DIFFERENTIATING INDUCED PLURIPOTENT STEM CELLS INTO GLUCOSE-RESPONSIVE, INSULIN-SECRETING PROGENY
This document provides methods and materials related to differentiating iPS cells into glucose-responsive, insulin-secreting progeny. For example, methods and material for using indolactam V (ILV) and glucagon like peptide-1 (GLP-1) to produce glucose-responsive, insulin-secreting progeny from iPS cells are provided.
Latest Mayo Foundation for Medical Education and Research Patents:
- NANOENGINEERING OF SHEAR-THINNING BIOMATERIALS
- Downstream variable thickness energy selection system for charged particle therapy
- Methods of Improving Recovery after Lung Resection
- High-sensitivity and real-time ultrasound blood flow imaging based on adaptive and localized spatiotemporal clutter filtering
- tTG-DGP biomarkers for monitoring celiac disease
This application is a continuation of U.S. application Ser. No. 14/340,161, filed Jul. 24, 2014, which is a continuation of U.S. application Ser. No. 13/553,064, filed Jul. 19, 2012 (Abandoned), which claims the benefit of U.S. Provisional Application Ser. No. 61/510,818, filed Jul. 22, 2011. The disclosures of the prior applications are considered part of (and are incorporated by reference in) the disclosure of this application.
BACKGROUND 1. Technical FieldThis document relates to methods and materials involved in differentiating induced pluripotent stem (iPS) cells into glucose-responsive, insulin-secreting progeny. For example, this document relates to the use of indolactam V (ILV) and glucagon like peptide-1 (GLP-1) to produce glucose-responsive, insulin-secreting progeny from iPS cells.
2. Background InformationStem cells are characterized by the ability of self-renewal and differentiation into a diverse range of cell types. The two broad types of mammalian stem cells are embryonic stem
(ES) cells and adult stem cells. Adult stem cells or progenitor cells replenish specialized cells to repair or maintain regenerative organs. Most adult stem cells are lineage-restricted and generally referred to by their tissue origin, such as adipose-derived stem cells. ES cell lines are derived from the epiblast tissue of the inner cell mass of a blastocyst or early morula stage embryos. ES cells are pluripotent and give rise to derivatives of the three germinal layers, i.e., the ectoderm, endoderm, and mesoderm.
SUMMARYThis document provides methods and materials related to differentiating iPS cells into glucose-responsive, insulin-secreting progeny. For example, this document provides methods and material for using ILV and GLP-1 to produce glucose-responsive, insulin-secreting progeny from iPS cells. As described herein, culturing iPS cells in the presence of a collection of agents that include ILV and GLP-1 can result in the production of glucose-responsive, insulin-producing cells. For example, an ILV and GLP-1-enriched pancreatogenic cocktail can be used under feeder cell-free conditions to produce glucose-responsive, insulin-producing cells from human iPS cells. Autologous iPS cell derivation and iPS cell differentiation into insulin-producing cells can allow modeling of patient-specific disease pathogenesis and can lead to personalized approaches for type 1 diabetes cell therapy with iPS-derived islet-like cells.
In general, one aspect of this document features a method for obtaining a population of glucose-responsive, insulin-secreting cells from a population of induced pluripotent stem cells.
The method comprises, or consists essentially of, culturing the induced pluripotent stem cells with medium comprising indolactam V and glucagon like peptide-1 under conditions to obtain the population of glucose-responsive, insulin-secreting cells. The medium can lack serum. The medium can lack feeder cells. The medium can lack non-human feeder cells. The induced pluripotent stem cells can be induced pluripotent stem cells that were obtained using one or more polypeptides or nucleic acid encoding the one or more polypeptides selected from the group consisting of a Oct3/4 polypeptide, a Sox family polypeptide, a Klf family polypeptide, a Myc family polypeptide, a Nanog polypeptide, and a Lin28 polypeptide. The induced pluripotent stem cells can be induced pluripotent stem cells that were induced from somatic cells. The somatic cells can be selected from the group consisting of skin, lung, heart, stomach, brain, liver, blood, kidney, and muscle cells. The induced pluripotent stem cells can comprise exogenous nucleic acid encoding a human Oct4 polypeptide, a human Sox2 polypeptide, a human Klf4 polypeptide, and a human c-Myc polypeptide. The glucose-responsive, insulin-secreting cells can secrete greater than 50 pM of C peptide per hour when in culture in the presence of about 10 mM of glucose. The glucose-responsive, insulin-secreting cells can secrete greater than 200 pM of C peptide per hour when in culture in the presence of about 10 mM of glucose. The glucose-responsive, insulin-secreting cells can secrete between about 50 and 250 pM of C peptide per hour when in culture in the presence of about 10 mM of glucose. The glucose-responsive, insulin-secreting cells can be human cells. The medium can comprise greater than 300 nM of indolactam V. The medium can comprise greater than 55 nM of glucagon like peptide-1. The culturing can be performed for more than 25 days.
In another aspect, this document features a population of glucose-responsive, insulin-secreting cells derived from induced pluripotent stem cells, wherein the glucose-responsive, insulin-secreting cells are produced by culturing the induced pluripotent stem cells with medium comprising indolactam V and glucagon like peptide-1 under conditions that result in the formation of the population of glucose-responsive, insulin-secreting cells. The medium can comprise greater than 300 nM of indolactam V. The medium can comprise greater than 55 nM of glucagon like peptide-1. The culturing can be performed for more than 25 days. The population of glucose-responsive, insulin-secreting cells can secrete greater than 50 pM of C peptide per hour when in culture in the presence of about 10 mM of glucose. The population of glucose-responsive, insulin-secreting cells can secrete greater than 200 pM of C peptide per hour when in culture in the presence of about 10 mM of glucose. The population of glucose-responsive, insulin-secreting cells can secrete between about 50 and 250 pM of C peptide per hour when in culture in the presence of about 10 mM of glucose. The glucose-responsive, insulin-secreting cells can be human cells.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.
iPS-derived pancreatic endoderm were differentiated into islet-like cells with HGF, IGF, DAPT, and GLP-1. Prominent islet-like cluster formation was observed in HCF#1-derived cells. (D) Islet-like clusters expressed high levels of human C-peptide. (E) Detection of pancreatic hormones insulin, C-peptide and glucagon in iPS-derived islet-like cells. Immunofluorescence analysis identified iPS-derived islet-like cells which expressed insulin (green stain was used), C-peptide (red stain was used), and glucagon (red stain was used).
This document provides methods and materials related to differentiating iPS cells into glucose-responsive, insulin-secreting progeny. For example, this document provides methods and material for using ILV and GLP-1 to produce glucose-responsive, insulin-secreting progeny from iPS cells.
Any appropriate method can be used to obtain iPS cells. For example, iPS cells can be obtained using polypeptides from a species that is the same species from which the cells (e.g., somatic cells) were obtained. An example of such iPS cells includes human somatic cells that were induced to form iPS cells using human polypeptides. In some cases, iPS cells can be obtained using polypeptides from a species that is different from the species from which the cells (e.g., somatic cells) were obtained. An example of such iPS cells includes human cells that were induced to form iPS cells using mouse polypeptides. Other examples include human cells that were induced to form iPS cells using rat, dog, cow, pig, or monkey (e.g., Rhesus monkey) polypeptides. In some cases, an iPS cell provided herein can be a human cell that was induced to form an iPS cell using non-human polypeptides (e.g., polypeptides of mouse, rat, pig, dog, or monkey origin).
The polypeptides used to induce the formation of iPS cells can include any combination of Oct3/4 polypeptides, Sox family polypeptides (e.g., Sox2 polypeptides), Klf family of polypeptides (e.g., Klf4 polypeptides), Myc family polypeptides (e.g., c-Myc), Nanog polypeptides, and Lin28 polypeptides. For example, nucleic acid vectors designed to express Oct3/4, Sox2, Klf4, and c-Myc polypeptides can be used to obtain iPS cells. In some cases, Oct3/4, Sox2, Klf4, and c-Myc polypeptides can be directly delivered into target cells to obtain iPS cells using a polypeptide transfection method (e.g., liposome or electroporation). In one embodiment, nucleic acid vectors designed to express Oct3/4, Sox2, and Klf4 polypeptides, and not a c-Myc polypeptide, can be used to obtain iPS cells. In some cases, Oct3/4, Sox2, and Klf4 polypeptides can be directly delivered into target cells to obtain iPS cells using a polypeptide transfection method. An Oct3/4 polypeptide can have the amino acid sequence set forth in GenBank® Accession Numbers BC117435 (e.g., GI No. 109659099). An Sox2 polypeptide can have the amino acid sequence set forth in GenBank° Accession Numbers BC013923 (e.g., GI No. 33869633). A Klf4 polypeptide can have the amino acid sequence set forth in GenBank® Accession Numbers BCO29923 (e.g., GI No. 20987475). A c-Myc polypeptide can have the amino acid sequence set forth in GenBank® Accession Numbers BC000141 (e.g., GI No. 12652778). A Nanog polypeptide can have the amino acid sequence set forth in GenBank® Accession Numbers BC099704.1 (e.g., GI No. 71043476). A Lin28 polypeptide can have the amino acid sequence set forth in GenBank® Accession Numbers BCO28566 (e.g., GI No. 33872076).
Any appropriate cell type can be used to obtain iPS cells. For example, skin, lung, heart, liver, blood, kidney, or muscle cells can be used to obtain iPS cells. Such cells can be obtained from any type of mammal including, without limitation, humans, mice, rats, dogs, cats, cows, pigs, or monkeys. In addition, any stage of the mammal can be used, including mammals at the embryo, neonate, newborn, or adult stage. For example, fibroblasts obtained from an adult human patient can be used to obtain iPS cells. Such iPS cells can be used to treat that same human patient (or to treat a different human) or can be used to create differentiated cells that can be used to treat that same human patient (or a different human). For example, somatic cells from a human patient can be treated as described herein to obtain iPS cells. The obtained iPS cells can be differentiated into glucose-responsive, insulin-producing cells as described herein that can be implanted into that same human patient.
Any appropriate method can be used to introduce nucleic acid (e.g., nucleic acid encoding polypeptides designed to induce iPS cell formation from somatic cells) into a cell. For example, nucleic acid encoding polypeptides (e.g., Oct3/4, Sox2, Klf4, and c-Myc polypeptides) designed to induce the formation of iPS cells from other cells (e.g., non-embryonic stem cells or somatic cells) can be transferred to the cells using recombinant viruses that can infect cells, or liposomes or other non-viral methods such as electroporation, microinjection, transposons, phage integrases, or calcium phosphate precipitation, that are capable of delivering nucleic acids to cells. The exogenous nucleic acid that is delivered typically is part of a vector in which a regulatory element such as a promoter is operably linked to the nucleic acid of interest. The promoter can be constitutive or inducible. Non-limiting examples of constitutive promoters include cytomegalovirus (CMV) promoter and the Rous sarcoma virus promoter. As used herein, “inducible” refers to both up-regulation and down regulation. An inducible promoter is a promoter that is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer, the DNA sequences or genes will not be transcribed. The inducer can be a chemical agent such as a protein, metabolite, growth regulator, phenolic compound, or a physiological stress imposed directly by, for example heat, or indirectly through the action of a pathogen or disease agent such as a virus.
Additional regulatory elements that may be useful in vectors, include, but are not limited to, polyadenylation sequences, translation control sequences (e.g., an internal ribosome entry segment, IRES), enhancers, or introns. Such elements may not be necessary, although they can increase expression by affecting transcription, stability of the mRNA, translational efficiency, or the like. Such elements can be included in a nucleic acid construct as desired to obtain optimal expression of the nucleic acids in the cells. Sufficient expression, however, can sometimes be obtained without such additional elements.
Vectors also can include other elements. For example, a vector can include a nucleic acid that encodes a signal peptide such that the encoded polypeptide is directed to a particular cellular location (e.g., the cell surface) or a nucleic acid that encodes a selectable marker. Non-limiting examples of selectable markers include puromycin, adenosine deaminase (ADA), aminoglycoside phosphotransferase (neo, G418, APH), dihydrofolate reductase (DHFR), hygromycin-B-phosphtransferase, thymidine kinase (TK), and xanthin-guanine phosphoribosyltransferase (XGPRT). Such markers are useful for selecting stable transformants in culture.
Any appropriate viral vectors can be used to introduce stemness-related factors such as Oct3/4, Klf4, Sox2 and c-Myc. Examples of viral vectors include, without limitation, vectors based on DNA or RNA viruses such as adenovirus, adeno-associated virus (AAV), retroviruses, lentiviruses, vaccinia virus, measles viruses, herpes viruses, baculoviruses, and papilloma virus vectors. See, Kay et al., Proc. Natl. Acad. Sci. USA, 94:12744-12746 (1997) for a review of viral and non-viral vectors. Viral vectors can be modified so the native tropism and pathogenicity of the virus has been altered or removed. The genome of a virus also can be modified to increase its infectivity and to accommodate packaging of the nucleic acid encoding the polypeptide of interest. In some cases, iPS cells can be obtained using viral vectors that do not integrate into the genome of the cells. Such viral vectors include, without limitation, adenoviral vectors, AAV vectors, baculovirus vectors, and herpesvirus vectors. For example, cells obtained from a human can be provided nucleic acid encoding human Oct3/4, Sox2, Klf4, and c-Myc polypeptides using viral vectors that do not integrate the exogenous nucleic acid into the cells. Once the polypeptides are expressed and iPS cells are obtained, the iPS cells can be maintained in culture such that the iPS cells are devoid of the exogenous nucleic acid.
Any appropriate non-viral vectors can be used to introduce stemness-related factors such as Oct3/4, Klf4, Sox2, and c-Myc. Examples of non-viral vectors include, without limitation, vectors based on plasmid DNA or RNA, retroelement, transposon, and episomal vectors. Non-viral vectors can be delivered to cells via liposomes, which are artificial membrane vesicles. The composition of the liposome is usually a combination of phospholipids, particularly high-phase-transition-temperature phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations. Transduction efficiency of liposomes can be increased by using dioleoylphosphatidylethanolamine during transduction. See, Felgner et al., J. Biol. Chem., 269:2550-2561 (1994). High efficiency liposomes are commercially available. See, for example, SuperFect® from Qiagen (Valencia, Calif.).
In some cases, iPS cells can be obtained using culture conditions that do not involve the use of serum, feeder cells, or serum and feeder cells. For example, cells obtained from a human can be provided nucleic acid encoding human Oct3/4, Sox2, Klf4, and c-Myc polypeptides and cultured using media lacking serum (e.g., human or non-human serum) and lacking feeder cells (e.g., human or non-human feeder cells).
Once obtained, iPS cells can be exposed to ILV and GLP-1. For example, human iPS cells can be cultured in the presence of retinoic acid (e.g., all-trans retinoic acid; RA), an FGF10 polypeptide, KAAD-cyclopamine (CYC), and ILV for a period of time (e.g., about 5 to 15 days, about 6 to 15 days, about 5 to 13 days, about 6 to 13 days, about 7 to 12 days, or about 8 to 11 days). After at least about 8 days, the resulting cells can be cultured in the presence of an hepatocyte growth factor (HGF) polypeptide, an insulin like growth factor (IGF) polypeptide, N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT), and GLP-1 for a period of time (e.g., about 10 to 30 days, about 12 to 30 days, about 14 to 30 days, about 10 to 25 days, about 14 to 25 days, or about 15 to 24 days) sufficient to result in a population of glucose-responsive, insulin-secreting cells. In some cases, iPS cells (e.g., human iPS cells) can be cultured in the presence of RA, FGF10, CYC, ILV, HGF, IGF, DAPT, and GLP-1 for a period of time (e.g., about 10 to 30 days, about 12 to 30 days, about 14 to 30 days, about 10 to 25 days, about 14 to 25 days, or about 15 to 24 days) sufficient to result in a population of glucose-responsive, insulin-secreting cells.
An FGF10 polypeptide can have the amino acid sequence set forth in GenBank® GI No. 255090638. An HGF polypeptide can have the amino acid sequence set forth in GenBank® GI No. 188595715. A IGF polypeptide can have the amino acid sequence set forth in GenBank® GI No. 163659904. A GLP-1 polypeptide can have the amino acid sequence set forth in GenBank® Accession Numbers NM_002054.3 (e.g., GI No. 291190799).
Any appropriate amount of these agents (or combination of agents) can be used to obtain glucose-responsive, insulin-secreting cells from iPS cells. For example, between about 1 μM and about 3 μM (e.g., about 2 μM) of RA, between about 25 ng/mL and about 75 ng/mL (e.g., about 50 ng/mL) of FGF10 polypeptide, between about 0.2 μM and about 0.3 μM (e.g., about 0.25 μM) of CYC, between about 200 nM and about 400 nM (e.g., about 300 nM) of ILV, between about 25 ng/mL and about 75 ng/mL (e.g., about 50 ng/mL) of HGF polypeptide, between about 25 ng/mL and about 75 ng/mL (e.g., about 50 ng/mL) of IGF polypeptide, between about 5 μM and about 15 μM (e.g., about 10 μM) of DAPT, between about 25 nM and about 75 nM (e.g., about 55 nM) of GLP-1 polypeptide can be used together or in various combinations with culture medium to obtain glucose-responsive, insulin-secreting cells from iPS cells.
Any appropriate method can be used to determine whether or not cells formed from iPS cells are glucose-responsive, insulin-secreting cells. For example, a C-peptide release assay can be performed to confirm the formation of glucose-responsive, insulin-secreting cells.
Once obtained, the glucose-responsive, insulin-secreting cells can be administered to a patient to treat, for example, diabetes (e.g., type 1 diabetes). For example, iPS-derived pancreatic endoderm cells or glucose-responsive islet-like cells can be transplanted into a human under a renal capsule, liver, fat pad, or subcutaneously.
The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
EXAMPLES Example 1 ILV/GLP-1-Mediated Differentiation of Human iPS Cells into Glucose-Responsive Insulin-Secreting Progeny Plasmid Construction and Lentiviral Vector ProductionStemness factor-expressing lentiviral pSIN-CSGWd1NotI-derived transfer vectors were generated as described elsewhere (Nelson et al., Circulation, 120:408-416 (2009)). In brief, the packaging plasmid pEX-QV was engineered with H87Q mutation in the HIV-1 capsid region for increased transduction efficiency of purified infectious supernatants (Nelson et al., Clin. Transl. Sci., 2:118-126 (2009)). HIV vectors were produced by transient transfection of 293T cells and titrated by immunostaining (Nelson et al., Clin. Transl. Sci., 2:118-126 (2009)). Vectors expressed pluripotency factors from a spleen focus-forming virus (SFFV) promoter (Nelson et al., Clin. Transl. Sci., 2:118-126 (2009)).
Generation and Culture of Human iPS Cells on SNL Feeder CellsHuman neonatal foreskin fibroblasts (BJ1) (ATCC#CRL-2522) and primary human cardiac fibroblasts (HCF) (ScienCell #6300) were seeded one day before infection in wells of 6 well plates with DMEM containing 10% FBS, Penicillin (100 U/mL) and Streptomycin (100 μg/mL) (Pen/Strep) (complete DMEM). Fibroblasts were infected with lentiviral vectors expressing OCT4, SOX2, KLF4, and c-MYC at a multiplicity of infection about 5 each. After 12 hours of viral infection, cells were fed with fresh complete DMEM. Vector-transduced cells were replated 4 days after infection at 5×104 cells per 100 mm dish on mitomycin-C treated SNL feeder cells in complete DMEM. Next day, the medium was replaced with the serum-free HEScGRO medium (Millipore #SCM020) supplemented with basic fibroblast growth factor (bFGF, 20 ng/mL; Peprotech). Cells were fed with fresh HEScGRO medium every two days. Putative iPS colonies, which began to appear 3-4 weeks after vector transduction, were picked based on size and human embryonic stem cell-like colony morphology, and expanded through dissociation with the cell dissociation buffer (Invitrogen #13151014). BJ1-derived iPS clones, BJ#SA and BJ#SD, were generated on SNL feeder cells. Established iPS clones were maintained in feeder-free condition.
Feeder Free iPS Generation and CultureFor feeder cell-free iPS generation and maintenance on Matrigel (BD Biosciences #354277)-coated plates, various commercially available stem cell media or their combinations were compared. Optimal results were obtained when iPS cells were maintained in a feeder cell-free medium, which contained HEScGRO with 25% of mTeSR1 medium (Stemcell Technologies #05850) and 20 ng/mL of bFGF (iPS medium). In order to generate feeder-cell free iPS clones from BJ and HCF fibroblasts, cells were transduced with pluripotency factor-expressing lentiviral vectors, 4 days after infection. The cells were re-plated at a density of 5×105 cells on a Matrigel-coated 100 mm dish. Medium was replaced with fresh iPS medium every two days. Putative iPS colonies were observed 1-2 weeks after vector transduction. iPS clones were picked based on morphology and size. iPS clones were expanded with cell dissociation buffer and passaged at a 1:2-1:8 split ratio every 3-7 days depending on cell density. BJ#1, HCF#1, and HCF#6 iPS clones were generated and maintained under feeder cell-free conditions.
RT-PCRRT-PCR analyses were performed using the primers indicated in Table 1.
For immunostaining, iPS cells were fixed for 20 minutes at room temperature (RT) in 4% paraformaldehyde (PFA) in PBS, washed in PBS, and blocked for 30 minutes with 5% FBS in PBST (PBS with 0.1% Tween-20 (Sigma). Cells were stained with primary antibodies overnight at 4° C., rinsed by PBS, and incubated with secondary antibodies 1 hour at RT (Martinez-Fernandez et al., Circ. Res., 105:648-656 (2009)). Cells at different stages of differentiation were fixed and stained with primary and secondary antibodies. Primary and secondary antibodies used for characterization of iPS and derived cells were: SSEA-1, SSEA-4, TRA-1-60, TRA-1-81 (Millipore #SCR001), OCT4 (Cell Signaling Technology #2750), SOX2 (Cell Signaling Technology #2748), KLF4 (Abcam #ab26648), NANOG (Abcam #ab21624), mouse anti-SOX17 (R&D Systems #MAB1924), rabbit anti-HNF3 beta/FOXA2 (Millipore #07-633), rabbit anti-PDX1 (Santa Cruz Biotechnology #sc-25403), rabbit anti-NGN3 (Millipore #AB5684), rabbit anti-NEUROD1 (Abcam #16508), mouse anti-insulin (Sigma #12018), rabbit anti-C-peptide (Cell Signaling Technology #4593), rabbit anti-Insulin (Cell Signaling Technology #4590), mouse anti-proinsulin C-peptide (Millipore #CBL94), mouse anti-glucagon (Abcam #ab10988), MafA (Santa Cruz Biotechnology #sc-66958), and rabbit anti-somatostatin (Dako #A0566). Texas Red-conjugated donkey-anti-rabbit IgG (Jackson Laboratories #711-075-152), Texas Red conjugated donkey-anti-mouse IgG (Jackson Laboratories #715-075-151), FITC conjugated donkey-anti-rabbit IgG (Jackson Laboratories #711-095-152), and FITC conjugated donkey-anti-mouse IgG (Jackson Laboratories #715-095-151) were used as secondary antibodies. DAPI was used for counterstaining. Stained cells were analyzed using confocal laser-scanning microscopy (Zeiss, LSM 510 confocal scanning laser system). Alkaline phosphatase staining was performed with an Alkaline Phosphatase Detection Kit (Millipore) as described elsewhere (Martinez-Fernandez et al., Circ. Res., 105:648-656 (2009)).
Spontaneous DifferentiationFor spontaneous differentiation, iPS clones were dissociated using collagenase IV and plated on low adhesion plates in basal HEScGRO medium (SCM 021) without bFGF. Embryoid bodies (EBs) were cultured as suspension for 7-14 days and were adherent in knockout DMEM with 20% FBS for an additional 7-14 days. For immunofluorescence analysis, cells were fixed and stained (Martinez-Fernandez et al., Circ. Res., 105:648-656 (2009)). Primary antibodies were: FOXA2 for endoderm, beta III tubulin (Abeam #41489) for ectoderm and CD31 (Santa Cruz Biotechnology #SC1506) for mesoderm, while Texas Red-conjugated donkey-anti-rabbit IgG (Jackson Laboratories #711-075-152) and FITC-conjugated donkey-anti-chicken IgG (Jackson Laboratories #703-095-155) were used as secondary antibodies.
Teratoma Formation and AnalysisA teratoma formation assay was performed using an approved protocol. iPS cells were injected subcutaneously into the flank skin of 2-3 months old athymic nude mice at 500,000 cells/50 μL medium. Tumor growth was observed 4-6 weeks after injection. Tumors were processed by rapid freezing, cut as cryosections, and stained with hematoxylin and eosin dyes (Nelson et al., Clin. Transl. Sci., 2:118-126 (2009)).
In Vitro Differentiation of Human iPS Cells to Insulin-Secreting Islet-like ClustersAt the first step of differentiation, human iPS clones were treated with 25 ng/mL Wnt3a (R&D systems) and 100 ng/mL activin A (Peprotech) in advanced RPMI (A-RPMI, Invitrogen) with Pen/Strep for 1 day, followed by treatment with 100 ng/mL activin A in A-RPMI supplemented with 0.2% FBS (Invitrogen) for two days. At step two, cells were cultured in A-RPMI medium containing 50 ng/mL FGF10 (R&D systems), 0.25 μM KAAD-cyclopamine (CYC), and 2% FBS for 2 days. Cells were then treated with 50 ng/mL FGF10, 0.25 μM CYC, and 2 μM all-trans Retinoic Acid (RA) (Sigma) in DMEM (Invitrogen) supplemented with Pen/Strep, 1×B27 supplement (Invitrogen) for 4 days at step three. Cells were then cultured in the presence of 50 ng/mL FGF10, 300 nM ILV (Axxora), and 55 nM GLP-1 (Sigma) in DMEM with 1×B27 for 4 days at step four. In step five, differentiation medium included 10 μM DAPT (Sigma) and 55 nM GLP-1 in DMEM with 1×B27 and culture lasted 6 days. Finally, in step six, cells were cultured in the presence of 50 ng/mL hepatocyte growth factor (HGF) (R&D systems), 50 ng/mL Insulin-like growth factor 1 (IGF-1) (R&D systems) and 55 nM GLP-1 in CMRL-1066 medium (Invitrogen) with 1×B27 for 6 days. All experiments were repeated more than three times.
C-peptide Content and Glucose Stimulated Secretion AssaysA C-peptide release assay was performed by incubating derived islet-like clusters in Krebs-Ringer solution with bicarbonate and HEPES (KRBH; 129 mM NaCl, 4.8 mM KC1, 2.5 mM CaCl2, 1.2 mM KH2PO4, 1.2 mM MgSO4, 5 mM NaHCO3, 10 mM HEPES, and 0.1% (wt/vol) BSA). Initial incubation was performed in KRBH buffer containing 2.5 mM D-glucose for 1 hour at 37° C., followed by incubation in glucose stimulation conditions containing 10 mM D-glucose and 27.7 mM D-glucose for 1 hour at 37° C. C-peptide or proinsulin levels were determined using an ultrasensitive C-peptide/proinsulin ELISA kit (Alpco Diagnostics).
Flow CytometrySingle-cell suspensions of differentiating human iPS cells were obtained by dissociating cells with TrypLE (Invitrogen #12605) at 37° C. Intracellular antibody staining was performed using BD Cytofix/Cytoperm and BD Perm/Wash buffer. The following antibodies were used: mouse-anti-SOX17 (R&D Systems #MAB1924), guinea pig-anti-insulin (Dako Cytomation #A0564), goat-anti-mouse Alexa Fluor 488 (Invitrogen #A11029), and donkey-anti-guinea pig-Cy5 (Jackson ImmunoResearch Laboratories #706-176-148). Flow cytometry data were acquired on a Becton Dickinson FACS Calibur and analyzed using Flowjo software.
ResultsReprogramming of Human Fibroblasts with Stemness Factors
HCF and BJ fibroblasts were infected with lentiviral vectors encoding OCT4, SOX2, KLF4, and c-MYC, and transduced cells re-seeded on mitomycin C-inactivated SNL feeder cells or replated on matrigel-coated plates to ensure feeder cell-free culture. On SNL feeder cells, reprogrammed colonies, characterized by distinct morphology of sharp-edged, flat, tightly-packed structures were visible 2 weeks after viral vector transduction (
Over 3-9 months or 30-90 passages, putative iPS clones cultured under feeder cell-free and serum-free conditions exhibited a distinctive morphology similar to that of human ES cells over long-term culture (
Pluripotency Validated through Three Germ Layer Differentiation
Human iPS clones were assayed, through embryoid body (EB) formation, for the ability to spontaneously differentiate in vitro into cells of the three embryonic germ layers. All iPS clones assayed formed EBs (
Differentiation of Human iPS cells into Pancreatic Endoderm
Normal differentiation of a pluripotent precursor into lineage-specified pancreatic endodermal tissue encompasses multiple steps. Here, verified iPS cells were treated first with activin A and Wnt3a for generation of definitive endoderm cells, and then with FGF10 and CYC for derivation of gut tube endoderm (
Induction of Stage-Specific Pancreatic Genes through Guided Differentiation
To determine the expression of endocrine-specific transcription factors and pancreas-specific genes throughout differentiation, the gene expression pattern was analyzed at each stage of differentiation. RT-PCR detected high levels of FOXA2 expression after 3 days of differentiation, confirming induction of definitive endoderm cells (
Differentiation of iPS Cells into Insulin-Secreting Islet-like Progeny
During treatment with RA, FGF10, CYC, and ILV, iPS-derived pancreatic endoderm cells started to form spheroid-like cell clusters, which reached maximum size and number following further maturation with HGF, IGF, DAPT, and GLP-1 (
Functional Response of iPS-derived Islet-like Clusters
C-peptide secretion from iPS-derived islet-like clusters in response to glucose challenge, the critical physiological function of pancreatic beta cells, was analyzed. To determine whether islet-like cells are capable of C-peptide secretion in response to glucose induction, cells were exposed to increasing concentrations of glucose and secreted C-peptide was measured by ELISA. At extracellular glucose levels of 2.5 mM, that mimics a fasting condition, there was only marginal detection of the C-peptide signal (
Clinical grade peripheral blood hematopoietic progenitor cells (HPC) products from patients, who were deceased, were used. HPCs were harvested from patients following mobilization by injection with granulocyte-CSF for 5 days. Blood (10-20 L) was processed for HPC collection. PBMCs from healthy donors were obtained as described elsewhere (Noser et al., J. Virol., 80:7769-7774 (2006)).
Lentiviral Vector ProductionPluripotency-associated factor-expressing lentiviral vectors, pSIN-OCT4, pSIN-SOX2, pSIN-KLF4, and pSIN-cMYC, were described elsewhere (Nelson et al., Clin. Transl. Sci., 2:118-126 (2009)). These vectors were produced by transient transfection of 293T cells. Vector titers were determined by immunostaining (Nelson et al., Clin. Transl. Sci., 2:118-126 (2009)).
iPSC Derivation
HPCs and PBMCs were cultured overnight in StemSpan H3000 serum-free medium (StemCell Technologies), which contained only human-derived or recombinant human proteins, supplemented with StemSpan CC100 cytokine cocktail (StemCell Technologies). Cultures were then transduced with four stemness factor-expressing lentiviral vectors overnight. One third of the culture supernatants were carefully removed and replaced daily with H3000 growth medium supplemented with CC100 cytokine cocktail. At 3 days after vector infection, cells were transferred to Matrigel (BD Bioscience)-coated culture plates. Starting 5 days after vector infection, cells were maintained in HEScGRO medium (100 mL, Millipore) supplemented with mTeSR-1 maintenance media (25 mL, Stemcell Technologies) (Thatava et al., Gene Ther., 18:283-293 (2011)). Seven to ten days after vector infection, the reprogrammed cells began to form colonies with iPS morphology. At two to three weeks after vector infection, cultures were treated with Cell Dissociation Buffer (Invitrogen) for 5 to 10 minutes to help lift clones, and individual iPSC-like clones were carefully picked up by a P200 pipette and placed into Matrigel-coated wells in a 96-well plate. To prevent spontaneous differentiation, the iPSC culture medium was replaced daily, and differentiated cells in the cultures were manually removed with a pipette tip. As the clones grew, cultures were expanded into larger culture plates for further characterization. Clones were preserved using Xeno-FREEze™ Human Embryonic Stem Cell Freezing Medium (Millipore). A verified iPSC clone, HCF1, from primary human fibroblast (HCF) cells, was described elsewhere (Thatava et al., Gene Ther., 18:283-293 (2011)). Primary human keratinocytes and keratinocyte-derived iPSC clones were also used as controls.
Immunostaining and Alkaline Phosphatase StainingFor immunostaining of iPSC, cells were fixed for 20 minutes at room temperature in 4% paraformaldehyde solution in PBS, washed several times in PBS, and blocked for 30 minutes in PBS with 5% fetal bovine serum. Cells were then stained with primary antibodies overnight at 4° C., rinsed by PBS, and incubated with secondary antibodies for 1 hour at room temperature. For immunostaining of differentiated cells, cells at different stages of differentiation were fixed and stained with primary and secondary antibodies. Primary antibodies used for characterization of iPSC and iPSC-derived cells were: SSEA-4 and TRA-1-60 (Millipore #SCR001), OCT4 (Cell Signaling Technology #2750), NANOG (Abcam #ab21624), mouse anti-SOX17 (R&D Systems #MAB1924), rabbit anti-HNF3 beta/FOXA2 (Millipore #07-633), rabbit anti-PDX1 (Santa Cruz Biotechnology#sc-25403), and mouse anti-insulin (Sigma #12018). Texas Red-conjugated donkey-anti-rabbit IgG (Jackson Laboratories #711-075-152), Texas Red-conjugated donkey-anti-mouse IgG (Jackson Laboratories #715-075-151), FITC-conjugated donkey-anti-rabbit IgG (Jackson Laboratories #711-095-152), and FITC-conjugated donkey-anti-mouse IgG (Jackson Laboratories #715-095-151) were used as secondary antibodies. DAPI was used for counter staining. Stained cells were analyzed using confocal laser-scanning microscope (Zeiss, LSM 510 confocal scanning laser system).
Spontaneous DifferentiationFor spontaneous differentiation, iPSC clones were dissociated using collagenase IV for 30 minutes and plated on low adhesion plates in basal HEScGRO medium without bFGF. Embryoid bodies (EBs) were cultured as suspension for 7-10 days and adherent in DMEM with 20% FBS for additional 7-10 days. For immunofluorescence analysis, cells were fixed with 4% PFA for 20 minutes at room temperature. Immunostaining was performed as described above. Primary antibodies against FOXA2 for endoderm, beta-III tubulin (Abcam #41489) for ectoderm, and CD31 (Santa Cruz Biotechnology #SC1506) for mesoderm were used, while Texas Red-conjugated donkey anti-rabbit IgG (Jackson Laboratories #711-075-152), and FITC-conjugated donkey anti-chicken IgG (Jackson Laboratories #703-095-155) served as secondary antibodies.
In Vivo Differentiation of Derived iPS CellsSCID-beige mice were anesthetized, and the kidney was externalized for iPS transplantation under the kidney capsule. A small incision was made in the kidney capsule, and a blunt needle was used to create a pocket under the kidney capsule. Following iPSC injection into the pocket, the kidney was placed back into the abdomen, and the incision closed with vicryl suture. Mice were maintained for 4 weeks and sacrificed for harvesting normal and iPS-transplanted kidneys. OTC-embedded frozen tissues were cryo-sectioned for H&E staining.
Differentiation of Derived iPS Cells into Insulin-Producing Cells
iPSC were differentiated into insulin-producing cells as reported elsewhere with several modifications (Thatava et al., Gene Ther., 18:283-293 (2011)). At the first step of differentiation, human iPSC clones were treated with 25 ng/mL Wnt3a (R&D systems) and 100 ng/mL activin A (Peprotech) in advanced RPMI (Invitrogen) with Pen/Strep for 1 day, followed by treatment with 100 ng/mL activin A in advanced RPMI supplemented with 0.2% fetal calf serum (FCS) (Invitrogen) for two days. At step two, cells were cultured in high glucose DMEM
(Invitrogen), supplemented with 20% (v/v) advanced RPMI medium containing 50 ng/mL FGF10 (R&D systems), 0.25 μM KAAD-cyclopamine (CYC), and 2% FCS for 2 days. Cells were then treated with 50 ng/mL FGF10, 0.25 μM CYC, and 2 μM all-trans Retinoic Acid (RA) (Sigma) in high glucose DMEM (Invitrogen) supplemented with 20% advanced RPMI, Pen/Strep, 1×B27 supplement (Invitrogen) for 4 days at step three. Cells were then cultured in the presence of 50 ng/mL FGF10, 300 nM ILV (Axxora), and 55 nM GLP-1 (Sigma) in DMEM (high glucose) supplemented with 20% advanced RPMI and 1×B27 for 4 days at step four. In step five, differentiation medium included 10 μM DAPT (Sigma) and 55 nM GLP-1 in DMEM (high glucose) with 20% advanced RPMI and 1×B27 and culture lasted 6 days. Finally, in step six, cells were cultured in the presence of 50 ng/mL hepatocyte growth factor (HGF) (R&D systems), 50 ng/ml insulin-like growth factor 1 (IGF-1) (R&D systems), and 55 nM GLP-1 in CMRL-1066 medium (Invitrogen) with 1×B27 for 8 days. All differentiation experiments were performed in triplicate, and repeated at least two times.
MicroarrayTotal RNA was isolated using TRIzol (Invitrogen) and further purified using RNeasy Plus spin columns (QIAGEN). Turbo DNA-free DNase (Ambion, Austin, Tex.) was used to digest all genomic DNA that could lead to false positive gene expression results. The RNA quantity and purity was measured with a Nanodrop spectrophotometer (Thermo Scientific, Wilmington, Del.), and the RNA integrity was determined using the Agilent 2100 Bioanalyzer (Santa Clara, Calif.). Microarray analysis was performed using the Affymetrix HG-U133 Plus2 GeneChip Array platform (Affymetrix, Santa Clara, Calif.). Data were preprocessed using standard in-house MicroArray Pre-Processing workflow, and hierarchical clustering was performed by Pearson Dissimilarity. To compare the transcriptome of blood-derived iPSCs, the data set of epidermal keratinocytes (HK, SW3, SW4 and SW8), two keratinocyte-derived iPSC clones (SW3 #b and SW4 #N1), and human fibroblast (FB)-derived iPSC clone HCF1 (Thatava et al., Gene Ther., 18:283-293 (2011)) were used. T-test was performed to analyze the significance of the changes (p<0.05) in the normalized gene expression levels between HK and iPSC clones, or between blood-derived iPSC clones and HK- and FB-derived iPSC clones. Heatmap Builder software (provided by Dr. Euan Ashley, Stanford School of Medicine) was used to generate a heatmap for the transcriptome data set. The registered GEO transcriptome database (GSM551202, human ES H9 cells; GSM452255, freshly isolated PBMC; GSM178554, mobilized HPCs) were used to analyze the similarities between blood-derived iPSC and human ES cells or non-reprogrammed PBMCs and HPCs.
ResultsCellular Reprogramming of HPCs and PBMCs into iPSCs
HPCs and PBMCs were cultured overnight in a serum-free medium with CC100 cytokine cocktail (recombinant Flt-3, SCF, IL-3 and IL-6), and transduced with four stemness factor-expressing lentiviral vectors at an MOI of 5 each. When transduced cells were transferred to Matrigel-coated culture plates at day 3 post-infection, a subset of cells attached to the plate. At 1 to 2 weeks after vector transduction, small, reprogrammed colonies, characterized by the morphology of sharp-edged, flat and tightly-packed cells, were observed (
High-resolution electron microscope analysis was performed to determine the morphological differences between blood-derived iPSCs and verified fibroblast-derived iPSCs (HCF1) (Thatava et al., Gene Ther., 18:283-293 (2011)). Blood-derived iPSCs exhibited scant cytoplasm and globular-shaped immature mitochondria with unorganized cristae, which resembled those of fibroblast-derived iPS cells (
Using a microarray representing the genome-wide transcriptome, the global gene-expression patterns in HPC- and PBMC-derived iPSC clones were determined, which were then compared with those of fibroblast (FB)- and epidermal keratinocytes (HK)-derived iPSCs. Transcriptome data from non-reprogrammed HK cells were also used as somatic cell controls. The dendrogram of unsupervised one-way hierarchical clustering analysis demonstrated that blood-derived iPSCs clustered closely with other iPSCs from different cell sources and were distinct from non-reprogrammed HK cells (
HPC- and PBMC-derived iPSC clones were assayed for the ability to spontaneously differentiate in vitro into cells of three embryonic germ layers through embryoid body (EB) formation. All the iPSC clones assayed formed EBs. After 7 to 10 days in suspension, EBs were transferred to a Matrigel-coated plate, and spontaneously differentiated cells were expanded under adherent conditions. Immunostaining for lineage-specific markers revealed that blood-derived iPSCs differentiated into cells of three germ layers including beta-III tubulin-positive ectoderm, FOXA2-positive endoderm, and CD31-positive mesoderm cells (
In Vivo Multilineage Differentiation of Blood-Derived iPSCs
To assess the multilineage differentiation capacity of iPSCs in vivo, blood-derived iPSCs were transplanted under the kidney capsule of SCID-beige mice. Following transplantation of 1 million cells, iPSCs formed cystic tumors within 4 weeks (
Generation of Insulin Producing Cells from iPSCs through Guided Differentiation
The pancreatic differentiation potentials of blood-derived iPSCs was examined. A guided iPSC differentiation protocol with indolactam V (ILV) and GLP-1 was used as set forth above. Blood-derived iPSC clones were first stimulated with actin A and Wnt3a to form definitive endoderm cells. Immunostaining revealed the efficient induction of definitive endoderm markers SOX17 and FOXA2 in iPSC-derived cells at day 5 of differentiation (
The results provided herein demonstrate the feasibility of iPSC derivation from GMP-grade mobilized HPCs and unmobilized PBMCs. The use of HPCs and PBMCs enabled time-effective iPSC derivation, as the cells did not require long-term expansion before reprogramming. Moreover, apart from minor differences in global gene expression profiles (
The results provided herein also demonstrate the feasibility of generating insulin-producing cells from blood-derived iPSCs. In contrast to skin biopsies, which involve an invasive procedure, the use of blood cells allows minimally invasive tissue procurement for iPSC derivation. Since diabetic patients often experience poor wound healing, the minimally invasive iPSC derivation from blood cell sources would be particularly advantageous for the generation of clinical-grade iPSCs from diabetic patients.
Example 3 Reprogrammed Keratinocytes from Elderly Type 2 Diabetes Patients Suppress Senescence Genes to Acquire Induced Pluripotency Human KeratinocytesSkin specimens from surgical pathology from nondiabetic and type 2 diabetic (T2D) individuals were enzymatically processed. Using sterile techniques, skin samples were incubated overnight at 4° C. in dispase (25 U/mL) to cleave epidermis from dermis. The epidermal layer was then placed into a recombinant trypsin/EDTA solution (Invitrogen, Carlsbad, Calif.) and incubated for 30 min at 37° C. Trypsin/EDTA was neutralized with a trypsin inhibitor (Invitrogen, Carlsbad, Calif.), and epidermal pieces were pipetted to release epidermal cells. The suspension was then passed through a 70 μm cell strainer and pelleted. Cell viability was determined by the trypan blue exclusion method. Cells were seeded in a plate coated with an animal component-free (ACF) coating matrix (Invitrogen). Selective trypsinization removed fibroblasts at about 6 minutes, while human keratinocytes (HK) were dissociated at about 20 minutes. HK cell populations were then grown in EpiLife Medium and S7 growth supplement (Invitrogen, Carlsbad, Calif.) in 5% CO2 and 95% air at 37° C. HK cells were maintained semi-confluent in low calcium media.
ReprogrammingLentiviral vectors, pSIN-OCT4, pSIN-SOX2, pSIN-KLF4, and pSIN-cMYC, were manufactured as described elsewhere to express pluripotency factors from an internal spleen focus-forming virus (SFFV) promoter (Nelson et al., Clin. Transl. Sci., 2:118-126 (2009)). HIV vectors were produced by transient transfection of 293T cells. To minimize calcium-mediated differentiation of HK cells during vector infection, lentiviral vectors were concentrated by ultracentrifugation and re-suspended in PBS (Sakuma et al., Hum. Gene Ther., 21:1665-1673 (2010)). Lentiviral titers were determined by immunostaining (Nelson et al., Clin. Transl. Sci., 2:118-126 (2009)). Human HK cells were grown in vitro in ACF EpiLife Medium in a matrix-coated plate. Cultures were transduced overnight with human OCT4, SOX2, KLF4, and cMYC expressing lentiviral vectors (Nelson et al., Clin. Transl. Sci., 2:118-126 (2009)). Culture supernatants were replaced daily with ACF media. At 4 days after vector infection, media was changed to HEScGRO medium (100 mL, Millipore, Billerica, Mass.) supplemented with mTeSR-1 maintenance media (25 mL, Stemcell Technologies, Vancouver, BC, Canada) (Thatava et al., Gene Ther., 18:283-293 (2011)). One to two weeks after vector infection, reprogrammed cells began to form colonies displaying stem cell morphology (Thatava et al., Gene Ther., 18:283-293 (2011)). At three to four weeks after vector infection, cultures were treated with Cell Dissociation Buffer (Invitrogen, Carlsbad, Calif.) for 5 to 10 minutes to help lift clones picked by a P200 pipette, and placed in BD Matrigel (BD Biosciences, San Jose, Calif.) coated 96-well plates. To prevent spontaneous differentiation, the iPS culture medium was replaced daily and differentiated cells in cultures manually removed. As clones grew, cultures were expanded into larger culture plates for further characterization. iPS clones were preserved using Xeno-FREEze™ Human Embryonic Stem Cell Freezing Medium (Millipore, Billerica, Mass.). For spontaneous differentiation, iPS clones were dissociated using collagenase IV (Stemcell Technologies) for 30 minutes and plated on low adhesion plates in basal HEScGRO medium without bFGF. Embryoid bodies (EBs) were cultured as suspensions for 7-14 days, and grown adherent in DMEM with 20% FBS for additional 7-14 days.
Differentiation of iPS Cells into Insulin Producing Cells
iPS clones were treated with 25 ng/mL Wnt3a (R&D systems) and 100 ng/mL activin A (Peprotech) in advanced RPMI (Invitrogen) with Pen/Strep for 1 day, followed by treatment with 100 ng/mL activin A in advanced RPMI supplemented with 0.2% fetal calf serum (FCS) (Invitrogen) for two days. Next, cells were cultured in high glucose DMEM (Invitrogen), supplemented with 20% (v/v) advanced RPMI medium containing 50 ng/mL FGF10 (R&D systems), 0.25 μM KAAD-cyclopamine (CYC), and 2% FCS for 2 days. Cells were then treated with 50 ng/mL FGF10, 0.25 μM CYC, and 2 μM all-trans Retinoic Acid (RA) (Sigma) in high glucose DMEM (Invitrogen) supplemented with 20% advanced RPMI, Pen/Strep, 1×B27 supplement (Invitrogen) for 4 days. Cells were then cultured in 50 ng/mL FGF10, 300 nM ILV (Axxora), and 55 nM GLP-1 (Sigma) in DMEM (high glucose) supplemented with 20% advanced RPMI and 1×B27 for 4 days. Differentiation medium including 10 μM DAPT (Sigma) and 55 nM GLP-1 in DMEM (high glucose) with 20% advanced-RPMI and 1×B27 was used to culture cells for the next 6 days. Finally, cells were cultured in 50 ng/mL hepatocyte growth factor (HGF) (R&D systems), 50 ng/mL insulin-like growth factor 1 (IGF-1) (R&D systems), and 55 nM GLP-1 in CMRL-1066 medium (Invitrogen) with 1×B27 for 8 days.
ImmunostainingFor immunostaining, iPS cells were fixed for 20 minutes at room temperature in 4% paraformaldehyde (PFA), washed in PBS, and blocked for 30 minutes in PBST (PBS with 0.1% Tween-20 (Sigma) and 5% FBS). Cells were stained with primary antibodies overnight at 4° C., rinsed by PBS, and incubated with secondary antibodies for 1 hour at room temperature. Separately, cells at different stages of differentiation were fixed and stained with primary and secondary antibodies. Primary and secondary antibodies used for characterization were: SSEA-1, SSEA-4, TRA-1-60, TRA-1-81 (Millipore #SCR001), OCT4 (Cell Signaling Technology #2750), SOX2 (Cell Signaling Technology #2748), KLF4 (Abcam #ab26648), NANOG (Abcam #ab21624), anti-SOX17 (R&D Systems #MAB1924), anti-HNF3 beta/FOXA2 (Millipore #07-633), anti-PDX1 (Santa Cruz Biotechnology#sc-25403), and anti-insulin (Sigma #12018). Texas Red-conjugated anti-rabbit IgG (Jackson Laboratories #711-075-152), Texas Red-conjugated anti-mouse IgG (Jackson Laboratories #715-075-151), FITC-conjugated anti-rabbit IgG (Jackson Laboratories #711-095-152), and FITC-conjugated anti-mouse IgG (Jackson Laboratories #715-095-151) were used as secondary antibodies. DAPI was used to counter-stain nuclei. Stained cells were analyzed using confocal laser-scanning microscopy (Zeiss, LSM 510 confocal scanning laser system). Alkaline phosphatase staining was performed with an Alkaline Phosphatase Detection Kit (Millipore). Antibodies FOXA2 for endoderm, beta III tubulin (Abcam #41489) for ectoderm and CD31 (Santa Cruz Biotechnology #SC1506) for mesoderm were used to immunostain embryoid body-derived cells.
In Vivo Differentiation of iPS CellsSCID-beige mice were anesthetized, and the kidney exposed for iPS transplantation under the kidney capsule. To this end, a small incision was made in the kidney capsule, and a blunt needle was used to create a pocket under the kidney capsule. Following iPS cell injection, the kidney was placed back into the abdomen, and the incision closed. Mice were maintained for 4 weeks and sacrificed for harvesting normal and iPS-transplanted kidneys. OTC-embedded frozen tissues were cryo-sectioned for H&E staining.
Gene ExpressionFor amplification of mitochondrial DNA, mitochondria-specific primer pairs (CYTB, CCTAGCCATGCACTACTCACCAGACGCCT (SEQ ID NO:39), CTGTCTACTGAGT-AGCCTCCTCAGATTC (SEQ ID NO:40); and NADH, TCACCAAAGAGCCCCTAA-AACCCGCCACATCTA (SEQ ID NO:41), TAAGGGTGGAGAGGTTAAAGGAGC (SEQ ID NO:42)) were used. For RT-PCR analysis, total RNA was isolated using TRIzol (Invitrogen), and reverse transcription was performed with oligo (dT) primer using RNA to cDNA EcoDry (Clontech). Platinum Taq DNA polymerase (Invitrogen) and primer pairs for TERT (TGTGCACCAACATCTACAAG (SEQ ID NO:43), GCGTTCTTGGCTTTCAGGAT (SEQ ID NO:44)), INS (AGCCTTTGTGAACCAACACC (SEQ ID NO:45), GCTGGTAG-AGGGAGCAGATG (SEQ ID NO:46)), SST (GTACTTCTTGGCAGAGCTGCTG (SEQ ID NO:47), CAGAAGAAATTCTTGCAGCCAG (SEQ ID NO:48)), GCG (AGGCAGACC-CACTCAGTGA (SEQ ID NO:49), AACAATGGCGACCTCTTCTG (SEQ ID NO:50)), GLUT2 (GCTACCGACAGCCTATTCTA (SEQ ID NO:51), CAAGTCCCACTGACATGAAG (SEQ ID NO:52)), and a-tubulin (AAGAAGTCCAAGCTGGAGTTC (SEQ ID NO:53), GTTG-GTCTGGAATTCTGTCAG (SEQ ID NO:54)) were used for the reaction. Separately, total RNA was isolated using TRIzol (Invitrogen) and further purified using RNeasy Plus spin columns (QIAGEN). Turbo DNA-free DNase (Ambion, Austin, Tex.) was used to digest all genomic DNA that could lead to false positive gene expression results. RNA quantity and purity were measured with a Nanodrop spectrophotometer (Thermo Scientific, Wilmington, Del.), and RNA integrity was determined using the Agilent 2100 Bioanalyzer (Santa Clara, Calif.).
Microarray analysis was performed using the Affymetrix HG-U133 Plus2 GeneChip Array platform (Affymetrix, Santa Clara, Calif.). Data were preprocessed using MicroArray Pre-Processing workflow, and hierarchical clustering was performed by Pearson Dissimilarity. For comparison of transcriptome data between pre- and post-reprogramming, the data set of parental HK cells from three patients (SW3, SW4 and SW8) were compared with those of three iPS clones from the same patients (SW3 #B, SW4 #N1, and SW8 #20I). Student's t-test was performed to assess significance (p<0.05) in normalized gene expression levels between HK and HK-derived iPS clones. The Heatmap Builder software (provided by Dr. Euan Ashley, Stanford University) was used to generate the heatmap for the transcriptome data set. Enrichment analysis was also performed to match gene IDs in functional ontologies. The registered GEO transcriptome information (GSM551202, human ES H9 cell transcriptome) was used as reference.
Telomere AssayTotal genomic DNA was isolated from patient-derived HK and iPS cells using QIAGEN
DNeasy Blood & Tissue Kit. Telomere length was determined using TeloTAGGG telomere length assay (Roche). Genomic DNA digestion, Southern blotting, and chemiluminescence detection was performed as per established protocols. Densitometric analysis was performed on Adobe Photoshop, and terminal restriction fragment lengths were determined by Σ(ODi)/Σ(ODi/L), where ODi and L were the optical density and length of fragment, respectively.
Results Reprogramming of Human KeratinocytesLentiviral vectors encoding human OCT4, SOX2, KLF4, and c-MYC, at an approximate multiplicity of infection of 5 each, transduced early passage human keratinocytes (HK cells) derived from 56 to 78 year-old individuals with or without T2D. Under serum-free and feeder-free conditions, within 1 to 2 weeks after viral vector infection, small reprogrammed colonies, characterized by a sharp-edged, flat, tightly-packed morphology, were apparent (
HK-derived iPS clones from diabetic and non-diabetic patients spontaneously differentiated in vitro into cells of all three germ layers within embryoid body (EB) formations (
Unbiased scan of the genome-wide transcriptome revealed distinct global gene-expression patterns in parental HK versus HK-derived iPS clones (
Electron microscopy demonstrated marked difference in the size of derived iPS compared to parental HK (
The copy number of mitochondrial DNA before and after reprogramming revealed a 30 to 60% reduction in the abundance of mitochondrial DNA in iPS compared to HK cells (
RT-PCR verified increased levels of TERT-specific transcripts in HK-derived iPS cells (
HK-derived iPS clones were initially induced to form definitive endoderm by treatment with activin A and Wnt3a for 1 day followed by culture in activin A and 2% FBS for 4 additional days. Immunostaining revealed efficient induction in iPS-derived cells of SOX17 and FOXA2, markers of definitive endoderm (
These results demonstrate the feasibility and reproducibility of iPS cell derivation from elderly patients with T2D. Reprogramming of HK cells was accompanied by morphological changes, induction of endogenous pluripotency genes, telomere elongation, and down-regulation of senescence- and apoptosis-related genes. Notably, stepwise differentiation with ILV and GLP-1 achieved successfully differentiation of T2D-specific iPS cells into insulin-producing islet-like cells. Thus, reprogramming of keratinocytes from elderly T2D patients yields proficient iPS cells through induction of a senescence privileged status. T2D-specific iPS cells can provide a versatile platform for disease modeling and regenerative applications.
Other EmbodimentsIt is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
1. (canceled)
2. A method for obtaining a population of glucose-responsive, insulin-secreting cells from a human, wherein said method comprises:
- (a) obtaining somatic cells from a human,
- (b) exposing said somatic cells to one or more polypeptides or nucleic acids encoding said one or more polypeptides to form induced pluripotent stem cells, wherein said one or more polypeptides are selected from the group consisting of a Oct3/4 polypeptide, a Sox family polypeptide, a Klf family polypeptide, a Myc family polypeptide, a Nanog polypeptide, and a Lin28 polypeptide, and
- (c) culturing said induced pluripotent stem cells with medium comprising indolactam V and glucagon like peptide-1 to obtain said population of glucose-responsive, insulin-secreting cells.
3. The method of claim 2, wherein said medium lacks serum.
4. The method of claim 2, wherein said culturing is performed in the absence of feeder cells.
5. The method of claim 2, wherein said culturing is performed in the absence of non-human feeder cells.
6. The method of claim 2, wherein said somatic cells are selected from the group consisting of skin, lung, heart, stomach, brain, liver, blood, kidney, and muscle cells.
7. The method of claim 2, wherein said induced pluripotent stem cells comprise exogenous nucleic acid encoding a human Oct4 polypeptide, a human Sox2 polypeptide, a human Klf4 polypeptide, and a human c-Myc polypeptide.
8. The method of claim 2, wherein said medium comprises between about 200 nM and about 400 nM of indolactam V.
9. The method of claim 2, wherein said medium comprises between about 25 nM and about 75 nM of glucagon like peptide-1.
10. The method of claim 2, wherein said culturing is performed for about 10 to 25 days.
Type: Application
Filed: Feb 22, 2018
Publication Date: Jul 5, 2018
Applicant: Mayo Foundation for Medical Education and Research (Rochester, MN)
Inventors: Tayaramma Thatava (Blue Ash, OH), Andre Terzic (Rochester, MN), Yogish C. Kudva (Rochester, MN), Yasuhiro Ikeda (Rochester, MN)
Application Number: 15/902,805