ARID1A AND PPP2R1A MUTATIONS IN CANCER

Abstract

Two genes, ARID1A (AT-rich interactive domain-containing protein 1A) and PPP2R1A (protein-phosphatase 2, regulatory subunit 1, alpha), can be used in methods which are useful for detecting cancer, diagnosing cancer, contributing to a diagnosis of cancer, confirming a diagnosis of cancer, identifying appropriate treatments for cancer, monitoring treatment of cancer, and evaluating treatment protocols for cancer, including ovarian clear cell carcinoma, breast cancer, colon cancer, gastric cancer, lung cancer, medulloblastoma, pancreatic cancer, and prostate cancer.

Description

This application claims the benefit of Ser. No. 61/379,875 filed on Sep. 3, 2010, which is incorporated herein by reference in its entirety.

This invention was made with government support under OC0400600 awarded by the U.S. Department of Defense and CA121113, CA57345, CA62924, CA129080, CA134292, CA103937, and CA103938 awarded by the National Institutes of Health. The government has certain rights in the invention.

This application incorporates by reference the contents of a 200 kb text file created on Sep. 3, 2010 and named “sequencelisting.txt,” which is the sequence listing for this application.

Each reference cited in this disclosure is incorporated herein by reference in its entirety.

BRIEF DESCRIPTION OF THE FIGURES

FIGS. 1A-D. Sequence chromatograms of examples of somatic ARID1A and PPP2R1A mutations. FIG. 1A, ARID1A mutation; FIG. 1B, ARID1A mutation; FIG. 1C, PPP2R1A mutation; FIG. 1D, PPP2R1A mutation. Arrows indicate the position of the mutation.

FIGS. 2A-D. Sequence chromatograms of examples of truncating mutations in ARID1A. FIG. 2A, gastric cancer; FIG. 2B, colon cancer; FIG. 2C, breast cancer; FIG. 2D, pancreatic cancer. Arrows indicate the position of the mutation.

DETAILED DESCRIPTION

This disclosure identifies mutations in two genes: ARID1A (AT-rich interactive domain-containing protein 1A) and PPP2R1A (protein-phosphatase 2, regulatory subunit 1, alpha). This disclosure also provides methods which are useful for detecting cancer, diagnosing cancer, contributing to a diagnosis of cancer, or confirming a diagnosis of cancer, particularly ovarian clear cell carcinoma (OCCC), breast cancer, colon cancer, gastric cancer, lung cancer, medulloblastoma, pancreatic cancer, and prostate cancer. In some embodiments, nucleic acid is obtained from cells of an individual and tested to determine whether either or both of ARID1A and PPP2R1A. ARID1A mutations can be, for example, an insertion, a duplication, a missense mutation, or a deletion. PPP2R1A mutations typically are missense mutations. Examples of these mutations arc provided below. Mutations in ARID1A and PPP2R1A typically are somatic mutations, but this disclosure also encompasses corresponding germline mutations.

Cancer cells which can be detected include, but are not limited to, cells from acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related lymphoma, anal cancer, appendix cancer, grade I (anaplastic) astrocytoma, grade II astrocytoma, grade III astrocytoma, grade IV astrocytoma, atypical teratoid/rhabdoid tumor of the central nervous system, basal cell carcinoma, bladder cancer, breast cancer, breast sarcoma, bronchial cancer, bronchoalveolar carcinoma, Burkitt lymphoma, cervical cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, endometrial cancer, endometrial uterine cancer, ependymoblastoma, ependymoma, esophageal cancer, esthesioneuroblastoma, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, fibrous histiocytoma, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, gestational trophoblastic tumor, gestational trophoblastic tumor, glioma, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular cancer, Hilar cholangiocarcinoma, Hodgkin's lymphoma, hypopharyngeal cancer, intraocular melanoma, islet cell tumor, Kaposi sarcoma, Langerhans cell histiocytosis, large-cell undifferentiated lung carcinoma, laryngeal cancer, lip cancer, lung adenocarcinoma, lymphoma, macroglobulinemia, malignant fibrous histiocytoma, medulloblastoma, medulloepithelioma, melanoma, Merkel cell carcinoma, mesothelioma, endocrine neoplasia, multiple myeloma, mycosis fungoides, myelodysplasia, myelodysplastic/myeloproliferative neoplasms, myeloproliferative disorders, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin's lymphoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian clear cell carcinoma, ovarian epithelial cancer, ovarian germ cell tumor, pancreatic cancer, papillomatosis, paranasal sinus cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pineal parenchymal tumor, pincoblastoma, pituitary tumor, plasma cell neoplasm, plasma cell neoplasm, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell cancer, respiratory tract cancer with chromosome 15 changes, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Sézary syndrome, small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous non-small cell lung cancer, squamous neck cancer, supratentorial primitive neuroectodermal tumor, supratentorial primitive neuroectodermal tumor, testicular cancer, throat cancer, thymic carcinoma, thymoma, thyroid cancer, cancer of the renal pelvis, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenström macroglobulinemia, and Wilms tumor.

In some embodiments, mutations detected are in ARID1A and cancer cells which can be detected include, but are not limited to, cells from adrenocortical carcinoma, AIDS-related lymphoma, anal cancer, appendix cancer, grade I (anaplastic) astrocytoma, grade II astrocytoma, grade III astrocytoma, grade IV astrocytoma, atypical teratoid/rhabdoid tumor of the central nervous system, basal cell carcinoma, bladder cancer, breast cancer, breast sarcoma, bronchial cancer, bronchoalveolar carcinoma, Burkitt lymphoma, cervical cancer, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, endometrial cancer, endometrial uterine cancer, ependymoblastoma, ependymoma, esophageal cancer, esthesioneuroblastoma, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, fibrous histiocytoma, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, gestational trophoblastic tumor, gestational trophoblastic tumor, glioma, head and neck cancer, heart cancer, hepatocellular cancer, Hilar cholangiocarcinoma, Hodgkin's lymphoma, hypopharyngeal cancer, intraocular melanoma, islet cell tumor, Kaposi sarcoma, Langerhans cell histiocytosis, large-cell undifferentiated lung carcinoma, laryngeal cancer, lip cancer, lung adenocarcinoma, lymphoma, macroglobulinemia, malignant fibrous histiocytoma, medulloblastoma, medulloepithelioma, melanoma, Merkel cell carcinoma, mesothelioma, endocrine neoplasia, multiple myeloma, mycosis fungoides, myelodysplasia, myelodysplastic/myeloproliferative neoplasms, myeloproliferative disorders, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin's lymphoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian clear cell carcinoma, ovarian epithelial cancer, ovarian germ cell tumor, pancreatic cancer, papillomatosis, paranasal sinus cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pineal parenchymal tumor, pincoblastoma, pituitary tumor, plasma cell neoplasm, plasma cell neoplasm, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell cancer, respiratory tract cancer with chromosome 15 changes, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Sézary syndrome, small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous non-small cell lung cancer, squamous neck cancer, supratentorial primitive neuroectodermal tumor, supratentorial primitive neuroectodermal tumor, testicular cancer, throat cancer, thymic carcinoma, thymoma, thyroid cancer, cancer of the renal pelvis, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenström macroglobulinemia, and Wilms tumor.

In some embodiments, mutations detected are in ARID1A and cancer cells which can be detected include, but are not limited to, cells from adrenocortical carcinoma, AIDS-related lymphoma, anal cancer, appendix cancer, grade I (anaplastic) astrocytoma, grade II astrocytoma, grade III astrocytoma, grade IV astrocytoma, atypical teratoid/rhabdoid tumor of the central nervous system, basal cell carcinoma, bladder cancer, bronchial cancer, bronchoalveolar carcinoma, Burkitt lymphoma, cervical cancer, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, endometrial cancer, endometrial uterine cancer, ependymoblastoma, ependymoma, esophageal cancer, esthesioneuroblastoma, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, fibrous histiocytoma, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, gestational trophoblastic tumor, gestational trophoblastic tumor, glioma, head and neck cancer, heart cancer, hepatocellular cancer, Hilar cholangiocarcinoma, Hodgkin's lymphoma, hypopharyngeal cancer, intraocular melanoma, islet cell tumor, Kaposi sarcoma, Langerhans cell histiocytosis, laryngeal cancer, lip cancer, lymphoma, macroglobulinemia, malignant fibrous histiocytoma, medulloblastoma, medulloepithelioma, melanoma. Merkel cell carcinoma, mesothelioma, endocrine neoplasia, multiple myeloma, mycosis fungoides, myelodysplasia, myelodysplastic/myeloproliferative neoplasms, myeloproliferative disorders, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin's lymphoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian clear cell carcinoma, ovarian epithelial cancer, ovarian germ cell tumor, papillomatosis, paranasal sinus cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pineal parenchymal tumor, pineoblastoma, pituitary tumor, plasma cell neoplasm, plasma cell neoplasm, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell cancer, respiratory tract cancer with chromosome 15 changes, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Sezary syndrome, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer, supratentorial primitive neuroectodermal tumor, supratentorial primitive neuroectodermal tumor, testicular cancer, throat cancer, thymic carcinoma, thymoma, thyroid cancer, cancer of the renal pelvis, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenström macroglobulinemia, and Wilms tumor.

In some embodiments, mutations detected are in ARID1A and cancer cells which can be detected include, but are not limited to, cells from adrenocortical carcinoma, AIDS-related lymphoma, anal cancer, appendix cancer, grade I (anaplastic) astrocytoma, grade II astrocytoma, grade III astrocytoma, grade IV astrocytoma, atypical teratoid/rhabdoid tumor of the central nervous system, basal cell carcinoma, bladder cancer, bronchial cancer, bronchoalveolar carcinoma, Burkitt lymphoma, cervical cancer, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, endometrial cancer, endometrial uterine cancer, ependymoblastoma, ependymoma, esophageal cancer, esthesioneuroblastoma, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, fibrous histiocytoma, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, gestational trophoblastic tumor, gestational trophoblastic tumor, glioma, head and neck cancer, heart cancer, hepatocellular cancer, Hilar cholangiocarcinoma, Hodgkin's lymphoma, hypopharyngeal cancer, intraocular melanoma, islet cell tumor, Kaposi sarcoma, Langerhans cell histiocytosis, laryngeal cancer, lip cancer, lymphoma, macroglobulinemia, malignant fibrous histiocytoma, medulloepithelioma, melanoma, Merkel cell carcinoma, mesothelioma, endocrine neoplasia, multiple myeloma, mycosis fungoides, myelodysplasia, myelodysplastic/myeloproliferative neoplasms, myeloproliferative disorders, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin's lymphoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian clear cell carcinoma, ovarian epithelial cancer, ovarian germ cell tumor, papillomatosis, paranasal sinus cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pineal parenchymal tumor, pineoblastoma, pituitary tumor, plasma cell neoplasm, plasma cell neoplasm, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell cancer, respiratory tract cancer with chromosome 15 changes, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Sézary syndrome, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer, supratentorial primitive neuroectodermal tumor, supratentorial primitive neuroectodermal tumor, testicular cancer, throat cancer, thymic carcinoma, thymoma, thyroid cancer, cancer of the renal pelvis, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenström macroglobulinemia, and Wilms tumor.

In some embodiments, mutations detected are in PPP2R1A and cancer cells which can be detected include, but are not limited to, cells from acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related lymphoma, anal cancer, appendix cancer, grade I (anaplastic) astrocytoma, grade IT astrocytoma, grade III astrocytoma, grade IV astrocytoma, atypical teratoid/rhabdoid tumor of the central nervous system, basal cell carcinoma, bladder cancer, bronchial cancer, bronchoalveolar carcinoma, Burkitt lymphoma, cervical cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, endometrial cancer, endometrial uterine cancer, ependymoblastoma, ependymoma, esophageal cancer, esthesioneuroblastoma. Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, fibrous histiocytoma, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, gestational trophoblastic tumor, gestational trophoblastic tumor, glioma, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular cancer, Hilar cholangiocarcinoma, Hodgkin's lymphoma, hypopharyngeal cancer, islet cell tumor, Kaposi sarcoma, Langerhans cell histiocytosis, laryngeal cancer, lip cancer, macroglobulinemia, malignant fibrous histiocytoma, medulloblastoma, medulloepithelioma, Merkel cell carcinoma, mesothelioma, endocrine neoplasia, multiple myeloma, mycosis fungoides, myelodysplasia, myelodysplastic/myeloproliferative neoplasms, myeloproliferative disorders, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin's lymphoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian clear cell carcinoma, ovarian epithelial cancer, ovarian germ cell tumor, pancreatic cancer, papillomatosis, paranasal sinus cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pineal parenchymal tumor, pineoblastoma, pituitary tumor, plasma cell neoplasm, plasma cell neoplasm, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell cancer, respiratory tract cancer with chromosome 15 changes, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Sézary syndrome, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer, supratentorial primitive neuroectodermal tumor, supratentorial primitive neuroectodermal tumor, testicular cancer, throat cancer, thymic carcinoma, thymoma, thyroid cancer, cancer of the renal pelvis, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenström macroglobulinemia, and Wilms tumor.

In some embodiments nucleic acids are tested to determine whether ARID1A and/or PPP2R1A comprises a mutation. In some embodiments, ARID1A and/or PPP2R1A proteins are tested to determine whether the protein comprises a structural alteration, such as an amino acid substitution or a truncation or deletion of a portion of the protein.

The disclosed methods are useful for individuals whether suspected or not of having cancer or a predisposition to cancer. The individual tested may be healthy and free of family history, may have a family history of cancer, may have a tentative diagnosis of cancer, or may be suspected of having cancer based on a symptom or condition or a previous diagnostic test.

The described methods also are useful for, e.g.:

• • i. detecting OCCC, breast cancer, colon cancer, gastric cancer, lung cancer, medulloblastoma, pancreatic cancer, or prostate cancer;
  • ii. diagnosing OCCC, breast cancer, colon cancer, gastric cancer, lung cancer, medulloblastoma, pancreatic cancer, or prostate cancer;
  • iii. contributing to a diagnosis of OCCC, breast cancer, colon cancer, gastric cancer, lung cancer, medulloblastoma, pancreatic cancer, or prostate cancer;
  • iv. confirming a diagnosis of OCCC, breast cancer, colon cancer, gastric cancer, lung cancer, medulloblastoma, pancreatic cancer, or prostate cancer;
  • v. identifying appropriate treatments for OCCC, breast cancer, colon cancer, gastric cancer, lung cancer, medulloblastoma, pancreatic cancer, or prostate cancer;
  • vi. monitoring treatment of OCCC, breast cancer, colon cancer, gastric cancer, lung cancer, medulloblastoma, pancreatic cancer, or prostate cancer; and
  • vii. evaluating a treatment protocol for OCCC, breast cancer, colon cancer, gastric cancer, lung cancer, medulloblastoma, pancreatic cancer, or prostate cancer, including assessing efficacy of established or experimental therapies.

OCCC

The described methods are useful for detecting OCCC, diagnosing OCCC, contributing to a diagnosis of OCCC, or confirming a diagnosis of OCCC. Among ovarian cancers, OCCC is one of the most aggressive types because, unlike the more common high grade-serous type, it is refractory to standard platinum-based chemotherapy. Previous morphological and molecular studies have indicated that OCCC develops in a stepwise fashion from a common disease progenitor state, endometriosis, and proceeds through atypical endometriosis to frank malignancy (2-6). Activating mutations in PIK3CA (7) and genomic amplification of chr20q13.2 (8) are the most common molecular genetic alterations so far identified in OCCC.

In some embodiments, therefore, the cancer is OCCC. In some embodiments, ARID1A mutations useful for detecting OCCC include mutations listed in Tables 1, S3, and S5, wherein nucleotides are numbered by reference to SEQ ID NO:2.

In some embodiments, ARID1A mutations useful for detecting OCCC are 3854_3855insA; 553C>T; 903_904dupGT; 3659_3684delTGATGGGGCGCATGTCCTATGAGCCA (SEQ ID NO:7); 585C>A; 3391delC; 4001_4002dupGCA; 6828_6829delTG; 1455_1466insCCTAC; 4926_4927insTGGC; 4011_4012delTT; 4635G>A; 5202T>A; 486_492delCGCCGCC; 3575delA; 3223delG; 6718dupG; 898_899insCGTC; 6710_6711insT; 1663C>T; 782_791delCGTCGTCTTC (SEQ ID NO:8); 3634_3644delCAGCCCAGTAT (SEQ ID NO:9); 1873C>T; 2122C>T; 1804G>T; 6702delT; 1341T>G; 3442delC; 883dupC; 2868delC; 1881delT; 2179_2188delCGGCCACCCA (SEQ ID NO: 10); 608dupA; 1626_1627delGC; 3994C>T; 6791C>G; 6625delC; 289G>T; 1650dupC; and 2272delC, wherein nucleotides are numbered by reference to SEQ ID NO:2.

In some embodiments, ARID1A mutations useful for detecting OCCC are 3854_3855insA; 553C>T; 903_904dupGT; 3659_3684delTGATGGGGCGCATGTCCTATGAGCCA (SEQ ID NO:7); 585C>A; 3391delC; 4001_4002dupGCA; 6828_6829delTG; 1455_1466insCCTAC; 4926_4927insTGGC; 4011_4012delTT; 4635G>A; 5202T>A; 486_492delCGCCGCC; 3575delA; 3223delG; 6718dupG; 898_899insCGTC; 6710_6711insT; 1663C>T; 782_791delCGTCGTCTTC (SEQ ID NO:8); 3634_3644delCAGCCCAGTAT (SEQ ID NO:9); 1873C>T; 2122C>T; 1804G>T; 6702delT; 1341T>G; 3442delC; 883dupC; 2868delC; 1881delT; and 2179_2188delCGGCCACCCA (SEQ ID NO: 10), wherein nucleotides are numbered by reference to SEQ ID NO:2.

In some embodiments PPP2R12A mutations useful for detecting OCCC include mutations listed in Tables 1 and S5, wherein nucleotides are numbered by reference to SEQ ID NO:5.

In some embodiments PPP2R12A mutations useful for detecting OCCC are 547C>G, 547C>T, 547C>T, and 548G>A, wherein nucleotides are numbered by reference to SEQ ID NO:5.

In some embodiments PPP2R12A mutations useful for detecting OCCC are 547C>G, 547C>T, and 547C>T, wherein nucleotides are numbered by reference to SEQ ID NO:5.

Breast Cancer

In some embodiments the cancer is breast cancer. In some embodiments ARID1A mutations useful for detecting breast cancer include those listed in Table 2, wherein nucleotides are numbered by reference to SEQ ID NO:2.

In some embodiments ARID1A mutations useful for detecting breast cancer are 1323delC, 6259G>A, 5719A>T, and 2830C>T, wherein nucleotides are numbered by reference to SEQ ID NO:2.

Colon Cancer

In some embodiments the cancer is colon cancer. In some embodiments ARID1A mutations useful for detecting colon cancer include those listed in Table 2, wherein nucleotides are numbered by reference to SEQ ID NO:2.

In some embodiments ARID1A mutations useful for detecting colon cancer are 1014delG, 4689delC, 3281delA, 3344delC, 5548delG, 4354delC, 5548delG, 5548delG, 5548dupG, 1848delC, 2944_2946delAAC, 1657C>T, 62280C>A, 5838_5844dupACAGAGC, 5834_5835insAGCACAG, and 2467_2468dupTA, wherein nucleotides are numbered by reference to SEQ ID NO:2.

Gastric Cancer

In some embodiments the cancer is gastric cancer. In some embodiments ARID1A mutations useful for detecting gastric cancer include those listed in Table 2, wherein nucleotides are numbered by reference to SEQ ID NO:2.

In some embodiments ARID1A mutations useful for detecting gastric cancer are 879dupC, 827delG, 4743_4744delCA, 5548delG, 4972C>T, 5359G>T, 5548delG, 4524T>A, 5548delG, 6420delC, 2357dupG, 854delG, 969_975delGGGCGCC, wherein nucleotides are numbered by reference to SEQ ID NO:2.

Lung Cancer

In some embodiments the cancer is lung cancer. In some embodiments ARID1A mutations useful for detecting lung cancer include those listed in Table 2, wherein nucleotides are numbered by reference to SEQ ID NO:2.

In some embodiments ARID1A mutations useful for detecting lung cancer are 2834delG and 6403_6408delATTCTG, wherein nucleotides are numbered by reference to SEQ ID NO:2.

Brain Cancer

In some embodiments the cancer is brain cancer (e.g., medulloblastoma, grade I (anaplastic) astrocytoma, grade II astrocytoma, grade III astrocytoma, grade IV astrocytoma, atypical teratoid/rhabdoid tumor of the central nervous system, neuroblastoma).

In some embodiments ARID1A mutations useful for detecting brain cancer, particularly medulloblastoma, include those listed in Table 2, wherein nucleotides are numbered by reference to SEQ ID NO:2.

In some embodiments ARID1A mutations useful for detecting brain cancer, particularly medulloblastoma, are 1015delG, 4893_4894InsC, and 5012delG, wherein nucleotides are numbered by reference to SEQ ID NO:2.

In some embodiments ARID1A mutations useful for detecting medulloblastoma are 4893_4894InsC and 5012delG, wherein nucleotides are numbered by reference to SEQ ID NO:2.

Pancreatic Cancer

In some embodiments the cancer is pancreatic cancer. In some embodiments ARID1A mutations useful for detecting pancreatic cancer include those listed in Table 2, wherein nucleotides are numbered by reference to SEQ ID NO:2.

In some embodiments ARID1A mutations useful for detecting pancreatic cancer are 3826C>T, 5947_5948delTG, IVS10+1G>A, 1945_1946insT, 2296dupC, 5965C>T, 5965C>T, 6287C>G, 1585C>T, 5548dupG, and 2402delG, wherein nucleotides are numbered by reference to SEQ ID NO:2.

In some embodiments ARID1A mutations useful for detecting pancreatic cancer are IVS10+1G>A, 1945_1946insT, 2296dupC, 5965C>T, 5965C>T, 6287C>G, 1585C>T, 5548dupG, and 2402delG, wherein nucleotides are numbered by reference to SEQ ID NO:2.

Prostate Cancer

In some embodiments the cancer is prostate cancer. In some embodiments ARID1A mutations useful for detecting prostate cancer include those listed in Table 2, wherein nucleotides are numbered by reference to SEQ ID NO:2.

In some embodiments ARID1A mutations useful for detecting prostate cancer are 3977delC, 5548dupG, and 3999_4101delGCA, wherein nucleotides are numbered by reference to SEQ ID NO:2.

Individuals to be Tested

Individuals to be tested include those suspected of having a cancer, as well as individuals who have no apparent signs of cancer. Individuals to be tested can be asymptomatic or may have one or more symptoms of a cancer.

In some embodiments the individual has a symptom of ovarian cancer, including OCCC, such as an accumulation of ascites fluid, and/or a predisposing condition such as endometriosis.

In some embodiments the individual has a symptom of breast cancer, such as a breast lump or thickening, bloody discharge from the nipple, change in size or shape of a breast, changes to the skin over the breast (such as dimpling), inverted nipple, peeling, scaling or flaking of the nipple or breast skin; and redness or pitting of the skin over the breast.

In some embodiments the individual has a symptom of colon cancer, such as a change in bowel habits, including diarrhea or constipation, a change in stool consistency, rectal bleeding, and persistent abdominal discomfort, such as cramps, gas, or pain.

In some embodiments the individual has a symptom of gastric cancer, including abdominal fullness or pain, dark stools, difficulty swallowing, excessive belching, general decline in health, loss of appetite, nausea and vomiting, premature abdominal fullness after meals, vomiting blood, weakness or fatigue, and unintentional weight loss.

In some embodiments the individual has a symptom of lung cancer, including persistent cough, coughing up blood, shortness of breath, wheezing, chest pain, loss of appetite, and unintended weight loss.

In some embodiments the individual has a symptom of brain cancer, including headache; seizure; confusion or other changes in mental function; change in alertness (including sleepiness, unconsciousness, and coma); changes in sensory functions (hearing, taste, smell); difficulty swallowing, writing, walking, or reading; dizziness or vertigo; asymmetric pupils; uncontrollable movements; tremors; muscle weakness; numbness or tingling; personality, mood, behavioral, or emotional changes; and problems with eyesight, including decreased vision, double vision, or total loss of vision.

In some embodiments the individual has a symptom of pancreatic cancer, including pain or discomfort in the upper part of the belly or abdomen, loss of appetite and weight loss, jaundice, dark mine, clay-colored stools, fatigue, weakness, nausea, and vomiting.

In some embodiments the individual has a symptom of prostate cancer, such as delayed or slowed start of urinary stream; dribbling or leakage of urine, most often after urinating; slow urinary stream; straining when urinating, or not being able to empty out all of the urine; or blood in the urine or semen.

In some embodiments the described methods can be used to monitor an individual who has one or more risk factors for developing a cancer. One can readily identify individuals with an increased risk or family history of cancer, such as OCCC, breast cancer, colon cancer, gastric cancer, lung cancer, brain cancer (e.g., medulloblastoma), pancreatic cancer, and prostate cancer. Typically, inquiries are made about an individual's family history of the cancer. If two or more first-degree relatives (sibling-sibling or parent-child) or second-degree relatives (uncle/aunt-cousin, grandparent-grandchild, etc.) in a family have been diagnosed with the cancer, then individuals in the family can be identified as having a family history of the cancer and/or as having an increased risk of developing the cancer.

Other recognized indices of elevated risk of various cancers can be determined by standard clinical tests or medical history. For example, in some embodiments, an individual has a predisposing condition such as Helicobacter pylori infection, history of an adenomatous gastric polyp larger than 2 centimeters, history of chronic atrophic gastritis, history of pernicious anemia, or smoking, intestinal polyps, a history of smoking, exposure to second-hand smoke, high levels of air pollution, high levels of arsenic in drinking water, exposure to radon gas or asbestos, radiation therapy (e.g., to the lungs or brain), an inherited condition with an increased risk of brain tumors, such as neurofibromatosis, Von Hippel-Lindau syndrome, Li-Fraumeni syndrome, and Turcot syndrome, obesity, age, sex, exposure to agent orange or cadmium, alcohol abuse, and high fat diet.

Methods of Detecting Mutations

Methods of detecting mutations in PPP2R1A or ARID1A are useful for a variety of purposes, including, but not limited to, detecting cancer, diagnosing cancer, contributing to a diagnosis of cancer, confirming a diagnosis of cancer, identifying appropriate treatments for cancer, monitoring treatment of cancer, and evaluating treatment protocols for cancer, including ovarian clear cell carcinoma, breast cancer, colon cancer, gastric cancer, lung cancer, medulloblastoma, pancreatic cancer, and prostate cancer.

A biological sample, i.e., tissue or fluid, can be tested for a mutation in PPP2R1A or ARID1A or for diminished expression from ARID1A or for overexpression from PPP2R1A. In non-tumor samples, a detected mutation is likely to be a germline mutation. The biological sample can be obtained by any suitable means, including biopsy, surgery, and aspiration of an appropriate fluid. Biological samples which can be tested include without limitation suspected cancerous tissues, stool, sputum, and biological fluids such as tears, saliva, blood, plasma, serum, urine, ascites, and bronchoalveolar lavage. Cells which can be tested include, but are not limited to, neurons, glia, skin, blood cells, bone cells, colorectal cells, heart cells, lung cells, stomach cells, smooth muscle cells, striated muscle cells, thymus cells, thyroid cells, ovarian cells, uterine cells, kidney cells, and breast cells.

Obtaining Cells

Cells to be tested can be obtained from individuals using methods well known in the art. For example, in some embodiments ovarian cells are obtained by biopsy (e.g., Papanicolaou or “Pap” smear). In other embodiments, ovarian cells are obtained from a fluid sample. For example, a sample of ascites fluid can be obtained using needle aspiration. Culdocentesis can be used to obtain fluid from the space surrounding the ovaries. Paracentesis can be used to remove fluid from the abdominal cavity.

Cells can be obtained from patients suspected of having breast cancer using procedures such as fine needle aspiration (FNA), core biopsy (e.g., ultrasound-guided core biopsy and stereotactic biopsy), open excisional biopsy, and sentinel node biopsy.

Cells can be obtained from patients suspected of having colon cancer by biopsy during colonoscopy, flexible sigmoidoscopy, or surgery.

Cells can be obtained from patients suspected of having gastric cancer by biopsy during endoscopy.

Cells can be obtained from patients suspected of having lung cancer by taking a biopsy during bronchoscopy or by needle biopsy.

Cells can be obtained from patients suspected of having brain cancer by biopsy during surgery or from a sample of cerebrospinal fluid.

Cells can be obtained from patients suspected of having pancreatic cancer using FNA or brush biopsy.

Cells can be obtained from patients suspected of having prostate cancer by transrectal, transurethral, or transperineal biopsy.

Reference Sequences

The reference genomic DNA sequence for ARID1A is provided in SEQ ID NO:1. The reference cDNA (coding) sequence for ARID1A is provided in SEQ ID NO:2. The reference amino acid sequence of ARID1A protein is provided in SEQ ID NO:3.

The reference genomic DNA sequence for PPP2R1A is provided in SEQ ID NO:4. The reference cDNA (coding) sequence for PPP2R1A is provided in SEQ ID NO:5. The reference amino acid sequence of PPP2R1A protein is provided in SEQ ID NO:6.

Nucleic Acids

Isolated nucleic acids (e.g., DNA) comprising a portion of an PPP2R1A or ARID1A gene sequence comprising one of the mutations identified in Tables 1, S3, S5, and 2 can be used as primers or probes for mutation detection. The isolated nucleic acids may have 17, 18, 19, 20, 21, 25 or 30 to about 100, 200, 300, 400 or 500 consecutive nucleotides of ARID1A genomic DNA or cDNA, spanning and/or containing one of the mutations identified in Tables 1, S3, S5, and 2. For example, isolated nucleic acids may have from 18, 19, 20 or 21 to about 100, 200, 300 400 or 500 nucleotides comprising at least 18, 19, 20 or 21 consecutive nucleotides spanning nucleotides 3659-3684, 3854-3855, 553, 903-904, 585, or 3391 numbered according to ARID1A cDNA (SEQ ID NO:2) or nucleotide 547 numbered according to PPP2R1A cDNA (SEQ ID NO:5). Pairs of primers can be used to amplify portions of PPP2R1A or ARID1A that comprise the disclosed mutations.

Mutations in PPP2R1A and ARID1A include deletions, insertions, duplications, substitutions (missense or nonsense mutations), etc. Such mutations, alterations, and defects can be detected inter alia by comparing to a wild type in another (non-tumor) tissue of an individual or by comparing to reference sequences, for example in databases or as provided in this disclosure. Mutations that are found in all tissues of an individual are genomic mutations, whereas those that occur only in tumor tissue are somatic mutations. Examples of PPP2R1A and ARID1A mutations include those in Table 1 and Table S3. Other examples of PPP2R1A and ARID1A mutations include those in Table S5. Other examples of ARID1A mutations include those in Table 2.

In various embodiments, mutations in the PPP2R1A and ARID1A genes, alterations in PPP2R1A and ARID1A gene expression, or structural alterations in PPP2R1A and ARID1A proteins can be analyzed in a patient sample by any suitable technique known in the art which is sufficiently sensitive. Non-limiting examples are described below.

Techniques involving genomic DNA, mRNA, or cDNA can be used. In a nucleic acid-based detection method, genomic DNA is first obtained (using any standard technique) from ovarian cells of an individual to be tested. If appropriate. cDNA can be prepared or mRNA can be obtained. In some embodiments, nucleic acids can be amplified by any known nucleic acid amplification technique such as PCR, to a sufficient quantity and purity, and further analyzed to detect mutations. For example, genomic DNA can be isolated from a sample, and all exonic sequences and the intron/exon junction regions including the regions required for exon/intron splicing can be amplified into one or more amplicons, and further analyzed for the presence or absence of mutations.

Nucleotide sequencing methods can be used to detect the presence or absence of mutations. Various sequencing techniques are generally known and widely used in the art including the Sanger method and Gilbert chemical method. Pyrosequencing monitors DNA synthesis in real time using a luminometric detection system. Pyrosequencing has been shown to be effective in analyzing genetic polymorphisms such as single-nucleotide polymorphisms and thus can also be used. See Nordstrom et al., Biotechnol. Appl. Biochem., 31(2): 107-112 (2000); Ahmadian et al., Anal. Biochem., 280:103-110 (2000). The obtained sequence is then compared to a wild-type reference sequence such as the reference sequences identified in Table S3 and provided in this disclosure.

Mutation scanning in a target gene can also be carried out using denaturing high pressure liquid chromatography (dHPLC). Specifically, the target gene is first amplified by PCR into different amplicons, and each amplicon is analyzed by dHPLC to detect the presence or absence of heterozygosity in each amplicon. The heterozygous amplicons thus identified are further sequenced to detect mutations. See, e.g., Cao et al., Breast Cancer Res Treat., 114(3):457-62 (2009).

High resolution melting analysis can also be used in the disclosed methods. Like dHPLC, PCR amplification is used to produce amplicons from the target gene, and each amplicon is analyzed by high resolution melting analysis to detect the presence or absence of heterozygosity in each amplicon. The heterozygous amplicons thus identified are further sequenced to detect mutations. See, e.g., Jiménez et al., Clin Biochem., 42(15): 1572-6 (2009).

Restriction fragment length polymorphism (RFLP) and amplified fragment length polymorphism (AFLP) methods may also be useful techniques. In particular, if a mutation in the target nucleic acid region results in the elimination or creation of a restriction enzyme recognition site, then digestion of the target DNA with that particular restriction enzyme will generate an altered restriction fragment length pattern. Thus, a detected RFLP or AFLP will indicate the presence of a mutation.

Another useful approach is the single-stranded conformation polymorphism assay (SSCA), which is based on the altered mobility of a single-stranded target DNA spanning the mutations of interest. A single nucleotide change in the target sequence can result in different intramolecular base pairing pattern, and thus different secondary structure of the single-stranded DNA, which can be detected in a non-denaturing gel. See Orita et al., Proc. Natl. Acad. Sci. USA, 86:2776-2770 (1989). Denaturing gel-based techniques such as clamped denaturing gel electrophoresis (CDGE) and denaturing gradient gel electrophoresis (DGGE) detect differences in migration rates of mutant sequences as compared to wild-type sequences in denaturing gel. See Miller et al., Biotechniques, 5:1016-24 (1999); Sheffield et al., Am. J. Hum. Genet., 49:699-706 (1991); Wartell et al., Nucleic Acids Res., 18:2699-2705 (1990); and Sheffield et al., Proc. Natl. Acad. Sci. USA, 86:232-236 (1989). In addition, the double-strand conformation analysis (DSCA) can also be useful. See Arguello et al., Nat. Genet., 18:192-194 (1998).

The presence or absence of a mutation at a particular locus in a genomic region of an individual can also be detected using the amplification refractory mutation system (ARMS) technique. See e.g., European Patent No. 0,332,435; Newton et al., Nucleic Acids Res., 17:2503-2515 (1989); Fox et al., Br. J. Cancer, 77:1267-1274 (1998); Robertson et al., Eur. Respir. J., 12:477-482 (1998). In the ARMS method, a primer is synthesized matching the nucleotide sequence immediately 5′ upstream from the locus being tested except that the 3′-end nucleotide which corresponds to the nucleotide at the locus is a predetermined nucleotide. For example, the 3′-end nucleotide can be the same as that in the mutated locus. The primer can be of any suitable length so long as it hybridizes to the target DNA under stringent conditions only when its 3′-end nucleotide matches the nucleotide at the locus being tested. Preferably the primer has at least 12 nucleotides, more preferably from about 18 to 50 nucleotides. If the individual tested has a mutation at the locus and the nucleotide therein matches the 3′-end nucleotide of the primer, then the primer can be further extended upon hybridizing to the target DNA template, and the primer can initiate a PCR amplification reaction in conjunction with another suitable PCR primer. In contrast, if the nucleotide at the locus is of wild type, then primer extension cannot be achieved. Various forms of ARMS techniques can be used. See e.g., Gibson et al., Clin. Chem. 43:1336-1341 (1997).

Similar to the ARMS technique is the mini sequencing or single nucleotide primer extension method, which is based on the incorporation of a single nucleotide. An oligonucleotide primer matching the nucleotide sequence immediately 5′ to the locus being tested is hybridized to the target DNA or mRNA in the presence of labeled dideoxyribonucleotides. A labeled nucleotide is incorporated or linked to the primer only when the dideoxyribonucleotides matches the nucleotide at the variant locus being detected. Thus, the identity of the nucleotide at the variant locus can be revealed based on the detection label attached to the incorporated dideoxyribonucleotides. See Syvanen et al., Genomics, 8:684-692 (1990); Shumaker et al., Hum. Mutat., 7:346-354 (1996); Chen et al., Genome Res., 10:549-547 (2000).

Another set of useful techniques are oligonucleotide ligation assays (OLA) in which differentiation between a wild-type locus and a mutation is based on the ability of two oligonucleotides to anneal adjacent to each other on the target DNA molecule allowing the two oligonucleotides joined together by a DNA ligase. See Landergren et al., Science, 241:1077-1080 (1988); Chen et al. Genome Res., 8:549-556 (1998); Iannone et al., Cytometry, 39:131-140 (2000). Thus, for example, to detect a single-nucleotide mutation at a particular locus in a genomic region, two oligonucleotides can be synthesized, one having the genomic sequence just 5′ upstream from the locus with its 3′ end nucleotide being identical to the nucleotide in the variant locus, the other having a nucleotide sequence matching the genomic sequence immediately 3′ downstream from the variant locus. The oligonucleotides can be labeled for the purpose of detection. Upon hybridizing to the target nucleic acid under a stringent condition, the two oligonucleotides are subject to ligation in the presence of a suitable ligase. The ligation of the two oligonucleotides would indicate that the target DNA has a mutation at the locus being detected.

Detection of mutations can also be accomplished by a variety of hybridization-based approaches. For example, allele-specific oligonucleotides are useful. See Conner et al., Proc. Natl. Acad. Sci. USA, 80:278-282 (1983); Saiki et al, Proc. Natl. Acad. Sci. USA, 86:6230-6234 (1989). Oligonucleotide probes (allele-specific) hybridizing specifically to an allele having a particular mutation at a particular locus but not to other alleles can be designed by methods known in the art. The probes can have a length of, e.g., from 10 to about 50 nucleotide bases. The target DNA and the oligonucleotide probe can be contacted with each other under conditions sufficiently stringent such that the mutations can be distinguished from the alternative variant/allele at the same locus based on the presence or absence of hybridization. The probe can be labeled to provide detection signals. Alternatively, an allele-specific oligonucleotide probe can be used as a PCR amplification primer in an “allele-specific PCR” and the presence or absence of a PCR product of the expected length would indicate the presence or absence of a particular mutation.

Other useful hybridization-based techniques allow two single-stranded nucleic acids annealed together even in the presence of mismatch due to nucleotide substitution, insertion or deletion. The mismatch can then be detected using various techniques. For example, the annealed duplexes can be subjected to electrophoresis. A mismatched duplex can be detected based on an electrophoretic mobility that is different from that of a perfectly matched duplex. See Cariello, Human Genetics, 42:726 (1988). Alternatively, in a RNase protection assay, a RNA probe can be prepared spanning the mutations site to be detected and having a detection marker. See Giunta et al., Diagn. Mol. Path., 5:265-270 (1996); Finkelstein et al., Genomics. 7:167-172 (1990); Kinzler et al., Science 251:1366-1370 (1991). The RNA probe can be hybridized to the target DNA or mRNA forming a heteroduplex that is then subject to the ribonuclease RNase A digestion. RNase A digests the RNA probe in the heteroduplex only at the site of mismatch. The digestion can be determined on a denaturing electrophoresis gel based on size variations. In addition, mismatches can also be detected by chemical cleavage methods known in the art. See e.g., Roberts et al., Nucleic Acids Res., 25:3377-3378 (1997).

A great variety of improvements and variations have been developed in the art on the basis of the above-described basic techniques, and can all be useful in detecting mutations. For example, the “sunrise probes” or “molecular beacons” utilize the fluorescence resonance energy transfer (FRET) property and give rise to high sensitivity. See Wolf et al., Proc. Nat. Acad. Sci. USA, 85:8790-8794 (1988). Typically, a probe spanning the nucleotide locus to be detected is designed into a hairpin-shaped structure and labeled with a quenching fluorophore at one end and a reporter fluorophore at the other end. In its natural state, the fluorescence from the reporter fluorophore is quenched by the quenching fluorophore due to the proximity of one fluorophore to the other. Upon hybridization of the probe to the target DNA, the 5′ end is separated apart from the 3′-end and thus fluorescence signal is regenerated. See Nazarenko et al., Nucleic Acids Res., 25:2516-2521 (1997); Rychlik et al., Nucleic Acids Res., 17:8543-8551 (1989); Sharkey et al., Bio/Technology 12:506-509 (1994); Tyagi et al., Nat. Biotechnol., 14:303-308 (1996); Tyagi et al., Nat. Biotechnol., 16:49-53 (1998). A homo-tag assisted non-dimer system (HANDS) can be used in combination with the molecular beacon methods to suppress primer-dimer accumulation. See Brownie et al., Nucleic Acids Res., 25:3235-3241 (1997).

A dye-labeled oligonucleotide ligation assay, which is a FRET-based method that combines the OLA assay and PCR, can be used. See Chen et al., Genome Res. 8:549-556 (1998). TaqMan is another FRET-based method for detecting mutations. A TaqMan probe can be an oligonucleotide designed to have the nucleotide sequence of the human nucleic acid spanning the variant locus of interest and to differentially hybridize with different alleles. The two ends of the probe are labeled with a quenching fluorophore and a reporter fluorophore, respectively. The TaqMan probe is incorporated into a PCR reaction for the amplification of a target nucleic acid region containing the locus of interest using Taq polymerase. Because Taq polymerase exhibits 5′-3′ exonuclease activity but has no 3′-5′ exonuclease activity, if the TaqMan probe is annealed to the target DNA template, the 5′-end of the TaqMan probe will be degraded by Taq polymerase during the PCR reaction thus separating the reporting fluorophore from the quenching fluorophore and releasing fluorescence signals. See Holland et al., Proc. Natl. Acad. Sci. USA, 88:7276-7280 (1991); Kalinina et al., Nucleic Acids Res., 25:1999-2004 (1997); Whitcombe et al., Clin. Chem., 44:918-923 (1998).

Chemiluminescence-based techniques can be used. For example, an oligonucleotide probe can be designed to hybridize to either the wild-type or a variant locus but not both. The probe is labeled with a highly chemiluminescent acridinium ester. Hydrolysis of the acridinium ester destroys chemiluminescence. The hybridization of the probe to the target DNA prevents the hydrolysis of the acridinium ester. Therefore, the presence or absence of a particular mutation in the target DNA is determined by measuring chemiluminescence changes. See Nelson et al., Nucleic Acids Res., 24:4998-5003 (1996).

The detection of mutations can also be based on the “base excision sequence scanning” (BESS) technique. The BESS method is a PCR-based mutation scanning method. BESS T-Scan and BESS G-Tracker are generated which are analogous to T and G ladders of dideoxy sequencing. Mutations are detected by comparing the sequence of normal and mutant DNA. See, e.g., Hawkins et al., Electrophoresis, 20:1171-1176 (1999).

Mass spectrometry can be used. See Graber et al., Curr. Opin. Biotechnol., 9:14-18 (1998). For example, in the primer oligo base extension (PROBE™) method, a target nucleic acid is immobilized to a solid-phase support. A primer is annealed to the target immediately 5′ upstream from the locus to be analyzed. Primer extension is carried out in the presence of a selected mixture of deoxyribonucleotides and dideoxyribonucleotides. The resulting mixture of newly extended primers is then analyzed by MALDI-TOF. See e.g., Monforte et al., Nat. Med., 3:360-362 (1997).

Microchip or microarray technologies are also applicable to the disclosed methods as will be apparent to a skilled artisan in view of this disclosure. For example, isolated genomic DNA can be prepared and hybridized to a DNA microchip having probes designed based on the target gene sequence.

As is apparent from the above survey of the suitable detection techniques, it may or may not be necessary to amplify the target nucleic acid, i.e., the genomic region of interest, or the corresponding cDNA or mRNA to increase the number of target molecules, depending on the detection techniques used. For example, most PCR-based techniques combine the amplification of a portion of the target and the detection of the mutations. PCR amplification is well known in the art and is disclosed in U.S. Pat. Nos. 4,683,195 and 4,800,159. For non-PCR-based detection techniques, if necessary, the amplification can be achieved by, e.g., in vivo plasmid multiplication, or by purifying the target DNA from a large amount of tissue or cell samples. See generally, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2^nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989. However, even with scarce samples, many sensitive techniques have been developed in which small genetic variations such as single-nucleotide substitutions can be detected without having to amplify the target DNA in the sample. For example, techniques have been developed that amplify the signal as opposed to the target DNA by, e.g., employing branched DNA or dendrimers that can hybridize to the target DNA. The branched or dendrimer DNAs provide multiple hybridization sites for hybridization probes to attach thereto thus amplifying the detection signals. See Detmer et al., J. Clin. Microbiol., 34:901-907 (1996); Collins et al., Nucleic Adds Res., 25:2979-2984 (1997); Horn et al., Nucleic Acids Res., 25:4835-4841 (1997); Horn et al., Nucleic Acids Res., 25:4842-4849 (1997); Nilsen et al., J. Theor. Biol., 187:273-284 (1997).

In yet another technique for detecting mutations, the INVADER® assay utilizes a novel linear signal amplification technology that improves upon the long turnaround times required of the typical PCR DNA sequenced-based analysis. See Cooksey et al., Antimicrobial Agents and Chemotherapy 44:1296-1301 (2000). This assay is based on cleavage of a unique secondary structure formed between two overlapping oligonucleotides that hybridize to the target sequence of interest to form a “flap.” Each “flap” then generates thousands of signals per hour. Thus, the results of this technique can be easily read, and the methods do not require exponential amplification of the DNA target. The INVADER® system utilizes two short DNA probes, which are hybridized to a DNA target. The structure formed by the hybridization event is recognized by a special cleavase enzyme that cuts one of the probes to release a short DNA “flap.” Each released “flap” then binds to a fluorescently-labeled probe to form another cleavage structure. When the cleavase enzyme cuts the labeled probe, the probe emits a detectable fluorescence signal. See e.g. Lyamichev et al., Nat. Biotechnol., 17:292-296 (1999).

The rolling circle method is another method that avoids exponential amplification. Lizardi et al., Nature Genetics, 19:225-232 (1998). For example, SNIPER™, a commercial embodiment of this method, is a sensitive, high-throughput SNP scoring system designed for the accurate fluorescent detection of specific variants. For each mutation, two linear, allele-specific probes are designed. The two allele-specific probes are identical with the exception of the 3′-base, which is varied to complement the variant site. In the first stage of the assay, target DNA is denatured and then hybridized with a pair of single, allele-specific, open-circle oligonucleotide probes. When the 3′-base exactly complements the target DNA, ligation of the probe will preferentially occur. Subsequent detection of the circularized oligonucleotide probes is by rolling circle amplification, whereupon the amplified probe products are detected by fluorescence. See Clark and Pickering, Life Science News 6, 2000, Amersham Pharmacia Biotech (2000).

Techniques that avoid amplification all together include, e.g., surface-enhanced resonance Raman scattering (SERRS), fluorescence correlation spectroscopy, and single-molecule electrophoresis. In SERRS, a chromophore-nucleic acid conjugate is absorbed onto colloidal silver and is irradiated with laser light at a resonant frequency of the chromophore. See Graham et al., Anal. Chem., 69:4703-4707 (1997). The fluorescence correlation spectroscopy is based on the spatio-temporal correlations among fluctuating light signals and trapping single molecules in an electric field. See Eigen et al., Proc. Natl. Acad. Sci. USA, 91:5740-5747 (1994). In single-molecule electrophoresis, the electrophoretic velocity of a fluorescently tagged nucleic acid is determined by measuring the time required for the molecule to travel a predetermined distance between two laser beams. See Castro et al., Anal. Chem., 67:3181-3186 (1995).

In addition, the allele-specific oligonucleotides (ASO) can also be used in in situ hybridization using tissues or cells as samples. The oligonucleotide probes which can hybridize differentially with the wild-type gene sequence or the gene sequence harboring a mutation may be labeled with radioactive isotopes, fluorescence, or other detectable markers. In situ hybridization techniques are well known in the art and their adaptation to the disclosed methods for detecting the presence or absence of a mutation in a genomic region of a particular individual should be apparent to a skilled artisan in view of this disclosure.

Proteins

Protein-based detection techniques may also prove to be useful, especially when the mutations causes amino acid substitutions or deletions or insertions or frameshift that affect the protein primary, secondary or tertiary structure. To detect the amino acid variations, protein sequencing techniques may be used. Alternatively, the recently developed HPLC-microscopy tandem mass spectrometry technique can be used for determining the amino acid sequence variations. See Gatlin et al., Anal. Chem., 72:757-763 (2000).

Other useful protein-based detection techniques include immunoaffinity assays based on antibodies selectively immunoreactive with mutant proteins or specifically with wild-type proteins. Antibodies can be used to immunoprecipitate specific proteins from solution samples or to immunoblot proteins separated by, e.g., polyacrylamide gels. Immunocytochemical methods can also be used in detecting specific protein in tissues or cells. Other well-known antibody-based techniques can also be used including, e.g., enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunoradiometric assays (IRMA) and immunoenzymatic assays (IEMA), including sandwich assays using monoclonal or polyclonal antibodies. See e.g., U.S. Pat. Nos. 4,376,110 and 4,486,530.

Antibodies (or fragments thereof) can be employed histologically—e.g., IHC, immunofluorescence or immunoelectron microscopy—for in situ detection of peptides encoded by nucleic acids of interest. In situ detection can be accomplished by removing a histological specimen from a patient, and applying thereto a labeled antibody. The antibody (or its fragment) is preferably applied by overlaying the labeled antibody (or fragment) onto a biological sample. Through the use of such a procedure, it is possible to determine not only the presence and amount of the expression product of a target gene, but also its distribution in the examined tissue. A skilled artisan will readily perceive that any of a wide variety of histological methods (e.g., staining procedures) can be modified to achieve such in situ detection.

U.S. Pat. No. 5,965,377 discloses an antibody-based method for determining the presence of mutated protein in cells expressing the protein, wherein the normal protein contains amino-terminus and carboxy-terminus regions and wherein the mutated protein is typically a foreshortened protein from which carboxy-terminus regions are missing. This method can be adapted to detect truncation mutations in PPP2R1A or ARID1A proteins. Specifically, an antibody reactive with the N-terminus of the target protein and an antibody reactive with the C-terminus of the target protein are used to react with a cell sample, and the ratio between the reactivity with the C-terminus and N-terminus can be obtained. If the reactivity with the C-terminus is about zero or no greater than about half of the reactivity with the N-terminus in the sample, it would indicate the presence of a truncation mutation in the gene. The antibody reactivity can be measured by any suitable immunoassays, e.g., immunohistochemistry (IHC) and ELISA.

The antibody based methods described above can also be used to determine generally the expression level of PPP2R1A and ARID1A, as will be apparent to skilled artisan.

For purposes of detecting a reduced level of gene expression, either mRNA or protein level in a sample from a patient can be determined by conventional methods known in the art. Protein expression level in a sample can be determined using an immunoassay described above. For mRNA level, typically hybridization of DNA probes or primers is utilized. For example, for mRNA expression level, qRT-PCT can be used. mRNA can be isolated from a particular sample, and the target gene mRNA, and preferably in addition, a reference gene mRNA (typically a housekeeping gene), are amplified by qRT-PCR, and the relative amount of the target gene mRNA is determined, which is compared to a predetermined reference standard level (e.g., an average level determined in a plurality of normal samples). Alternatively, digital PCR is also useful.

Additionally, gene expression levels can also be detected indirectly by determining the methylation status of the target gene. If the target gene is methylated at a greater extent than normal, then the target gene expression is usually reduced. Methods for determining gene methylation status are well known in the art.

Additional Diagnostic Tests

In some embodiments one or more other diagnostic tests can follow a disclosed method. In some embodiments one or more other diagnostic tests can be performed in conjunction with a disclosed method.

Diagnostic tests for OCCC include imaging studies (e.g., ultrasound, CT scan, endoscopic ultrasound), blood tests (e.g., CA125 testing), microscopic examination of cells obtained from fluid (e.g., ascites fluid, fluid from the space surrounding the ovaries, or fluid from the abdominal cavity) and biopsies (e.g., percutaneous needle biopsy or Papanicolaou smear).

Diagnostic tests for breast cancer include mammograms, ultrasound, MRI, CAT scans, PET scans, and biopsies.

Diagnostic tests for colon cancer include colonoscopies (including high-definition colonoscopy and virtual colonoscopy) and biopsies.

Diagnostic tests for gastric cancer include esophagogastroduodenoscopy (EGD), biopsy, and imaging studies (e.g., upper GI series).

Diagnostic tests for lung cancer include chest x-ray, sputum cytology test, CT scan, MRI, PET scan, bronchoscopy combined with biopsy, pleural biopsy, CT-scan-directed needle biopsy, mediastinoscopy with biopsy, and open lung biopsy.

Diagnostic tests for brain cancer include CT scans. EEGs, examination of cerebral spinal fluid, MRIs, and biopsy.

Diagnostic tests for pancreatic cancer include CT scan, MRI, endoscopic retrograde cholangiopancreatography (ERCP), endoscopic ultrasound, and pancreatic biopsy.

Diagnostic tests for prostate cancer include PSA testing and biopsy.

Use of Test Results

The result of the tests described herein can be recorded in a tangible medium, such as such as paper or a computer readable medium (for example, a diskette, CD-ROM, ROM, or fixed disk, memory drive, a solid state memory device, or an optical storage device). Results can be displayed on a computer screen or the screen of a hand-held device such as a smartphone.

In some embodiments, following a test as described above, a diagnosis of cancer is provided to the patient and/or to a medical professional, such as the patient's doctor. The diagnosis can be provided orally, in writing, or via electronic media.

In some embodiments, a course of treatment is recommended to the patient. “Treatment” as used in this context includes surgery and chemotherapy as well as surveillance for the cancer via biopsy or imaging techniques or by assessing levels of diagnostic markers such as prostate specific antigen (prostate cancer), MUC1 (multiple myeloma), carcinoembryonic antigen (CEA; colon cancer), and CA125 (ovarian cancer). Administration of a therapy to a patient in treatment does not require any particular effect or cure. In some embodiments, appropriate treatments for OCCC, breast cancer, colon cancer, gastric cancer, lung cancer, medulloblastoma, pancreatic cancer, or prostate cancer are identified. In some embodiments, treatments for OCCC, breast cancer, colon cancer, gastric cancer, lung cancer, medulloblastoma, pancreatic cancer, or prostate cancer are modified.

Cancer tissues can be categorized on the basis of which, if any, PPP2R1A and/or ARID1A mutation(s) they contain. Somatic mutations arc identified on the basis of a difference between an affected tissue and a normal tissue of the same individual. Categorization of the tissue can be used for stratifying patients for clinical trials, for analyzing data from clinical trials, for correlating with prognostic data (such as recurrence, metastasis, and life expectancy), as well as for selecting an appropriate course of treatment for a cancer patient Categorization can be correlated with efficacy of a therapeutic agent to enable prescription of drugs for individuals with higher probability of successful treatment. The categorization can be used in conjunction with other data, for example, histopathological data, to identify a cancer. Somatic mutation analysis can be used in any tissue or body sample to diagnose cancer. Presence of a mutant PPP2R1A and/or ARID1A protein or PPP2R1A and/or ARID1A coding sequence in a tissue or body sample indicates the presence of cancer cells, either in the sample itself, or in a tissue which drains into the sample. Thus, for example, detection of PPP2R1A and/or ARID1A mutations in a fecal sample reflects the presence of colorectal cancer cells in the individual from whom the sample was taken. Detection of PPP2R1A and/or ARID1A mutations in a sample of ovarian cells reflects the presence of ovarian cancer in the individual from whom the sample was taken.

Kits

This disclosure also provides kits for use in the disclosed methods. The kits may include a carrier for the various components of the kits. The carrier can be a container or support, in the form of. e.g., bag, box, tube, rack, and is optionally compartmentalized. The kit also includes various components useful in detecting mutations, or determining gene expression (mRNA and protein) levels, using the above-discussed detection techniques. For example, the detection kit may include one or more oligonucleotides useful as primers for amplifying all or a portion of the PPP2R1A and ARID1A genomic or cDNA. The detection kit may also include one or more oligonucleotide probes for hybridization to the PPP2R1A and ARID1A genomic or cDNA or mRNA. Optionally the oligonucleotides are affixed to a solid support, e.g., incorporated in a microchip or microarray included in the kit.

In some embodiments, a detection kit contains one or more antibodies selectively immunoreactive with PPP2R1A and ARID1A protein, for example antibodies selectively immunoreactive with the N-terminus of PPP2R1A and ARID1A protein, and/or antibodies selectively immunoreactive with the C-terminus of PPP2R1A and ARID1A protein.

Various other components useful in the detection techniques can also be included in a detection kit. Examples of such components include, but are not limited to, Taq polymerase, deoxyribonucleotides, dideoxyribonucleotides other primers suitable for the amplification of a target DNA sequence, RNase A, mutS protein, and the like. A detection kit can include instructions on using the kit for the various embodiments described above.

Therapeutic Methods

This disclosure also provides methods of inhibiting growth of cancer cells. In some embodiments a polynucleotide encoding ARID1A is administered to cancer cells, such as ovarian cancer cells. The cells can be in culture or can be in vivo, such as in an animal cancer model or a human. The polynucleotide can be administered by intratumoral injection.

Screening Methods

Test compounds can be tested to determine whether they have a differential effect in a tumor comprising a mutation in ARID1A or PPP2R1A. In some embodiments the effect of a test compound on a tumor cell is compared with the effect of the test compound on a cell that does not comprise the mutation (either a non-tumor cell or a tumor cell that does not comprise a mutation in ARID1A or PPP2R1A. The results can be recorded as described above. The differential effect can be, for example, inhibition of tumor cell growth, inhibition of tumor cell proliferation, stimulation of apoptosis, or inhibition of tumor growth. The tested cells can be in vitro or can be in an animal cancer model.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods, suitable methods and materials are described below. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

REFERENCES

• 1. Cho & Ic, Annu Rev Pathol 4, 287 (2009).
• 2. Erzen et al., Gynecol Oncol 83, 100 (2001).
• 3. Fukunaga et al., Histopathology 30, 249 1997.
• 4. Marquez et al., Clin Cancer Res 11,6116 (2005).
• 5. Sato et al., Cancer Res 60, 7052 (2000).
• 6. Veras et al., Am J Surg Pathol 33, 844 (2009).
• 7. Kuo et al., Am J Pathol 174, 1597 (2009).
• 8. Kuo et al., Clin Cancer Res 16, 1997 2010.
• 9. Jones et al., Science 330:228-31 (2010), supporting material on Science Online.
• 10. Greenman et al., Nature 446, 153 (2007).
• 11. Sjöblom et al., Science 314, 268-74 (2006).
• 12. Wood et al., Science 318, 1108-13 (2007).
• 13. Jones et al., Science 321, 1801-06 (2010).
• 14. Parsons et al., Science 321, 1807-12 (2010).
• 15. Vogelstein, K. W. Kinzler, Nat Med 10, 789 (2004).
• 16. Calin et al., Oncogene 19, 1191 (2000).
• 17. Tang et al., Dev Cell 10, 575 (2006).
• 18. Wu et al., Cell 136, 200-06 (2009).
• 19. Weissamn & Knudsen, Cancer Res 69, 8223-30 (2009).
• 20. Nagl et al., Embo J 26, 752 (2007).
• 21. Luo et al., Proc Natl Acad Sci USA 105, 20380 (2010).
• 22. Huang et al., Genes Chromosomes Cancer 46, 745-50 (2007).
• 23. Van Raamsdonk et al., Nature 457, 599 (2009).
• 24. Dalgliesh et al., Nature 463, 360-63 (2010).
• 25. Eshleman et al., Oncogene 12:1425-32 (1996).
• 26. Jones et al., Science 330:228-31 (2010).
• 27. Kern, Cancer Biol Ther. 1:189-94 (2002).
• 28. Markowitz et al., Science. 268:1336-38 (1994).
• 29. Medina et al., Hum Mutat 29:617-22 (2010).
• 30. Meyerson et al., Nat Rev Genet 11:685-96 (2010).
• 31. Parsons et al., Science 331:435-59 (2011).
• 32. Rampino et al., Science 275:967-69 (1997).
• 33. Varela et al., Nature 469:539-42 (2011).
• 34. Wang et al., Biochem J 383:319-25 (2004).
• 35. Wiegand et al., N Engl J Med 363:1532-43 (2010).
• 36. Van et al., N Engl. J. Med. 360: 765-73 (2009).
• 37. Morin et al., Nature, doi: 10.1038/nature10351 (2011).
• 38. 1000 Genomes Project Consortium, Nature 457: 1061-73 (2010).

Example 1

Identification of Mutations

To comprehensively explore the genetic basis of OCCC tumors, we determined the sequences of the ˜18,000 protein-encoding genes listed in the RefSeq database in tumors from eight patients (Table S1). Because these tumors are composed of a mixture of neoplastic and non-neoplastic stromal cells, we purified the neoplastic cells using epithelial cell target antibodies attached to magnetic beads (Epi-CAM, Dynal) (see the Examples, below). Staining of the cells bound to the beads revealed that >90% of them were OCCC cells. This procedure thereby maximized the sensitivity of the sequencing analyses by eliminating most of the contaminating normal cells and therefore, the normal genomes from the sample. DNA from the purified cells, as well as from normal cells obtained from the blood or uninvolved tissues of the same patients, were used to generate libraries suitable for massively parallel sequencing by synthesis (see the Examples, below). Following capture of the coding sequences of the targeted genes with a SureSelect Enrichment System, the DNA was sequenced using an Illumina GAIIx platform. The average coverage of each base in the targeted regions was 84 fold and 92.7% of these bases were represented in at least 10 reads (Tables S2A-S2D).

Using stringent criteria for analysis of these data (see the Examples, below) we identified 268 somatic mutations in 253 genes among the eight tumors. The range of mutations per tumor was 13 to 125 alterations. The tumor with 125 mutations (OCC06PT) was from a patient with recurrent disease that had previously been treated with chemotherapy. Excluding OCC06PT, there was an average of 20 mutations per tumor (Tables S2A-S2D and S3). The mutation spectrum was enriched for C to T transitions at 5′-CG base pairs, similar to diose of other tumors whose exomes have been sequenced (10-14). Only four genes were mutated in more than one of the eight tumors studied: PIK3CA, KRAS, PPP2R1A (protein phosphatase 2, regulatory subunit A, alpha) and ARID1A (AT-rich interactive domain-containing protein 1A). The mutations in each of these four genes, and their somatic nature, were confirmed by Sanger sequencing of the DNA from the tumor and normal tissues of the corresponding patients (examples in FIG. 1). The sequences of these four genes were then determined in the tumor and normal tissues of an additional 34 OCCC cases using PCR amplification and Sanger sequencing with the primers listed in Table S4. In total, PIK3CA, KRAS, PPP2R1A, and ARID1A mutations were identified in 40%, 4.7%, 7.1%, and 57% of the 42 tumors, respectively (Table 1).

We extended the analysis of these four genes in seven OCCC cell lines that were derived from tumors independent of those described above. In these seven cell lines we identified nine ARID1A mutations in five cell lines, three with PPP2R1A mutations, one with a KRAS mutation and four with PIK3CA, mutations (Table S5).

The nature of the somatic mutations in tumors can often be used to classify them as oncogenes or tumor suppressor genes (15). In particular, all bona fide oncogenes are mutated recurrently (that is, at the same codon, or clustered in few codons, in different tumors), and the mutations are nearly always missense. In contrast, all bona fide tumor suppressor genes are mutated at a variety of positions throughout the coding region of the gene and the mutations often truncate the encoded protein through production of a stop codon by a base substitution, an out-of-frame insertion or deletion (“indel”) or a splice site mutation. Moreover, tumor suppressor gene mutations generally affect both alleles while mutations in oncogenes commonly affect only one allele.

The nature of the mutations we discovered in OCCCs could thereby be used to gain insights into their likely function. PIK3CA and KRAS are well-studied oncogenes, and the 19 mutations identified in OCCC were heterozygous and clustered; fourteen of the 17 mutations in PIK3CA were at codons 381, 542 to 546, or 1047, while both mutations in KRAS were at codon 12 (Table 1). The three mutations in PPP2R1A were similarly heterozygous and clustered, suggesting it functions, when mutated, as an oncogene (Table 1). In contrast, the 32 mutations in ARID1A were distributed throughout the coding region and all were predicted to truncate the protein through a base substitution resulting in a stop codon (9 mutations), or an out-of-frame insertion or deletions (23 mutations) (Table 1). In 10 of the 24 tumors with ARID1A mutations, both ARID1A alleles were affected through either a mutation in one allele and loss of heterozygosity of the other allele, or through two mutations which were presumably biallelic. Thus, ARID1A apparently functions as a tumor suppressor gene in OCCC, and the mutations likely inactivate the gene product.

The phosphatase PP2A is a trimer composed of a common heteromeric core enzyme composed of the PPP2CA catalytic subunit and the PPP2R1A regulatory subunit acting as a scaffold to coordinate the assembly of the catalytic subunit with a variety of other regulatory subunits. Somatic mutations in PPP2R1A are not listed in the Cancer Gene Census of the COSMIC database, although a few alterations in this gene have been previously reported (16). Functional studies have shown that PP2A is involved in the control of cell growth and division. Specifically, this protein is required for proper chromosome segregation through its interactions with Bub1 and Sgo1 (17). The two arginine residues that were somatically mutated in OCCC are highly conserved and reside within one of the HEAT domains of PPP2R1A that are involved in binding regulatory subunits.

The protein encoded by ARID1A, as its name implies, can bind to AT-rich DNA sequences and is a component of the ATP-dependent chromatin modeling complex SWI/SNF. The SWI/SNF chromatin-remodeling complex allows DNA to become accessible to repair enzymes and transcription factors, thereby influencing the epigenetic regulation of a number of genes, including genes that may play a role in cancer (18, 19). ARID1A is one of the two mutually exclusive ARID1 subunits of the SWI/SNF complex and is thought to provide specificity to this complex (18). Functional studies have implicated ARID1A in the anti-proliferative properties of the complex (20). No mutations of ARID1A are listed in the Cancer Gene Census of the COSMIC database, but chromosomal translocations that involve this gene have been identified in a breast and a lung cancer (21). Knock-down of ARID1A has been shown to make a leukemia cancer cell line resistant to Fas-mediated apoptosis (22).

The results of this study emphasize two themes in modern cancer genetics. The first is that specific tumor types are characterized by mutations in “communal cancer genes” like KRAS and PIK3CA but also by “restricted cancer genes” like PPP2R1A and ARID1 A. The communal cancer genes are involved in a variety of cancers and have been extensively studied. Restricted cancer genes have been shown to play a role in specific types of leukemias and sarcomas, mainly through translocations (e.g., ABL in CML, and EWS fused to an ETS family member in Ewing's sarcoma). With the advent of whole exome sequencing, we are beginning to see similar specificity with respect to point mutations (e.g., IDH1 in gliomas (14) and GNAQ in uveal melanomas (23)). The second theme is that mutations of chromatin-modifying genes are characteristic of certain tumor types. Recent examples include the JARID1C gene in renal cell cancers (24) and now ARID1A. Epigenetic changes in cancer cells are of great interest as they are thought to open new avenues of therapeutic intervention.

Genetic inactivation of ARID1A is likely to lead to epigenetic changes in cancer cells through modifications of chromatin proteins.

Example 2

Immunoaffinity Isolation of Ovarian Clear Cell Carcinoma Cells

Because the sensitivity of mutation detection in tumor tissues can be affected by the purity of the tumor DNA analyzed, we affinity purified tumor cells using Epi-CAM antibody coated beads from 26 freshly collected ovarian clear cell carcinoma samples. Briefly, tumors were minced to small fragments (1 mm×1 mm×1 mm) and digested with collagenase I (1 mg/ml in RPMI 1640 supplemented with 10% FBS) at 37° C. for 40 min. The cells were washed and incubated with 300-500 ml of Epi-CAM conjugated Dynal® (cat no: 162-03, Invitrogen) beads for 30 minutes at 2-8° C. Tumor cells that bound to the beads were separated from non-tumor cell population by a magnet and repeated sorting. Tumor cells (˜2×10⁶-10⁷ cells) were then collected and their genomic DNA purified using a Qiagen DNA purification kit.

Example 3

Preparation of Illumina Genomic DNA Library

DNA samples were obtained from patients after informed consent as described (1, 2). Genomic DNA libraries were prepared following Illumina's (Illumina, San Diego, Calif.) suggested protocol with the following modifications. (1) 3 micrograms (μg) of genomic DNA from tumor or normal cells in 100 microliters (pi) of TE was fragmented in a Covaris sonicator (Covaris, Woburn, Mass.) to a size of 100-500 bp. DNA was purified with a PCR purification kit (Cat #28104, Qiagen, Valencia, Calif.) and eluted in 35 μl of elution buffer included in the kit. (2) Purified, fragmented DNA was mixed with 40 μl of H₂O, 10 μl of 10×T4 ligase buffer with 10 mM ATP, 4 μl of 10 mM dNTP, 5 μl of T4 DNA polymerase, 1 μl of Klenow Polymerase, and 5 μl of T4 polynucleotide Kinase. All reagents used for this step and those described below were from New England Biolabs (NEB, Ipswich, Mass.) unless otherwise specified. The 100 μl end-repair mixture was incubated at 20° C. for 30 min, purified by a PCR purification kit (Cat #28104, Qiagen) and eluted with 32 μl of elution buffer (EB). (3) To A-tail, all 32 μl of end-repaired DNA was mixed with 5 μl of 10×Buffer (NEB buffer 2), 10 μl of 1 mM dATP and 3 μl of Klenow (exo). The 50 μl mixture was incubated at 37° C. for 30 min before DNA was purified with a MinElute PCR purification kit (Cat #28004, Qiagen). Purified DNA was eluted with 12.5 μl of 70° C. EB and obtained with 10 μl of EB. (4) For adaptor ligation, 10 μl of A-tailed DNA was mixed with 10 μl of PE-adaptor (Illumina), 25 μl of 2× Rapid ligase buffer and 5 μl of Rapid Ligase. The ligation mixture was incubated at room temperature (RT) or 20° C. for 15 min. (5) To purify adaptor-ligated DNA, 50 μl of ligation mixture from step (4) was mixed with 200 μl of NT buffer from NucleoSpin Extract II kit (cat#636972, Clontech, Mountain View, Calif.) and loaded into NucleoSpin column. The column was centrifuged at 14000 g in a desktop centrifuge for 1 min, washed once with 600 μl of wash buffer (NT3 from Clontech), and centrifuged again for 2 min to dry completely. DNA was eluted in 50 μl elution buffer included in the kit. (6) To obtain an amplified library, ten PCRs of 25 μl each were set up, each including 12 μl of H₂O, 5 μl of 5× Phusion HE buffer, 0.5 μl of a dNTP mix containing 10 mM of each dNTP, 1.25 μl of DMSO, 0.5 μl of Illumina PE primer #1, 0.5 μl of Illumina PE primer #2, 0.25 μl of Holslart Phusion polymerase, and 5 μl of the DNA from step (5). The PCR program used was: 98° C. 1 minute; 6 cycles of 98° C. for 20 seconds, 65° C. for 30 seconds, 72° C. for 30 seconds; and 72° C. for 5 min. To purify the PCR product, 250 μl PCR mixture (from the ten PCR reactions) was mixed with 500 μl NT buffer from a NucleoSpin Extract II kit and purified as described in step (5). Library DNA was eluted with 70° C. elution buffer and the DNA concentration was estimated by absorption at 260 nm.

Example 4

Exome and Targeted Subgenomic DNA Capture

Human exome capture was performed following a protocol from Agilent's SureSelect Paired-End Version 2.0 Human Exome Kit (Agilent, Santa Clara, Calif.) with the following modifications. (1) A hybridization mixture was prepared containing 25 μl of SureSelect Hyb #1, 1 μl of SureSelect Hyb #2, 10 μl of SureSelect Hyb #3, and 13 μl of SureSelect Hyb #4. (2) 3.4 μl (0.5 μg) of the PE-library DNA described above, 2.5 μl of SureSelect Block #1, 2.5 μl of SureSelect Block #2 and 0.6 μl of Block #3; was loaded into one well in a 384-well Diamond PCR plate (cat# AB-1111, Thermo-Scientific, Lafayette, Colo.), sealed with microAmp clear adhesive film (cat#4306311; AB1, Carlsbad, Calif.) and placed in GeneAmp PCR system 9700 thermocycler (Life Sciences Inc., Carlsbad Calif.) for 5 minutes at 95° C., then held at 65° C. (with the heated lid on). (3) 25-30 μl of hybridization buffer from step (1) was heated for at least 5 minutes at 65° C. in another sealed plate with heated lid on. (4) 5 μl of SureSelect Oligo Capture Library, 1 μl of nuclease-free water, and 1 μl of diluted RNase Block (prepared by diluting RNase Block 1: 1 with nuclease-free water) were mixed and heated at 65° C. for 2 minutes in another sealed 384-well plate. (5) While keeping all reactions at 65° C. 13 μl of Hybridization Buffer from Step (3) was added to the 7 μl of the SureSelect Capture Library Mix from Step (4) and then the entire contents (9 μl) of the library from Step (2). The mixture was slowly pipetted up and down 8 to 10 times. (6) The 384-well plate was sealed tightly and the hybridization mix tine was incubated for 24 hours at 65° C. with a heated lid.

After hybridization, five steps were performed to recover and amplify captured DNA library: (1) Magnetic beads for recovering captured DNA: 50 μl of Dynal M-280 Streptavidin magnetic beads (Cat #112-05D, Invitrogen) was placed in a 1.5 ml microfuge tube and vigorously resuspended on a vortex mixer. Beads were washed three times by adding 200 μl SureSelect Binding buffer, mixed on a vortex for five seconds, then removing and discarding supernatant after placing the tubes in a Dynal magnetic separator. After the third wash, beads were resuspended in 200 μl of SureSelect Binding buffer. (2) To bind captured DNA, the entire hybridization mixture described above (29 μl) was transferred directly from the thermocycler to the bead solution and mixed gently; the hybridization mix/bead solution was rotated for 30 minutes at room temperature. (3) To wash the beads, the supernatant was removed from beads after applying a Dynal magnetic separator and the beads was resuspended in 500 μl SureSelect Wash Buffer #1 by mixing on vortex mixer for 5 seconds and incubated for 15 minutes at room temperature. Wash Buffer#1 was then removed from beads after magnetic separation. The beads were further washed three times, each with 500 μl pre-warmed SureSelect Wash Buffer #2 after incubation at 65° C. for 10 minutes. After the final wash, SureSelect Wash Buffer #2 was completely removed. (4) To elute captured DNA, the beads were suspended in 50 μl SureSelect Elution Buffer, vortex-mixed and incubated for 10 minutes at room temperature. The supernatant was removed after magnetic separation, collected in a new 1.5 ml microcentrifuge tube, and mixed with 50 μl of SureSelect Neutralization Buffer. DNA was purified with a Qiagen MinElute column and eluted in 17 μl of 70° C. EB to obtain 15 μl of captured DNA library. (5) The captured DNA library was amplified in the following way: 15 PCR reactions each containing 9.5 μl of H₂O, 3 μl of 5× Phusion HF buffer, 0.3 μl of 10 mM dNTP, 0.75 μl of DMSO, 0.15 μl of Illumine PE primer #1, 0.15 μl of Illumina PE primer #2, 0.15 μl of Hotstart Phusion polymerase, and 1 μl of captured exome library were set up. The PCR program used was: 98° C. for 30 seconds; 14 cycles of 98° C. for 10 seconds, 65° C. for 30 seconds, 72° C. for 30 seconds; and 72° C. for 5 min. To purify PCR products, 225 μl PCR mixture (from 15 PCR reactions) was mixed with 450 μl NT buffer from NucleoSpin Extract II kit and purified as described above. The final library DNA was eluted with 30 μl of 70° C. elution buffer and DNA concentration was estimated by OD260 measurement.

Example 5

Somatic Mutation Identification by Illumina GAIIx Sequencing and Sanger Sequencing

All captured DNA libraries were sequenced with Illumina GAIIx Genome Analyzer, yielding 75 base pairs from the final library fragments. All sequencing reads were analyzed and aligned to human genome hg18 with the Eland algorithm of CASAVA 1.6 software (Illumina). A mismatched base was identified as a mutation only when (i) it was identified by more than four distinct tags; (ii) the number of distinct tags containing a particular mismatched base was at least 20% of the total distinct tags; and (iii) it was not present in >0.5% of the tags in the matched normal sample.

All somatic mutations identified by the first round of exome sequencing were subjected to conventional Sanger sequencing. PCR amplification and sequencing were performed following protocols described previously (3) using the primers listed in Table S4. SNP search databases included ncbi.nlm.nih.gov/projects/SNP/ and /browser.1000genomes.org/index.html.

Example 6

Evaluation of Genes in Additional Tumors and Matched Normal Controls.

For the ARID1A, PPP2R1A, PIK3CA, and KRAS genes, the coding region was sequenced in a series of additional ovarian clear cell carcinomas and matched controls. PCR and Sanger sequencing were performed as described above using the primers listed in Table S4.

Example 7

Occurrence of Somatic Mutations in AR11A in Other Tumor Types

The protein encoded by ARID1A is a key component of the highly conserved SWI-SNF chromatin remodeling complex that uses ATP-dependent helicase activities to allow access of transcriptional activators and repressors to DNA (Wang et al, 2004). The protein therefore appears to be involved in regulating processes including DNA repair, differentiation and development (Weissman et al, 2009). Functional studies by Nagl et al (2007) have demonstrated that the SW1-SNF complex suppresses proliferation. The ARID1A encoded protein, BAF250a, is one of two mutually exclusive ARID1 subunits. BAF250a has a DNA-binding domain that specifically binds to AT-rich DNA sequences and is thought to confer specificity to the complex (Wu et al, 2009).

Passenger mutations are best defined as those which do not confer a selective growth advantage to the cells in which they occur, while driver mutations are those which do confer a growth advantage. It is often difficult to distinguish driver mutations from passenger mutations when the mutations occur at low frequency. One of the best examples of this challenge is provided by IDH1 mutations. A single mutation of IDH1, R132H, was discovered in a whole exomic screen of 11 colorectal cancers (CRCs) (Sjoblom et al, 2006). This mutation was not identified in more than 200 additional colorectal cancer samples and was presumed to be a passenger mutation. However, frequent IDH1 mutations at the identical residue were found when brain tumors, such as lower grade astrocytomas and oligodendrogliomas were evaluated (Parsons et al, 2008; Yan et al, 2009). Thus the IDH1 mutation in that original CRC in retrospect was undoubtedly a driver.

This example illustrates that once a genetic alteration is identified as a driver in one tumor type, infrequent mutations of the same type in the same gene in other tumors can be more reliably interpreted. Given that it is now known that ARID1A is a bona fide tumor suppressor gene in OCCC, we applied this principle to the evaluation of ARID1A mutations in other tumor types. As described below, we studied more than 700 different neoplasms of seven different types using Sanger sequencing to determine the contribution of ARID1A alterations to tumorigenesis in general.

Samples

A total of 763 neoplasms subdivided into 119 pancreas (2 mutations among 24 samples were previously reported (Jones et al, 2008), 114 breast (0 mutations among 11 samples previously studied (Wood et al, 2007), 36 lung, 104 gastric, 34 glioblastoma (0 mutations among 22 samples previously studied) (Parsons et al, 2008), 125 medulloblastoma (1 mutation among 110 samples was previously reported) (Parsons et al, 2011), 119 colon, 23 prostate and 89 leukemias were obtained according to appropriate IRB protocols. Tumor DNA was extracted as previously described (Sjoblom et al, 2006). Of the 763 neoplasms, 103 were cell lines and the remainder were primary tumors or xenografts. As we considered only truncating mutations as drivers, and because truncating mutations of ARID1A have never been observed in the human germline (Jones et al, 2010; Wiegand et al, 2010; dbSNP (http://www.ncbi.nlm.nih.gov/projects/SNP); 1000 Genomes Consortium, 2010), we considered any truncating mutation to be somatic in origin. The somatic nature of the truncating mutations was confirmed in 100% of the cases in which matched normal DNA was available (n=17).

Amplification

The coding regions of ARID1A (CCDS285.1; NM_006015.4; OMIM603024) were amplified by the polymerase chain reaction in 5 μl reactions containing 1×PCR Buffer (67 mM Tris-HCl, pH 8.8, 6.7 mM MgCl₂, 16.6 mM NH₄SO₄, 10 mM 2-mercaptoethanol), 1 mM dNTPs (Invitrogen, San Diego, Calif.), 1 μM forward and 1 μM reverse primers, 6% DMSO, 2 mM ATP, 0.25 U Platinum Taq (Invitrogen, San Diego, Calif.) and 3 ng DNA. The 34 pairs of primer sequences used were reported in Jones et al, 2010. PCR cycling conditions were as follows: 94° C. for 2 min; three cycles of 94° C. for 15 s, 64° C. for 30 s, 70° C. for 30 s; three cycles of 94° C. for 15 s, 61° C. for 30 s, 70° C. for 30 s; three cycles of 94° C. for 15 s, 58° C. for 30 s, 70° C. for 30 s; and 41 cycles of 94° C. for 15 s, 57° C. for 30 s, 70° C. for 30 s, followed by 70° C. for 5 min.

Sequencing

Sequencing was carried out as described in Sjoblom et al. In brief, PCR products were purified using AMPure (Agencourt Biosciences, Beverly, Mass.) and sequencing was carried out with Big Dye Terminator Kit v.3.1 (Applied Biosystems, Foster City, Calif.). One PCR primer of each pair was tagged with an M13F sequence (5′-GTAAAACGACGGCCAGT; SEQ ID NO:158) to allow Sanger sequencing with this universal primer. Sequencing reactions were purified using the CleanSEQ kit (Agencourt Biosciences, Beverly, Mass.) and run on ABI PRISM 3730 machines (Applied Biosystems, Foster City, Calif.). Mutation surveyor software (SoftGenetics, State College, Pa.) was used to visually analyze sequencing traces for mutations and all potential variants were confirmed by an independent PCR and sequencing reaction.

Microsatellite Instability Testing

Microsatellite instability was detected using the MSI Analysis System (Promega, Madison, Wis.), which contains 5 mononucleotide repeats (BAT-25, BAT-26, NR-21, NR-24 and MONO-27) and 2 pentanucleotide repeat loci, per manufacturer's instructions. Following amplification, the fluorescent PCR products were sized on an Applied Biosystems 3130 capillary electrophoresis instrument (Invitrogen, Calsbad, Calif.). Tumor samples were designated as: MSI-high if two or more mononucleotides varied in length compared to the germline DNA, MSI-low if only one locus varied, and microsatellite stable (MSS) if there was no variation compared to the germline. Pentanucleotide loci confirmed identity in all cases where normal DNA was available. For samples lacking normal DNA, tumor microsatellite length was interpreted relative to population length of these generally monomorphic alleles.

Results

Somatic mutations were identified in 43 of the 763 neoplasms studied (6%) (Table 2). Eight neoplasms contained two or three (1 case) different mutations, presumably on different alleles, so the total number of mutations was fifty-two. A relatively high frequency of mutations was observed in neoplasms of the colon (10%; 12/119), stomach (10%; 10/104), and pancreas (8%; 10/119). Though only a small number of prostate tumors was available for study, we identified 2 carcinomas with mutations among the 23 studied. Mutations were observed in three of 125 (2%) medulloblastomas, in four of 114 (4%) breast cancers, and in two of 36 (6%) lung carcinomas (Table 2; FIG. 2). No mutations were observed among 34 glioblastomas or 89 leukemias tested.

As expected for inactivating mutations of a tumor suppressor gene, the mutations were distributed throughout the gene and included nonsense variants, out of frame and in-frame small insertions and deletions, as well as a small number (three) of missense changes. Mutations were most commonly observed in a 7 base G tract around position g.chr1:26978524 (c.5548) where there were six single base pair deletions and three duplications among gastric, colon, prostate and pancreas carcinomas. This G tract is the longest mononucleotide repeat in the coding region and the probability of slippage at mononucleotide repeats clearly increases with run length (Markowitz et al, 1995; Eshleman et al, 1996). Thirty-eight of the 43 samples with somatic mutations were available for microsatellite instability (MSI) testing. Twelve tumors (6 colon, 5 gastric and 1 prostate) were shown to be MSI high, and all carried mutations at mononucleotide tracts in the ARID1A gene (Table 2). It is therefore possible that ARID1A, like TGFβRII or BAX, is associated with microsatellite instability and that the homopolymeric repeat frameshifts may result from defects in mismatch repair (Markowitz et al, 1995; Rampino et al 1997). Though the interpretation of mutations in mismatch repair deficient tumors is challenging (Kern, 2002), the fact that 40% of the colorectal cancers with ARID1A mutations did not have MSI leaves little doubt that ARID1A plays a role in this tumor type.

The identification of mutations in ARID1A in several different types of cancer indicates that this gene has a wider role in human tumorigenesis than previously appreciated. In addition, ARID1A appears to be frequently mutated in gastrointestinal tumors displaying high levels of microsatellite instability. Mutations in other members of the SWI-SNF chromatin remodeling complex have also been reported. For example, truncating mutations in SMARCA4/BRG1 were identified in three pancreatic cancers, in a medulloblastoma, and in several lung cancers (Jones et al, 2008; Parsons et al, 2011; Medina et al, 2008). More recently, 41% of renal cancers have been shown to have truncating mutations in the SWI-SNF chromatin remodeling complex gene, PBRM1 (Varela et al, 2011). In addition, a pattern of somatic mutation of genes involved more generally in chromatin remodeling is starting to appear. MLL3 appears to be involved in a small number of colon and pancreatic cancers and medulloblastomas (Wood et al, 2007; Jones et al, 2009; Parsons et al, 2011); MLL2 is mutated in 14% of medulloblastomas and a large fraction of non-Hodgkin's lymphomas (Parsons et al. 2011; Morin et al. 2011) and JARID1C is genetically altered in a small proportion of kidney cancers (Dalgliesh et al, 2010). These data collectively link genetic alterations to epigenetic changes and pave the way for a better understanding of both.

ADDITIONAL REFERENCES

• S1. M. D. Fallin et al., Am J Hum Genet 73, 601 (2003).
• S2. M. D. Fallin et al., Am J Hum Genet 77, 918 (2005).
• S3. T. Sjoblom et al., Science 314, 268 (2006).

TABLE 1
Mutations in ARID14, KRAS, PIK3CA and PPP2R1A in Ovarian Clear Cell Carcinomas
					Amino
		Transcript			acid	Mutation
Sample	Gene	Accession	Nucleotide (genornic)*	Nucleotide (cDNA)	(protein)	type
OCC01PT	ARID1A	CCDS285.1	g.chr1: 26972561_26972562insA	c.3854_3855insA	fs	Indel
OCC02PT	ARID1A	CCDS285.1	g.chr1: 26896034C > 7	c.553C > T	p.Q185X	Nonsense
OCC02PT	ARID1A	CCDS285.1	g.chr1: 26978879-26978880dupGT	c.903_904dupGT	fs	Indel
OCC03PT	ARID1A	CCDS285.1	g.chr1: 26972009_26972034del	c.3659_3684delTGATGGGGCG	fs	Indel
			GCGCATGTCCTATGAGCCA (hom)	CATGTCCTGATGGGT
			(SEQ ID NO: 7)	ATGAGCCA (SEQ ID NO: 7)
OCC07PT	ARID1A	CCDS285.1	g.chr1: 26896066C > A	c.585C > A	p.Y195X	Nonsense
OCC08PT	ARID1A	CCDS285.1	g.chr1: 26970389delC	c.3391delC	fs	Indel
OCC10PT	ARID1A	CCDS285.1	g.chr1: 26972790_26972792dupGCA	c.4001_4002dupGCA (hom)	fs	Indel
			(hom)
OCC10PT	ARID1A	CCDS285.1	g.chr1: 26979804_26979805delTG	c.6828_6829delTG (hom)	fs	Indel
			(hom)
OCC11PT	ARID1A	CCDS285.1	g.chr1: 26930334_26930335insC	c.1455_1466insCCTAC	fs	Indel
			CTAC
OCC13PT	ARID1A	CCDS285.1	g.chr1: 26974233_26974234insTGGC	c.4926_4927insTGGC	fs	Indel
OCC14PT	ARID1A	CCDS285.1	g.chr1: 26972886_26972887_delTT	c.4011_4012delTT (hom)	fs	Indel
			(hom)
OCC15PT	ARID1A	CCDS285.1	g.chr1: 26973940G > A	c.4635G > A	p.W1545X	Nonsense
OCC15PT	ARID1A	CCDS285.1	g.chr1: 26978178T > A	c.5202T > A	p.Y1734X	Nonsense
OCC16PT	ARID1A	CCDS285.1	g.chr1: 26895967_26895973delCGC	c.486_492delCGCCGCC	fs	Indel
			CGCC (hom)	(hom)
OCC18PT	ARID1A	CCDS285.1	g.chr1: 26971925delA	c.3575delA	fs	Indel
OCC20PT	ARID1A	CCDS285.1	g.chr1: 26970221delG	c.3223delG	fs	Indel
OCC22PT	ARID1A	CCDS285.1	g.chr1: 26979694dupG	c.6718dupG	fs	Indel
OCC23PT	ARID1A	CCDS285.1	g.chr1: 26896379_2689637980_ins	c.898_899insCGTC	fs	Indel
			CGTC
OCC23PT	ARID1A	CCDS285.1	g.chr1: 26979686_26979687insT	c.6710_6711insT	fs	Ind&
OCC24PT	ARID1A	CCDS285.1	g.chr1: 26930542C > T	c.1663C > T	p.Q555X	Nonsense
OCC27PT	ARID1A	CCDS285.1	g.chr1: 26896263_26896272delCGT	c.782_791delCGTCGTCTTC	fs	Indel
			CGTCTTC (SEQ ID NO: 8)	(SEQ ID NO: 8)
OCC27PT	ARID1A	CCDS285.1	g.chr1: 26971984_26971994delCA	c.3634_3644delCAGCCC	fs	Indel
			GCCCAGTAT (SEQ ID NO: 9)	AGTAT (SEQ ID NO: 9)
OCC30PT	ARID1A	CCDS285.1	g.chr1: 26931823C > T	c.1873C > T	p.Q625X	Nonsense
OCC32PT	ARID1A	CCDS285.1	g.chr1: 26960135C > T	c.2122C > T	p.Q708X	Nonsense
OCC34PT	ARID1A	CCDS285.1	g.chr1: 26931754G > T	c.1804G > T	p.E602X	Nonsense
OCC34PT	ARID1A	CCDS285.1	g.chr1: 26979678delT	c.6702delT	fs	Indel
OCC36PT	ARID1A	CCDS285.1	g.chr1: 26928932T > G	c.1341T > G	p.Y447X	Nonsense
OCC36PT	ARID1A	CCDS285.1	g.chr1: 26971613delC	c.3442delC	fs	Indel
OCC39PT	ARID1A	CCDS285.1	g.chr1: 26896364dupC	c.883dupC	fs	Indel
OCC39PT	ARID1A	CCDS285.1	g.chr1: 26965434delC	c.2868delC	fs	Indel
OCC41PT	ARID1A	CCDS285.1	g.chr1: 26931831delT	c.1881delT	fs	Indel
OCC42PT	ARID1A	CCDS285.1	g.chr1: 26960479_26960488delCG	c.2179_2188delCGGCC	fs	Indel
			GCCACCCA (SEQ ID NO: 10)	ACCCA (SEQ ID NO: 10)
OCC04PT	KRAS	CCDS8703.1	g.chr12: 25289551C > T	c.35G > A	p.G12D	Missense
OCC05PT	KRAS	CCDS8703.1	g.chr12: 25289551C > G	c.35G > C	p.G12A	Missense
OCC01PT	PIK3CA	CCDS43171.1	g.chr3: 180418788C > A	c.1636C > A	p.0546K	Missense
OCC02PT	PIK3CA	CCDS43171.1	g.chr3: 180418776G > A	c.1624G > A	p.E542K	Missense
OCC06PT	PIK3CA	CCDS43171.1	g.chr3: 180418785G > A	c.1633G > A	p.E545K	Missense
OCC08PT	PIK3CA	CCDS43171.1	g.chr3: 180418785G > A	c.1633G > A	p.E545K	Missense
OCC09PT	PIK3CA	CCDS43171.1	g.chr3: 180434779A > T	c.31404 > T	p.H1047R	Missense
OCC10PT	PIK3CA	CCDS43171.1	g.chr3: 180434779A > G	c.3140A > G	p.H1047R	Missense
OCC11PT	PfK3CA	CCDS43171.1	g.chr3: 180418777A > T	c.1625A > T	p.E542V	Missense
OCC13PT	PIK3CA	CCDS43171.1	g.chr3: 180434779A > G	c.31404 > G	p.H1047R	Missense
OCC15PT	PIK3CA	CCDS43171.1	g.chr3: 180410152C > G	c.1221C > G	p.C407W	Missense
OCC20PT	PfK3CA	CCDS43171.1	g.chr3: 180434779A > G	c.3140A > G	p.H1047R	Missense
OCC22PT	PIK3CA	CCDS43171.1	g.chr3: 180434779A > G	c.3140A > G	p.H1047R	Missense
OCC23PT	PIK3CA	CCDS43171.1	g.chr3: 180399648_180399649ins	c.341_342insCCTCAA	fs	Indel
			CCTCAA
OCC27PT	PIK3CA	CCDS43171.1	g.chr3: 180399638A > G	c.331A > G	p.K111E	Missense
OCC30PT	PIK3CA	CCDS43171.1	g.chr3: 180434779A > G	c.3140A > G	p.H1047R	Missense
OCC35PT	PIK3C4	CCDS43171.1	g.chr3: 180418776G > A	c.1624G > A	p.E542K	Missense
OCC36PT	PIK3C4	CCDS43171.1	g.chr3: 180418785G > A	c.16336 > A	p.E545K	Missense
OCC42PT	PIK3CA	CCDS43171.1	g.chr3: 180434779A > G	c.3140A > G	p.H1047R	Missense
OCC05PT	PPP2R1A	CCDS12849.1	g.chr19: 57407794C > G	c.547C > G	p.R183G	Missense
OCC07PT	PPP2R1A	CCDS12849.1	g.chr19: 57407794C > T	c.547C > T	p.R183W	Missense
OCC36PT	PPP2R1A	CCDS12849.1	g.chr19: 57407791C > T	c.544C > T	p.R182W	Missense
*Coordinates refer to the human reference genome hg18 release (NCBI 36.1, March 2006).

TABLE S1
Characteristics of ovarian clear cell carcinoma samples
	Patient
	age	Tissue
Sample	(years)	derivation	Stage	Sample type	Screen*
OCC01PT	39	Primary tumor	IV	Immunopurified	Discovery	ARID1A	PPP2R1A	PIK3CA	KRAS
						Mutation	Mutation	Mutation	Mutation
OCC02PT	47	Primary tumor	IIIC	Immunopurified	Discovery	Y	N	Y	N
OCC03PT	58	Primary tumor	IC	Immunopurified	Discovery	Y	N	Y	N
OCC04PT	32	Primary tumor	IV	Immunopurified	Discovery	Y	N	N	N
OCC05PT	55	Primary tumor	IC	Immunopurified	Discovery	N	N	N	Y
OCC06PT	46	Recurrent	na**	Immunopurified	Discovery	N	Y	N	Y
		tumor$
OCC07PT	52	Primary tumor	IIIC	Immunopurified	Discovery	N	N	Y	N
OCC08PT	53	Primary tumor	IC	Immunopurified	Discovery	Y	Y	N	N
OCC09PT	38	Primary tumor	IC	Immunopurified	Validation	Y	N	Y	N
OCC10PT	47	Primary tumor	IA	Immunopurified	Validation	N	N	Y	N
OCC11PT	53	Primary tumor	IIC	Immunopurified	Validation	Y	N	Y	N
OCC12PT	56	Primary tumor	IV	Bulk tumor, >80%	Validation	Y	N	Y	N
				tumor cells
OCC13PT	49	Recurrent	na	Immunopurified	Validation	N	N	N	N
		tumor
OCC14PT	46	Primary tumor	IIIC	Immunopurified	Validation	Y	N	Y	N
OCC15PT	54	Primary tumor	IIIC	Immunopurified	Validation	Y	N	N	N
OCC16PT	82	Primary tumor	IIB	Immunopurified	Validation	Y	N	Y	N
OCC17PT	56	Primary tumor	IA	Bulk tumor, >80%	Validation	Y	N	N	N
				tumor cells
OCC18PT	63	Primary tumor	IA	Bulk tumor, >80%	Validation	N	N	N	N
				tumor cells
OCC19PT	45	Primary tumor	IC	Bulk tumor, >80%	Validation	Y	N	N	N
				tumor cells
OCC20PT	62	Primary tumor	IC	Immunopurified	Validation	N	N	N	N
OCC21PT	53	Primary tumor	IC	Bulk tumor, >80%	Validation	Y	N	Y	N
				tumor cells
OCC22PT	38	Primary tumor	IC	Bulk tumor, >70%	Validation	N	N	N	N
				tumor cells
OCC23PT	40	Primary tumor	IC	Bulk tumor, >70%	Validation	Y	N	Y	N
				tumor cells
OCC24PT	50	Primary tumor	IC	Bulk tumor, >70%	Validation	Y	N	Y	N
				tumor cells
OCC25PT	52	Primary tumor	IC	Bulk tumor, >70%	Validation	Y	N	N	N
				tumor cells
OCC26PT	47	Primary tumor	IC	Bulk tumor, >70%	Validation	N	N	N	N
				tumor cells
OCC27PT	51	Primary tumor	IIIC	Bulk tumor, >70%	Validation	N	N	N	N
				tumor cells
OCC28PT	62	Primary tumor	IC	Bulk tumor, >70%	Validation	Y	N	Y	N
				tumor cells
OCC29PT	60	Primary tumor	IV	Immunopurified	Validation	N	N	N	N
OCC30PT	53	Primary tumor	IC	Immunopurified	Validation	N	N	N	N
OCC31PT	52	Primary tumor	IC	Immunopurified	Validation	Y	N	Y	N
OCC32PT	42	Primary tumor	IC	Immunopurified	Validation	N	N	N	N
OCC33PT	55	Primary tumor	IIIC	Immunopurified	Validation	Y	N	N	N
OCC34PT	47	Recurrent	na	Immunopurified	Validation	N	N	N	N
		tumor
OCC35PT	46	Primary tumor	IC	Immunopurified	Validation	Y	N	N	N
OCC36PT	37	Primary tumor	IC	Immunopurified	Validation	N	N	Y	N
OCC37PT	57	Primary tumor	IC	Immunopurified	Validation	Y	Y	Y	N
OCC38PT	53	Primary tumor	IC	Immunopurified	Validation	N	N	N	N
OCC39PT	70	Primary tumor	IIA	Bulk tumor, >70%	Validation	N	N	N	N
				tumor cells
OCC40PT	47	Primary tumor	IC	Bulk tumor, >70%	Validation	Y	N	N	N
				tumor cells
OCC41PT	57	Primary tumor	IC	Bulk tumor, >70%	Validation	N	N	N	N
				tumor cells
OCC42PT	51	Primary tumor	IIIC	Bulk tumor, >70%	Validation	Y	N	N	N
				tumor cells
*Discovery: the eight samples used to capture and sequence all the ~18,000 genes.
Validation: additional samples used to determine the sequence of PIK3CA, KRAS, PPP21R1A, and ARID1A by Sanger sequencing.
$Sample from patient with recurrent tumor previously treated with 3 cycles of cisplatin and cyclophosphamide.
**na indicates not available.

	TABLE S2A
	OCC01	OCC02
	Average	Normal	Tumor	Normal	Tumor
Bases in target region	37,806,033	37,806,033	37,806,033	37,806,033	37,806,033
Bases sequenced (after quality filtering)	6,511,999,219	5,869,322,400	6,039,432,975	7,743,998,175	5,887,057,800
Bases mapped to genome	5,061,811,983	4,697,337,900	4,752,944,850	6,092,898,975	4,526,013,900
Bases mapped to targeted region	3,181,949,119	2,951,410,606	2,905,106,291	3,938,277,117	2,787,699,744
Average # of reads per targeted base	84	78.1	76.8	104.2	73.7
Targeted bases with at least 10 reads (%)	92.7%	93.5%	91.7%	94.5%	91.7%
Known SNPs identified in targeted region	20,037	19,703	19,519	19,800	19,504
Somatic mutations identified in targeted region	20 (excluding OCC06)	20	19

	TABLE S2B
	OCC03	OCC04
	Average	Normal	Tumor	Normal	Tumor
Bases in target region	37,806,033	37,806,033	37,806,033	37,806,033	37,806,033
Bases sequenced (after quality filtering)	6,511,999,219	4,927,758,075	5,350,539,525	5,481,781,050	4,796,809,725
Bases mapped to genome	5,061,811,983	3,560,079,675	4,074,495,075	4,294,296,450	3,835,246,875
Bases mapped to targeted region	3,181,949,119	2,372,688,851	2,347,615,071	2,789,190,234	2,415,146,056
Average # of reads per targeted base	84	62.8	62.1	73.8	63.9
Targeted bases with at least 10 reads (%)	92.7%	89.6%	89.4%	93.1%	90.7%
Known SNPs identified in targeted region	20,037	19,551	18,998	19,524	19,266
Somatic mutations identified in targeted region	20 (excluding OCC06)	23	13

	TABLE S2C
	OCC05	OCC06
	Average	Normal	Tumor	Normal	Tumor
Bases in target region	37,806,033	37,806,033	37,806,033	37,806,033	37,806,033
Bases sequenced (after quality filtering)	6,511,999,219	8,072,903,325	6,098,389,650	8,784,608,625	10,792,972,200
Bases mapped to genome	5,061,811,983	6,609,351,825	4,836,418,575	7,064,921,250	7,611,497,100
Bases mapped to targeted region	3,181,949,119	4,205,386,181	2,944,517,632	4,405,093,249	4,716,682,489
Average # of reads per targeted base	84	111.2	77.9	116.5	124.8
Targeted bases with at least 10 reads (%)	92.7%	94.0%	92.8%	95.1%	93.5%
Known SNPs identified in targeted region	20,037	21,391	21,240	18,907	18,632
Somatic mutations identified in targeted region	20 (excluding OCC06)	24	125

	TABLE S2D
	OCC07	OCC08
	Average	Normal	Tumor	Normal	Tumor
Bases in target region	37,806,033	37,806,033	37,806,033	37,806,033	37,806,033
Bases sequenced (after quality filtering)	6,511,999,219	5,876,999,250	7,251,704,925	5,324,268,750	5,893,441,050
Bases mapped to genome	5,061,811,983	4,593,099,375	5,707,748,925	4,159,913,325	4,572,727,650
Bases mapped to targeted region	3,181,949,119	2,984,229,243	3,581,297,932	2,652,614,272	2,914,230,935
Average # of reads per targeted base	84	78.9	94.7	70.2	77.1
Targeted bases with at least 10 reads (%)	92.7%	93.0%	93.6%	93.1%	93.7%
Known SNPs identified in targeted region	20,037	22,946	18,765	24,318	18,523
Somatic mutations identified in targeted region	20 (excluding OCC06)	20	24

TABLE S3
Mutations identified in the discovery screen
Sample	Gene	Transcript Accession	Nucleotide (genomic)*	Nucleotide (cDNA)	Amino acid (protein)	Mutation type
OCC06PT	ABCC10	CCDS4896.1	g.chr6: 43523575T > G	c.3797T > G	p.F1266C	Missense
OCC06PT	ABCD4	CCDS9828.1	g.chr14: 73823213C > T	c.1696G > A	p.G566.S.	Missense
OCC06PT	ACADVL	CCDS11090.1	g.chr17: 7067740G > C	c.1236G > C	p.Q412H	Missense
OCC04PT	ADAM7	CCDS6045.1	g.chr8: 24414262G > A	c.2072G > A	p.R691H	Missense
OCC08PT	ADNP2	CCDS32853.1	g.chr18: 75994633C > T	c.346C > T	p.Q116X	Nonsense
OCC06PT	AFF4	CCDS4164.1	g.chr5: 132260486G > C	c.1735C > G	p.R579G	Missense
OCC01PT	AICDA	CCDS41747.1	g.chr12: 8648681G > A	c.532C > T	p.R178C	Missense
OCC08PT	AMPD1	CCDS876.1	g.chr1: 115017346delT	c.2154delA	fs	Indel
OCC06PT	ANKDD1A	CCDS10197.2	g.chr15: 63021732C > G	c.883C > G	p.L295V	Missense
OCC02PT	ARHGAP5	CCDS32062.1	g.chr14: 31.631490G > A	c.1864G > A	p.E622K	Missense
OCC01PT	ARID1A	CCDS285.1	g.chr1: 26972561_26972562insA	c.3854_3855insA	fs	Indel
OCC02PT	ARID1A	CCDS285.1	g.chr1: 26896034C > T	c.553C > T	p.Q185X	Nonsense
OCC02PT	ARID1A	CCDS285.1	g.chr1: 26978879-26978880dupGT	c.903_904dupGT	fs	Indel
OCC03PT	ARID1A	CCDS285.1	g.chr1: 26972009_26972034delTGA	c.3659_3684delTGATGGGGCGCATGICCT	fs	Indel
			TGGGGCGCATGTCCTATGAGCCA	ATGAGCCA (SEQ ID NO: 11)
			(hom) (SEQ ID NO: 11)
OCC07PT	ARID1A	CCDS285.1	g.chr1: 26896066C > A	c.585C > A	p.Y195X	Nonsense
OCC08PT	ARID1A	CCDS285.1	g.chr1: 26970389delC	c.3391delC	fs	Indel
OCC02PT	ARID1B	CCDS5251.1	g.chr6: 157570517dupC	c.6500dupC	fs	Indel
OCC06PT	ARPC2	CCDS2410.1	g.chr2: 218822398G > A	c.743G > A	p.R248Q	Missense
OCC06PT	ASB2	CCDS9915.1	g.chr14: 93487138C > G	c.696G > C	p.Q232H	Missense
OCC02PT	ATP4A	CCDS12467.1	g.chr19: 40737917C > T	c.2317G > A	p.V773M	Missense
OCC06PT	ATP6V0C	CCDS10470.1	g.chr16: 2509574G > A	c.295G > A	p.V99M	Missense
OCC06PT	B3GALTL	CCDS9341.1	g.chr13: 30687235C > T	c.118C > T	p.Q40X	Nonsense
OCC07PT	B4GALNT3	CCDS8504.1	g.chr12: 537114_537118delCAACA	c.2460_2464delCAACA	fs	Indel
OCC06PT	BCL11A	CCDS1862.1	g.chr2: 60542953C > G	c.598G > C	p.E200Q	Missense
OCC06PT	BMF	CCDS10052.1	g.chr15: 38185428delG	c.154delC	fs	Indel
OCC06PT	BZW2	CCDS5362.1	g.chr7: 16704324C > G	c.1096C > G	p.L366V	Missense
OCC06PT	C10orf90	CCDS31310.1	g.chr10: 1281831436 > A	c.616C > T	p.R206W	Missense
OCC08PT	C10orf91	CCDS7668.1	g.chr10: 134111295C > G	c.178C > G	p.Q60E	Missense
OCC03PT	C13orf35	CCDS9S26.1	g.chr13: 112381800G > T	c.106G > T	p.D36Y	Missense
OCC06PT	C14orf43	CCDS9819.1	g.chr14: 73255795G > C	c.3100C > G	p.Q1034E	Missense
OCC06PT	C16orf70	CCDS10828.1	g.chr16: 65731955C > T	c.836C > T	p.S279L	Missense
OCC06PT	C17orf61	CCDS11102.1	g.chr17: 7247227G > C	c.224C > G	p.T75R	Missense
OCC06PT	C1orf168	CCDS30729.1	g.chr1: 56989372C > G	c.1320G > C	p.M440I	Missense
OCC06PT	C2CD3	CCDS31636.1	g.chr11: 73481254C > G	c.3372G > C	p.Q1124H	Missense
OCC0PT	C2orf16	CCDS42666.1	g.chr2: 27654243G > A	c.1300G > A	p.V434I	Missense
OCC06PT	CC2D1B	CCDS30714.1	g.chr1: 52593147C > G	c.2310G > C	p.K770N	Missense
OCC06PT	CCT2	CCDS8991.1	g.chr12: 68267579G > T	c.172G > T	p.D58Y	Missense
OCC06PT	CCT8L1	ENST00000021776	g.chr7: 151774819C > A	c.1325C > A	p.A442D	Missense
OCC06PT	CD97	CCDS32929.1	g.chr19: 14374516G > T	c.1291G > T	p.E431X	Nonsense
OCC06PT	CDH11	CCDS10803.1	g.chr16: 63584411G > A	c.551C > T	p.S1841	Missense
OCC06PT	CDK19	CCDS5085.1	g.chr6: 111243029C > T	c.4G > A	p.D2N	Missense
OCC05PT	CELF5	CCDS12106.1	g.chr19: 3233451C > T	c.994C > T	p.P332S	Missense
OCC03PT	CELSR3	CCDS2775.1	g.chr3: 48660374G > A	c.7033C > T	p.R2345C	Missense
OCC03PT	CHD4	CCDS85.52.1	g.chr12: 6567814T > C	c.3376A > G	p.T1126A	Missense
OCC06PT	CHD5	CCDS57.1	g.chr1: 6110824C > G	c.37720 > C	p.D1258H	Missense
OCC06PT	CLCN1	CCDS5881.1	g.chr7: 142746776G > C	c.15220 > C	p.D508H	Missense
OCC08PT	CLEC4C	CCDS8583.1	g.chr12: 7785340T > C	c.179A > G	p.E60G	Missense
OCC04PT	COL22A1	CCDS6376.1	g.chr8: 139761041C > A	IVS39 + 1G > T	Splice site	Splice site
OCC04PT	CRMP1	CCDS33950.1	g.chr4: 5881160G > A	c.1760C > T	p.A587V	Missense
OCC06PT	CSMD2	CCDS380.1	g.chr1: 33844067A > G	c.6332T > C	p.L2111P	Missense
OCC03PT	CSMD3	CCDS6315.1	g.chr8: 113718308G > A	c.3629C > T	p.S1210L	Missense
OCC03PT	CSNK1D	CCDS11805.1	g.chr17: 77802635T > C	c.794A > G	p.D265G	Missense
OCC06PT	CYP1A1	CCDS10268.1	g.chr15: 72800116C > G	c.1306G > C	p.D436H	Missense
OCC03PT	CYP4F22	CCDS12331.1	g.chr19: 15509730G > A	c.597G > A	p.M199I	Missense
OCC05PT	DCAF12L1	CCDS14610.1	g.chrX: 1255131177 > A	c.1156A > T	p.R386X	Nonsense
OCC06PT	DDHD1	CCDS9714.1	g.chr14: 52610215C > 0	c.1390G > C	p.D464H	Missense
OCC07PT	DDX53	CCDS35214.1	g.chrX: 22929339G > A	c.1244G > A	p.R415H	Missense
OCC02PT	DIS3L2	CCDS42834.1	g.chr2: 232811498G > A	c.1216G > A	p.V406M	Missense
OCC05PT	DMRTB1	CCDS581.1	g.chr1: 53697826G > A	c.112G > A	p.E38K	Missense
OCC03PT	DNAH8	CCDS4838.1	g.chr6: 38971909G > A	c.8219G > A	p.R2740H	Missense
OCC05PT	DNAJC13	CCDS33857.1	g.chr3: 133703893C > T	c.4607C > T	p.T1536I	Missense
OCC06PT	DNAJC14	CCDS8894.1	g.chr12: 54507891G > C	c.819C > G	p.I273M	Missense
OCC03PT	DPP8	CCDS10207.1	g.chr15: 63526323G > C	c.2649C > G	p.Y883X	Nonsense
OCC06PT	DSC2	CCDS11892.1	g.chr18: 26903091G > T	c.2275C > A	p.Q759K	Missense
OCC03PT	DYRK1A	CCDS42925.1	g.chr21: 37799751C > T	c.1535C > T	p.S512L	Missense
OCC06PT	EIF5B	CCDS42721.1	g.chr2: 99347175G > A	c.1147G > A	p.E383K	Missense
OCC06PT	ELP2	CCDS11918.1	g.chr18: 31976873C > G	c.742C > G	p.Q248E	Missense
OCC05PT	EML3	CCDS8023.2	g.chr11: 62129695_62129698delGGTC	c.del1906-1909delGACC	fs	Indel
OCC08PT	EPHA1	CCDS5884.1	g.chr7: 142801541G > C	c.2370C > G	p.I790M	Missense
OCC05PT	ETV6	CCDS8643.1	g.chr12: 11796732C > T	c.115C > T	p.R39X	Nonsense
OCC06PT	EXOC3L2	CCDS12657.1	g.chr19: 50426910G > C	c.41C > G	p.S14C	Missense
OCC02PT	FAM13C	CCDS7255.1	g.chr10: 60699701G > A	c.767C > T	p.S256L	Missense
OCC06PT	FAM40A	CCDS30798.1	g.chr1: 110387874G > A	c.1159G > A	p.D387N	Missense
OCC01PT	FAM71B	CCDS4335.1	g.chr5: 156522716T > C	c.1138A > G	p.I380V	Missense
OCC01PT	FAT4	CCDS3732.2	g.chr4: 126631378A > G	c.13780A > G	p.I4594V	Missense
OCC06PT	F8XO34	CCDS32086.1	g.chr14: 54887408G > T	c.547G > T	p.G183C	Missense
OCC06PT	FILIP1	CCDS4984.1	g.chr6: 76081298G > C	c.970C > G	p.Q324E	Missense
OCC06PT	FLG2	CCDS30861.1	g.chr1: 150590126C > A	c.6760G > T	p.G2254C	Missense
OCC03PT	FNDC38	CCDS3217.1	g.chr3: 173578891C > T	c.3146C > T	p.T1049I	Missense
OCC06PT	FOLH1	CCDS7946.1	g.chr11: 49154047C > T	c.959G > A	p.R320K	Missense
OCC06PT	GADD45A	CCDS640.1	g.chr1: 67925936_67925937delCA	c.389_390delCA	fs	Indel
OCC02PT	GAL3ST3	CCDS8128.1	g.chr11: 65567327C > T	c.523G > A	p.V175I	Missense
OCC03PT	GALNT8	CCDS8533.1	g.chr12: 4724019G > A	c.752G > A	p.R251Q	Missense
OCC02PT	GARNL3	CCDS6869.1	g.chr9: 129159326G > A	c.1889G > A	p.C630Y	Missense
OCC01PT	GATA3	CCDS31143.1	g.chr10: 8155905G > T	c.1248G > T	p.M416I	Missense
OCC06PT	GBA2	CCDS6589.1	g.chr9: 35730929T > G	c.919A > C	p.N307H	Missense
OCC06PT	GCN1L1	CCDS41847.1	g.chr12: 119063135C > T	c.5905G > A	p.E1969K	Missense
OCC06PT	GFI1B	CCDS6957.1	g.chr9: 134856217G > A	c.952G > A	p.D318N	Missense
OCC02PT	GIMAP8	CCDS34777.1	g.chr7: 149805569G > A	c.1766G > A	p.R589H	Missense
OCC06PT	GOPC	CCDS5117.1	g.chr6: 118006855T > G	c.351A > C	p.K117N	Missense
OCC06PT	GPR22	CCDS5744.1	g.chr7: 106903043G > C	c.1302G > C	p.X434Y	Missense
OCC08PT	GPR3	CCDS303.1	g.chr1: 27593530C > A	c.641C > A	p.A214D	Missense
OCC06PT	GPRIN3	CCDS34030.1	g.chr4: 90389594C > G	c.691G > C	p.E231Q	Missense
OCC01PT	GPT	CCDS6430.1	g.chr8: 145702267G > A	c.901G > A	p.A301T	Missense
OCC01PT	GRN	CCDS11483.1	g.chr17: 39782410G > A	c.229G > A	p.V77I	Missense
OCC06PT	H3F3B	CCDS11729.1	g.chr17: 71286367G > C	c.315C > G	p.F105L	Missense
OCC05PT	HAO2	CCDS901.1	g.chr1: 119729197A > T	c.559A > T	p.K187X	Nonsense
OCC06PT	HDAC2	CCDS43493.1	g.chr6: 114384509C > G	c.607G > C	p.E203Q	Missense
OCC06PT	HEATR4	CCDS9815.1	g.chr14: 73059203A > C	c.266T > G	p.V89G	Missense
OCC07PT	HECTD1	CCDS41939.1	g.chr14: 30645942delA	c.6887delA	fs	Indel
OCC06PT	HIBADH	CCDS5414.1	g.chr7: 27655756G > C	c.113C > G	p.S38X	Nonsense
OCC06PT	HIST1H4B	CCDS4572.1	g.chr6: 26135340C > A	c.120G > T	p.R40S	Missense
OCC06PT	HIST1H4B	CCDS4572.1	g.chr6: 26135341C > A	c.119G > T	p.R40M	Missense
OCC08PT	HSP90B1	CCDS9094.1	g.chr12: 102851919G > A	c.467G > A	p.R156K	Missense
OCC05PT	HSPA14	CCDS7103.1	g.chr10: 14937857A > C	c.902A > C	p.E301A	Missense
OCC05PT	IGSF10	CCDS3160.1	g.chr3: 152647246delC	c.3213delG	fs	Indel
OCC01PT	IL1RAP	CCDS3298.1	g.chr3: 191804683A > T	c.137A > T	p.K46M	Missense
OCC06PT	ITGA1	CCDS3955.1	g.chr5: 52269009C > T	c.2986C > T	p.P996S	Missense
OCC06PT	ITGB2	CCDS13716.1	g.chr21: 45136197C > T	c.1367G > A	p.R456H	Missense
OCC06PT	KCNT2	CCDS1384.1	g.chr1: 194843995C > A	c.68G > T	p.G23V	Missense
OCC03PT	KCNV2	CCDS6447.1	g.chr9: 2707998G > A	c.259G > A	p.E87K	Missense
OCC06PT	KCTD3	CCDS1515.1	g.chr1: 213818978G > A	c.410G > A	p.R137H	Missense
OCC01PT	KIAA0247	CCDS9796.1	g.chr14: 69195186dupT	IVS1 + 2dupT	Splice site	Splice site
OCC06PT	KIAA0649	CCDS6988.1	g.chr9: 137516929A > C	c.752A > C	p.K251T	Missense
OCC07PT	KIAA1109	CCDS43267.1	g.chr4: 123387357C > T	c.5254C > T	p.H1752Y	Missense
OCC05PT	KIAA1539	CCDS6578.1	g.chr9: 35097703_35097704delAA	c.568_569delTT	fs	Indel
OCC06PT	KIAA1715	CCDS33332.1	g.chr2: 176520535C > G	c.625G > C	p.E209Q	Missense
OCC01PT	KLHL28	CCDS9680.1	g.chr14: 44484193C > T	c.689G > A	p.S230N	Missense
OCC04PT	KRAS	CCDS8703.1	g.chr12: 25289551C > T	c.35G > A	p.G12D	Missense
OCC05PT	KRAS	CCDS8703.1	g.chr12: 25289551C > G	c.35G > C	p.G12A	Missense
OCC01PT	LAMA5	CCDS33502.1	g.chr20: 60332924C > A	c.5611G > T	p.D1871Y	Missense
OCC07PT	LECT1	CCDS9437.1	g.chr13: 52175897C > T	c.839G > A	p.G280E	Missense
OCC06PT	LGALS4	CCDS12521.1	g.chr19: 43984294C > A	c.922G > T	p.D308Y	Missense
OCC06PT	LIFR	CCDS3927.1	g.chr5: 38566445_38566452dupCTCATTCT	c.55_62dupAGAATGT	fs	Indel
OCC05PT	LRP1B	CCDS2182.1	g.chr2: 141175367G > A	c.6320C > T	p.S2107F	Missense
OCC05PT	LRP1B	CCDS2182.1	g.chr2: 141175868A > T	c.6319T > A	p.S2107T	Missense
OCC06PT	LRRC7	CCDS645.1	g.chr1: 70277630G > A	c.3421G > A	p.D1141N	Missense
OCC08PT	LRRK2	CCDS31774.1	g.chr12: 38995283G > A	c.4741G > A	p.V1581I	Missense
OCC06PT	MARCH6	CCDS34135.1	g.chr5: 10447235G > A	c.808G > A	p.E270K	Missense
OCC03PT	MARK1	CCDS31029.2	g.chr1: 218892093G > A	c.1714G > A	p.G572S	Missense
OCC03PT	MARK3	CCDS41993.1	g.chr14: 103039093C > T	c.1966C > T	p.R656C	Missense
OCC08PT	MAS1	CCDS5272.1	g.chr6: 160248330C > T	c.353C > T	p.T118M	Missense
OCC02PT	MCF2L2	CCDS3243.1	g.chr3: 184408211C > T	c.2591G > A	p.R864Q	Missense
OCC06PT	MDGA2	CCDS41948.1	g.chr14: 46413127C > A	c.1570G > T	p.G524C	Missense
OCC06PT	MED13L	CCDS9177.1	g.chr12: 115159803G > T	c.163C > A	p.P55T	Missense
OCC08PT	MFSD5	CCDS8851.1	g.chr12: 51933584C > G	c.698C > G	p.S233X	Nonsense
OCC06PT	MLL3	CCDS5931.1	g.chr7: 151509027G > T	c.6851C > A	p.S2284X	Nonsense
OCC06PT	MLL3	CCDS5931.1	g.chr7: 151522533G > A	c.4432C > T	p.Q1478X	Nonsense
OCC05PT	MRI1	CCDS32923.1	g.chr19: 13740712A > G	c.799A > G	p.I267V	Missense
OCC06PT	MTO1	CCDS4979.1	g.chr6: 74246564C > T	c.1123C > T	p.Q375X	Nonsense
OCC06PT	MYH11	CCDS10565.1	g.chr16: 15777493C > T	c.832G > A	p.E278K	Missense
OCC03PT	MYO16	CCDS32008.1	g.chr13: 108502685C > A	c.2843C > A	p.S948X	Nonsense
OCC04PT	MYO1G	CCDS34629.1	g.chr7: 44971978G > A	c.2164C > T	p.R722W	Missense
OCC06PT	MYO3B	CCDS42773.1	g.chr2: 170764100_170764101delAA	c.139_140delAA	fs	Indel
OCC01PT	MYO5B	CCDS42436.1	g.chr18: 45660823G > A	c.3046C > T	p.R1016X	Nonsense
OCC06PT	MYST3	CCDS6124.1	g.chr8: 41919512C > G	c.2392G > C	p.E798Q	Missense
OCC07PT	NDRG2	CCDS9565.1	g.chr14: 20558829A > G	c.422T > C	p.I141T	Missense
OCC06PT	NDUFAF4	CCDS5037.1	g.chr6: 97445894C > T	c.335G > A	p.G112D	Missense
OCC06PT	NFKBIL2	CCDS34968.1	g.chr8: 145630246C > T	c.2833G > A	p.D945N	Missense
OCC06PT	NFKBIL2	CCDS34968.1	g.chr8: 145630291C > T	c.2788G > A	p.E930K	Missense
OCC06PT	NGRN	CCDS32329.1	g.chr15: 88615882G > C	c.734G > C	p.R245T	Missense
OCC06PT	NIPBL	CCDS3920.1	g.chr5: 37007894C > A	c.862C > A	p.P288T	Missense
OCC04PT	NLGN4X	CCDS14126.1	g.chrX: 5837139C > A	c.767G > T	p.G256V	Missense
OCC06PT	NLRP3	CCDS1632.1	g.chr1: 245654152C > T	c.784C > T	p.R262X	Nonsense
OCC06PT	NOS1	CCDS41842.1	g.chr12: 116142349C > T	c.4084G > A	p.D1362N	Missense
OCC06PT	NR1I2	CCDS2995.1	g.chr3: 121014470G > A	c.884G > A	p.S295N	Missense
OCC02PT	NR2F2	CCDS10375.1	g.chr15: 94681704T > C	c.1094T > C	p.L365P	Missense
OCC03PT	NR6A1	CCDS35137.1	g.chr9: 126326955C > G	c.1220G > C	p.S407T	Missense
OCC08PT	NUP98	CCDS7746.1	g.chr11: 3671072G > C	c.4277C > G	p.S1426C	Missense
OCC02PT	OR4D1	CCDS42365.1	g.chr17: 53587855dupT	c.342dupT	fs	Indel
OCC05PT	OR51I2	CCDS31383.1	g.chr11: 5431563G > A	c.269G > A	p.R90H	Missense
OCC05PT	OR52J3	CCDS31370.1	g.chr11: 5024450C > T	c.119C > T	p.A40V	Missense
OCC06PT	OR5D16	CCDS31512.1	g.chr11: 55363314C > T	c.511C > T	p.H171Y	Missense
OCC05PT	OR6C75	CCDS31820.1	g.chr12: 54045519C > T	c.358C > T	p.R120C	Missense
OCC05PT	OXCT1	CCDS3937.1	g.chr5: 41843189C > A	IVS8 + 1G > T	Splice site	Splice site
OCC06PT	PALMD	CCDS758.1	g.chr1: 99927932G > A	c.1528G > A	p.E510K	Missense
OCC07PT	PAPSS1	CCDS3676.1	g.chr4: 108794150G > A	c.1183C > T	p.Q395X	Nonsense
OCC04PT	PCDH10	CCDS34063.1	g.chr4: 134303647A > C	c.2863A > C	p.M955L	Missense
OCC06PT	PCDH17	CCDS31986.1	g.chr13: 57105042G > C	c.361G > C	p.E121Q	Missense
OCC04PT	PCDHA3	CCDS34248.1	g.chr5: 140162411C > T	c.1445C > T	p.A482V	Missense
OCC07PT	PCDHA7	CCDS34252.1	g.chr5: 140195657G > A	c.1505G > A	p.R502H	Missense
OCC07PT	PCDHA8	CCDS34253.1	g.chr5: 140202604C > T	c.1514C > T	p.S505L	Missense
OCC06PT	PCDHB7	CCDS4249.1	g.chr5: 140534794C > T	c.2194C > T	p.R732X	Nonsense
OCC01PT	PDE4DIP	CCDS30824.1	g.chr1: 143590779C > T	c.4028G > A	p.R1343Q	Missense
OCC06PT	PDE9A	CCDS13690.1	g.chr21: 43058674G > C	IVS15 + 1G > C	Splice site	Splice site
OCC05PT	PDZD7	CCDS31269.1	g.chr10: 102773205A > G	c.520T > C	p.F174L	Missense
OCC06PT	PEPD	CCDS42544.1	g.chr19: 38594443G > A	c.793C > T	p.R265X	Nonsense
OCC02PT	PFKM	CCDS8760.1	g.chr12: 46817867C > T	c.1033C > T	p.R345C	Missense
OCC05PT	PGM1	CCDS625.1	g.chr1: 63886821C > T	c.1190C > T	p.A397V	Missense
OCC06PT	PHF3	CCDS4966.1	g.chr6: 64480931G > C	c.5488G > C	p.G1830R	Missense
OCC06PT	PHLPP2	CCDS32479.1	g.chr16: 70270185C > T	c.1242G > A	p.M414I	Missense
OCC06PT	PIAS2	CCDS32824.1	g.chr18: 42649287G > T	c.1672C > A	p.P558T	Missense
OCC01PT	PIK3CA	CCDS43171.1	g.chr3: 180418788C > A	c.1636C > A	p.Q546K	Missense
OCC02PT	PIK3CA	CCDS43171.1	g.chr3: 180418776G > A	c.1624G > A	p.E542K	Missense
OCC06PT	PIK3CA	CCDS43171.1	g.chr3: 180418785G > A	c.1633G > A	p.E545K	Missense
OCC08PT	PIK3CA	CCDS43171.1	g.chr3: 180418785G > A	c.1633G > A	p.E545K	Missense
OCC06PT	PKD1L1	CCDS34633.1	g.chr7: 47835604G > A	c.6679C > T	p.R2227C	Missense
OCC06PT	PLD5	CCDS1621.1	g.chr1: 240343918T > G	c.691A > C	p.S231R	Missense
OCC08PT	PLEKHA6	CCDS1444.1	g.chr1: 202484579G > A	c.1817C > T	p.A606V	Missense
OCC06PT	PLIN2	CCDS6490.1	g.chr9: 19116246G > T	c.92C > A	p.S31X	Nonsense
OCC06PT	PLS1	CCDS3125.1	g.chr3: 143885798G > T	c.759G > T	p.L253F	Missense
OCC07PT	PMFBP1	CCDS32483.1	g.chr16: 70727871T > G	c.1180A > C	p.K394Q	Missense
OCC06PT	PMM1	CCDS14020.1	g.chr22: 40315716C > G	c.40G > C	p.V14L	Missense
OCC07PT	POLRMT	CCDS12036.1	g.chr19: 572222C > G	c.2476G > C	p.E826Q	Missense
OCC08PT	PPL	CCDS10526.1	g.chr16: 4875813C > G	c.2844G > C	p.E948D	Missense
OCC06PT	PPP1R12C	CCDS12916.1	g.chr19: 60315966C > T	c.331G > A	p.D111N	Missense
OCC05PT	PPP2R1A	CCDS12849.1	g.chr19: 57407794C > G	c.547C > G	p.R183G	Missense
OCC07PT	PPP2R1A	CCDS12849.1	g.chr19: 57407794C > T	c.547C > T	p.R183W	Missense
OCC07PT	PTPRM	CCDS11840.1	g.chr18: 7945226C > G	c.946C > G	p.R316G	Missense
OCC06PT	R3HDM2	CCDS8937.1	g.chr12: 55935044G > C	c.1693C > G	p.Q565E	Missense
OCC06PT	RAB8B	CCDS10183.1	g.chr15: 61328957G > A	c.246G > A	p.M82I	Missense
OCC04PT	RAI2	CCDS14183.1	g.chrX: 17729307G > A	c.745C > T	p.P249S	Missense
OCC06PT	RCBTB1	CCDS9418.1	g.chr13: 49006380A > C	c.1475T > G	p.F492C	Missense
OCC06PT	RETSAT	CCDS1972.1	g.chr2: 85431542C > G	c.469G > C	p.V157L	Missense
OCC06PT	REV3L	CCDS5091.2	g.chr6: 111759634C > G	c.7972G > C	p.D2658H	Missense
OCC08PT	RHBDD3	CCDS13850.1	g.chr22: 27986387G > A	c.911C > T	p.S304L	Missense
OCC06PT	RIPK2	CCDS6247.1	g.chr8: 90871585G > A	c.1423G > A	p.E475K	Missense
OCC06PT	ROPN1L	CCDS3879.1	g.chr5: 10518033G > C	c.667G > C	p.E223Q	Missense
OCC06PT	RPAP2	CCDS740.1	g.chr1: 92561809G > T	c.744G > T	p.M248I	Missense
OCC07PT	RRAS	CCDS12774.1	g.chr19: 54830656C > T	c.646G > A	p.V216I	Missense
OCC03PT	SAGE1	CCDS14652.1	g.chrX: 134818022C > A	c.1258C > A	p.A423D	Missense
OCC03PT	SALL3	CCDS12013.1	g.chr18: 74853658C > T	c.679C > T	p.R227C	Missense
OCC06PT	SEL1L2	CCDS42852.1	g.chr20: 13798816G > C	c.1138C > G	p.L380V	Missense
OCC06PT	SENP7	CCDS2941.2	g.chr3: 102539043G > A	c.2480C > T	p.S827L	Missense
OCC01PT	SERPINB3	CCDS11986.1	g.chr18: 59457541G > T	c.626C > A	p.5209Y	Missense
OCC04PT	SFRP1	CCDS34886.1	g.chr8: 41285481G > C	c.355C > G	p.P119A	Missense
OCC06PT	SLC12A2	CCDS4144.1	g.chr5: 127531402G > C	c.2667G > C	p.K889N	Missense
OCC03PT	SLC12A7	CCDS34129.1	g.chr5: 1129308C > T	c.1792G > A	p.V598M	Missense
OCC01PT	SLC18A3	CCDS7231.1	g.chr10: 50490297G > A	c.1505G > A	p.R502H	Missense
OCC07PT	SLC30A1	CCDS1499.1	g.chr1: 209818351C > A	c.227G > T	p.R76L	Missense
OCC06PT	SLC38A6	CCDS9751.1	g.chr14: 60519109G > A	c.236G > A	p.S79N	Missense
OCC02PT	SLC4A3	CCDS2446.1	g.chr2: 220212528G > T	c.3185G > T	p.G1062V	Missense
OCC02PT	SLITRK2	CCDS14680.1	g.chrX: 144712029G > A	c.394G > A	p.G132S	Missense
OCC07PT	SMAD3	CCDS10222.1	g.chr15: 65269917A > G	c.1267A > G	p.S423G	Missense
OCC06PT	SMARCA4	CCDS12253.1	g.chr19: 10999550C > G	c.3306C > G	p.F1102L	Missense
OCC04PT	SOCS3	CCDS11756.1	g.chr17: 73866491C > A	c.281G > T	p.R94L	Missense
OCC06PT	SOLH	CCDS10410.1	g.chr16: 539033delC	c.1491delC	fs	Indel
OCC07PT	SON	CCDS13629.1	g.chr21: 33848740G > T	c.5333G > T	p.R1778I	Missense
OCC04PT	SPACA3	CCDS11275.1	g.chr17: 28348073G > A	c.443G > A	p.R148Q	Missense
OCC06PT	SPARCL1	CCDS3622.1	g.chr4: 88622650C > A	c.1618G > T	p.E540X	Nonsense
OCC08PT	SPATA5L1	CCDS10123.1	g.chr15: 43489979G > T	c.1393G > T	p.E465X	Nonsense
OCC05PT	SPOP	CCDS11551.1	g.chr17: 45054368C > T	c.139G > A	p.E47K	Missense
OCC06PT	SPTBN1	CCDS33198.1	g.chr2: 54727813C > G	c.4908C > G	p.I1636M	Missense
OCC06PT	ST6GAL2	CCDS2073.1	g.chr2: 106825995G > A	c.871C > T	p.R291C	Missense
OCC06PT	STAG3	CCDS34703.1	g.chr7: 99637885G > A	c.2549G > A	p.G850E	Missense
OCC06PT	TAF1	CCDS14412.1	g.chrX: 70559765C > T	c.4586C > T	p.S1529F	Missense
OCC06PT	TAF1	CCDS14412.1	g.chrX: 70559773C > G	c.4594C > G	p.L1532V	Missense
OCC06PT	TANK	CCDS2215.1	g.chr2: 161769509G > C	c.286G > C	p.D96H	Missense
OCC06PT	TCERG1	CCDS4282.1	g.chr5: 145843332delA	c.2060delA	fs	Indel
OCC05PT	TCN1	CCDS7978.1	g.chr11: 59377272C > G	c.1220G > C	p.G407A	Missense
OCC06PT	TCP11L2	CCDS9104.1	g.chr12: 105239560G > A	c.581G > A	p.R194Q	Missense
OCC05PT	TENC1	CCDS8842.1	g.chr12: 51734479G > C	c.539G > C	p.R180P	Missense
OCC06PT	TFAP2A	CCDS4510.1	g.chr6: 10518385G > C	c.215C > G	p.P72R	Missense
OCC01PT	THBS1	CCDS32194.1	g.chr15: 37666969C > T	c.1250C > T	p.S417L	Missense
OCC06PT	THBS2	CCDS34574.1	g.chr6: 169371666C > G	c.2185G > C	p.E729Q	Missense
OCC08PT	TKTL2	CCDS3805.1	g.chr4: 164613564G > A	c.773C > T	p.A258V	Missense
OCC01PT	TNNT3	CCDS7727.1	g.chr11: 1912711C > T	c.667C > T	p.R223C	Missense
OCC03PT	TOP1	CCDS13312.1	g.chr20: 39174872C > T	c.1345C > T	p.R449W	Missense
OCC04PT	TP53	CCDS11118.1	g.chr17: 7518978C > A	c.596G > T	p.G199V	Missense
OCC07PT	TPO	CCDS1643.1	g.chr2: 1478811C > T	c.2050C > T	p.R684C	Missense
OCC08PT	TRIM7	CCDS4462.1	g.chr5: 180555122G > A	c.1186C > T	p.R396W	Missense
OCC03PT	TRPV6	CCDSS874.1	g.chr7: 142282824C > T	c.1241G > A	p.R414H	Missense
OCC06PT	TSHZ2	CCDS33490.1	g.chr20: 51304068G > A	c.664G > A	p.A222T	Missense
OCC07PT	TXLNB	CCDS34545.1	g.chr6: 139651330C > T	c.400G > A	p.E134K	Missense
OCC03PT	UBE3A	CCDS32177.1	g.chr15: 23167713T > C	c.641A > G	p.D214G	Missense
OCC01PT	UHRF1BP1L	CCDS31882.1	g.chr12: 98990653G > T	c.1477C > A	p.L493I	Missense
OCC06PT	UTRN	CCDS34547.1	g.chr6: 144837577C > T	c.3325C > T	p.L1109F	Missense
OCC06PT	VPS33B	CCDS10369.1	g.chr15: 89362068C > G	c.148G > C	p.D50H	Missense
OCC02PT	WARS2	CCDS900.1	g.chr1: 119377335G > A	c.805C > T	p.R269C	Missense
OCC02PT	YEATS2	CCDS43175.1	g.chr3: 184959448G > C	IVS12 + 1G > C	Splice site	Splice site
OCC08PT	ZHX3	CCDS13315.1	g.chr20: 39265364C > G	c.1607G > C	p.R536T	Missense
OCC08PT	ZNF223	CCDS12635.1	g.chr19: 49262723C > T	c.902C > T	p.S301L	Missense
OCC08PT	ZNF318	CCDS4895.2	g.chr6: 43414988C > A	c.4726G > T	p.G1576C	Missense
OCC06PT	ZNF454	CCDS4441.1	g.chr5: 178324711C > T	c.700C > T	p.H234Y	Missense
OCC06PT	ZNF7	CCDS6435.1	g.chr8: 146038269C > T	c.973C > T	p.Q325X	Nonsense
OCC08PT	ZP4	CCDS1615.1	g.chr1: 236117373G > C	c.665C > G	p.A222G	Missense
OCC06PT	ZSCAN1	CCDS12969.1	g.chr19: 63257154G > A	c.1150G > A	p.V384I	Missense
OCC08PT	ZZEF1	CCDS11043.1	g.chr17: 3882226A > C	c.6835T > G	p.F2279V	Missense
*All coordinates refer to the human reference genome hg18 release (NCBI 36.1, March 2006).

TABLE S4
Primers used for PCR amplification and sequencing
Gene		Coding Exon					SEQ ID
Symbol	Transcript IDs	No.	Genomic Region of interest*	M13 PCR primer sequence†	SEQ ID NO:	PCR primer sequence	NO:
ARID1A	ENST00000324856	1	chr1: 26895478-26895713	CCCGTTCGAGTTGTCAGGT	12	GCAGAAAGCGGAGAGTCACA	85
ARID1A	ENST00000324856	1	chr1: 26895714-26896145	GGGAAAGGAGCTGCAGGA	13	ACCTCTCGGGGAGCTCAG	86
ARID1A	ENST00000324856	1	chr1: 26896146-26896381	CAGCAGAACTCTCACGACCA	14	CCCACTCAGCTGTGTACCTG	87
ARID1A	ENST00000324856	1	chr1: 26896382-26896622	GAGAAGAGCCAGACAATGGC	15	ACCCTCAACCAACTGCTCAC	88
ARID1A	ENST00000324856	2	chr1: 26928725-26928945	TTGGAAGCCAAGGATACATTC	16	AGGTTGGTCTCATTGCTCTTTC	89
ARID1A	ENST00000324856	3	chr1: 26930226-26930491	ACCCTGGGCCTCCTAAGTATG	17	ATATCTTACCTGCGGTGGAGG	90
ARID1A	ENST00000324856	3	chr1: 26930492-26930686	TGCACGTTAGAGAACCACTCTG	18	ACAACCAGCAAAGTCCTCACC	91
ARID1A	ENST00000324856	4	chr1: 26931750-26931874	CAGTCCCATAACCCTTTCACAG	19	CTGGGCAGGGAGACAGAAC	92
ARID1A	ENST00000324856	5	chr1: 26959930-26960178	GAAACTATGCAGGCATGAGCC	20	AAAGAACGTGTG7GATGTATTTGC	93
ARID1A	ENST00000324856	6	chr1: 26960458-26960555	TTGGCTGGATCTCTTTGTGTG	21	TTCATGGTCAAACAGCTCTCC	94
ARID1A	ENST00000324856	7	chr1: 26961226-26961401	TCCCAGGATAAGGATGGAGAG	22	GGACAGCCCTTCTCTCACAAG	95
ARID1A	ENST00000324856	8	chr1: 26962047-26962367	TTGAATGACATTGTTTGGTGTTC	23	GGTCCAGAAGCATCTCAATAATC	96
ARID1A	ENST00000324856	9	chr1: 26965295-26965448	ATCATCTCTGGGCTGGCTG	24	CACAGCACTATTTGGCTCCAG	97
ARID1A	ENST00000324856	10	chr1: 26965531-26965648	GGCTGGGATCTTGTCACTCTC	25	GCCAACAATTCTGCAGGTAAG	98
ARID1A	ENST00000324856	11	chr1: 26966864-26967081	CAAGAGACTTCTGAGACCCTTAGC	26	CATGGTACCACATGAAGCCAG	99
ARID1A	ENST00000324856	12	chr1: 26970193-26970408	ATCCTTGGCATATCCTGTTGG	27	GAATACCTTACAGCCTGATGGG	100
ARID1A	ENST00000324856	13	chr1: 26971574-26971714	AACAAAGGACACGCAGGAGTC	28	GGCCTTAGGAAGAACTTTCCC	101
ARID1A	ENST00000324856	14	chr1: 26971886-26972069	GGCTGAAGATAAGTGCATGGG	29	CAAGAACCCTGAGCCATTCTC	102
ARID1A	ENST00000324856	15	chr1: 26972420-26972578	GAACTCTGAAGAGGGCCTGG	30	AATTGGAGAGGCAGATTGAGC	103
ARID1A	ENST00000324856	16	chr1: 26972654-26972799	CAGAGTGAGGTAAGCATGACCC	31	CCTTGGGTGGAGAACTGATTG	104
ARID1A	ENST00000324856	17	chr1: 26972876-26972980	GTGAGTAAAGCCTGGTCTCGG	32	ATTGAGGACGTGGCTCTTCAG	105
ARID1A	ENST00000324856	18	chr1: 26973403-26973673	GGAAGAAAGAGTGGTGGTTGC	33	CCAAACTGGAATGGAAATTGG	106
ARID1A	ENST00000324856	18	chr1: 26973674-26973835	GGAGATGTACAGCGTGCCATA	34	TCGGTTCACGCCATGATAG	107
ARID1A	ENST00000324856	18	chr1: 26973836-26974028	GCTATGTGCGAGGCAGGTACT	35	GCTCAGCAAGGCACCATGT	108
ARID1A	ENST00000324856	18	chr1: 26974029-26974302	ATTGCATGGCAATGAAGGAG	36	CCTCCATCTAACTACCAGCCC	109
ARID1A	ENST00000324856	19	chr1: 26974651-26974789	TGGCTAAAGATGAGACATTCCC	37	AGACAGAAACTGCCTTCCACC	110
ARID1A	ENST00000324856	20	chr1: 26978097-26978514	GTCTTGCTCTCGAAGTGGGTC	38	GGAGAACCTTTGGGAAAGGAG	111
ARID1A	ENST00000324856	20	chr1: 26978515-26978778	GGCTTCGAA7GGTATTGGACA	39	CAGGCAAGGACAAGCCAG	112
ARID1A	ENST00000324856	20	chr1: 26978779-26979042	GGCGAGTGTAACCAAGGTGTT	40	GCTAAGAGTTCAGAGGCCATCA	113
ARID1A	ENST00000324856	20	chr1: 26979043-26979306	GCTAAGAGTTCAGAGGCCATCA	41	CCGCATCATGTCCACACTA	114
ARID1A	ENST00000324856	20	chr1: 26979307-26979580	CCTTGGTTACACTCGCCAAC	42	CAGCCGTGATTCGTACAGAGTA	115
ARID1A	ENST00000324856	20	chr1: 26979581-26979838	GAGGTGGAAGGAGGAGAGAGA	43	CTCAGTGACCGAAAGAACCC	116
KRAS	ENST00000311936	1	chr12: 25253992-25254116	TCAGTTGCCTGAAGAGAAACATAA	44	TAACAGTCTGCATGGAGCAGG	117
KRAS	ENST00000395977	1	chr12: 25259638-25259765	AGTGGTTGCCACCTTGTTACC	45	GAACAAACCAGGATTCTAGCCC	118
KRAS	ENST00000395977	2	chr12: 25269811-25269978	TGGATTAAGAAGCAATGCCCT	46	TGGTGTAGTGGAAACTAGGAATTACAT	119
KRAS	ENST00000395977	3	chr12: 25271431-25271617	ATGCATGGCATTAGCAAAGAC	47	CGTCATCTTTGGAGCAGGAAC	120
KRAS	ENST00000395977	4	chr12: 25289471-25289589	TTGAAACCCAAGGTACATTTCAG	48	TCTTAAGCGTCGATGGAGGAG	121
PIK3CA	ENST00000263967	1	chr3: 180399304-180399543	TCTGCTTTGGGACAACCATAC	49	CAACAGTTAAGCTTTATGGTTATTTGC	122
PIK3CA	ENST00000263967	1	chr3: 180399544-180399663	GCCTCCGTGAGGCTACATTA	50	GCAATTTAGAGCAAAGGCAGC	123
PIK3CA	ENST00000263967	2	chr3: 180400168-180400385	AAATCTACAGAGTTCCCTGTTTGC	51	TCAGTATAAGCAGTCCCTGCC	124
PIK3CA	ENST00000263967	3	chr3: 180401768-180402026	TGAATACTTGTTGAAATTTCTCCCT	52	GCAGAGCCTGCAGTGAGC	125
PIK3CA	ENST00000263967	4	chr3: 180404022-180404275	CGGAGATTTGGATGTTCTCCT	53	TGATTGATCTTGTGCTTCAACG	126
PIK3CA	ENST00000263967	5	chr3: 180404981-180405074	CAAACTCCGACTTCGTGATCC	54	TTAGTGGATGAAGGCAGCAAC	127
PIK3CA	ENST00000263967	6	chr3: 180410073-180410185	TTGGTTGATCTTTGTCTTCGTG	55	ATGAACCAAAGCAAGCATGAG	128
PIK3CA	ENST00000263967	7	chr3: 180410664-180410824	TGAATTTTCCTTTTGGGGAAG	56	GAGAGAAGGTTTGACTGCCATAA	129
PIK3CA	ENST00000263967	8	chr3: 180410909-180411051	ATGAATGAAGGCAAGCTAGGG	57	GATTTGCTGAACCCTATTGGTG	130
PIK3CA	ENST00000263967	9	chr3: 180418688-180418820	TGCTGAGATCAGCCAAATTCA	58	TCAGCAGTTACTATTCTGTGACTGG	131
PIK3CA	ENST00000263967	10	chr3: 180419674-180419763	AAAGCTAGTAATGTAAGAAGTTTGGGA	59	GGGAAAGATAGTTGTGAATGAGC	132
PIK3CA	ENST00000263967	11	chr3: 180420049-180420221	ATAGACTAATAGTAATATAGTGT	60	AAGGAAGTTGTATGGATCTAG	133
PIK3CA	ENST00000263967	12	chr3: 180420427-180420538	CGGGAGTTTGACATTGTTCTGA	61	CGGCCATGCAGAAACTGAC	134
PIK3CA	ENST00000263967	13	chr3: 180421464-180421643	GGCCACCTTCTATGTTCCAA	62	CAAGAAGCATAGGCGTGTGTC	135
PIK3CA	ENST00000263967	14	chr3: 180424559-180424673	TTTGAGGGTAGGAGAATGAGAGA	63	TCTGAGTGTTGCTGCTCTGTG	136
PIK3CA	ENST00000263967	15	chr3: 180425178-180425307	TCTGTTACCATAGGATAAGAAATGGA	64	GCTAAATTCATGCATCATAAGCTC	137
PIK3CA	ENST00000263967	16	chr3: 180426440-180426526	CATGTGATGGCGTGATCC	65	GGTGACACTCCAGAGGCAGTAG	138
PIK3CA	ENST00000263967	17	chr3: 180429750-180429928	GGAAAGGCAGTAAAGGTCATGC	66	GAGGAATACACAAACACCGACAG	139
PIK3CA	ENST00000263967	18	chr3: 130430482-180430607	TAAATGGAAACTTGCACCCTG	67	AAACAAATGGCACACGTTCTC	140
PIK3CA	ENST00000263967	19	chr3: 180430703-180430862	TACCCAGGCTGGTTTCAATTC	68	TGGTGAAAGACGATGGACAAG	141
PIK3CA	ENST00000263967	20	chr3: 180434572-180434850	GACATTTGAGCAAAGACCTGAAG	69	TGGATTGTGCAATTCCTATGC	142
PPP2R1A	ENST00000322088	1	chr19: 57385158-57385243	ATAAGAGACGCACGCTGATTG	70	ACCAAAGAAACGCGAGCTTAG	143
PPP2R1A	ENST00000322088	2	chr19: 57397005-57397103	GCTGACTGGGTTGAGAGCTG	71	TCCCTTTCACCATCTGTCTCC	144
PPP2R1A	ENST00000322088	3	chr19: 57401024-57401132	GTCCATGTGTTCTGAGCTTGG	72	TGTTGGATTAAAGCGGATGTC	145
PPP2R1A	ENST00000322088	4	chr19: 57406321-57406561	AAGGTCGGGATGGGTAATAGG	73	TGGGAGTGGAGAGAGTTCAGG	146
PPP2R1A	ENST00000322088	5	chr19: 57407747-57407902	TGCTGAGCTCTGGGATTCTC	74	AACTGCAGAGTCTGTGCTTGC	147
PPP2R1A	ENST00000322088	6	chr19: 57408016-57408179	GGTTCCTGCCCATGAAAGAG	75	GATCTTATTGCTCAAACGCCC	148
PPP2R1A	ENST00000322088	7	chr19: 57410840-57410962	TTTAGCACTGCTTCCAAGGC	76	TGATGTGCTAGTTCCACCTCC	149
PPP2R1A	ENST00000322088	8	chr19: 57411065-57411143	CTCCCACAAGGTCAAAGGTTG	77	AACTGCTTGAAACCCAAGAGC	150
PPP2R1A	ENST00000322088	9	chr19: 57411590-57411732	TCAGCAGATTCCTGGTCAATC	78	GGGCAGAAGCAGGTTATTGTC	151
PPP2R1A	ENST00000322088	10	chr19: 57414752-57414933	CCACTAAGCCTTCAAAGCCC	79	AGCTCTTTCCATCCTGTCCTG	152
PPP2R1A	ENST00000322088	11	chr19: 57415250-57415318	GTGTCCGGTCTTTCTAGGGTG	80	GATCTGTTTCGTCCTCCTCCC	153
PPP2R1A	ENST00000322088	12	chr19: 57416040-57416202	GAACCCTCTAGCATCCCTCC	81	TAAGCCATGGTGAGTGTGACC	154
PPP2R1A	ENST00000322088	13	chr19: 57417160-57417310	TGAGTCACCCGTATTGCTCAG	82	CTGACCCTGGGCTCTACCTTC	155
PPP2R1A	ENST00000322088	14	chr19: 57420778-57420877	ACAATGCCAAGGTACCTCCC	83	CTTGAGACTCCTCCCACCTTG	156
PPP2R1A	ENST00000322088	15	chr19: 57421026-57421050	TGGACAGTGAGACATCTTCCC	84	CTAGCAGGAGGGTGGACTTTG	157
*Coordinates refer to the human reference genome hg18 release (NCBI 36.1, March 2006).
*Coordinates refer to the human reference genome hg18 release (NCBI 36.1, March 2006).
†M13 denotes the universal sequencing primer 5′-GTAAAACGACGGCCAGT-3′ (SEQ ID NO: 158).

TABLE S5
Mutations in ARID1A, KRAS, PIK3CA and PPP2R1A in Human Ovarian Clear Cell Carcinoma Cell lines
		Transcript		Nucleotide	Amino acid	Mutation
Sample	Gene	Accession	Nucleotide (genomic)*	(cDNA)	(protein)	type
OV207	ARID1A	CCDS285.1	g.chr1:26973940G>A	c.4635G>A	p.W1545X	Nonsense
OVISE	ARID1A	CCDS285.1	g.chr1:26896089dupA	c.608dupA	fs	Indel
OVISE	ARID1A	CCDS285.1	g.chr1:26930505_26930506delGC	c.1626_1627delGC	fs	Indel
OVMANA	ARID1A	CCDS285.1	g.chr1:26972785C>T	c.3994C>T	p.Q1332X	Nonsense
OVMANA	ARID1A	CCDS285.1	g.chr1:26979767C>G	c.6791C>G	p.S2264X	Nonsense
OVTOKO	ARID1A	CCDS285.1	g.chr1:26979601het_delC	c.6625delC	fs	Indel
OVTOKO	ARID1A	CCDS285.1	g.chr1:26895770G>T	c.289G>T	P.E97X	Nonsense
TOV 21G	ARID1A	CCDS285.1	g.chr1:26930529dupC	c.1650dupC	fs	Indel
TOV 21G	ARID1A	CCDS285.1	g.chr1: 269611250delC	c.2272delC	fs	Indel
TOV 21G	KRAS	CCDS8703.1	g.chr12:25289549C>A	c.38G>T	p.G13C	Missense
KK	PIK3CA	CCDS43171.1	g.chr3:180418794A>C	c.1634A>C	P.E545A	Missense
OVCA429	PIK3CA	CCDS43171.1	g.chr3:180418793G>A	c.1633G>A	p.E545K	Missense
OVMANA	PIK3CA	CCDS43171.1	g.chr3:180418794A>T	c.1634A>T	p.E545V	Missense
TOV 21G	PIK3CA	CCDS43171.1	g.chr3:180434778C>CT	c.3139C>T	p.H1047Y	Missense
KK	PPP2R1A	CCDS12849.1	g.chr19:57407795G>A	c.548G>A	p.R183Q	Missense
OVISE	PPP2R1A	CCDS12849.1	g.chr19:57407794C>T	c.547C>T	p.R183W	Missense
OVTOKO	PPP2R1A	CCDS12849.1	g.chr19:57407794C>G	c.547C>G	p.R183G	Missense
*Coordinates refer to the human reference genome hg18 release (NCBI 36.1, March 2006).

TABLE 2
Mutations in the chromatin remodeling gene, ARID1A
			Nucleotide	Amino acid	Mutation	MSI
Sample	Tumor type	Nucleotide (genomic)#	(cDNA)$	(protein)	type	Status
399	Breast	g.chr1:26928914delC	c.1323delC	fs	Indel	MSS
3814	Breast	g.chr1:26979235G>A	c.6259G>A	p.G2087R	Missense	MSS
5887	Breast	g.chr1:26978695A>T	c.5719A>T	p.I1907F	Missense	MSS
C-122	Breast	g.chr1:26965396C>T	c.2830C>T	p.Q944X	Nonsense	MSS
Co001	Colon	g.chr1:26396495delG	c.1014delG	fs	Indel	MSI-
						High
Co001	Colon	g.chr1:26973994delC	c.4689delC	fs	Indel	MSI-
						High
Co014	Colon	g.chr1:26970279delA	c.3281delA	fs	Indel	MSI-
						High
Co024	Colon	g.chr1:26970342delC	c.3344delC	fs	Indel	MSI-
						High
Co024	Colon	g.chr1:26978524delG	c.5548delG	fs	Indel	MSI-
						High
Co038	Colon	g.chr1:26973659delC	c.4354delC	fs	Indel	MSI-
						High
Co038	Colon	g.chr1:26978524delG	c.5548delG	fs	Indel	MSI-
						High
Co083	Colon	g.chr1:26978524delG	c.5548delG	fs	Indel	MSI-
						High
Co097	Colon	g.chr1:26978524dupG	c.5548dupG	fs	Indel	MSI-
						High
Hx132	Colon	g.chr1:26931798delC	c.1848delC	fs	Indel	ND
Hx132	Colon	g.chr1:26965600_26965602delAAC	c.2944_2946delAAC	in-frame	Indel	ND
				del
Hx164	Colon	g.chr1:26930536C>T	c.1657C>T	p.Q553X	Nonsense	MSS
Hx245	Colon	g.chr1:26979204C>A	c.6228C>A	p.Y2076X	Nonsense	MSS
Hx290	Colon	g.chr1:26978814_26978820dupACAGAGC	c.5838_5844dupACAGAGC	fs	Indel	MSS
		(hom)
Hx308	Colon	g.chr1:26978810_26978811insAGCACAG	c.5834_5835insAGCACAG	fs	Indel	ND
Hx326	Colon	g.chr1:26962098_26962099dupTA	c.2467_2468dupTA	fs	Indel	MSS
G07	Gastric	g.chr1:26896360dupC	c.879dupC	fs	Indel	MSI-
						High
G08	Gastric	g.chr1:26896308delG	c.827delG	fs	Indel	MSI-
						High
G13	Gastric	g.chr1:26974048_26974049delCA	c.4743_4744delCA	fs	Indel	MSI-
						High
G13	Gastric	g.chr1:26978524delG	c.5548delG	fs	Indel	MSI-
						High
G13	Gastric	g.chr1:26974277C>T	c.4972C>T	p.R1658W	Missense	MSI-
						High
G18	Gastric	g.chr1:26978335G>T	c.5359G>T	p.E1787X	Nonsense	MSS
G21	Gastric	g.chr1:26978524delG	c.5548delG	fs	Indel	MSI-
						High
G24	Gastric	g.chr1:26973829T>A	c.4524T>A	p.Y1508X	Nonsense	MSI-
						High
G61	Gastric	g.chr1:26978524delG	c.5548delG	fs	Indel	ND
G61	Gastric	g.chr1:26979396delC	c.6420delC	fs	Indel	ND
G84	Gastric	g.chr1:26961335dupG	c.2357dupG	fs	Indel	MSS
G144	Gastric	g.chr1:26896335delG	c.854delG	fs	Indel	MSS
G280	Gastric	g.chr1:26896450_26896456delGGGCGCC	c.969_975delGGGCGCC	fs	Indel	MSS
L11C	Lung	g.chr1:26965400delG	c.2834delG	fs	Indel	ND
L17C	Lung	g.chr1:26979379_26979384delATTCTG	c.6403_6408delATTCTG	in-frame	Indel	MSS
				del
MB118PT*	Medulloblastoma	g.chr1:26896496delG	c.1015delG	fs	Indel	MSS
MB155PT	Medulloblastoma	g.chr1:26974198_26974199InsC	c.4893_4894InsC	fs	Indel	MSS
MB156PT	Medulloblastoma	g.chr1:26974673delG	c.5012delG	fs	Indel	MSS
Pa07C**	Pancreas	g.chr1:26972534C>T	c.3826C>T	p.R1276X	Nonsense	MSS
Pa37X**	Pancreas	g.chr1:26978923_26978924delTG	c.5947_5948delTG	fs	Indel	MSS
Pa102C	Pancreas	g.chr1:26965645G>A	IVS10+1G>A	Splice site	Splice site	MSS
Pa144X	Pancreas	g.chr1:26959958_26959959insT	c.1945_1946insT	fs	Indel	MSS
Pa158X	Pancreas	g.chr1:26961274dupC	c.2296dupC	fs	Indel	MSS
Pa166X	Pancreas	g.chr1:26978941C>T	c.5965C>T	p.R1989X	Nonsense	MSS
Pa194X	Pancreas	g.chr1:26978941C>T	c.5965C>T	p.R1989X	Nonsense	MSS
Pa194X	Pancreas	g.chr1:26979263C>G	c.6287C>G	p.S2096X	Nonsense	MSS
Pa197X	Pancreas	g.chr1:26930464C>T	c.1585C>T	p.Q529X	Nonsense	MSS
Pa198X	Pancreas	g.chr1:26978524dupG	c.5548dupG	fs	Indel	MSS
Pa216X	Pancreas	g.chr1:26961380delG	c.2402delG	is	Indel	MSS
SW32	Prostate	g.chr1:26972768delC	c.3977delC	fs	Indel	ND
SW32	Prostate	g.chr1:26978524dupG	c.5548dupG	fs	Indel	ND
Pr04PT	Prostate	g.chr1:26972790_26972792het_delGCA	c.3999_4101delGCA	in-frame	Indel	MSI-
				del		High
*Mutation previously reported in Parsons et al, Science 2011 Jan. 28; 331(6016): 435-9;
**Mutation previously reported in Jones et al., Science 2008 Sep. 26; 321(5897); 1801-6;
#Genomic co-ordinates refer to hg18;
$Reference sequence CCDS285.1;
MSI, microsatellite instability;
MSS, microsatellite stable;
ND, not determined

Claims

1. A method of detecting cancer cells, comprising:

(a) testing a biological sample of an individual to detect a mutation in an PPP2R1A GENE; AND

(b) identifying the biological sample as containing cancer cells if the PPP2R1A gene comprises the mutation,

Wherein the mutation is selected from the group consisting of 547C>G, 547C>T, and 544C>T, wherein the nucleotides are numbered by reference to SEQ ID NO:5.