksgsgqteqe qntfckqang tweli
(Hypothetical protein G1E_03180 (Pseudomonas sp. TJI-51))
SEQ ID NO: 88
1 mrkkfvasll avaiasttac aqlgiskeqa gtvigglagv aigstlgsgn gkiaaaliag
61 gigayvgnri gnmldekdqq alalrtqevl sqqqatasaq pvtwksdhsg asaqivpgke
121 ytktkqvevk rapkiqavps mklinepyvt tsdnlnvraa pnasgekvgs lknhteftav
181 gatgdwilvg rkgvtvgyvh kdyvepkaqa vakrvtpavn ldeldvaask etqafdldsl
241 qslptqtvaa eaacrpvtvs lkaqngkteq eqntfckqan gtweli
(SH3 type 3 domain-containing protein (Pseudomonas putida GB-1))
SEQ ID NO: 89
1 mrkkfvasll avaiasttac aqlgiskeqa gtvigglagv aigstmgsgn gkiaaaliag
61 gigayvgnri ghmldekdqq alalrtqevl sqqqatasaq pvtwksdhsg ataqivpgke
121 ytqtkkvevk rapkiqavps mklinepyvt vsdnlnvraa pnqsgekvgs lknhteftav
181 gstgdwilvg rkgvtvgyvh knyvepkaqa vakrvtpavn ldeldvaask etqgfdldsv
241 qslptetvaa eaacrpvtvs lksgsgqteq eqntfckqan gtweli
(SH3 type 3 domain-containing protein (Pseudomonas putida F1))
SEQ ID NO: 90
1 mrkkfvasll avaiasttac aqlgiskeqa gtvigglagv aigstmgsgn gkiaaaliag
61 gigayvgnri ghmldekdqq alalrtqevl sqqqttasaq pvtwksdhsg ataqivpgke
121 ytktkqvevk rapkiqavps mklinepyvt isdnlnvraa pnqagekvgs lknhteftav
181 gstgdwilvg rkgvtvgyvh knyvepkaqa vakrvtpavn ldeldvaask etqgfdldsv
241 qslptqtvaa eaacrpvtvs lksgsgqteg eqntfckgan gtweli
PP_1247
(NP_743407.1; GI: 26987982; Hypothetical protein PP_1247
(Pseudomonas putida KT2440))
SEQ ID NO: 91
1 mpicssgwrg lawwdsasnw rrcadpkpds vrarltatlk kppathgsrg lvhsaitqsi
61 gfqliglahe grrkgalafl egvllferav fdqllpdgaf rvavvlglga kvtaprrqpn
121 llaegcelcl gdlllvfaes lfqrfeaava hrvvldlgla gkaahrfsqh rlagvravra
181 nqhraggtle lgfdivqfrq rlevglandf phlgavvavg dherhrafai agaldgevqv
241 drgtkvtgaa dqkragywla hrhvgapgev rrggptiggq lgtwldfvad irhqhdfgpl
301 ggnvrvahlh aqqldmnaai laysvmgqlq rislqvhpgh iaadielvlg parqaffsrt
361 tlyglhgarq aahellgaig lrrrhadlry gyrqvagkrr vgnvplrqhi lkeiallevv
421 vvgqrsllar agdhriatte hqhrcghtan qqlllvhlfd hgvcltgpwr krcssrsrtv
481 grprgss
(Uncharacterized protein LOC100789425 (Glycine max))
SEQ ID NO: 92
1 msniafrsti vfllfsavls tppedpikca tsenttctit nsygafpdrs ickaaqvlyp
61 tteqelvsvv asatrnktkm kvatrfshsi pklvopegen gllistkyln kilkvdvetr
121 tmtvesgvtl qqlineaakv glalpyapyw wgltigglmg tgahgstlrg kgsavhdyvv
181 elrivrpagp edgyamvenl neqhedlnaa kvslgvlgvi sqitlklepl fkrsityvak
241 ddsdlggqvv afgdahefad itwypsqhka iyrvddrvpi ntsgnglydf ipfrptpsla
301 svfirtteei qestndangk civastasnt litaaygltn ngiifagypi igfqnrlqss
361 gscldslqda littcawdpr mkglffhqtt fsirlsfvks fiedvqklve lepkglcvlg
421 lyngmlmryv tassaylghq enaldidity yrskdpmtpr lyedileeve qlgifkyggl
481 phwgknrnla fegaikkyks aeyflkvkek ydldglfsst wtdqvlglkd gvtilkdgca
541 leglciclqd shcnpskgyy crpgkvykea rvctnlk
PP_1246
(NP_743406.1; GI: 26987981; Hypothetical protein PP_1246
(Pseudomonas putida KT2440))
SEQ ID NO: 93
1 mkkhalalav igacglvpqa fahelafskk dnikvevpgd atswckpqvd ltitrpawdn
61 gellaglitk lpfvfakdcs takvswkavd akgnlyasgs gnasnigivt laaapataap
121 apaaaptptp apapapapap aaaaapavve aapaqakpap apapapapav aaepapapea
181 paaapvvppa papatavaaa ptsdfgrsvv lenrnlmqvt dgtgckwvis tsiigdgdti
241 sfgttpampc pasgfgegsf dkiswkavgt yrgdnwtrvy ahpsglifnk nlepavkdka
301 vsyltpqadq aaflvgeipg rqmkvyltft rssygvlrpf ssdpyyvavt pdesfaldat
361 kykeaaleif dlikttsptt tdvanlfivk dlsaisnniw gndaqkitrn riginrqglf
421 fdvrdganwa vgreqqrvre grqrqqelar vhtrvieryq qlqdgmsdfk gretealaqm
481 agikvrfasp leqqnpatsa svvpmmvhvt gkkgdfysid fpsngrlvad eeysegwyvt
541 qvanatpyyp lddgravpty raysagepea ckqdhcadry sfgavlakef pnagidfswt
601 pevsqqyvnd wnnasamvq
(Hypothetical protein TIE_4663 (Pseudomonas putida DOT-T1E))
SEQ ID NO: 94
1 mvienrnimq vtdgtgckwv lstsiigdgd tlsfgttpam pcpasgfgeg sfdkiswkav
61 gtyrgdnwtr vyahpsglif nkhlepavkd kaysyltpqa dqaafivgei pgrqmkvylt
121 ftrssygvlr pfgsdpyyva vtpdesfald atkykeaale ifdlikttsp tttdvanlfi
181 vkdlsaisnn iwgndaqkit rnriginrqg iffdvrdgan wavgreqqry reqrqrqqe1
241 arvhtrvier yqqlqdgmsd fkgreteala qmagikvrfa spleqqnpat sasvvpmmvh
301 vtgkkgdfys idfpsngrlv adeeysegwy vtqvanatpy yplddgravp tyraysagep
361 eackqdhcad rvsfgavlak efpnagidfs wtpevsqqyv ndwnnasamv q
(Hypothetical protein YSA_07676 (Pseudomonas putida ND6))
SEQ ID NO: 95
1 mkkhalalav igacglvpqa fahelafskk dnikvevpgd attwckpqvd ltitrpawdn
61 gellsglitk lpfvfakdcs takvswkavd akgnlyasgs gnasnlgivt laaapataap
121 apaaavapap apagpeapaa aaptpapapa papapaaaaa pavveaapaq akpapapapa
181 pavaaepapt peapaaapvv ppapapatav aaaptsdfgr svvienrnlm qvtdgtgckw
241 vlstsiigdg dtlsfgttpa mpcpasgfge gsfdkiswka vgtyrgdnwt rvyahpsgli
301 fnkhlepavk dkaysyltpq adqaafivge ipgrqmkvyl tftrssygvl rpfgsdpyyv
361 avtpdesfal datkykeaal eifdliktts ptttdvanlf ivkdlsaisn niwgndaqki
421 trnriginrq glffdvrdga nwavqreqqr vreqrqrqqe larvhtrvle ryqqlqdgms
481 dfkgreteal aqmagikvrf aspleqqnpa tsasvvpmmv hvtgkkgdfy sidfpsngrl
541 vadeeysegw yvtqvanatp yyplddgrav ptyraysage peackqdhca drvsfgavla
601 kefpnagidf swtpevsqqy vndwnnasam vq
(Hypothetical protein Pput_1275 (Pseudomonas putida F1))
SEQ ID NO: 96
1 mkkhalalav igacglvpqa fahelafskk dnikvevpgd attwckpqvd ltitrpawdn
61 qellsglltk lpfvfakdcs takvswkavd akgnlyasgs gnasnlglvt laaapapapa
121 papapapaaa apapaaavap apapagpeap aaaaptpapa papapaaaaa pavveaaaaq
181 akpapapapa pavaaepapt peapaaapvv ppapapatav aaaptsdfgr svvlenrnlm
241 qvtdgtgckw vlstsiigdg dtlsfgttpa mpcpasgfge gsfdkiswka vgtyrgdnwt
301 rvyahpsgli fnknlepavk dkaysyltpq adqaaflvge ipgrqmkvyl tftrssygvl
361 rpfgsdpyyv avtpdesfal datkykeaal eifdliktts ptttdvanlf ivkdlsaisn
421 niwgndaqki trnriginrq glffdvrdga nwavqreqqr vreqrqrqqe larvhtrvle
481 ryqqlqdgms dfkgreteal aqmagikvrf aspleqqnpa tsasvvpmmv hvtgkkgdfy
541 sidfpsngrl vadeeysegw yvtqvanatp yyplddgrav ptyraysage peackqdhca
601 drvsfgavla kefpnagidf swtpevsqqy vndwnnasam vg
(Hypothetical protein PputGB1_4145 (Pseudomonas putida GB-1))
SEQ ID NO: 97
1 mkkhalalav vgacglvpqa fahelafskk enikvevpgd aatwckpeve ltitrpawdk
61 qellsglltk lpfvfakdca takvswkavd akgnlyasgs gnatnlglvt avapaaasa
121 apapapapap apapapapap avaalapaap avpapaeapa avaaapapav vepapakaev
181 apapvvaaep apapvaetpv aapvappvpa padavaaapt sdfgravvlq nrnlmqvtdg
241 tgckwvlsts iisdgdtlsf gttpvmpcpa sgfgegsfek iswkavgtyr gdnwtrvyah
301 psglifnknl esavkdkays yltadadqaa flvgeipsrq mkvyltftrs sygvlrpfss
361 dpyyvavtpd esfaldaaky keaaleifdl ikatsptttd vanlfivkdi saitnsmwgn
421 daqkitrnri gitrqglffd vreganwavq reqqrvreer grqqelarvh trvleryqql
481 qdgmsdfkgr etealaqmag ikvrfaspla qqdpatsary apmmvhvtgk kgdfytldfp
541 skgrlvadee ysegwyvtqv anatpyypld dgravptyra ysagepeacq qdhcadrvsf
601 gavlakefpn agidfswtpe vsqkyvndwn nasamvq
Alpha-ketoisovalerate decarboxylase
(YP_003353820.1; GI: 281491840; Alpha-ketoisovalerate decarboxylase
(Lactococcus lactis subsp. lactis KF147))
SEQ ID NO: 98
1 mytvgdylld rlhelgieei fgvpgdynlq fldqiisrkd mkwvgnanel nasymadgya
61 rtkkaaaflt tfgvgelsav nglagsyaen lpvveivgsp tskvqnegkf vhhtladgdf
121 khfmkmhepv taartlltae natveidrvl sallkerkpv yinlpvdvaa akaekpslpl
181 kkenptsnts dgeilnkige slknakkpiv itgheiisfg lentvtqfis ktklpittln
241 fgkssvdetl psflgiyngk lsepnlkefv esadfilmlg vkltdsstga fthhlnenkm
301 islnidegki fnesiqnfdf eslisslldl sgieykgkyi dkkqedfvps nallsqdrlw
361 qavenitqsn etivaeggts ffgassiflk pkshfiggpl wgsigytfpa algsqiadke
421 srhllfigdg slqltvgelg lairekinpi cfiinndgyt vereihgpnq syndipmwny
481 sklpesfgat eervvskivr tenefvsvmk eaqadpnrmy wielvlaked apkvlkkmgk
541 lfaeqnks
(Indole-3-pyruvate decarboxylase (Lactococcus lactis subsp. lactis
IO-1))
SEQ ID NO: 99
1 mytvgdylld rlhelgieei fgvpgdynlq fldqiisrkd mkwvgnanel nasymadgya
61 rtkkaaaflt tfgvgelsav nglagsyaen lpvveivgsp tskvqnegkf vhhtladgdf
121 khfvkmhepv taartlltae natveidrvl svllkerkpv yinlpvdvaa akaekpslpl
181 kkenpnsnts dgeilnkige slknakkpiv itgheiisfg lektvtqfis ktklpittln
241 fgkssvdeal psflgiyngk lsepnlkefv esadfilmlg vkltdsstga fthhlnenkm
301 islninegki fsesiqnfdf eslisslldl sgieykgkyi dkkqenfvps nallsqdrlw
361 qavenitqsn etivaeggts ffgassiflk pkshfiggpl wgsigftfpa algsqiadke
421 srhllfigdg slqltvgelg lairekinpi cfiinndgyt vereihgpnq syndipmwny
481 sklpesfgat edrvvskivr tenefvsvmk eaqadpnrmy wielvlaked apkvlkkmgk
541 lfaeqnks
(Branched-chain alpha-ketoacid decarboxylase Lactococcus lactis))
SEQ ID NO: 100
1 mytvgdylld rlhelgieei fgvpgdynlq fldqiisred mkwignanel nasymadgya
61 rtkkaaaflt tfgvgelsai nglagsyaen lpvveivgsp tskvqndgkf vhhtladgdf
121 khfmkmhepv taartlltae natyeidrvl sqllkerkpv yinlpvdvaa akaekpals1
181 ekessttntt eqvilskiee slknaqkpvv iaghevisfg lektvtqfvs etklpittln
241 fgksavdesl psflgiyngk lseislknfv esadfilmlg vkltdsstga fthhldenkm
301 islnidegii fnkvvedfdf ravvsslsel kgieyegqyi dkqyeefips saplsqdrlw
361 qavesltqsn etivaeggts ffgastiflk snsrfiggpl wgsigytfpa algsqiadke
421 srhllfigdg slqltvgelg lsireklnpi cfiinndgyt vereihgptq syndipmwny
481 sklpetfgat edrvvskivr tenefvsvmk eaqadvnrmy wielvleked apkllkkmgk
541 lfaeqnk
(Chain A, branched-chain ketoacid decarboxylase (Kdca) (Lactococcus
Lactis))
SEQ ID NO: 101
1 mgsshhhhhh ssglvprgsh masmytvgdy lldrlhelgi eeifgvpgdy nlqfldqiis
61 redmkwigna nelnasymad gyartkkaaa flttfgvgel sainglagsy aenlpvveiv
121 gsptskvqnd gkfvhhtlad gdfkhfmkmh epvtaartll taenatyeid rvlsqllker
181 kpvyinlpvd vaaakaekpa lslekesstt ntteqvilsk ieeslknaqk pvviaghevi
241 sfglektvtq fvsetklpit tlnfgksavd eslpsflgiy ngklseislk nfvesadfil
301 mlgvkltdss tgafthhlde nkmislnide giifnkvved fdfravvssl selkgieyeg
361 gyidkgyeef ipssaplsqd rlwqaveslt qsnetivaeg gtsffgasti flksnsrfig
421 qplwgsigyt fpaalgsqia dkesrhllfi gdgslqltvg elglsirekl npicfiinnd
481 gytvereihg ptqsyndipm wnysklpetf gatedrvvsk ivrtenefvs vmkeaqadvn
541 rmywielvle kedapkllkk mgklfaeqnk
(Indole-3-pyruvate decarboxylase (Lactococcus lactis subsp. lactis
II1403))
SEQ ID NO: 102
1 mytvgdylld rlhelgieei fgvpgdynlq fldqiisrkd mkwvgnanel nasymadgya
61 rtkkaaaflt tfgvgelsav nglagsyaen lpvveivgsp tskvqnegkf vhhtladgdf
121 khfmkmhepv taartlltae natveidrvl sallkerkpv yinlpvdvaa akaekpslp1
181 kkenptsnts dgeilnkige slknakkpiv itgheiisfg lektvtqfis ktklpittln
241 fgkssvdetl psflgiyngk lsepnlkefv esadfilmlg vkltdsstga fthhlnenkm
301 islninegki fnerignfdf eslisslldl sgieykgkyi dkkqedfvps nallsqdrlw
361 qavenitqsn etivaeqgts ffgassiflk pkshfigqpl wgsigytfpa algsqiadke
421 srhllfigd slqltvgerk lqvqvscipss shmnsys
Alcohol dehydrogenase yqhD
(YP_001459806.1; GI: 157162488; Alcohol dehydrogenase yqhD
(Escherichia coli HS))
SEQ ID NO: 103
1 mnnfnlhtpt rilfgkgaia glreqiphda rvlitygggs vkktgvldqv ldalkgmdvl
61 efggiepnpa yetlmnavkl vreqkvtfll avgggsvldg tkfiaaaany penidpwhil
121 qtggkeiksa ipmgcvltlp atgsesnaga visrkttgdk qafhsahvqp vfavldpvyt
181 ytlpprqvan gvvdafvhtv eqyvtkpvda kiqdrfaegi lltliedgpk alkepenydv
241 ranvmwaatq alngligagv pqdwathmlg heltamhgld haqtlaivlp alwnekrdtk
301 rakllqyaer vwnitegsdd eridaaiaat rnffeqlgvp thlsdygldg ssipallkkl
361 eehgmtqlge nhditldvsr riyeaar
(Alcohol dehydrogenase, iron-dependent (Escherichia coli 97.0259))
SEQ ID NO: 104
1 mnnfnlhtpt rilfgkgaia glreqiphda rvlitygggs vkktgvldqv ldalkgmdvl
61 efggiepnpa yetlmnavkl vreqkvtfll avgggsvldg tkfiaaaany penidpwhil
121 qtggkeiksa ipmgcvltlp atgsesnaga visrkttgdk qafhsahvqp vfavldpvyt
181 ytlpprqvan gvvdafvhtv eqyvtkpvda kiqdrfaegi lltliedgpk alkepenydv
241 ranvmwaatq alngligagv pqdwathmlg heltamhgld haqtlaivlp alwnekrdtk
301 rakllqyaer iwnitegsdd eridaaiaat rnffeqlgvp thlsdygldg ssipallkkl
361 eehgmtqlge nhditldvsr riyeaar
(Alcohol dehydrogenase (Escherichia coli MS 200-1))
SEQ ID NO: 105
1 mnnfnlhtpt rilfgkgaia glreqiphda rvlitygggs vkktgvldqv lnalkgmdvl
61 efggiepnpa yetlmnavkl vreqkvtfll avgggsvldg tkfiaaaany penidpwhil
121 qtggkeiksa ipmgcvltlp atgsesnaga visrkttgdk qafhsahvqp vfavldpvyt
181 ytlpprqvan gvvdafvhtv eqyvtkpvda kiqdrfaegi lltliedgpk alkepenydv
241 ranvmwaatq alngligagv pqdwathmlg heltamhgld haqtlaivlp alwnekrdtk
301 rakllqyaer vwnitegsdd eridaaiaat rnffeqlgvp thlsdygldg ssipallkkl
361 eehgmtqlge nhditldvsr riyeaar
(Alcohol dehydrogenase yqhD (Escherichia coli B7A))
SEQ ID NO: 106
1 mnnfnlhtpt rilfgkgaia glreqiphda rvlitygggs vkktgvldqv ldalkgmdvl
61 efggiepnpa yetlmnavkl vreqkvtfll avgggsvldg tkfiaaaany penidpwhil
121 qtggkeiksa ipmgcvltlp atgsesnaga visrkttgdk qafhsahvqp vfavldpvyt
181 ytlpprqvan gvvdafvhtv eqyvtkpvda kiqdrfaegi lltliedgpk alkepenydv
241 ranvmwaatq alngligagv pqdwathmlg heltamhgld haqtlaivlp alwnekretk
301 rakllqyaer vwnitegsdd eridaaiaat rnffeqlgvp thlsdygldg ssipallkkl
361 eehgmtqlge nhditldvsr riyeaar
(Alcohol dehydrogenase (Escherichia coli MS 196-1))
SEQ ID NO: 107
1 mnnfnlhtpt rilfgkgaia glreqiphda rvlitygggs vkktgvldqv ldalkgmdvl
61 efggiepnpa yetlmnavkl vreqkvtfll avgggsvldg tkfiaaaany penidpwhil
121 qtggkeiksa ipmgcvltlp atgsesnaga visrkttgdk qafhsahvqp vfavldpvyt
181 ytlpprqvan gvvdafvhtv eqyvtkpvda kiqdrfaegi lltliedgpk alkepenydv
241 ranvmwaatq alngligagv pqdwathmlg hkltamhgld haqtlaivlp alwnekrdtk
301 rakllqyaer vwnitegsdd eridaaiaat rnffeqlgvp thlsdygldg ssipallkkl
361 eehgmtqlge nhditldvsr riyeaar
