STANDARDIZED NEURONAL CELL ASSAYS FROM PRIMATE SPECIES

This patent application relates to a method to generate standardized and robust neuronal cell culture assays from primate species, for example suitable for high-throughput screening of drug candidates. The method includes differentiating human and/or non-human primate neuronal precursor cells (NPCs) to neuronal cells (NCs) and producing uniform NC cultures based on a dissociation and reseeding step performed on the differentiated NCs resulting in robust cultures suitable for high-throughput drug screening assays, in particular to screen antisense oligonucleotides.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a continuation of PCT International Application No. PCT/EP2016/077429, filed on Nov. 11, 2016, which claims priority to European Patent Application No. 16189502.4 filed on Sep. 19, 2016 and European Patent Application No. 15194367.7 filed on Nov. 12, 2015, the entire contents of which are incorporated herein by reference.

SEQUENCE LISTING

This application contains a Sequence Listing submitted via EFS-Web and hereby incorporated by reference in its entirety. Said ASCII copy, created on Apr. 16, 2018, is named P33889-US_SeqListing.txt, and is 554,446 bytes in size.

FIELD OF THE INVENTION

This patent application relates to a method to generate standardized and robust neuronal cell culture assays from primate species, for example suitable for high-throughput screening of drug candidates. The method includes differentiating human and/or non-human primate neuronal precursor cells (NPCs) to neuronal cells (NCs) and producing uniform NC cultures based on a dissociation and reseeding step performed on the differentiated NCs resulting in robust cultures suitable for high-throughput drug screening assays, in particular to screen antisense oligonucleotides.

BACKGROUND OF THE INVENTION

High-throughput screening assays based on diverse cell types or cell culture models displaying the pathophysiology of various diseases, including diseases of the central nervous system (CNS), are widely employed to assess efficacy and toxicity profiles of drug candidates early in development. Restrictions to limited types of cells or to cells derived from embryonic stem cell have been overcome in the past decade by establishing protocols to generate pluripotent cell from somatic cells. Since Yamanaka and colleagues (Takahashi, K. & Yamanaka, S. Cell. 2006; 126:663-676) demonstrated that somatic cells can be reprogrammed to induced pluripotent stem cells (IPSCs) it became possible to generate pluripotent cells from a variety of cell sources. Different types of somatic cells including fibroblasts, keratinocytes, adipocytes and blood cells have been reprogrammed to an IPSC pluripotent state. More recently, specific somatic cell types could be transdifferentiated to a completely different somatic cell type such as a neuron. Vierbuchen and colleagues demonstrated the direct conversion of mouse fibroblasts to functional neurons by transduction of three crucial genes: Mash1, Brn2 and Myt1I (Vierbuchen et al. Nature. 2010; 463:1035-41). Notably, US2010/0021437 discloses a method for generating induced pluripotent stem cells from fibroblasts and inducing those cells to differentiate into NPCs. More recently direct conversion of differentiated somatic cells to NPCs has been described (WO2012/022725). Such neuronal cells are thought to be a valuable tool for modeling the pathophysiology of various CNS diseases.

NPCs are multipotent stem cells and propagate under specific conditions. They can grow as a monolayer adherent culture or as floating neurospheres in non-adherent cell culture plates. The two types of NPC cultures (neurospheres, adherent cultures) seem to be completely inter-convertible. NPCs can be grown indefinitely and still remain truly multipotent. Upon special conditions they differentiate into the neuronal cell types that compose the adult brain, including differentiated NCs. Differentiated NC cultures are a valuable disease model to screen effective and safe drugs. Indeed, NC cultures are important to assess toxicity and efficacy of drug candidates in a drug development setting.

Before administered in human patients for the first time, drug candidates need to be evaluated thoroughly in in vitro cell culture systems followed by in vivo testing in rodent and non-human primate (NHP) species. Today, the toxicity and efficacy assessment of novel drug candidates is performed in different assay formats using different protocols for different species. While the in vitro testing of drug candidates allows to reduce the number of laboratory animals sacrificed for drug testing, it also posed challenges of outcome translatability from in vitro to in vivo and to the human physiology. Indeed, the translatability of the efficacy and toxicity profiles of drug candidates from rodent species to humans can be challenging, due to non-close genetic relation between the species. Notably, the protein-coding regions of the mouse and human genome are about 85% identical. The difference in genetic makeup may account for different physiological reactions to drugs and also to different tolerance against toxins or mutagens. Translatability between species becomes even more important to date with novel drug classes targeting specific DNA or RNA sequences, as e.g. antisense oligonucleotides, or genetic variants of a gene or gene product. Therefore, in view of the close genetic relatedness (>90%), NHP species represent the most meaningful model system to generate efficacy and toxicity data to predict response and adverse event rate in humans. Without being bound to theory it is assumed that in vivo tests in NHP species, e.g. cynomolgus monkey, are preferable prior to first human trials for all drug classes, but especially for drug classes targeting a defined human genetic makeup. On the other hand, the use of NHP species in drug discovery remains a controversial matter. The very fact that NHP species are genetically close to humans raises ethical questions. Therefore, the number of NHP laboratory animals, e.g. cynomolgus monkey, should be reduced as much as possible.

A comprehensible setup for efficacy and toxicity screening of a novel drug candidate should, therefore, comprise both in vitro and in vivo tests on NHP species, and parallel in vitro tests using IPSC derived human cells. The sequence of testing should include parallel in vitro tests both on a NHP species and human cells preceding in vivo tests in the NHP species, e.g. cynomolgus monkey. Drug candidates with poor efficacy and/or toxicity profile should already be rejected at an early stage upon in vitro assessment on NHP and/or human cells before starting in vivo tests in an NHP species. Indeed, this sequence ensures that the number of NHP laboratory animals can be kept as low as possible.

However, there are formidable hurdles for gaining such primate inter-species transferable efficacy and toxicity data in vitro from stem cell-derived differentiated NCs: first, species specific cell culture protocols and non-transferability of cell culture conditions between primate species and, second, inhomogeneous distribution of the differentiating NPCs leading to non-optimal survival conditions or hampered differentiation effects due to local concentration of cells and autocrine and paracrine signaling leading to challenges in phenotypic assessment of drug effects. This becomes most pronounced when the cultures have to be differentiated for a long period of time to obtain the desired differentiation state of the cells. Most notably, differentiated primate NCs are innate sensitive to cell culture conditions and do not tolerate harsh treatment which is an inherent obstacle to producing standardized assays with these cells.

Hence, there remains a need for an easy accessible and reproducible technology for the generation of uniform NC assays from different primate species including humans.

SUMMARY OF THE INVENTION

Provided herein is an in vitro method for producing standardized cell cultures of uniformly distributed differentiated neuronal cells (NCs) from different primate species, the method comprising the steps of

    • a) providing neuronal precursor cells (NPCs);
    • b) differentiating the NPCs to NCs comprising the steps of
      • (i) dissociating the differentiated NCs from its support after about 20 days to about 45 days of differentiation; and
      • (ii) reseeding the cells in a suitable cell culture format and continuing differentiation of the NCs for about 4 days to about 15 days.

In one embodiment, the primate species are selected from the group consisting of human (Homo sapiens), Cynomolgus monkey (Macaca fascicularis) and Rhesus monkey (Macaca mulatta).

In one embodiment, the primate species are selected from the group consisting of human (Homo sapiens) and Cynomolgus monkey (Macaca fascicularis).

In one embodiment, standardized cell cultures of differentiated NCs are individually produced for 2 primate species, wherein the first primate species is human (Homo sapiens) and the second primate species is Cynomolgus monkey (Macaca fascicularis).

In one embodiment, the NPCs are derived from induced pluripotent stem cells (IPSCs).

In one embodiment, step b) comprises cultivating the NPCs with one or more differentiating agents selected from the group consisting of Shh, FGF8, BDNF, GDNF, cAMP and ascorbic acid phosphate.

In one embodiment, step b)(i) comprises cultivating the cells in basal medium comprising Shh, FGF8 and ascorbic acid phosphate for a period of about 5 to about 10 days followed by cultivating the cells in basal medium comprising BDNF, GDNF, cAMP and ascorbic acid phosphate for a further period of about 15 days to about 35 days prior to dissociating the differentiated NCs from its support.

In one embodiment, the concentration of the one or more differentiating agent in basal medium is 50-500 ng/ml for Shh, 25-250 ng/ml for FGF8, 1-50 ng/ml for BDNF, 150 ng/ml for GDNF, 0.1-10 mM for cAMP and 20-200 μM for ascorbic acid phosphate.

In one embodiment, the concentration of the one or more differentiating agent in basal medium is 200 ng/ml for Shh, 100 ng/ml for FGF8, 20 ng/ml for BDNF, 10 ng/ml for GDNF, 0.5 mM for cAMP and 100 μM for ascorbic acid phosphate.

In one embodiment, the cultivation period with Shh, FGF8 and ascorbic acid phosphate is about 7 days and the cultivation period with BDNF, GDNF, cAMP and ascorbic acid phosphate is about 20 to about 40 days.

In one embodiment, the NPCs are provided on a Laminin521 support.

In one embodiment, step b)(i) comprises dissociating the cells with a cell detachment solution.

In one embodiment, the cell detachment solution is Accutase.

In one embodiment, step b)(ii) comprises reseeding the cells at 200000 cells/cm2 on a Laminin521 support.

In one embodiment, the cells are reseeded in 96 well or 384 well plates.

In one embodiment, step b)(ii) comprises reseeding the cells in the presence of a ROCK inhibitor.

In one embodiment, the ROCK inhibitor is Y-27632.

In one embodiment, step b)(ii) comprises continuing differentiation by cultivating the cells in basal medium supplemented with BDNF, GDNF, cAMP and ascorbic acid after reseeding the cells.

In one embodiment, the differentiated NCs express MAP2.

In one embodiment, the differentiated NCs comprise MAP2 positive neurites.

In one embodiment, the NPCs are derived from an individual with a neuronal disorder.

In one embodiment, the NPCs are derived from a healthy individual.

In one embodiment, the cell cultures are produced sequentially for different species.

In one embodiment, the cells are essentially uniformly distributed over the cell culture area as assessed by cell nucleus staining.

In one embodiment, the distribution of the cells is assessed by DNA staining, in particular by Hoechst staining.

In one embodiment, provided is a cell culture system obtained by a method as described herein.

In one embodiment, provided is the use of the cell cultures obtained according to a method as described herein for in vitro testing of the toxicity of a drug candidate.

In one embodiment, provided is the use of the cell cultures obtained according to a method as described herein for in vitro testing of the efficacy of a drug candidate.

In one embodiment, provided is the use of the cell cultures obtained according to a method as described herein for in vitro testing of the efficacy of a drug candidate, wherein the efficacy is tested in a cell culture derived from an individual with a neuronal disorder and a cell culture derived from a healthy individual.

In one embodiment, provided is the use of the cell cultures obtained according to a method as described herein for selecting a drug candidate, in particular for selecting a drug candidate for further development.

In one embodiment, provided is the cell cultures for use as described herein, wherein the drug candidate comprises a polynucleotide or targets a specific sequence of a polynucleotide.

In one embodiment, provided is the cell cultures for use as described herein, wherein the drug candidate comprises at least one nucleic acid molecule such as a RNAi agent or an antisense oligonucleotide.

In one embodiment, provided is the cell cultures for use as described herein, wherein the nucleic acid molecule comprise one or more 2′ sugar modified nucleosides, independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA and LNA nucleosides.

In one embodiment, provided is the cell cultures for use as described herein, wherein the one or more 2′ sugar modified nucleoside is a LNA nucleoside.

In one embodiment, provided is the cell cultures for use as described herein, wherein the LNA nucleoside is selected from beta-D-oxy-LNA, alpha-L-oxy-LNA, beta-D-amino-LNA, alpha-L-amino-LNA, beta-D-thio-LNA, alpha-L-thio-LNA, (S)cET, (R)cET, beta-D-ENA or alpha-L-ENA.

In one embodiment, provided is the cell cultures for use as described herein, wherein the nucleic acid molecule comprises at least one modified internucleoside linkage.

In one embodiment, provided is the cell cultures for use as described herein, wherein the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

In one embodiment, provided is the cell cultures for use as described herein, wherein the antisense oligonucleotide is capable of recruiting RNase H.

In one embodiment, provided is the cell cultures for use as described herein, wherein the antisense oligonucleotide is a gapmer.

In one embodiment, provided is the cell cultures for use as described herein, wherein the oligonucleotide is a gapmer of formula 5′-F-G-F′-3′, where region F and F′ independently comprise 1 to 7 modified nucleosides and G is a region between 6 and 16 nucleosides which are capable of recruiting RNaseH.

In one embodiment, provided is the methods and uses essentially as described herein.

DESCRIPTION OF THE FIGURES

FIG. 1: The upper strand illustrates the region of the SNHG14 transcript downstream of SNORD109B (UBE3A-ATS) where the black boxes indicate the location of the tested mouse oligonucleotides. The lower strand illustrates the UBE3A coding region, where the black boxes indicate exons. Exon 1 is located around 160 kb. The oligonucleotides are placed in the antisense region of Exon 9 (positioned at ˜97 kb), Exon 10 (positioned at ˜92 kb), Exon 13 (positioned at ˜77 kb) and the 5′ end of Exon 16 (positioned at ˜60 kb).

FIG. 2: Representation of the ability of the oligonucleotides, tested in Example 2, to induce re-expression of UBE3A in human neuronal cell cultures. Oligonucleotides complementary to the region of human SNHG14 long non-coding RNA between SNORD109B and the region upstream of the UBE3A coding region (position 1 to 55318 of SEQ ID NO: 1) are indicated with ● nonoverlap. Oligonucleotides complementary to the region of human SNHG14 long non-coding RNA which is antisense to the UBE3A pre-mRNA (position 55319 to 141053 of SEQ ID NO: 1) are indicated with ▴ overlap. Oligonucleotides from Table 3 with conservation to human and rhesus monkey are indicated at the bottom of each plot as . Conservation between human:rhesus:mouse is indicated by . The oligonucleotide concentrations were 0.2, 1 and 5 microM as indicated in the right hand side each plot.

FIG. 3: Schematic representation of a screening strategy to assess efficacy of a drug candidate on primate in vitro cell culture models followed by in vivo studies on a primate species before assessing drug efficacy on humans. Cynomolgus monkey and human IPSC-derived neurons are used as in vitro model to assess target engagement and efficacy of oligonucleotides targeting UBE3A antisense. Candidates with favorable efficacy profile are prioritized prior to in vivo studies.

FIG. 4: Overview of the different steps carried out for the derivation of neural progenitor cells from cynomolgus IPSCs. A modified version of the dual SMAD inhibition protocol is used for neuralization of primate IPSC lines. MT refers to MT medium; N2B27+SB+LDN refers to N2B27 medium supplemented with SB-431542 and LDN-193189; N2B27+FEB refers to N2B27 medium supplemented with FGF, EGF and BDNF.

FIG. 5A and FIG. 5B: Cyno and human neural precursors display a similar staining positive for Sox2 and Nestin and respective differentiated neurons stain positive for Map2.

FIG. 6A, FIG. 6B, FIG. 6C, FIG. 6D: The applied directed-differentiation method induces a comparable cross-species neuronal differentiation. FIG. 6A) Cyno IPSCs were differentiated in basal medium supplemented with BDNF, GDNF, cAMP and ascorbic acid phosphate (BGAA) for 14 days. RNA from cyno IPSCs and day 14 NCs was isolated and the expression of the indicated markers was analyzed by qPCR. Data are normalized to the housekeeping gene GAPDH and are presented relative to expression levels in cyno IPSCs. FIG. 6B) RNA was isolated from human PSCs and human NCs differentiated for 14 days in basal medium supplemented with BGAA and the expression of the indicated markers was analyzed by RNA sequencing. Data are presented as RPKM values. FIG. 6C) RNA was isolated from human PSCs and human NCs differentiated for 14 days in basal medium supplemented with BGAA and the expression of the indicated markers was analyzed by qPCR. Data are normalized to the housekeeping gene GAPDH and are presented relative to expression levels in human PSCs. FIG. 6D) RNA from cyno (left panel) and human (right panel) NCs differentiated in basal medium supplemented with BGAA for 14 days has been isolated and expression of UBE3A and UBE3A-ATS transcripts has been analyzed by qPCR. Left panel: Data are normalized to the housekeeping gene TBP and presented relative to cyno IPSCs. Right panel: Data are normalized to the housekeeping gene GAPDH and presented relative to human PSCs.

FIG. 7: Schematic depiction of experimental layout for comparison of 4 differentiation methods (A-D) to derive robust neuronal cultures from cyno neural precursors, which is amenable for compound screening. MI refers to Mitotic inhibitor.

FIG. 8: Image-based comparison of the 4 neuronal differentiation methods as described in FIG. 7. NCs were fixed at day 35 of differentiation and stained for Sox2 (marker for Glia and NSCs) depicted in magenta and Map2 (marker for NCs) depicted in green.

FIG. 9: To test the feasibility of dissociating and reseeding human iPSC-derived differentiated NCs, two cell lines were differentiated in parallel. For each, cells were differentiated directly (i.e. without replating) for 6 weeks, or dissociated and reseeded at day 21 and then cultured for a further 3 weeks. Immunofluorescent staining for neuronal (MAP2) and glial (GFAP) markers shows that the dissociating and reseeding (replating) does not hinder the ability of the cells to differentiate.

FIG. 10: Quantification of the extend of differentiation in two different iPSC-derived cell lines with and without dissociation and reseeding (replating). HuC/D is a marker expressed by neurons and was detected by immunofluorescence staining in cultures differentiated for a total of 6 weeks, and quantified by high content imaging. The data show that replating does not significantly change the extent of neuronal differentiation.

FIG. 11: The expression of the microtubule associated protein Tau and two of its phosphorylated forms was analyzed. The constant expression and extent of phosphorylation in two cell lines with and without replating proves that replating (dissociating and reseeding) does not disrupt the cytoskeletal characteristics of human iPSC-derived NCs, suggesting that physiological features will not be altered by dissociating and reseeding the NCs.

FIG. 12: Schematic illustration of the workflow enabling a constant supply of robust primate neuronal cultures for screening in a high-throughput format. SFA refers to basal medium supplemented with Shh, FGF8 and ascorbic acid phosphate; BGAA refers to basal medium supplemented with BDNF, GDNF, cAMP and ascorbic acid phosphate; arrows signify dissociation and reseeding (replating).

FIG. 13A, FIG. 13B, FIG. 13C, FIG. 13D: Target engagement of tested compounds on standardized cell cultures of uniformly distributed neural cells (NCs) from human and Cynomolgus monkey. Two concentrations (low: 0.02 μM; high: 2 μM) of antisense oligonucleotides directed against UBE3A-antisense transcript (antisense) with known target engagement in human were tested. The NC cultures derived from Cynomolgus monkey in A and B display a comparable target engagement as compared to the NC cultures derived from human in C and D. Treatment of cyno and human NCs at indicated concentration results in a reduction of the UBE3A-antisense transcript accompanied with an upregulation of the UBE3A transcript (sense). The cell cultures were produced according to the workflow as included in FIG. 12.

DETAILED DESCRIPTION

The term “antisense oligonucleotide” as used herein is defined as oligonucleotides capable of modulating expression of a target gene by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid. The antisense oligonucleotides are not essentially double stranded and are therefore not siRNAs. Preferably, the antisense oligonucleotides of the present invention are single stranded.

As used herein, the term “basal medium” refers to a defined medium composed of equal volumes of DMEM:F12 Glutamax medium and Neurobasal medium (Gibco, Invitrogen), supplemented with 1× B27 (Gibco, Invitrogen), 1× N2 (Gibco, Invitrogen), 0.1 mM beta-mercaptoethanol (Gibco, Invitrogen). The term “BGAA” refers to basal medium supplemented with 20 ng/ml BDNF (Peprotech), 10 ng/ml GDNF (Peprotech), 0.5 mM cAMP (BIOLOG Life Science), and 100 μM ascorbic acid phosphate (Sigma). The term “SFA” refers to basal medium supplemented with 200 ng/ml Shh, 100 ng/ml FGF8 and 100 μM ascorbic acid phosphate.

The term “contiguous nucleotide sequence” as used herein refers to the region of the oligonucleotide which is complementary to the target nucleic acid. The term is used interchangeably herein with the term “contiguous nucleobase sequence” and the term “oligonucleotide motif sequence”. In some embodiments all the nucleotides of the oligonucleotide are present in the contiguous nucleotide sequence. In some embodiments the oligonucleotide comprise the contiguous nucleotide sequence and may, optionally comprise further nucleotide(s), for example a nucleotide linker region which may be used to attach a functional group to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid.

As used herein, the term “defined medium” or “chemically defined medium” refers to a cell culture medium in which all individual constituents and their respective concentrations are known. Defined media may contain recombinant and chemically defined constituents.

As used herein the terms “differentiating” and “differentiation” refers to one or more steps to convert a less-differentiated cell into a more-differentiated cell, in particular a postmitotic tissue-specific cell type, e.g., to convert a NPC into a NC. Differentiation of NPCs to NCs can be induced inter alia by adding one or several differentiating agents to the cell culture medium.

As used herein the term “efficacy profile” or “efficacy” is defined as generally understood by the skilled person to comprise an assessment of the efficacy of a drug candidate based on exposure of a test system, e.g., a cell culture or an organism, with the drug candidate, in particular in different concentrations and/or with different routes of administration, followed by the determination of resulting cellular and/or physiological effects correlating to the desired effect of the drug candidate. Parameters to determine a cellular and/or physiological effect are defined in context with the respective drug candidate, comprising parameters correlating with the desired phenotypic effect of the drug candidate on the test system or an organism. Preferably, more than one parameter including but not limited to survival, cell viability, morphology, expression and/or expression level of specific genes and protein synthesis is recorded to establish an efficacy profile of a drug candidate. In one aspect of the invention, establishing the efficacy profile includes assessing target engagement.

“Expression markers” or “markers” can be used to determine the identity of a cell type. A certain informative DNA sequence of a cell specific gene is transcribed into mRNA and usually is subsequently translated into a protein (its gene product) which exerts a certain function in a cell. The expression of a marker can be detected and quantified on the RNA level or on the protein level by methods known in the art. IPSC cell markers are known in the art and include but are not limited to TRA-1-60, TRA-1-81, Ecat1, Nanog, Oct4/POU5F1, Sox2, Rex1/Zfp-42 and UTF1, or any combinations thereof. NPC cell markers are known in the art and include but are not limited to Sox2, Nestin, Sox1, Pax6, Dach1. NC cell markers are known in the art and include but are not limited to MAP2, β-III-Tubulin, DCX/Doublecortin, SYN 1/Synapsin 1 and GPHN/Gephyrin.

As used herein, the term “genetic distance” shall be understood as a measure of the genetic divergence between two species, two genomes or two populations. The genetic distance, e.g., between different species, can be determined by methods known in the art including but not limited to determining the Nei's standard distance, the Goldstein distance or the Rynolds/Weir/Cockerham's genetic distance. Genetic distance can be calculated using software known to the art including but not limited to POPTREE2 or DISPAN. The “genetic similarity” is high when the genetic distance is low.

As used herein, the following abbreviations are used; fibroblast growth factor (FGF), basic fibroblast growth factor (bFGF), epidermal growth factor (EGF), sonic hedgehog (shh), fibroblast growth factor 8 (FGF8), brain-derived neurotrophic factor (BDNF), glial cell-derived neurotrophic factor (GDNF), cyclic adenosine monophosphate (cAMP), Rho-associated coiled-coil forming protein serine/threonine kinase (ROCK).

As used herein, the term “growth factor” means a biologically active polypeptide or a small molecule compound which causes cell proliferation, and includes both growth factors and their analogs.

“High-throughput screening” as used herein shall be understood to signify that a relatively large number of different disease model conditions and/or chemical compounds can be analyzed and compared with the novel assay described herein. Typical, such high-throughput screening is performed in multi-well microtiter plates, e.g., in a 96 well plate or a 384 well plate or plates with 1536 or 3456 wells.

“LNA nucleosides” are modified nucleosides which comprise a linker group (referred to as a biradicle or a bridge) between C2′ and C4′ of the ribose sugar ring of a nucleotide. These nucleosides are also termed bridged nucleic acid or bicyclic nucleic acid (BNA) in the literature.

As used herein, the terms “uniformly distributed”, “uniform distribution” or “homogenous distribution” refers as generally understood by the skilled person to the distribution of an entity in a 1-, 2- or multidimensional space, in particular to the distribution of cells on the 2-dimensional surface of a cell culture support. A uniform distribution is established on a 2-dimensional cell culture surface if the mean cell count per area is essentially constant over the whole cell culture surface. The distribution of cells can be assessed, e.g., by nuclear staining and determining the number of cell nuclei per area using fluorescence microscopy. Indicators for non-homogenous distribution of cells include, e.g., clumps of cells, a significant number of overlapping cell nuclei, or a significant portion of the cell culture area devoid of cells. A cell culture with uniformly distributed cells, of one or more cell types, is referred to as “standardized” as used herein. A “standardized cell culture” or “standardized NC culture” refers to a cell culture produced according to the present invention wherein the distribution of the cells is essentially uniform, i.e., the cells are uniformly distributed and the cell cultures are characterized by uniform distribution of the cells, wherein the cell culture may include one or more cell types. Accordingly, a cell culture is considered to be standardized if the cells display a homogenous distribution as assessed, e.g., by nuclear staining and determining the number of cell nuclei per area.

The term “modified internucleoside linkage” as used herein is defined as generally understood by the skilled person as linkages other than phosphodiester (PO) linkages that covalently couple two nucleosides together. Nucleotides with modified internucleoside linkage are also termed “modified nucleotides”. The modified internucleoside linkage increases the nuclease resistance of the oligonucleotide compared to a phosphodiester linkage. For naturally occurring oligonucleotides, the internucleoside linkage includes phosphate groups creating a phosphodiester bond between adjacent nucleosides. Modified internucleoside linkages are particularly useful in stabilizing oligonucleotides for in vivo use, and may serve to protect against nuclease cleavage at regions of DNA or RNA nucleosides in the oligonucleotide of the invention, for example within the gap region of a gapmer oligonucleotide, as well as in regions of modified nucleosides.

As used herein, the term “MT medium” refers to a defined medium that contains Dulbecco's Modified Eagle Medium with Ham's F12 Nutrient Mixture (DMEM/F12) with 2.5 mM GlutaMAX™, 7 μg/ml insulin, 450 μM monothioglycerole, 1× Lipid concentrate, 5 mg/ml BSA, 14 ng/ml sodium selenite, 1× non-essential amino acids, 2 mg/ml heparin, 15 μg/ml transferrin, and 220 μM ascorbic acid-2-phosphate.

As used herein, “neuronal precursor cells” or “NPCs” refers to a subset of multipotent cells, which were derived from IPSCs and express some neural progenitor cell markers including, for example, Nestin. NPCs can be produced, inter alia, according to the methods as described in Costa et al. Cell Rep 2016; 15:86-95 and Dunkley et al. Proteomics Clin Appl 2015; 7-8:684-94 which are incorporated herein by reference in their entirety or according to the methods as described herein. NPCs can be expanded indefinitely and may differentiate into neurons or glial cells (e.g., astrocytes and oligodendrocytes). The term “patient specific NPCs” refers to NPCs obtained from patient IPSCs that have been reprogrammed from somatic cells of a patient. “NPCs obtained from a healthy individual” as used herein refers to NPCs differentiated from IPSCs obtained from somatic cells of an individual that is apparently healthy and not suspected to suffer from any disorder or disease.

As used herein, “neuronal cells” or “NCs” refer to tissue-specific cells from the neuronal lineage. NCs can be differentiated in vitro from NPCs using specific cell culture conditions, e.g., by withdrawal of growth factors or by addition of one or more differentiating agents, as described herein.

The term “non-human primate” or “NHP” as used herein refers to species belonging to the order of primates with the exception of Homo sapiens. In particular, NHP species according to the methods disclosed in the present invention include but are not limited to Pan troglodytes, Pan paniscus, Hylobates lar, Gorilla gorilla, Pongo abelii, Pongo pygmaeus, Cercopithecus mitis, Cercopithicus neglectus, Chlorocebus aethiops, Chlorocebus sabaeus, Colobus guereza, Lophocebus aterrimus, Macaca arctoides, Macaca assamensis, Macaca fascicularis (Cynomolgus monkey), Macaca fuscata, Macaca mulatta (Rhesus monkey), Macaca nemestrina, Macaca silenus, Mandrillus leucophaeus, Mandrillus sphinx, Macaca thibetana, Papio anubis, Papio cynocephalus, Papio hamadryas, Papio papio, Papio ursinus, Presbytis entellus, Theropithecus gelada, Aotus azarae, Aotus nancymaae, Aotus nigriceps, Aotus trivirgatus, Aotus vociferans, Ateles belzebuth, Ateles fusciceps, Callithrix jacchus, Callicebus moloch, Cebuella pygmaea, Cebus apella, Leontopithecus rosalia, Pithecia pithecia, Saguinus fuscicollis, Saguinus geoffroyi, Saguinus labiatus, Saguinus mystax, Saguinus Oedipus and Saimiri sciureus.

The term “cyno” as used herein is an abbreviation for Cynomolgus monkey and/or refers to material derived from Cynomolgus monkeys including but not limited to cells, tissues, organs, blood or cells derived therefrom.

“Nucleotides” are the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present invention include both naturally occurring and non-naturally occurring nucleotides. In nature, nucleotides, such as DNA and RNA nucleotides comprise a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (which is absent in nucleosides). Nucleosides and nucleotides may also interchangeably be referred to as “units” or “monomers”.

As used herein, the term “nucleotide sequence derived from a human genome” means that the respective nucleotide sequence is derived from a human genome reference, i.e. at least a subpopulation of the global human population comprises the respective nucleotide sequence in the genome. Furthermore, as used herein the term “nucleotide sequence derived from a human genome” is used for sequences assigned to a human genome with highest maximal score using the NCBI/Blast database and algorithm (Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), “A greedy algorithm for aligning DNA sequences”, J Comput Biol 2000; 7(1-2):203-14.). Without being bound to theory it is assumed that the alignment Score of a query sequence is higher for a human reference sequence compared to a non-human reference sequence if the query sequence is derived from a human genome.

The term “modified nucleoside” or “nucleoside modification” as used herein refers to nucleosides modified as compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications of the sugar moiety or the (nucleo)base moiety. In a preferred embodiment the modified nucleoside comprises a modified sugar moiety. The term modified nucleoside may also be used herein interchangeably with the term “nucleoside analogue” or modified “units” or modified “monomers”.

The term “modified internucleoside linkage” is defined as generally understood by the skilled person as linkages other than phosphodiester (PO) linkages, that covalently couples two nucleosides together. Nucleotides with modified internucleoside linkage are also termed “modified nucleotides”. In some embodiments, the modified internucleoside linkage increases the nuclease resistance of the oligonucleotide compared to a phosphodiester linkage. For naturally occurring oligonucleotides, the internucleoside linkage includes phosphate groups creating a phosphodiester bond between adjacent nucleosides. Modified internucleoside linkages are particularly useful in stabilizing oligonucleotides for in vivo use, and may serve to protect against nuclease cleavage at regions of DNA or RNA nucleosides in the oligonucleotide of the invention, for example within the gap region of a gapmer oligonucleotide, as well as in regions of modified nucleosides.

As used herein, the term “N2B27” refers to a defined medium composed of equal volumes of DMEM:F12 (Gibco, Invitrogen) supplemented with N2 and B27 (both from Gibco, Invitrogen).

The term “oligonucleotide” as used herein is defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification. When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. The oligonucleotide may comprise one or more modified nucleosides or nucleotides. The term “antisense oligonucleotide” as used herein is defined as oligonucleotides capable of modulating expression of a target gene by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid. The antisense oligonucleotides are not essentially double stranded and are therefore not siRNAs. Preferably, the antisense oligonucleotides are single stranded.

As used herein, the term “reprogramming” refers to one or more steps needed to convert a somatic cell to a less-differentiated cell, for example for converting a fibroblast cell, adipocytes, keratinocytes or leucocyte into a NPC. “Reprogrammed” cells refer to cells derived by reprogramming somatic cells as described herein.

The term “small molecule”, or “small compound”, or “small molecule compound” as used herein, refers to organic or inorganic molecules either synthesized or found in nature, generally having a molecular weight less than 10,000 grams per mole, optionally less than 5,000 grams per mole, and optionally less than 2,000 grams per mole.

The term “somatic cell” as used herein refers to any cell forming the body of an organism that are not germline cells (e.g., sperm and ova, the cells from which they are made (gametocytes)) and undifferentiated stem cells.

The term “stem cell” as used herein refers to a cell that has the ability for self-renewal and differentiation. An “undifferentiated stem cell” as used herein refers to a stem cell that has not undergone differentiation. As used herein, “pluripotent stem cells” or “PSCs” refers to stem cells that can give rise to cell types of the three germlayers (endoderm, ectoderm, mesoderm) as well as the germline. Pluripotent stem cells (PSCs) include but are not limited to “embryonic stem cells” (“ESCs”) and “induced pluripotent stem cells” (“IPSCs”). The terms “hIPSCs” and “cIPSCs” refer to IPSCs derived from human cells and to IPSCS derived from Cynomolgus monkey cells, respectively.

As used herein the term “substantial loss of cell viability” refers to a reduction of cell viability upon application of distinct cell culture conditions or manipulating the cells in a defined process, in particular in connection to dissociating cells from the cell culture support. In one embodiment, substantial loss of cell viability means that more than 5% of the cells become non-viable and/or undergo apoptosis. In further embodiments, substantial loss of cell viability means that more than 10%, more than 15%, more than 20% or more than 25% of the cells become non-viable and/or undergo apoptosis. Accordingly, in one embodiment, the term “essentially remain viable” means that more of 95% of the cells remain viable. In further embodiments, essentially remain viable means that more than 90%, more than 85%, more than 80% or more than 75% of the cells remain viable.

A “suitable medium for differentiation”, also depicted as “differentiation medium”, as used herein refers to any chemically defined medium useful for differentiation of NPCs to NCs. A differentiation medium as described herein contains at least one “differentiating agent”. Differentiating agents include but are not limited to biologically active polypeptides or a small molecule compounds which cause cell differentiation.

The “target” refers to the protein which it is desired to modulate. A “target nucleic acid” is the intended target which the oligonucleotide of the invention hybridizes to, and may for example be a gene, a RNA, a non-coding RNA, a long non-coding RNA, a mRNA, and pre-mRNA, a mature mRNA or a cDNA sequence. In some embodiments the target nucleic acid is a non-coding RNA or a long non-coding RNA, or a subsequence thereof. For particular in vivo or in vitro application, the oligonucleotide of the invention is capable of decreasing the level of the SNHG14 transcript downstream of SNORD109B of and thereby relieving the suppression of the paternal UBE3A transcript in the intended target cell. The contiguous sequence of nucleobases of the oligonucleotide of the invention is complementary to the target nucleic acid, as measured across the length of the oligonucleotide, optionally, with the exception of one or two mismatches, and, optionally, excluding nucleotide based linker regions which may link the oligonucleotide to an optional functional group such as a conjugate. The oligonucleotide comprises a contiguous nucleotide sequence which is complementary to or hybridizes to a sub-sequence of the target nucleic acid molecule.

The term “target sequence” as used herein refers to a sequence of nucleotides present in the target nucleic acid which comprises the nucleobase sequence which is complementary to the oligonucleotide of the invention. In some embodiments, the target sequence consists of a region on the target nucleic acid which is complementary to the contiguous nucleotide sequence of the oligonucleotide of the invention. In some embodiments the target sequence is longer than the complementary sequence of a single oligonucleotide, and may, for example represent a preferred region of the target nucleic acid which may be targeted by several oligonucleotides of the invention. The oligonucleotide of the invention comprises a contiguous nucleotide sequence which is complementary to the target nucleic acid, such as a target sequence. The oligonucleotide comprises a contiguous nucleotide sequence of at least 8 nucleotides which is complementary to or hybridizes to a target sequence present in the target nucleic acid molecule. The contiguous nucleotide sequence (and therefore the target sequence) comprises of at least 8 contiguous nucleotides, such as 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleotides, such as from 12-25, such as from 14-18 contiguous nucleotides.

The term a “target cell” as used herein refers to a cell which is expressing the target nucleic acid. In some embodiments the target cell may be in vivo or in vitro. In some embodiments the target cell is a mammalian cell such as a rodent cell, such as a mouse cell or a rat cell, or a primate cell such as a monkey cell or a human cell. In one embodiment the target cell is a neuronal cell (NC).

As used herein the term “toxicity profile” or “toxicity” is defined as generally understood in the art to comprise a toxicological assessment of a potential harmful or non-harmful substance based on exposure of a test system, e.g., a cell culture or an organisms, with the substance, in particular in different concentrations and/or with different routes of administration, followed by the determination of resulting cellular and/or physiological effects, e.g., cell survival or health. Parameters to determine cellular and/or physiological effects are well known in the art including but not limited to survival, cell viability, morphology, expression and/or expression level of certain genes and protein synthesis. Preferably, more than one parameter is recorded to establish a toxicity profile of a substance with unknown toxicity. The toxicity profile of a drug candidate is used in the art to select drug candidates for further development, e.g., in vivo testing on primates or humans.

The present invention provides a novel method for producing reproducible and standardised differentiated NC cultures from different primate species, including human, which can be used for in vitro high-throughput testing of drug candidates. The method comprises providing primate NPCs, differentiating the NPCs to NCs, and capacitating the cell cultures for high-throughput screening of drug candidates by dissociating the differentiated primate NCs and reseeding the cells in a suitable cell culture format without significant loss of cell viability, and pursuing differentiation of the NCs. The primate NPCs can be derived from IPSCs or transdifferentiated cells, which both can be generated from somatic cells. Preferably said somatic cells are primate cells including human somatic cells.

In one embodiment provided is an in vitro method for producing cell cultures of uniformly distributed differentiated neuronal cells (NCs) from different primate species, the method comprising the steps of

    • a) providing neuronal precursor cells (NPCs); and
    • b) differentiating the NPCs to NCs comprising the steps of
      • (i) dissociating the differentiated NCs from its support between day 20 and 45 of differentiation; and
      • (ii) reseeding the cells in a suitable cell culture format and continuing differentiation of the NCs for 4 to 15 days.

To achieve the inventive method described here, it was necessary to bypass some of the existing limitations of NC cultures. It is widely accepted that in contrast to NPCs, which can be expanded indefinitely either as adherent or floating cultures, differentiating NCs are critically dependent on interaction with a matrix usually consisting of a biopolymer coating of a cell culture plate. Furthermore, differentiated NCs become sensitive to cellular stress and, therefore, passaging of differentiated cells is considered to be detrimental to the cells. The innovative method according to the present invention discloses cell culture conditions whereby uniform NC cultures can be produced from different primate species wherein the NCs are dissociated from its support between day 10 and 40 of differentiation without substantial loss of viability. The NCs can be reseeded in a suitable cell culture format and the differentiation continued. The dissociation and reseeding results in a homogenous distribution of the differentiated NCs over the cell culture area. Furthermore, the method of the present invention allows changing the cell culture format at a late stage of NC differentiation. In further embodiments, step b)(i) comprises dissociating the differentiated NCs from its support between about day 25 and about day 40, between about day 28 and about day 30, at about day 28 or at about day 30 of differentiation.

Accordingly, one aspect of the present invention is a method as described herein to produce uniform differentiated NC cultures. In one embodiment, step b) comprises differentiating the NPCs to neural cells (NCs) comprising the steps of (i) dissociating the differentiated NCs from its support between day 20 and 45 of differentiation; and (ii) reseeding the cells in a suitable cell culture format and continuing differentiation of the NCs for 4 to 10 days, wherein the NCs essentially remain viable. Said dissociation and reseeding step is critical to obtain a uniform distribution of differentiated primate NCs across the area of a cell culture surface, e.g., a cell culture well and/or for harvesting differentiated primate NCs without substantial loss of viability. Consequently, differentiated primate NC culture assays produced according to the present invention display more evenly distributed cells and are better suited for high-throughput assays compared to cell cultures produced without dissociation and reseeding. Importantly, the cell culture format can be changed at a late stage of NC differentiation. This is in contrast to methods of the art, wherein the final cell culture format has to be employed at an early time point. Indeed, being able to change the cell culture format allows for considerable logistic flexibility.

The highly reproducible cell cultures of primate NCs are well standardised and can be used in compound screening assays including but not limited to in vitro efficacy assessment of drug candidates. Furthermore, the cell cultures as described herein can be used for selecting drug candidates, in particular for selecting a drug candidate for further development as described herein. In one embodiment, the cell cultures according to the invention are used to determine the in vitro efficacy profile of a drug candidate as described herein. In a further embodiment the in vitro efficacy profile of a drug candidate is determined prior to the determination of an in vivo efficacy profile as described herein. In a further embodiment, the cell cultures according to the invention are used to determine the in vitro toxicity profile of a drug candidate as described herein.

Accordingly, in one embodiment, differentiated primate NCs are dissociated from the cell culture vessel, wherein the NCs essentially remain viable. The dissociated NCs can be reseeded in a desired cell culture format at a cell density optimized to the needs of a given cell culture assay. In one embodiment, the dissociation and reseeding conditions as described in the present invention can be applied to different primate species. In one embodiment, the method according to the present invention can be used for inter-species comparison of the efficacy profile of a drug candidate, wherein the cell cultures are produced individually from cells of at least two species, wherein essentially the same conditions are applied to the cultures for all species and wherein the efficacy profile is determined and compared for all species. It is within the scope of the present invention to produce standardised cell culture assays deriving from at least one primate species, at least two primate species or at least three primate species using essentially the same cell culturing conditions and to compare and integrate the results as determined by the assay readout to determine a comprehensive efficacy profile of at least one drug candidate.

In one embodiment the NPCs are generated from IPSCs derived from reprogrammed somatic cells. Reprogramming of somatic cells to IPSCs can be achieved by introducing specific genes involved in the maintenance of IPSC properties. Genes suitable for reprogramming of somatic cells to IPSCs include, but are not limited to Oct4, Sox2, Klf4 and C-Myc and combinations thereof. In one embodiment the genes for reprogramming are Oct4, Sox2, Klf4 and C-Myc. Combinations of genes for transdifferentiating somatic cells to NPCs are described in WO2012/022725 which is herein included by reference.

Internal organs, skin, bones, blood and connective tissue are all made up of somatic cells. Somatic cells used to generate IPSCs include but are not limited to fibroblast cells, adipocytes and keratinocytes and can be obtained from skin biopsy. Other suitable somatic cells are leucocytes, erythroblasts cells obtained from blood samples or epithelial cells or other cells obtained from blood or urine samples and reprogrammed to IPSCs by the methods known in the art and as described herein. The somatic cells can be obtained from a healthy individual or from a diseased individual. The genes for reprogramming as described herein are introduced into somatic cells by methods known in the art, either by delivery into the cell via reprogramming vectors or by activation of said genes via small molecules. Methods for reprogramming comprise, inter alia, retroviruses, lentiviruses, adenoviruses, plasmids and transposons, microRNAs, small molecules, modified RNAs and recombinant proteins. In one embodiment, a lentivirus is used for the delivery of genes as described herein. In another embodiment, Oct4, Sox2, Klf4 and C-Myc are delivered to the somatic cells using Sendai virus particles. In addition the somatic cells can be cultured in the presence of at least one small molecule. In one embodiment, said small molecule comprises an inhibitor of the Rho-associated coiled-coil forming protein serine/threonine kinase (ROCK) family of protein kinases. Non-limiting examples of ROCK inhibitors comprise fasudil (1-(5-Isoquinolinesulfonyl) homopiperazine), Thiazovivin (N-Benzyl-2-(pyrimidin-4-ylamino) thiazole-4-carboxamide) and Y-27632 ((+)-(R)-trans-4-(1-aminoethyl)-N-(4-pyridyl) cyclo-hexanecarboxamide dihydrochloride). Resulting IPSCs can be induced to differentiate into NPCs. In one embodiment, the IPSCs are induced to differentiate into NPCs.

In one embodiment, primate NPCs are generated from IPSCs by dual SMAD inhibition. In one embodiment NPCs are generated from IPSCs by contacting the cells with SB-431542 (Calbiochem) and LDN-193189 (Calbiochem). In a particular embodiment NPCs are generated from IPSCs by contacting the cells with 5 ng/ml FGF (Peprotech), 10 μM SB-431542 (Calbiochem) and 100 nM LDN-193189 (Calbiochem). Resulting primate NPCs can be expanded in basal medium supplemented with FGF, EGF and BDNF. In one embodiment, NPCs are expanded in basal medium supplemented with 10 ng/ml FGF (Peprotech), 10 ng/ml EGF (RnD), and 20 ng/ml BDNF (Peprotech). Continued passaging in basal medium supplemented with FGF, EGF and BDNF leads to a stable neural progenitor cell line (NPC line). A stable NPC line is defined by its capacity to self-renew and by the expression of the developmental stage-specific markers Sox2 and Nestin. Accordingly, in one embodiment, the primate NPCs express Sox2 and Nestin.

For propagating proliferation of NPCs the cells are grown in an expansion medium comprising a serum free medium supplemented with growth factors. In one embodiment, said growth factors comprise FGF, BDNF and EGF. Accordingly, in one embodiment, the method additionally comprises incubating the cells of step a) under conditions suitable for proliferation of NPCs, e.g., until a defined number of cells per area is reached. Non-limiting examples of expansion media are described herein. In one embodiment, the expansion medium is supplemented with 10-50 ng/ml FGF, 10-50 ng/ml EGF and 1-20 ng/ml BDNF. In a particular embodiment, the NPC expansion medium is basal medium supplemented with 10 ng/ml FGF2, 10 ng/ml EGF and 20 ng/ml BDNF. NPCs can be produced in unrestricted quantities and are therefore most suitable for high-throughput cell culture assays requiring large numbers of assay plates. Culturing is within the capabilities of the person skilled in the art.

In one embodiment the primate NPCs are washed with a suitable buffer or medium prior to initializing differentiation to remove any dead cells. Preferably the media are changed in between each step of the cell culture protocol, e.g., the medium is removed, by aspiration or centrifuging the cells and discarding the supernatant and then the medium used in the subsequent step is added to the cells. In one embodiment the cells are washed with a suitable buffer or medium prior to adding the medium of the subsequent step to remove any dead cells and any residual medium or growth factors or cytokines applied in the previous step. Buffers or media useful for washing the cells are known in the art. One example of a suitable buffer for washing the cells is phosphate buffered saline (PBS).

In one embodiment, the primate NPC cultures are provided at a density of about 5000 cells/cm2 to about 100000 cells/cm2. In further embodiments, the primate NPC cultures are provided at a density of about 10000 cells/cm2 to about 50000 cells/cm2. In one embodiment, the adherent primate NPC cultures are provided at a density of about 20000 cells/cm2 to about 40000 cells/cm2. In one embodiment the adherent primate NPC cultures are provided at a density of about 30000 cells/cm2. In one embodiment the adherent primate NPC cultures are provided on a Laminin521 support.

In one embodiment, the primate NPCs obtained by methods known in the art and as described herein are in a next step induced to differentiate to NCs by contacting the cells with Shh (sonic hedgehog), FGF8 (fibroblast growth factor 8) and ascorbic acid phosphate. In one embodiment the NPCs are incubated with a chemically defined medium as described herein comprising Shh, FGF8 and ascorbic acid phosphate. In one embodiment, the medium is supplemented with 50-1000 ng/ml Shh, 25-500 ng/ml FGF8 and 20-200 μM ascorbic acid phosphate. In further embodiments, the cells are contacted with Shh, FGF8 and ascorbic acid phosphate for about 1 day, for about 2 days, for about 3 days, for about 4 days, for about 5 days, for about 6 days, for about 7 days, for about 8 days, for about 9 days or for about 10 days. In a further embodiment, the cells are contacted with Shh, FGF8 and ascorbic acid phosphate for about 5 days to about 10 days. In a particular embodiment, the primate NPCs are cultivated in basal medium supplemented with 200 ng/ml Shh, 100 ng/ml FGF8 and 100 μM ascorbic acid phosphate for about 7 days.

In one embodiment the cells are replated after induction of neuronal differentiation at a density of about 10000 cells/cm2 to about 80000 cells/cm2, about 20000 cells/cm2 to about 70000 cells/cm2, about 30000 cells/cm2 to about 60000 cells/cm2 or about 40000 cells/cm2 to about 50000 cells/cm2. In a particular embodiment the cells are replated after induction of neuronal differentiation at a density of about 45000 cells/cm2.

In one embodiment, the cells induced to neuronal differentiation are in a next step differentiated in basal medium supplemented with BDNF, GDNF, cAMP and ascorbic acid phosphate for about further 15 days, for about further 16 days, for about further 17 days, for about further 18 days, for about further 19 days, for about further 20 days, for about further 21 days, for about further 22 days, for about further 23 days, for about further 24 days, for about further 25 days, for about further 26 days, for about further 27 days, for about further 28 days, for about further 29 days, for about further 30 days, for about further 31 days, for about further 32 days, for about further 33 days, for about further 34 days or for about further 35 days. In a particular embodiment, the cells are cultivated in basal medium supplemented with 20 ng/ml BDNF (Peprotech), 10 ng/ml GDNF (Peprotech), 0.5 mM cAMP (BIOLOG Life Science), and 100 μM ascorbic acid phosphate (Sigma) for further about 19 days to about 35 days.

In one embodiment, according to the invention, the differentiated NCs are dissociated from its support and reseeded on a suitable cell culture format as described herein. In further embodiments the NCs, are differentiated in basal medium supplemented with BDNF, GDNF, cAMP and ascorbic acid for at least about 10 days, for at least about 11 days, for at least about 12 days, for at least about 13 days, for at least about 14 days, for at least about 15 days, for at least about 16 days, for at least about 17 days, for at least about 18 days, for at least about 19 days, for at least about 20 days, for at least about 21 days, for at least about 22 days, for at least about 23 days, for at least about 24 days, for at least about 25 days, for at least about 26 days, for at least about 27 days or for at least about 28 days before being dissociated and reseeded on a suitable cell culture assay format. In further embodiments, the primate NCs are differentiated in basal medium supplemented with BDNF, GDNF, cAMP and ascorbic acid for about 15 to about 30 days, for about 20 to about 25 days, for about 21 to about 23 days before being dissociated and reseeded on a suitable cell culture assay format.

In one aspect of the invention, the differentiated NCs obtained by the method as described herein are dissociated from the cell culture substrate without substantial loss of cell viability. Accordingly, in one embodiment the differentiated NCs are harvested without substantial loss of cell viability. Cell number can be determined according to conventional methods used in the art including but not limited to counting cell numbers in a haemocytometer or using flow cytometry. Cell viability can be determined according to conventional methods including but not limited to trypan blue and Erythrosin B staining. After dissociation the cells can be reseeded in suitable cell culture wells at a suitable cell density according to the specific need or experimental parameters of the desired assay based on NCs.

Accordingly, in one embodiment, the differentiated NCs are separated from the cell culture surface by use of a cell detachment solution. In one embodiment, the differentiated NCs are dissociated from its support and reseeded in a suitable cell culture format. In a further embodiment the differentiated NCs are dissociated from its support between about day 20 and about day 45 of differentiation. The number of days of differentiation is counted from the day of initiation of differentiation, e.g., incubating with Shh, FGF8 and ascorbic acid phosphate, wherein the day of addition of Shh, FGF8 and ascorbic acid is counted as day 0. In further embodiments the differentiated NCs are dissociated from its support between about day 15 and about day 50, between about day 28 and about day 30, at about day 25 of differentiation, at about day 26 of differentiation, at about day 27 of differentiation, at about day 28 of differentiation, at about day 29 of differentiation, at about day 30 of differentiation, at about day 31 of differentiation, at about day 32 of differentiation, at about day 33 of differentiation or at about day 34 of differentiation. In one embodiment, the differentiated NCs are dissociated from its support by incubating the cells with a cell detachment solution. In one embodiment the cell detachment solution is Accutase. Accutase is a marine-origin enzyme with proteolytic and collagenolytic activity. In one embodiment the cell detachment solution is added to the differentiated NC cultures and incubated for 1 to 5 minutes, for 2 to 4 minutes, preferentially for 3 minutes. After completion of the incubation time, the Accutase solution is diluted with medium, in particular basal medium. Before reseeding, Accutase containing medium is removed and replenished with fresh basal medium supplemented with growth factors as described herein.

After detachment the primate NCs can be reseeded in new cell culture containments as, e.g., cell culture wells in a suitable plate format. NCs can be reseeded at any desired density, including low density, medium density and high density. Accordingly, cultures of uniformly distributed differentiated NCs can be generated at a defined and desired density, including low density, medium density and high density. This is in contrast to conventional cell culture methods wherein the cell density is fixed at the beginning of culture and wherein the cell density may change considerably in time due to proliferation of cells or cell death. In one embodiment, the NCs are reseeded at a high density. In further embodiments, NCs are reseeded at a density of about 50000 cells/cm2 to about 500000 cells/cm2, at a density of about 75000 cells/cm2 to about 400000 cells/cm2, or at a density of about 100000 cells/cm2 to about 300000 cells/cm2. In a particular embodiment, the differentiated NCs are reseeded in step b)(ii) at a density of about 200000 cells/cm2. In one embodiment the cells are dissociated and reseeded after differentiation with BDNF, GDNF, cAMP and ascorbic acid phosphate at a density of about 50000 cells/cm2 to about 500000 cells/cm2, about 75000 cells/cm2 to about 400000 cells/cm2 or about 100000 cells/cm2 to about 300000 cells/cm2. In a particular embodiment the cells are dissociated and reseeded after differentiation with BDNF, GDNF, cAMP and ascorbic acid phosphate at a density of about 200000 cells/cm2. After dissociation and reseeding (replating), the cells are further differentiated in basal medium supplemented with BDNF, GDNF, cAMP and ascorbic acid for about further 1 day, for about further 2 days, for about further 3 days, for about further 4 days, for about further 5 days, for about further 6 days, for about further 7 days, for about further 8 days, for about further 9 days, for about further 10 days, for about further 11 days, for about further 12 days, for about further 13 days, for about further 14 days or for about further 15 days.

The dissociated and reseeded differentiated NC cultures can be used according to the invention for testing the efficacy of drug candidates. In a particular embodiment the cells are further differentiated in basal medium supplemented with 20 ng/ml BDNF (Peprotech), 10 ng/ml GDNF (Peprotech), 0.5 mM cAMP (BIOLOG Life Science), and 100 μM ascorbic acid phosphate (Sigma) for about 7 days before applying a drug candidate to the cells. Accordingly, the NC cells are ready for screening drug candidates after a total differentiation period of about 10 days to about 50 days, of about 15 days to about 45 days, of about 30 to about 40 days, of about 35 days or about 37 days. In a particular embodiment, the NCs are ready for screening oligonucleotide candidates after a total differentiation period of about 30 to about 40 days.

In further embodiments, the differentiated NC cultures are ready for treatment with a drug candidate after a total differentiation period of about 28 days, of about 29 days, of about 30 days, of about 31 days, of about 32 days, of about 33 days, of about 34 days, of about 35 days, of about 36 days, of about 37 days, of about 38 days, of about 39 days, of about 40 days, of about 41 days, of about 42 days, of about 43 days, of about 44 days, of about 45 days, of about 46 days, of about 47 days, of about 48 days, of about 49 days, of about 50 days, of about 51 days, of about 52 days, of about 53 days, of about 54 days or of about 55 days. In a further embodiment, treatment with a drug candidate is performed at any step of the cell culture protocols as described herein.

In a particular embodiment, the primate NPCs are differentiated to NCs in a serum free differentiation medium comprising 20 ng/ml BDNF, 10 ng/ml GDNF, 0.5 mM cAMP and 100 μM ascorbic acid phosphate for about 21 to about 23 days prior to dissociating and reseeding. In a further embodiment, the differentiated NCs are incubated with differentiation medium as described herein for further about 1 day, for further about 2 days, for further about 3 days, for further about 4 days, for further about 5 days, for further about 6 days, for further about 7 days, for further about 8 days, for further about 9 days, for further about 10 days, for further about 11 days, for further about 12 days, for further about 13 days, for further about 14 days, or for further about 15 days after reseeding as described herein. In a particular embodiment, the differentiated NCs are incubated in a serum free differentiation medium comprising 20 ng/ml BDNF, 10 ng/ml GDNF, 0.5 mM cAMP and 100 μM ascorbic acid phosphate for about 7 days after reseeding. Thereafter, the differentiated NCs are ready for treatment with a drug candidate.

In one aspect of the invention differentiation of the dissociated and reseeded NCs is continued prior to adding a drug candidate to the cell culture medium. Accordingly, in further embodiments, the reseeded NCs are incubated in a differentiation medium as described herein for about 1 day, for about 2 days, for about 3 days, for about 4 days, for about 5 days, for about 6 days, for about 7 days, for about 8 days, for about 9 days, for about 10 days, for about 11 days, for about 12 days, for about 13 days, for about 14 days or for about 15 days prior to adding a drug candidate. In further embodiments step b)(ii) comprises differentiating the NCs after reseeding for further about 1 to about 20 days, for further about 5 to about 10 days, for about 7 days with basal medium comprising 1 to 50 ng/ml BDNF, 1 to 50 ng/ml GDNF and 0.1-10 mM cAMP and 20 to 200 μM ascorbic acid phosphate prior to adding a drug candidate. In a particular embodiment step b)(ii) comprises differentiating the NCs after reseeding for further about 7 days with basal medium comprising 20 ng/ml BDNF, 10 ng/ml GDNF and 0.5 mM cAMP and 100 μM ascorbic acid phosphate prior to adding a drug candidate.

In one embodiment, the drug candidate is added to the cell culture medium after dissociating and reseeding the differentiated NCs. In further embodiments, the drug candidate is added to the cell culture medium about 1 day to about 15 days, about 5 days to about 10 days or about 7 days after reseeding the differentiated NCs. In a particular embodiment, the drug candidate is added to the cell culture medium about 7 days after reseeding the differentiated NCs.

In one embodiment the primate NPCs are differentiated to NCs according to the methods as described herein. In one embodiment, the neuronal identity is assessed with expression markers associated with cellular and/or metabolic functions of neurons. Typical neuronal markers include but are not limited to MAP2, HuC/D, Nestin, β-III-Tubulin, DCX/Doublecortin, SYN 1/Synapsin 1 and GPHN/Gephyrin. The expression markers associated with neuronal identity can be expressed at a lower level in NCs derived from NPCs compared to the expression level in primary neurons or neural tissue. The normalized expression level of neuronal expression markers in NSC-derived NCs can be 10000× lower, or 1000× lower, or 100× lower, or 10× lower, or 2× lower compared to the expression level of the respective markers in primary neurons or neural tissue. The fold change of expression level of neuronal expression markers between NPC-derived NCs and primary neurons can be different for different expression markers. Normalization can be achieved by relating the absolute expression level of a given marker to a suitable house-keeping gene, e.g., GAPDH or TBP.

In one embodiment, the innovative method of the present invention is used to generate robust differentiated NC cultures with homogenous NC distribution for different primate species including but not limited to human (Homo sapiens), Cynomolgus monkey (Macaca fascicularis) and Rhesus monkey (Macaca mulatta). Essentially the same cell culture conditions can be applied to all primate species.

Without being bound theory, the present invention distinguishes two different stages of cells along the axis from pluripotent stem cells to fully differentiated NCs which are NPCs and differentiated NCs. Pluripotent NPCs can be obtained as disclosed herein and can be expanded to any suitable cell number, e.g., for a cell culture assay of a desirable format. It is possible to freeze and thaw healthy individuals and patients specific NPC aliquots. Accordingly, said NPCs can be expanded to a suitable cell number, frozen for storing or directly differentiated to produce robust differentiated NC culture assays according to the invention. Unexpectedly, the inventors found that using the specific conditions as disclosed in the present application differentiated primate NCs can be harvested and used as a source for cells with fixed neuronal identity. The differentiated primate NCs can be detached from the cell culture matrix at a late stage of differentiation without substantial loss of viability. The harvested differentiated primate NCs can be reseeded on a defined assay format, wherein the cells attach to the cell culture support and differentiation can be continued before or in parallel to applying a drug candidate to be tested. The method of the present invention solves the problem of non-uniformity of NC cultures from different primate species. Hence the primate NC cultures obtained with the method described herein are valuable models to screen effective and safe drugs and to elaborate new therapeutics for various diseases of the nervous system.

Accordingly, in a further aspect of the invention, the NC cultures produced according to the invention are used for testing the efficacy of at least one drug candidate. The drug candidate can be added to the cell culture medium at any stage of the method of the present invention. In one embodiment, the drug candidate is added to the differentiated NCs. In one embodiment, the drug candidate is added to the dissociated and reseeded differentiated NC to determine the efficacy profile of the drug candidate. In further embodiments, the drug candidate is added to the cell culture medium at about day 1, at about day 2, at about day 3, at about day 4, at about day 5, at about day 6, at about day 7, at about day 8, at about day 9, at about day 10, at about day 11, at about day 12, at about day 13, at about day 14, at about day 15, at about day 16, at about day 17, at about day 18, at about day 19, at about day 20, at about day 21, at about day 22, at about day 23, at about day 24, at about day 25, at about day 26, at about day 27, at about day 28, at about day 29, at about day 30, at about day 31, at about day 32, at about day 33, at about day 34, at about day 35, at about day 36, at about day 37, at about day 38, at about day 39 or at about day 40 of differentiation.

In a particular embodiment the step b)(i) comprises in this sequence dissociating the differentiated NCs from its support after about day 28 to about day 30 and step b)(ii) comprises reseeding the cells in a suitable cell culture format, continuing differentiation of the NCs for about 7 days, addition of a drug candidate to the cell culture medium, continuing differentiation of the NCs for about further 5 days and assessment of the efficacy profile of the drug candidate.

The primate NC cultures according to the present invention are characterised by uniform cell distribution and, therefore, testing the efficacy of novel drug candidates is straight-forward and well-standardized. The efficacy of a drug candidate can be determined by methods known to the art including but not limited to measuring a phenotypic marker, e.g., the expression of a marker, correlated to the efficacy of the drug candidate. In one embodiment the efficacy of a drug candidate is tested by determining the expression of a disease relevant marker. In one embodiment the efficacy of a drug candidate is tested by determining the expression of a disease relevant protein. In one embodiment the efficacy of a drug candidate is tested by determining the expression of a relevant marker by quantitative real time PCR. The determination of efficacy is performed at a defined time point after addition of a drug candidate. In further embodiments the determination of efficacy is performed at about day 1, at about day 2, at about day 3, at about day 4, at about day 5, at about day 6, at about day 7, at about day 8, at about day 9, at about day 10, at about day 11, at about day 12, at about day 13 or at about day 14 after addition of a drug candidate. In a particular embodiment the step b)(ii) comprises adding a drug candidate to the cell culture medium at about day 7 after dissociating and reseeding, and determining the efficacy of a drug candidate at about day 5 after addition of the drug candidate to the cell culture medium. Robust and uniform differentiated NC cultures according to the invention can be produced for different primate species and used to test the efficacy profile of drug candidates. In one embodiment, the method is suitable for inter-species comparison of efficacy between primate species, in particular between NHP species and human.

A further aspect of the invention is the use of the uniformly distributed differentiated primate NCs obtained by the methods as described herein. In a preferred embodiment the differentiated primate NCs obtained by the method of the present invention are used as in vitro model to study the pathophysiology of CNS diseases. For example, the differentiated primate NCs obtained by the method of the invention can be used for screening for compounds that reverse, inhibit or prevent neurological diseases. In one embodiment, the uniformly distributed differentiated primate NCs are used for screening for compounds that reverse, inhibit or prevent neural side effects of medicaments, for example diabetes medicaments.

In one embodiment, uniformly distributed differentiated primate NCs according to steps a) to b) are used for high-throughput screening of compounds and/or drug candidates selected from the group consisting of small molecules, proteins, peptides and nucleic acids. In a further embodiment, the differentiated NCs according to the invention are used for high-throughput screening of nucleic acid molecules such as a RNAi agent or an antisense oligonucleotide.

In a particular embodiment provided is an in vitro method for selecting at least one drug candidate for further development, comprising producing cell cultures of uniformly distributed differentiated neurons individually from human (Homo sapiens) and Cynomolgus monkey (Macaca fascicularis) comprising the steps of

    • a) providing neuronal precursor cells (NPCs) individually for both human and Cynomolgus monkey at a density of about 30000 cells/cm2 wherein the NPCs are derived from IPSCs;
    • b) differentiating the NPCs to neural cells (NCs) comprising the steps of
      • (i) incubating the NPCs with basal medium supplemented with Shh, FGF8 and ascorbic acid phosphate for about 7 days, replating the cells at a density of about 45000 cells/cm2, incubating the replated cells with basal medium supplemented with BDNF, GDNF, cAMP and ascorbic acid phosphate for about 21 days to about 23 days followed by dissociating the differentiated NCs from its support; and
      • (ii) individually reseeding the cells in a suitable cell culture format at a density of about 200000 cells/cm2 and continuing differentiation of the NCs for about 7 days by incubating the cells with basal medium supplemented with BDNF, GDNF, cAMP and ascorbic acid followed by incubating the cells with a drug candidate for about 5 days wherein the drug candidate is added to basal medium supplemented with BDNF, GDNF, cAMP and ascorbic acid; and

establishing the efficacy profiles of the drug candidate on both human and Cynomolgus monkey, and selecting drug candidates for further development if the efficacy profiles are favourable. In one embodiment, establishing the efficacy profile includes assessing target engagement. In one embodiment the further development comprises in vivo testing of the drug candidate in NHP species and/or in vivo testing in humans.

In one embodiment, a population of differentiated primate NCs produced by any of the foregoing methods is provided. In one embodiment, the differentiated primate NCs are dissociated and reseeded, and further differentiated to obtain uniform and standardized cultures of differentiated NCs. In one embodiment the primate NCs are derived from a healthy individual. In another embodiment, patient-derived primate NCs are used to generate a disease relevant in vitro model to study the pathophysiology of CNS diseases. Conversion of patient specific somatic cells to differentiated NCs represents an easy accessible and reproducible technology to generate a source of patient specific NCs for high-throughput cellular assays for disease modeling or compound screening.

In one embodiment, somatic cells from an Angelman syndrome patient are used to generate

NPCs. The NPCs derived from one or several patients suffering from Angelman syndrome can be used to generate a disease model of Angelman syndrome. A human monogenic disease model can be recapitulated in NHP species by introduction of the etiologic gene mutation into the respective NHP genome by methods known to the art, e.g., by introducing the respective mutation into NHP NPCs.

In a further embodiment, data generated using the cell assays of the present invention is intended for research purposes with the aim of addressing neural diseases like neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, Huntington's disease, Amyotrophic lateral sclerosis (ALS/Lou Gehrig's Disease) stroke, and spinal cord injury or for therapy of said neurological diseases. Importantly, the present invention leads to consistent and reproducible cell culture assays. Indeed, a major drawback of former cell culture assays deriving from primate stem cells is non-homogenous distribution of differentiating cells among the surface of the cell culture area. The present invention solves this issue by introducing a dissociation and reseeding step which is, surprisingly, tolerated by the differentiating primate NCs, said cells remaining viable and suitable to seed cell culture assays at a defined and uniform cell density. A homogenous cell distribution among the surface of a given cell culture containment leads to improved and more reproducible cell culture assays. Accordingly, a method is provided to generate standardized primate NC culture assays, wherein the obtained differentiated NC cultures according to steps a) to b) are characterized by a homogenous cell distribution, evenly distributed cells in high-throughput plate wells, reduced formation of clusters and/or clumps and more equal cell distribution. Consequently, the resulting assays display increased robustness, increased homogeneity and decreased variation between assay replicates. In one embodiment, the cells are distributed uniformly over the cell culture area, in particular as assessed by cell nucleus staining.

One embodiment is the use of the standardized NC cultures obtained by the methods according to the invention to determine the efficacy of a drug candidate. In a further aspect of the invention the standardized primate NC culture are used for in vitro testing of toxicity of a drug candidate. In a further aspect of the invention the standardized primate NC cultures are used for in vitro testing of the efficacy of a drug candidate. The cultures can be derived from healthy individuals and/or from diseased individuals and results from the efficacy and/or toxicity integrated to predict disease and/or therapy relevant physiological effects of a drug candidate. In one embodiment, the in vitro efficacy profile of a drug candidate is assessed and drug candidates with favourable efficacy profile are selected for further development. Further development may comprise in vivo testing of the drug candidate in NHP species and/or in vivo testing in humans.

In a particular embodiment provided is a method for determining the in vitro efficacy profile of a drug candidate using standardized cell cultures of uniformly distributed differentiated neural cells (NCs) from at least two primate species, wherein the differentiated NC cultures are qualified for high throughput screening, the method comprising the steps of:

    • a) dissociating the differentiated NCs from its support after about 20 days to about 45 days of differentiation and reseeding the differentiated NCs in a high-throughput cell culture format;
    • b) incubating the reseeded NCs in a differentiation medium;
    • c) contacting the reseeded NCs with a drug candidate; and
    • d) determining the in vitro efficacy profile of the drug candidate.

Assessing efficacy data in vitro and/or in vivo on NHP species prior to in vivo testing in humans is conclusive since the genetic distance between NHP species and human is small. This is in contrast to, e.g., rodent species which are genetically more distant to humans compared to NHP species. The small genetic distance between NHP species and humans is especially important when assessing drug candidates targeting a human polynucleotide sequence or if the drug candidate itself comprises a polynucleotide with or close to a sequence derived from a human genome. In one embodiment provided, is a method as described herein, wherein the determined in vitro efficacy profile of the drug candidate is used for inter-species comparison of the efficacy profile of a drug candidate, wherein the cell cultures are produced individually from cells of at least two primate species, wherein essentially the same conditions are applied to the cultures for all primate species and wherein the efficacy profile is determined and compared for all primate species. In one embodiment, provided is a method for selecting a drug candidate for further development comprising the steps of: (i) determining the in vitro efficacy profile of the drug candidate for a first and a second species according to the method as described herein; and (ii) selecting the drug candidate for further development if the efficacy profile of the drug candidate is favourable. In one embodiment the genetic similarity of the protein-coding regions between the first and the second species is high. In one embodiment the genetic similarity of the protein-coding regions between the first and the second species is higher than between human (Homo sapiens) and mouse (Mus musculus). In further embodiments the genetic similarity of the protein-coding regions between the first and the second species is higher than 85%, higher than 90% or higher than 95%. In one embodiment the genetic similarity of the protein-coding regions between the first and the second species is higher than 90%. In one particular embodiment the first species is Cynomolgus monkey (Macaca fascicularis) and the second species is human (Homo sapiens). The differentiated NC cultures according to the invention may be produced sequentially for different species.

Accordingly, in one embodiment the standardized cell cultures of differentiated NCs from one or more primate species according to the present invention are used for in vitro efficacy testing of a drug candidate wherein the drug candidate comprises a polynucleotide or targets a specific sequence of a polynucleotide wherein the polynucleotide sequence derives from a human genome. In a further embodiment the drug candidate comprises nucleic acid molecules such as a RNAi agent or an antisense oligonucleotide.

In a further embodiment of the invention, the drug candidate assessed in the in vitro efficacy and/or toxicity tests comprises one or more antisense oligonucleotide. In further embodiments, the antisense oligonucleotide comprise or consist of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity to a sequence derived from a human genome. It is understood that the antisense oligonucleotide sequences (motif sequence) can be modified to for example increase nuclease resistance and/or binding affinity to the target nucleic acid. In one aspect the antisense oligonucleotides comprise sugar-modified nucleosides and may also comprise DNA or RNA nucleosides. In some embodiments, the oligonucleotide comprise sugar-modified nucleosides and DNA nucleosides. In another aspect incorporation of modified nucleosides into the oligonucleotide enhance the affinity of the oligonucleotide for the target nucleic acid. In that case, the modified nucleosides can be referred to as affinity enhancing modified nucleotides.

In one embodiment, the antisense oligonucleotide comprises at least 1 modified nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 or at least 16 modified nucleosides. In an embodiment the oligonucleotide comprises from 1 to 10 modified nucleosides, such as from 2 to 9 modified nucleosides, such as from 3 to 8 modified nucleosides, such as from 4 to 7 modified nucleosides, such as 6 or 7 modified nucleosides. In some embodiments, at least 1 of the modified nucleosides is a locked nucleic acid (LNA), such as at least 2, such as at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 of the modified nucleosides are LNA. In a still further embodiment all the modified nucleosides are LNA.

In one embodiment, the antisense oligonucleotide comprises modifications, which are independently selected from these three types of modifications (modified sugar, modified nucleobase and modified internucleoside linkage) or a combination thereof. Preferably the antisense oligonucleotide comprises one or more sugar modified nucleosides, such as 2′ sugar modified nucleosides. Preferably the antisense oligonucleotide comprises the one or more 2′ sugar modified nucleoside independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA and LNA nucleosides. Even more preferably the one or more modified nucleoside is LNA.

In a further embodiment the antisense oligonucleotide comprises at least one modified internucleoside linkage. In a preferred embodiment the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate or boranophosphate internucleoside linkages.

In some embodiments, the antisense oligonucleotide comprise at least one modified nucleoside which is a 2′-MOE-RNA, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 2′-MOE-RNA nucleoside units. In some embodiments, at least one of said modified nucleoside is 2′-fluoro DNA, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 2′-fluoro-DNA nucleoside units.

In some embodiments, the oligonucleotide of the invention comprises at least one LNA unit, such as 1, 2, 3, 4, 5, 6, 7, or 8 LNA units, such as from 2 to 6 LNA units, such as from 3 to 7 LNA units, 4 to 8 LNA units or 3, 4, 5, 6 or 7 LNA units. In some embodiments, all the modified nucleosides are LNA nucleosides. In a further embodiment, the oligonucleotide may comprise both beta-D-oxy-LNA, and one or more of the following LNA units: thio-LNA, amino-LNA, oxy-LNA, and/or ENA in either the beta-D or alpha-L configurations or combinations thereof. In a further embodiment, all LNA cytosine units are 5-methyl-cytosine. In a preferred embodiment the oligonucleotide or contiguous nucleotide sequence has at least 1 LNA unit at the 5′ end and at least 2 LNA units at the 3′ end of the nucleotide sequence.

In some embodiments, the antisense oligonucleotide comprise at least one LNA unit and at least one 2′ substituted modified nucleoside.

In some embodiments of the invention, the antisense oligonucleotide comprise both 2′ sugar modified nucleosides and DNA units. Preferably the antisense oligonucleotide comprise both LNA and DNA units. Preferably, the combined total of LNA and DNA units is 8-30, such as 10-25, preferably 12-22, such as 12-18, even more preferably 11-16. In some embodiments of the invention, the nucleotide sequence of the antisense oligonucleotide, such as the contiguous nucleotide sequence consists of at least one or two LNA units and the remaining nucleotide units are DNA units. In some embodiments the antisense oligonucleotide comprises only LNA nucleosides and naturally occurring nucleosides (such as RNA or DNA, most preferably DNA nucleosides), optionally with modified internucleoside linkages such as phosphorothioate.

In an embodiment of the invention the antisense oligonucleotide is capable of recruiting RNase H.

In a preferred embodiment the antisense oligonucleotide has a gapmer design or structure also referred herein merely as “Gapmer”. In a gapmer structure the antisense oligonucleotide comprises at least three distinct structural regions a 5′-flank, a gap and a 3′-flank, F-G-F′ in ‘5→3’ orientation. In this design, flanking regions F and F′ (also termed wing regions) comprise a contiguous stretch of modified nucleosides, which are complementary to the target nucleic acid, while the gap region, G, comprises a contiguous stretch of nucleotides which are capable of recruiting a nuclease, preferably an endonuclease such as RNase, for example RNase H, when the antisense oligonucleotide is in duplex with the target nucleic acid. Nucleosides which are capable of recruiting a nuclease, in particular RNase H, can be selected from the group consisting of DNA, alpha-L-oxy-LNA, 2′-Flouro-ANA and UNA. Regions F and F′, flanking the 5′ and 3′ ends of region G, preferably comprise non-nuclease recruiting nucleosides (nucleosides with a 3′ endo structure), more preferably one or more affinity enhancing modified nucleosides.

In some embodiments, the 3′ flank comprises at least one LNA nucleoside, preferably at least 2 LNA nucleosides. In some embodiments, the 5′ flank comprises at least one LNA nucleoside. In some embodiments both the 5′ and 3′ flanking regions comprise a LNA nucleoside. In some embodiments all the nucleosides in the flanking regions are LNA nucleosides. In other embodiments, the flanking regions may comprise both LNA nucleosides and other nucleosides (mixed flanks), such as DNA nucleosides and/or non-LNA modified nucleosides, such as 2′ substituted nucleosides. In this case the gap is defined as a contiguous sequence of at least 5 RNase H recruiting nucleosides (nucleosides with a 2′ endo structure, preferably DNA) flanked at the 5′ and 3′ end by an affinity enhancing modified nucleoside, preferably LNA, such as beta-D-oxy-LNA. Consequently, the nucleosides of the 5′ flanking region and the 3′ flanking region which are adjacent to the gap region are modified nucleosides, preferably non-nuclease recruiting nucleosides.

In some embodiments, the modified nucleoside or the LNA nucleosides of the oligomer of the invention has a general structure of the formula I or II:

wherein W is selected from —O—, —S—, —N(Ra)—, —C(RaRb)—, such as, in some embodiments —O—;

B designates a nucleobase or modified nucleobase moiety;

Z designates an internucleoside linkage to an adjacent nucleoside, or a 5′-terminal group;

Z* designates an internucleoside linkage to an adjacent nucleoside, or a 3′-terminal group;

X designates a group selected from the list consisting of —C(RaRb)—, —C(Ra)═C(Rb)—, —(Ra)═N—, —O—, —Si(Ra)2—, —S—, —SO2—, —N(Ra)—, and >C═Z.

In some embodiments, X is selected from the group consisting of: —O—, —S—, NH—, NRaRb, —CH2—, CRaRb, —C(═CH2)—, and —C(═CRaRb)—.

In some embodiments, X is —O— and Y designates a group selected from the group consisting of —C(RaRb)—, —C(Ra)═C(Rb)—, —C(Ra)═N—, —O—, —Si(Ra)2—, —S—, —SO2—, —N(Ra)—, and >C═Z.

In some embodiments, Y is selected from the group consisting of: —CH2—, —C(RaRb)—, —CH2CH2—, —C(RaRb)—C(RaRb)—, —CH2CH2CH2—, —C(RaRb)C(RaRb)C(RaRb)—, —C(Ra)═C(Rb)—, and —C(Ra)═N—.

In some embodiments, Y is selected from the group consisting of: —CH2—, —CHRa—, —CHCH3—, CRaRb— or —X—Y— together designate a bivalent linker group (also referred to as a radicle) together designate a bivalent linker group consisting of 1, 2, 3 or 4 groups/atoms selected from the group consisting of —C(RaRb)—, —C(Ra)═C(Rb)—, —C(Ra)═N—, —O—, —Si(Ra)2—, —S—, —SO2—, —N(Ra)—, and >C═Z.

In some embodiments, —X—Y— designates a biradicle selected from the groups consisting of: —X—CH2—, —X—CRaRb—, —X—CHRa—, —X—C(HCH3)—, —O—Y—, —O—CH2—, —S—CH2—, —NH—CH2—, —O—CHCH3—, —CH2—O—CH2, —O—CH(CH3CH3)—, —O—CH2—CH2—, OCH2—CH2—CH2—,-O—CH2OCH2—, —O—NCH2—, —C(═CH2)—CH2—, —NRa—CH2—, N—O—CH2, —S—CRaRb— and —S—CHRa—.

In some embodiments —X—Y— designates —O—CH2— or —O—CH(CH3)— wherein Z is selected from —O—, —S—, and —N(Ra)—, and Ra and, when present Rb, each is independently selected from hydrogen, optionally substituted C1-6-alkyl, optionally substituted C2-6-alkenyl, optionally substituted C2-6-alkynyl, hydroxyl, optionally substituted C1-6-alkoxy, C2-6-alkoxyalkyl, C2-6-alkenyloxy, carboxy, C1-6-alkoxycarbonyl, C1-6-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(C1-6-alkyl)amino, carbamoyl, mono- and di(C1-6-alkyl)-amino-carbonyl, amino-C1-6-alkyl-aminocarbonyl, mono- and di(C1-6-alkyl)amino-C1-6-alkyl-aminocarbonyl, C1-6-alkyl-carbonylamino, carbamido, C1-6-alkanoyloxy, sulphono, C1-6-alkylsulphonyloxy, nitro, azido, sulphanyl, C1-6-alkylthio, halogen, where aryl and heteroaryl may be optionally substituted and where two geminal substituents Ra and Rb together may designate optionally substituted methylene (═CH2), wherein for all chiral centers, asymmetric groups may be found in either R or S orientation, wherein R1, R2, R3, R5 and R5* are independently selected from the group consisting of: hydrogen, optionally substituted C1-6-alkyl, optionally substituted C2-6-alkenyl, optionally substituted C2-6-alkynyl, hydroxy, C1-6-alkoxy, C2-6-alkoxyalkyl, C2-6-alkenyloxy, carboxy, C1-6-alkoxycarbonyl, C1-6-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(C1-6-alkyl)amino, carbamoyl, mono- and di(C1-6-alkyl)-amino-carbonyl, amino-C1-6-alkyl-aminocarbonyl, mono- and di(C1-6-alkyl)amino-C1-6-alkyl-aminocarbonyl, C1-6-alkyl-carbonylamino, carbamido, C1-6-alkanoyloxy, sulphono, C1-6-alkylsulphonyloxy, nitro, azido, sulphanyl, C1-6-alkylthio, halogen, where aryl and heteroaryl may be optionally substituted, and where two geminal substituents together may designate oxo, thioxo, imino, or optionally substituted methylene.

In some embodiments R1, R2, R3, R5 and R5* are independently selected from C1-6 alkyl, such as methyl, and hydrogen.

In some embodiments R1, R2, R3, R5 and R5* are all hydrogen.

In some embodiments R1, R2, R3, are all hydrogen, and either R5 and R5* is also hydrogen and the other of R5 and R5*is other than hydrogen, such as C1-6 alkyl such as methyl.

In some embodiments, Ra is either hydrogen or methyl. In some embodiments, when present, Rb is either hydrogen or methyl.

In some embodiments, one or both of Ra and Rb is hydrogen. In some embodiments, one of Ra and Rb is hydrogen and the other is other than hydrogen. In some embodiments, one of Ra and Rb is methyl and the other is hydrogen.

In some embodiments, both of Ra and Rb are methyl.

In some embodiments, the biradicle —X—Y— is —O—CH2—, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such LNA nucleosides are disclosed in WO99/014226, WO00/66604, WO98/039352 and WO2004/046160 which are all hereby incorporated by reference, and include what are commonly known as beta-D-oxy LNA and alpha-L-oxy LNA nucleosides.

In some embodiments, the biradicle —X—Y— is —S—CH2—, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such thio LNA nucleosides are disclosed in WO99/014226 and WO2004/046160 which are hereby incorporated by reference.

In some embodiments, the biradicle —X—Y— is —NH—CH2—, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such amino LNA nucleosides are disclosed in WO99/014226 and WO2004/046160 which are hereby incorporated by reference.

In some embodiments, the biradicle —X—Y— is —O—CH2—CH2— or —O—CH2—CH2—CH2—, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such LNA nucleosides are disclosed in WO00/047599 and Morita et al, Bioorganic & Med. Chem. Lett. 12 73-76, which are hereby incorporated by reference, and include what are commonly known as 2′-O-4′C-ethylene bridged nucleic acids (ENA).

In some embodiments, the biradicle —X—Y— is —O—CH2—, W is O, and all of R1, R2, R3, and one of R5 and R5* are hydrogen, and the other of R5 and R5* is other than hydrogen such as C1-6 alkyl, such as methyl. Such 5′ substituted LNA nucleosides are disclosed in WO2007/134181 which is hereby incorporated by reference.

In some embodiments, the biradicle —X—Y— is —O—CRaRb—, wherein one or both of Ra and Rb are other than hydrogen, such as methyl, W is O, and all of R1, R2, R3, and one of R5 and R5* are hydrogen, and the other of R5 and R5* is other than hydrogen such as C1-6 alkyl, such as methyl. Such bis modified LNA nucleosides are disclosed in WO2010/077578 which is hereby incorporated by reference.

In some embodiments, the biradicle —X—Y— designate the bivalent linker group —O—CH(CH2OCH3)— (2′ O-methoxyethyl bicyclic nucleic acid—Seth at al., 2010, J. Org. Chem. Vol 75(5) pp. 1569-81). In some embodiments, the biradicle —X—Y— designate the bivalent linker group —O—CH(CH2CH3)— (2′O-ethyl bicyclic nucleic acid—Seth at al., 2010, J. Org. Chem. Vol 75(5) pp. 1569-81). In some embodiments, the biradicle —X—Y— is —O—CHRa—, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such 6′ substituted LNA nucleosides are disclosed in WO10036698 and WO07090071 which are both hereby incorporated by reference.

In some embodiments, the biradicle —X—Y— is —O—CH(CH2OCH3)—, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such LNA nucleosides are also known as cyclic MOEs in the art (cMOE) and are disclosed in WO07090071.

In some embodiments, the biradicle —X—Y— designate the bivalent linker group —O—CH(CH3)— in either the R- or S-configuration. In some embodiments, the biradicle —X—Y— together designate the bivalent linker group —O—CH2—O—CH2— (Seth at al., 2010, J. Org. Chem). In some embodiments, the biradicle —X—Y— is —O—CH(CH3)—, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such 6′ methyl LNA nucleosides are also known as cET nucleosides in the art, and may be either (S)cET or (R)cET stereoisomers, as disclosed in WO07090071 (beta-D) and WO2010/036698 (alpha-L) which are both hereby incorporated by reference.

In some embodiments, the biradicle —X—Y— is —O—CRaRb—, wherein in neither Ra or Rb is hydrogen, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments, Ra and Rb are both methyl. Such 6′ di-substituted LNA nucleosides are disclosed in WO 2009006478 which is hereby incorporated by reference.

In some embodiments, the biradicle —X—Y— is —S—CHRa—, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such 6′ substituted thio LNA nucleosides are disclosed in WO11156202 which is hereby incorporated by reference. In some 6′ substituted thio LNA embodiments Ra is methyl.

In some embodiments, the biradicle —X—Y— is —C(═CH2)—C(RaRb)—, such as —C(═CH2)—CH2—, or —C(═CH2)—CH(CH3)—W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such vinyl carbo LNA nucleosides are disclosed in WO08154401 and WO09067647 which are both hereby incorporated by reference.

In some embodiments the biradicle —X—Y— is —N(—ORa)—, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments Ra is C1-6 alkyl such as methyl. Such LNA nucleosides are also known as N substituted LNAs and are disclosed in WO2008/150729 which is hereby incorporated by reference. In some embodiments, the biradicle —X—Y— together designate the bivalent linker group —O—NRa—CH3— (Seth at al., 2010, J. Org. Chem). In some embodiments the biradicle —X—Y— is —N(Ra)—, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments Ra is C1-6 alkyl such as methyl.

In some embodiments, one or both of R5 and R5* is hydrogen and, when substituted the other of R5 and R5* is C1-6 alkyl such as methyl. In such an embodiment, R1, R2, R3, may all be hydrogen, and the biradicle —X—Y— may be selected from —O—CH2— or —O—C(HCRa)—, such as —O—C(HCH3)—.

In some embodiments, the biradicle is —CRaRb—O—CRaRb—, such as CH2—O—CH2—, W is O and all of R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments Ra is C1-6 alkyl such as methyl. Such LNA nucleosides are also known as conformationally restricted nucleotides (CRNs) and are disclosed in WO2013036868 which is hereby incorporated by reference.

In some embodiments, the biradicle is —O—CRaRb—O—CRaRb—, such as O—CH2—O—CH2—, W is O and all of R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments Ra is C1-6 alkyl such as methyl. Such LNA nucleosides are also known as COC nucleotides and are disclosed in Mitsuoka et al., Nucleic Acids Research 2009 37(4), 1225-1238, which is hereby incorporated by reference.

It will be recognized than, unless specified, the LNA nucleosides may be in the beta-D or alpha-L stereoisoform.

Further gapmer designs are disclosed in WO2004/046160, WO2007/146511 and incorporated by reference.

An aspect of the invention is to modulate the level of pig, primate or human UBE3A protein expression, in particular to increase the expression of paternal UBE3A expression in neuronal cells, in particular in human neuronal cells. The human UBE3A protein exists in several isoforms which are listed under Uniprot nr. Q05086. Several mutations in the maternal UBE3A gene can results in Angelman syndrome.

The target nucleic acid for the oligonucleotides of this aspect of the invention is RNA, in particular a long non-coding RNA. The long non-coding RNA which is targeted by the oligonucleotides of the present invention is human SNHG14 (also known as UBE3A-ATS with Ensembl entry number ENSG00000224078, version GRCh38.p2). In particular the target nucleic acid is the region downstream of SNORD109B corresponding to position 25278410 to 25419462 on chromosome 15 (SEQ ID NO: 1). In Rhesus monkey (Macaca mulatta) the UBE3A supressor is defined as region downstream of SNORD109A corresponding to position 4222848 to 4373084 (forward strand) on chromosome 7 using the Ensembl assembly MMUL 1.0 (SEQ ID NO: 2).

In some embodiments, the target nucleic acid is SEQ ID NO: 1, or naturally occurring variants thereof. In certain embodiments target nucleic acid correspond to regions which are conserved between human (SEQ ID NO: 1) and Rhesus monkey (SEQ ID NO: 2). In certain embodiments target nucleic acid correspond to regions which are conserved between human (SEQ ID NO:1), Rhesus monkey (SEQ ID NO: 2) and mouse (SEQ ID NO: 3).

In certain embodiments target nucleic acid is the region that is antisense to the UBE3A pre-mRNA, this region corresponds to position 55319 to 141053 of SEQ ID NO: 1.

In some embodiments, the target nucleic acid is present in a cell, such as a mammalian cell in particular a human cell in vitro or in vivo (the target cell). In certain embodiments the target cell is a neuron, preferably a human neuronal cell.

The target sequence may be a sub-sequence of the target nucleic acid. In some embodiments the oligonucleotide targets sub-sequence selected from the group consisting of the antisense region of exon 9, exon10, exon13, exon14, intron 14, exon 15, intron15 and exon 16 of UBE3A. In some embodiments the oligonucleotide or contiguous nucleotide sequence hybridize or is complementary to a single stranded nucleic acid molecule selected from the group consisting of positions: 55319-76274, 77483-77573, 92157-93403 and 97056-97354 of SEQ ID NO: 1. In some embodiments the oligonucleotide or contiguous nucleotide sequence hybridize or is complementary to a single stranded nucleic acid molecule selected from the group consisting of positions: 60821-60849, 77567-77583, 92323-92339 and 97156-97172 of SEQ ID NO: 1.

Particular Embodiments

    • 1. An in vitro method for producing standardized cell cultures of uniformly distributed differentiated neural cells (NCs) from different primate species, the method comprising the steps of
      • a) providing neuronal precursor cells (NPCs);
      • b) differentiating the NPCs to neural cells (NCs) comprising the steps of
        • (i) dissociating the differentiated NCs from its support after about 20 days to about 45 days of differentiation; and
        • (ii) reseeding the cells in a suitable cell culture format and continuing differentiation of the NCs for about 4 days to about 15 days.
    • 2. The method according to embodiment 1, wherein the primate species are selected from the group consisting of human (Homo sapiens), Cynomolgus monkey (Macaca fascicularis) and Rhesus monkey (Macaca mulatta).
    • 3. The method according to embodiment 1, wherein the primate species are selected from the group consisting of human (Homo sapiens) and Cynomolgus monkey (Macaca fascicularis).
    • 4. The method according to embodiment 1, wherein standardized cell cultures of differentiated NCs are individually produced for 2 primate species, wherein the first primate species is human (Homo sapiens) and the second primate species is Cynomolgus monkey (Macaca fascicularis).
    • 5. The method according to any one of embodiments 1 to 4, wherein the NPCs are derived from induced pluripotent stem cells (IPSCs).
    • 6. The method according to any one of embodiments 1 to 5, wherein step b) comprises cultivating the NPCs with one or more differentiating agents selected from the group consisting of Shh, FGF8, BDNF, GDNF, cAMP and ascorbic acid phosphate.
    • 7. The method according to any one of embodiments 1 to 6, wherein step b)(i) comprises cultivating the cells in basal medium comprising Shh, FGF8 and ascorbic acid phosphate for a period of about 5 to about 10 days followed by cultivating the cells in basal medium comprising BDNF, GDNF, cAMP and ascorbic acid phosphate for a further period of about 15 days to about 35 days prior to dissociating the differentiated NCs from its support.
    • 8. The method according to embodiment 6 or 7, wherein the concentration of the one or more differentiating agent in basal medium is 50-500 ng/ml for Shh, 25-250 ng/ml for FGF8, 1-50 ng/ml for BDNF, 1-50 ng/ml for GDNF, 0.1-10 mM for cAMP and 20-200 μM for ascorbic acid phosphate.
    • 9. The method according to any one of embodiments 6 to 8 wherein the concentration of the one or more differentiating agent in basal medium is 200 ng/ml for Shh, 100 ng/ml for FGF8, 20 ng/ml for BDNF, 10 ng/ml for GDNF, 0.5 mM for cAMP and 100 μM for ascorbic acid phosphate.
    • 10. The method according to any one of embodiments 6 to 9, wherein the cultivation period with Shh, FGF8 and ascorbic acid phosphate is about 7 days and the cultivation period with BDNF, GDNF, cAMP and ascorbic acid phosphate is about 20 to about 40 days.
    • 11. The method according to any one of embodiments 1 to 10, wherein the NPCs are provided on a Laminin521 support.
    • 12. The method according to any one of embodiments 1 to 11, wherein step b)(i) comprises dissociating the cells with a cell detachment solution.
    • 13. The method according to embodiment 12, wherein the cell detachment solution is Accutase.
    • 14. The method according to any one of embodiments 1 to 13, wherein step b)(ii) comprises reseeding the cells at 200000 cells/cm2 on a Laminin521 support.
    • 15. The method according to any one of embodiments 1 to 14, wherein the cells are reseeded in 96 well or 384 well plates.
    • 16. The method according to any one of embodiments 1 to 15, wherein step b)(ii) comprises reseeding the cells in the presence of a ROCK inhibitor.
    • 17. The method according to embodiment 16, wherein the ROCK inhibitor is Y-27632.
    • 18. The method according to any one of embodiments 1 to 17, wherein step b)(ii) comprises continuing differentiation by cultivating the cells in basal medium supplemented with BDNF, GDNF, cAMP and ascorbic acid after reseeding the cells.
    • 19. The method according to any one of embodiments 1 to 18, wherein the differentiated NCs express MAP2.
    • 20. The method according to any one of embodiments 1 to 19, wherein the differentiated NCs comprise MAP2 positive neurites.
    • 21. The method according to any one of embodiments 1 to 20, wherein the NPCs are derived from an individual with a neuronal disorder.
    • 22. The method according to any one of embodiments 1 to 21, wherein the NPCs are derived from a healthy individual.
    • 23. The method according to any one of embodiment 1 to 22, wherein the cell cultures are produced sequentially for different species.
    • 24. The method according to any one of embodiment 1 to 23, wherein the cells are essentially uniformly distributed over the cell culture area as assessed by cell nucleus staining.
    • 25. The method according to any one of embodiment 1 to 24, wherein the distribution of the cells is assessed by DNA staining, in particular by Hoechst staining.
    • 26. A cell culture system obtained by a method according to any one of embodiments 1 to 25.
    • 27. Use of the cell cultures obtained according to any one of embodiments 1 to 26 for in vitro testing of the toxicity of a drug candidate.
    • 28. Use of the cell cultures obtained according to any one of embodiments 1 to 27 for in vitro testing of the efficacy of a drug candidate.
    • 29. The use according to embodiment 28, wherein the efficacy is tested in a cell culture derived from the method of embodiment 21 and a cell culture derived from the method of embodiment 22.
    • 30. Use of the cell cultures obtained according to any one of embodiments 1 to 25 for selecting a drug candidate, in particular for selecting a drug candidate for further development.
    • 31. The cell cultures for use according to any one of embodiments 27 to 30 wherein the drug candidate comprises a polynucleotide or targets a specific sequence of a polynucleotide.
    • 32. The cell cultures for use according to any one of embodiments 27 to 31 wherein the drug candidate comprises at least one nucleic acid molecule such as a RNAi agent or an antisense oligonucleotide.
    • 33. The cell cultures for use according to embodiment 32, wherein the nucleic acid molecule comprise one or more 2′ sugar modified nucleosides, independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA and LNA nucleosides.
    • 34. The cell cultures for use according to embodiment 33, wherein the one or more 2′ sugar modified nucleoside is a LNA nucleoside.
    • 35. The cell cultures for use according to embodiment 34, wherein the LNA nucleoside is selected from beta-D-oxy-LNA, alpha-L-oxy-LNA, beta-D-amino-LNA, alpha-L-amino-LNA, beta-D-thio-LNA, alpha-L-thio-LNA, (S)cET, (R)cET, beta-D-ENA or alpha-L-ENA.
    • 36. The cell cultures for use according to any one of embodiments 32 to 35, wherein the nucleic acid molecule comprises at least one modified internucleoside linkage.
    • 37. The cell cultures for use according to embodiment 36, wherein the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.
    • 38. The cell cultures for use according to any one of embodiments 32 to 37, wherein the antisense oligonucleotide is capable of recruiting RNase H.
    • 39. The cell cultures for use according to any one of embodiments 32 to 38, wherein the antisense oligonucleotide is a gapmer.
    • 40. The cell cultures for use according embodiment 38 or 39, wherein the oligonucleotide is a gapmer of formula 5′-F-G-F′-3′, where region F and F′ independently comprise 1 to 7 modified nucleosides and G is a region between 6 and 16 nucleosides which are capable of recruiting RNaseH.
    • 41. The methods and uses essentially as described herein.

Any of the embodiments as described herein may be used singly or in combination. The examples below explain the invention in more detail. The following preparations and examples are given to enable those skilled in the art to more clearly understand and to practice the present invention. The present invention, however, is not limited in scope by the exemplified embodiments, which are intended as illustrations of single aspects of the invention only, and methods which are functionally equivalent are within the scope of the invention. Indeed, various modifications of the invention in addition to those disclosed herein will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims.

EXAMPLES

Materials and Methods

TABLE 3 List of oligonucleotides or contiguous nucleobase sequences complementary to SEQ ID NO: 1 (motif sequences indicated by SEQ ID NO), oligonucleotide designs made from these, as well as specific oligonucleotide compounds (indicated by CMP ID NO) designed based on the motif sequence. Seq Start ID CMP SEQ ID NO Motif Design Compound ID NO ΔG° NO 1   4 AACTTCATCAATATTTCCC 3-13-3 AACttcatcaatatttCCC   4_1 -23.36   1677   4 AACTTCATCAATATTTCCC 2-15-2 AActtcatcaatatttcCC   4_2 -19.60   1677   5 ACTTCATCAATATTTCCC 3-12-3 ACTtcatcaatatttCCC   5_1 -23.80   1677   5 ACTTCATCAATATTTCCC 2-14-2 ACttcatcaatatttcCC   5_2 -20.24   1677   6 CAACTTCATCAATATTTCCC 2-14-4 CAacttcatcaatattTCCC   6_1 -25.64   1677   6 CAACTTCATCAATATTTCCC 2-16-2 CAacttcatcaatatttcCC   6_2 -22.28   1677   7 CAACTTCATCAATATTTCC 4-13-2 CAACttcatcaatatttCC   7_1 -21.47   1678   7 CAACTTCATCAATATTTCC 2-15-2 CAacttcatcaatatttCC   7_2 -19.46   1678   8 CCAACTTCATCAATATTTCC 3-14-3 CCAacttcatcaatattTCC   8_1 -25.64   1678   9 CCCAACTTCATCAATATTTC 4-14-2 CCCAacttcatcaatattTC   9_1 -25.64   1679  10 ACCCAACTTCATCAATATTT 2-16-2 ACccaacttcatcaatatTT  10_1 -20.05   1680  11 CCCAACTTCATCAATATTT 4-13-2 CCCAacttcatcaatatTT  11_1 -23.96   1680  11 CCCAACTTCATCAATATTT 2-15-2 CCcaacttcatcaatatTT  11_2 -20.28   1680  12 ACCCAACTTCATCAATATT 4-13-2 ACCCaacttcatcaataTT  12_1 -23.64   1681  12 ACCCAACTTCATCAATATT 2-15-2 ACccaacttcatcaataTT  12_2 -19.18   1681  13 CCCAACTTCATCAATATT 4-12-2 CCCAacttcatcaataTT  13_1 -23.09   1681  13 CCCAACTTCATCAATATT 2-14-2 CCcaacttcatcaataTT  13_2 -19.41   1681  14 TACCCAACTTCATCAATAT 2-15-2 TAcccaacttcatcaatAT  14_1 -19.31   1682  15 TACCCAACTTCATCAATA 2-14-2 TAcccaacttcatcaaTA  15_1 -19.14   1683  16 TTACCCAACTTCATCAATA 2-15-2 TTacccaacttcatcaaTA  16_1 -19.74   1683  17 TTTACCCAACTTCATCAAT 4-13-2 TTTAcccaacttcatcaAT  17_1 -21.68   1684  17 TTTACCCAACTTCATCAAT 2-15-2 TTtacccaacttcatcaAT  17_2 -19.22   1684  18 ATACTTTACCCAACTTCAT 3-13-3 ATActttacccaacttCAT  18_1 -23.44   1688  18 ATACTTTACCCAACTTCAT 2-15-2 ATactttacccaacttcAT  18_2 -20.13   1688  19 TACTTTACCCAACTTCAT 3-12-3 TACtttacccaacttCAT  19_1 -22.78   1688  19 TACTTTACCCAACTTCAT 2-14-2 TActttacccaacttcAT  19_2 -19.30   1688  20 TTATACTTTACCCAACTTCA 2-16-2 TTatactttacccaacttCA  20_1 -21.40   1689  21 TCACTGTTCTGACTTT 3-10-3 TCActgttctgacTTT  21_1 -19.11   1712  22 TTCAATCTCTATCTCATCAT 2-16-2 TTcaatctctatctcatcAT  22_1 -19.42   4169  23 CTTCAATCTCTATCTCATCA 4-14-2 CTTCaatctctatctcatCA  23_1 -24.21   4170  23 CTTCAATCTCTATCTCATCA 2-16-2 CTtcaatctctatctcatCA  23_2 -22.04   4170  24 TTCAATCTCTATCTCATCA 2-15-2 TTcaatctctatctcatCA  24_1 -19.44   4170  25 CTTCAATCTCTATCTCATC 2-15-2 CTtcaatctctatctcaTC  25_1 -19.87   4171  26 ACTTCAATCTCTATCTCAT 3-13-3 ACTtcaatctctatctCAT  26_1 -22.36   4172  26 ACTTCAATCTCTATCTCAT 2-15-2 ACttcaatctctatctcAT  26_2 -19.08   4172  27 CACTTCAATCTCTATCTCAT 2-16-2 CActtcaatctctatctcAT  27_1 -20.98   4172  28 ACTTCAATCTCTATCTCA 2-12-4 ACttcaatctctatCTCA  28_1 -21.96   4173  28 ACTTCAATCTCTATCTCA 2-14-2 ACttcaatctctatctCA  28_2 -19.10   4173  29 CACTTCAATCTCTATCTCA 2-13-4 CActtcaatctctatCTCA  29_1 -23.86   4173  29 CACTTCAATCTCTATCTCA 2-15-2 CActtcaatctctatctCA  29_2 -21.00   4173  30 ACACTTCAATCTCTATCTC 2-15-2 ACacttcaatctctatcTC  30_1 -19.38   4174  31 TACACTTCAATCTCTATCTC 2-14-4 TAcacttcaatctctaTCTC  31_1 -23.31   4174  31 TACACTTCAATCTCTATCTC 2-16-2 TAcacttcaatctctatcTC  31_2 -20.53   4174  32 TACACTTCAATCTCTATCT 4-13-2 TACActtcaatctctatCT  32_1 -22.34   4175  33 CTTTGTCTCTCTTTACT 2-13-2 CTttgtctctctttaCT  33_1 -19.36   4374  34 TATACCTTTCTTTAACCC 3-12-3 TATacctttctttaaCCC  34_1 -24.89   8118  34 TATACCTTTCTTTAACCC 2-14-2 TAtacctttctttaacCC  34_2 -20.83   8118  35 TGTTTATACCCTTTCC 2-12-2 TGtttataccctttCC  35_1 -20.33   9212  36 TCTCCTTTATGACTCC 2-10-4 TCtcctttatgaCTCC  36_1 -23.29  10839  37 CTTCTCCTTTATGACTC 2-13-2 CTtctcctttatgacTC  37_1 -19.26  10840  38 CCATTTATTTCCATTTATT 4-13-2 CCATttatttccatttaTT  38_1 -22.32  15567  38 CCATTTATTTCCATTTATT 2-15-2 CCatttatttccatttaTT  38_2 -19.61  15567  39 CTTTCCATTTATTTCCATTT 2-14-4 CTttccatttatttccATTT  39_1 -23.14  15570  40 TCTTTCCATTTATTTCCATT 2-14-4 TCtttccatttatttcCATT  40_1 -24.62  15571  41 ATTACCCATCCGTTCT 2-12-2 ATtacccatccgttCT  41_1 -21.15  21965  42 GCATTAGGCACATTACAT 3-12-3 GCAttaggcacattaCAT  42_1 -23.96  22211  43 ATTATTATTTAACCTTCCTA 2-16-2 ATtattatttaaccttccTA  43_1 -19.28  30451  44 ACATTATTATTTAACCTTCC 4-14-2 ACATtattatttaaccttCC  44_1 -22.84  30453  44 ACATTATTATTTAACCTTCC 2-16-2 ACattattatttaaccttCC  44_2 -20.13  30453  45 CATTATTATTTAACCTTCC 4-13-2 CATTattatttaaccttCC  45_1 -22.04  30453  45 CATTATTATTTAACCTTCC 2-15-2 CAttattatttaaccttCC  45_2 -19.55  30453  46 CCTCTGCTTATAACTTT 2-13-2 CCtctgcttataactTT  46_1 -19.15  30699  47 CTACTATACTTTCCTCT 2-11-4 CTactatactttcCTCT  47_1 -22.32  30711  48 GTTCTACTATACTTTCC 4-11-2 GTTCtactatactttCC  48_1 -21.69  30714  48 GTTCTACTATACTTTCC 2-13-2 GTtctactatactttCC  48_2 -19.21  30714  49 CACCTGATAACAGACCCT 3-12-3 CACctgataacagacCCT  49_1 -26.38  36068  50 CACCTGATAACAGACC 3-10-3 CACctgataacagACC  50_1 -21.10  36070  Si CCCACCAAAGGATATATT 3-12-3 CCCaccaaaggatatATT  51_1 -23.47  37208  52 ACCAGCTACAGGAACCTC 3-12-3 ACCagctacaggaacCTC  52_1 -26.57  46132  53 CTATATCTCACTCCTATTT 4-13-2 CTATatctcactcctatTT  53_1 -23.07  48143  53 CTATATCTCACTCCTATTT 2-13-4 CTatatctcactcctATTT  53_2 -22.12  48143  54 CTATATCTCACTCCTATT 2-14-2 CTatatctcactcctaTT  54_1 -19.40  48144  54 CTATATCTCACTCCTATT 2-12-4 CTatatctcactccTATT  54_2 -22.28  48144  54 CTATATCTCACTCCTATT 3-12-3 CTAtatctcactcctATT  54_3 -21.44  48144  55 CTACTATATCTCACTCCTAT 2-16-2 CTactatatctcactcctAT  55_1 -22.00  48145  55 CTACTATATCTCACTCCTAT 2-14-4 CTactatatctcactcCTAT  55_2 -25.54  48145  56 TACTATATCTCACTCCTAT 2-13-4 TActatatctcactcCTAT  56_1 -23.29  48145  57 CTACTATATCTCACTCCTA 2-15-2 CTactatatctcactccTA  57_1 -21.91  48146  58 TACTATATCTCACTCCTA 2-14-2 TActatatctcactccTA  58_1 -19.66  48146  58 TACTATATCTCACTCCTA 2-12-4 TActatatctcactCCTA  58_2 -23.59  48146  58 TACTATATCTCACTCCTA 3-12-3 TACtatatctcactcCTA  58_3 -22.62  48146  59 CTACTATATCTCACTCCT 2-14-2 CTactatatctcactcCT  59_1 -21.25  48147  59 CTACTATATCTCACTCCT 4-12-2 CTACtatatctcactcCT  59_2 -23.87  48147  60 CTACTATATCTCACTCC 2-13-2 CTactatatctcactCC  60_1 -20.13  48148  60 CTACTATATCTCACTCC 2-11-4 CTactatatctcaCTCC  60_2 -23.00  48148  60 CTACTATATCTCACTCC 3-11-3 CTActatatctcacTCC  60_3 -22.56  48148  61 CCTACTATATCTCACTC 2-11-4 CCtactatatctcACTC  61_1 -21.93  48149  62 CTCCTACTATATCTCACTC 4-13-2 CTCCtactatatctcacTC  62_1 -25.69  48149  63 TCCTACTATATCTCACTC 3-12-3 TCCtactatatctcaCTC  63_1 -23.88  48149  64 CTCCTACTATATCTCACT 4-12-2 CTCCtactatatctcaCT  64_1 -24.87  48150  64 CTCCTACTATATCTCACT 3-12-3 CTCctactatatctcACT  64_2 -22.93  48150  65 TTTCCTCTCCTACTATATC 2-15-2 TTtcctctcctactataTC  65_1 -21.23  48155  66 ATCCATATCCTTTCCT 3-10-3 ATCcatatcctttCCT  66_1 -24.02  48168  67 CATCCATATCCTTTCCT 4-11-2 CATCcatatcctttcCT  67_1 -24.94  48168  68 ATCATCCATATCCTTTCC 4-12-2 ATCAtccatatcctttCC  68_1 -25.69  48169  69 CATCATCCATATCCTTTC 4-12-2 CATCatccatatccttTC  69_1 -23.32  48170  69 CATCATCCATATCCTTTC 2-14-2 CAtcatccatatccttTC  69_2 -20.72  48170  69 CATCATCCATATCCTTTC 2-12-4 CAtcatccatatccTTTC  69_3 -22.56  48170  70 TACATCATCCATATCCTTTC 2-16-2 TAcatcatccatatccttTC  70_1 -22.45  48170  70 TACATCATCCATATCCTTTC 4-14-2 TACAtcatccatatccttTC  70_2 -25.00  48170  70 TACATCATCCATATCCTTTC 2-14-4 TAcatcatccatatccTTTC  70_3 -24.29  48170  71 ACATCATCCATATCCTTT 3-12-3 ACAtcatccatatccTTT  71_1 -22.11  48171  72 CATCATCCATATCCTTT 2-13-2 CAtcatccatatcctTT  72_1 -19.04  48171  72 CATCATCCATATCCTTT 4-11-2 CATCatccatatcctTT  72_2 -21.64  48171  73 TACATCATCCATATCCTTT 2-15-2 TAcatcatccatatcctTT  73_1 -20.76  48171  73 TACATCATCCATATCCTTT 2-13-4 TAcatcatccatatcCTTT  73_2 -23.36  48171  73 TACATCATCCATATCCTTT 3-13-3 TACatcatccatatccTTT  73_3 -22.88  48171  74 ATACATCATCCATATCCTT 2-15-2 ATacatcatccatatccTT  74_1 -20.80  48172  74 ATACATCATCCATATCCTT 4-13-2 ATACatcatccatatccTT  74_2 -23.12  48172  75 TACATCATCCATATCCTT 2-14-2 TAcatcatccatatccTT  75_1 -19.97  48172  75 TACATCATCCATATCCTT 4-12-2 TACAtcatccatatccTT  75_2 -22.52  48172  76 TATACATCATCCATATCCTT 2-16-2 TAtacatcatccatatccTT  76_1 -21.36  48172  77 ATACATCATCCATATCCT 3-12-3 ATAcatcatccatatCCT  77_1 -24.15  48173  77 ATACATCATCCATATCCT 2-14-2 ATacatcatccatatcCT  77_2 -20.55  48173  77 ATACATCATCCATATCCT 2-13-3 ATacatcatccatatCCT  77_3 -22.92  48173  78 ATATACATCATCCATATCCT 2-16-2 ATatacatcatccatatcCT  78_1 -22.04  48173  79 TACATCATCCATATCCT 2-11-4 TAcatcatccataTCCT  79_1 -23.21  48173  79 TACATCATCCATATCCT 2-13-2 TAcatcatccatatcCT  79_2 -19.71  48173  79 TACATCATCCATATCCT 4-11-2 TACAtcatccatatcCT  79_3 -22.27  48173  80 TATACATCATCCATATCCT 2-15-2 TAtacatcatccatatcCT  80_1 -21.11  48173  80 TATACATCATCCATATCCT 3-13-3 TATacatcatccatatCCT  80_2 -25.15  48173  80 TATACATCATCCATATCCT 4-13-2 TATAcatcatccatatcCT  80_3 -24.01  48173  81 ATACATCATCCATATCC 3-11-3 ATAcatcatccataTCC  81_1 -21.79  48174  82 ATATACATCATCCATATCC 4-13-2 ATATacatcatccatatCC  82_1 -23.73  48174  82 ATATACATCATCCATATCC 2-15-2 ATatacatcatccatatCC  82_2 -20.93  48174  83 TATACATCATCCATATCC 2-14-2 TAtacatcatccatatCC  83_1 -20.00  48174  83 TATACATCATCCATATCC 4-12-2 TATAcatcatccatatCC  83_2 -22.90  48174  84 TATATACATCATCCATATCC 2-16-2 TAtatacatcatccatatCC  84_1 -21.49  48174  84 TATATACATCATCCATATCC 4-14-2 TATAtacatcatccatatCC  84_2 -24.29  48174  85 GCTTCATATTTCTCCA 2-12-2 GCttcatatttctcCA  85_1 -20.44  49345  86 CATCTTGTTCTTTACCT 2-13-2 CAtcttgttctttacCT  86_1 -19.67  49581  87 TATATTCACCATTGCC 2-10-4 TAtattcaccatTGCC  87_1 -22.70  49724  88 CCTTATATTCACCATTG 2-13-2 CCttatattcaccatTG  88_1 -19.44  49726  88 CCTTATATTCACCATTG 2-11-4 CCttatattcaccATTG  88_2 -21.25  49726  89 CCTCCTTATATTCACC 4-10-2 CCTCcttatattcaCC  89_1 -24.64  49730  90 CCCTTCCTTTATTCAA 3-10-3 CCCttcctttattCAA  90_1 -23.86  50189  91 CCTTACTGTTAAATCCT 2-13-2 CCttactgttaaatcCT  91_1 -19.81  50475  92 CAGGCAGATAACCTCCAA 3-12-3 CAGgcagataacctcCAA  92_1 -25.31  52419  93 CAGCAGGCAGATAACCTC 3-12-3 CAGcaggcagataacCTC  93_1 -25.88  52422  94 CGAATCTTGACATACAGG 3-12-3 CGAatcttgacatacAGG  94_1 -21.47  53955  95 CTCATACTTGCTTTAAT 4-11-2 CTCAtacttgctttaAT  95_1 -19.10  60821  95 CTCATACTTGCTTTAAT 2-13-2 CTcatacttgctttaAT  95_2 -16.35  60821  96 ACATCTCATACTTGCTT 2-11-4 ACatctcatacttGCTT  96_1 -21.31  60825  96 ACATCTCATACTTGCTT 2-13-2 ACatctcatacttgcTT  96_2 -17.66  60825  96 ACATCTCATACTTGCTT 2-12-3 ACatctcatacttgCTT  96_3 -19.52  60825  97 ACATCTCATACTTGCT 2-10-4 ACatctcatactTGCT  97_1 -21.18  60826  97 ACATCTCATACTTGCT 2-12-2 ACatctcatacttgCT  97_2 -17.70  60826  97 ACATCTCATACTTGCT 2-11-3 ACatctcatacttGCT  97_3 -19.49  60826  97 ACATCTCATACTTGCT 4-10-2 ACATctcatacttgCT  97_4 -20.48  60826  98 TACATCTCATACTTGCT 2-11-4 TAcatctcatactTGCT  98_1 -22.33  60826  98 TACATCTCATACTTGCT 2-13-2 TAcatctcatacttgCT  98_2 -18.85  60826  98 TACATCTCATACTTGCT 4-11-2 TACAtctcatacttgCT  98_3 -21.40  60826  99 CCTACATCTCATACTTGC 3-12-3 CCTacatctcatactTGC  99_1 -26.29  60827  99 CCTACATCTCATACTTGC 2-14-2 CCtacatctcatacttGC  99_2 -22.98  60827  99 CCTACATCTCATACTTGC 2-13-3 CCtacatctcatactTGC  99_3 -24.67  60827  99 CCTACATCTCATACTTGC 2-12-4 CCtacatctcatacTTGC  99_4 -25.70  60827 100 CTACATCTCATACTTGC 3-11-3 CTAcatctcatactTGC 100_1 -22.33  60827 100 CTACATCTCATACTTGC 2-13-2 CTacatctcatacttGC 100_2 -19.41  60827 100 CTACATCTCATACTTGC 2-12-3 CTacatctcatactTGC 100_3 -21.10  60827 101 TACATCTCATACTTGC 3-10-3 TACatctcatactTGC 101_1 -19.94  60827 101 TACATCTCATACTTGC 2-12-2 TAcatctcatacttGC 101_2 -17.15  60827 101 TACATCTCATACTTGC 2-11-3 TAcatctcatactTGC 101_3 -18.85  60827 101 TACATCTCATACTTGC 4-10-2 TACAtctcatacttGC 101_4 -19.71  60827 102 CCTACATCTCATACTTG 4-11-2 CCTAcatctcatactTG 102_1 -22.52  60828 102 CCTACATCTCATACTTG 2-13-2 CCtacatctcatactTG 102_2 -19.67  60828 102 CCTACATCTCATACTTG 3-12-2 CCTacatctcatactTG 102_3 -21.29  60828 102 CCTACATCTCATACTTG 3-11-3 CCTacatctcatacTTG 102_4 -22.31  60828 103 ACCTACATCTCATACTT 3-11-3 ACCtacatctcataCTT 103_1 -21.93  60829 103 ACCTACATCTCATACTT 2-13-2 ACctacatctcatacTT 103_2 -17.76  60829 103 ACCTACATCTCATACTT 2-11-4 ACctacatctcatACTT 103_3 -20.03  60829 103 ACCTACATCTCATACTT 3-12-2 ACCtacatctcatacTT 103_4 -20.26  60829 104 CCTACATCTCATACTT 3-10-3 CCTacatctcataCTT 104_1 -21.50  60829 104 CCTACATCTCATACTT 2-12-2 CCtacatctcatacTT 104_2 -18.21  60829 104 CCTACATCTCATACTT 2-10-4 CCtacatctcatACTT 104_3 -20.48  60829 105 TACCTACATCTCATACTT 4-12-2 TACCtacatctcatacTT 105_1 -22.49  60829 105 TACCTACATCTCATACTT 2-14-2 TAcctacatctcatacTT 105_2 -18.81  60829 105 TACCTACATCTCATACTT 2-13-3 TAcctacatctcataCTT 105_3 -20.48  60829 105 TACCTACATCTCATACTT 2-12-4 TAcctacatctcatACTT 105_4 -21.08  60829 106 TTACCTACATCTCATACTT 3-13-3 TTAcctacatctcataCTT 106_1 -22.30  60829 106 TTACCTACATCTCATACTT 2-15-2 TTacctacatctcatacTT 106_2 -19.40  60829 106 TTACCTACATCTCATACTT 2-14-3 TTacctacatctcataCTT 106_3 -21.08  60829 106 TTACCTACATCTCATACTT 2-13-4 TTacctacatctcatACTT 106_4 -21.67  60829 107 ACCTACATCTCATACT 4-10-2 ACCTacatctcataCT 107_1 -21.72  60830 107 ACCTACATCTCATACT 2-12-2 ACctacatctcataCT 107_2 -17.61  60830 107 ACCTACATCTCATACT 3-11-2 ACCtacatctcataCT 107_3 -20.10  60830 107 ACCTACATCTCATACT 2-10-4 ACctacatctcaTACT 107_4 -20.11  60830 108 TACCTACATCTCATACT 4-11-2 TACCtacatctcataCT 108_1 -22.34  60830 108 TACCTACATCTCATACT 2-13-2 TAcctacatctcataCT 108_2 -18.66  60830 108 TACCTACATCTCATACT 3-12-2 TACctacatctcataCT 108_3 -19.85  60830 108 TACCTACATCTCATACT 3-11-3 TACctacatctcatACT 108_4 -20.44  60830 109 TTACCTACATCTCATACT 2-12-4 TTacctacatctcaTACT 109_1 -21.75  60830 109 TTACCTACATCTCATACT 2-14-2 TTacctacatctcataCT 109_2 -19.25  60830 109 TTACCTACATCTCATACT 3-13-2 TTAcctacatctcataCT 109_3 -20.48  60830 109 TTACCTACATCTCATACT 3-12-3 TTAcctacatctcatACT 109_4 -21.08  60830 110 TTACCTACATCTCATAC 3-11-3 TTAcctacatctcaTAC 110_1 -19.50  60831 110 TTACCTACATCTCATAC 2-13-2 TTacctacatctcatAC 110_2 -16.37  60831 111 GTTACCTACATCTCATA 2-11-4 GTtacctacatctCATA 111_1 -21.69  60832 111 GTTACCTACATCTCATA 2-13-2 GTtacctacatctcaTA 111_2 -18.74  60832 111 GTTACCTACATCTCATA 3-12-2 GTTacctacatctcaTA 111_3 -19.98  60832 112 GTTACCTACATCTCAT 3-10-3 GTTacctacatctCAT 112_1 -20.69  60833 112 GTTACCTACATCTCAT 2-12-2 GTtacctacatctcAT 112_2 -17.37  60833 113 ATATACCCAAAGGCACCT 3-12-3 ATAtacccaaaggcaCCT 113_1 -25.99  62200 114 TCTACTCATCCTTTAACTCA 2-14-4 TCtactcatcctttaaCTCA 114_1 -25.63  62251 115 CCTTAATCTGTATCACT 2-13-2 CCttaatctgtatcaCT 115_1 -19.58  62286 116 CCATACACAGCACATA 2-12-2 CCatacacagcacaTA 116_1 -19.04  62424 117 CTCCATACACAGCACAT 2-13-2 CTccatacacagcacAT 117_1 -20.08  62425 118 CAGAATAATTCTCCTCC 2-13-2 CAgaataattctcctCC 118_1 -19.86  62441 119 GTCCTACATATATACC 4-10-2 GTCCtacatatataCC 119_1 -22.09  66380 120 TGCTTCCTTACTAACC 4-10-2 TGCTtccttactaaCC 120_1 -23.93  66701 120 TGCTTCCTTACTAACC 2-12-2 TGcttccttactaaCC 120_2 -20.10  66701 121 CCCTTTGTAATCATCT 4-10-2 CCCTttgtaatcatCT 121_1 -23.44  66838 122 TCCCTTTGTAATCATCT 2-13-2 TCcctttgtaatcatCT 122_1 -19.97  66838 123 CTGCCATCAATACCAT 2-12-2 CTgccatcaataccAT 123_1 -19.14  68918 124 TCACTGCCATCAATACC 2-13-2 TCactgccatcaataCC 124_1 -21.35  68920 125 ATTCTTACTTTATTCCTCA 2-15-2 ATtcttactttattcctCA 125_1 -20.16  70033 126 TCACTTTCCAGATATCA 4-11-2 TCACtttccagatatCA 126_1 -21.61  77567 126 TCACTTTCCAGATATCA 2-13-2 TCactttccagatatCA 126_2 -18.65  77567 127 TCCTTCAAATTCCACATAC 3-13-3 TCCttcaaattccacaTAC 127_1 -24.09  82053 128 ACATGTCCCTTTATATT 4-11-2 ACATgtccctttataTT 128_1 -20.87  92323 128 ACATGTCCCTTTATATT 2-13-2 ACatgtccctttataTT 128_2 -17.66  92323 128 ACATGTCCCTTTATATT 3-12-2 ACAtgtccctttataTT 128_3 -19.13  92323 128 ACATGTCCCTTTATATT 3-11-3 ACAtgtccctttatATT 128_4 -20.03  92323 129 ACATGTCCCTTTATAT 3-10-3 ACAtgtccctttaTAT 129_1 -20.11  92324 129 ACATGTCCCTTTATAT 2-12-2 ACatgtccctttatAT 129_2 -16.74  92324 130 CCAAGAAAGGAGCAAGCT 3-12-3 CCAagaaaggagcaaGCT 130_1 -25.26  97146 131 TCCAAGAAAGGAGCAAGC 3-12-3 TCCaagaaaggagcaAGC 131_1 -24.12  97147 132 CTCATCCCTCCAAGAAA 4-11-2 CTCAtccctccaagaAA 132_1 -22.58  97156 132 CTCATCCCTCCAAGAAA 2-13-2 CTcatccctccaagaAA 132_2 -19.83  97156 132 CTCATCCCTCCAAGAAA 3-12-2 CTCatccctccaagaAA 132_3 -21.11  97156 133 TCATCCCTCCAAGAAA 4-10-2 TCATccctccaagaAA 133_1 -20.41  97156 133 TCATCCCTCCAAGAAA 2-12-2 TCatccctccaagaAA 133_2 -17.63  97156 133 TCATCCCTCCAAGAAA 3-11-2 TCAtccctccaagaAA 133_3 -19.09  97156 133 TCATCCCTCCAAGAAA 3-10-3 TCAtccctccaagAAA 133_4 -19.81  97156 134 CACCTCCCTATTACATAAA 4-13-2 CACCtccctattacataAA 134_1 -24.18 100018 134 CACCTCCCTATTACATAAA 2-15-2 CAcctccctattacataAA 134_2 -20.51 100018 135 CACCTCCCTATTACATAA 4-12-2 CACCtccctattacatAA 135_1 -23.75 100019 135 CACCTCCCTATTACATAA 2-14-2 CAcctccctattacatAA 135_2 -20.07 100019 136 CCTCCCTATTACATAA 2-12-2 CCtccctattacatAA 136_1 -18.40 100019 137 CTAAATCTTCCAATTCATA 2-15-2 CTaaatcttccaattcaTA 137_1 -18.12 106139 138 TATCCCTTGATTATCCT 2-13-2 TAtcccttgattatcCT 138_1 -20.68 109406 139 CCTCTTTGTCAAATACT 2-13-2 CCtctttgtcaaataCT 139_1 -19.30 110768 140 CAGCTTATTTACCTCTT 2-13-2 CAgcttatttacctcTT 140_1 -19.30 114828 141 ACTCTTTACCTCTAACACT 4-13-2 ACTCtttacctctaacaCT 141_1 -24.26 117468 142 TTACTCTTTACCTCTAACAC 3-14-3 TTActctttacctctaaCAC 142_1 -23.23 117469 143 CCAACCTAATACCTTAATA 2-15-2 CCaacctaataccttaaTA 143_1 -20.27 118639 144 TACCAACCTAATACCTTAA 2-15-2 TAccaacctaataccttAA 144_1 -18.32 118641 145 CCAATACCCACAAACC 3-10-3 CCAatacccacaaACC 145_1 -23.17 124162 145 CCAATACCCACAAACC 2-12-2 CCaatacccacaaaCC 145_2 -20.85 124162 146 CCATTATTCTACTTTGT 3-11-3 CCAttattctacttTGT 146_1 -21.79 125501 146 CCATTATTCTACTTTGT 2-13-2 CCattattctactttGT 146_2 -18.63 125501 147 CATTTCCTTATCTTCACA 2-14-2 CAtttccttatcttcaCA 147_1 -20.39 125529 148 TCATTTCCTTATCTTCACA 4-13-2 TCATttccttatcttcaCA 148_1 -24.13 125529 149 AATAATTCCTCATTTCCT 2-14-2 AAtaattcctcatttcCT 149_1 -18.01 125539 150 ACAATAATTCCTCATTTCC 3-13-3 ACAataattcctcattTCC 150_1 -22.71 125540 150 ACAATAATTCCTCATTTCC 2-15-2 ACaataattcctcatttCC 150_2 -20.23 125540

Designs refer to the gapmer design, F-G-F′, where each number represents the number of consecutive modified nucleosides, e.g 2′ modified nucleosides (first number=5′ flank), followed by the number of DNA nucleosides (second number=gap region), followed by the number of modified nucleosides, e.g. 2′ modified nucleosides (third number=3′ flank), optionally preceded by or followed by further repeated regions of DNA and LNA, which are not necessarily part of the contiguous sequence that is complementary to the target nucleic acid.

For the oligonucleotide compounds capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, and 5-methyl DNA cytosines are presented by “e”, all internucleoside linkages are phosphorothioate internucleoside linkages

Oligonucleotide Synthesis

Oligonucleotide synthesis is generally known in the art. Below is a protocol which may be applied. The oligonucleotides of the present invention may have been produced by slightly varying methods in terms of apparatus, support and concentrations used.

Oligonucleotides are synthesized on uridine universal supports using the phosphoramidite approach on a MerMade12 or an Oligomaker DNA/RNA synthesizer at 1-4 μmol scale. At the end of the synthesis, the oligonucleotides are cleaved from the solid support using aqueous ammonia for 5-16 hours at 60° C. The oligonucleotides are purified by reverse phase HPLC (RP-HPLC) or by solid phase extractions and characterized by UPLC, and the molecular mass is further confirmed by ESI-MS.

Elongation of the Oligonucleotide:

The coupling of β-cyanoethyl-phosphoramidites (DNA-A(Bz), DNA-G(ibu), DNA-C(Bz), DNA-T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA-G(dmf), LNA-T or amino-C6 linker) is performed by using a solution of 0.1 M of the 5′-O-DMT-protected amidite in acetonitrile and DCI (4,5-dicyanoimidazole) in acetonitrile (0.25 M) as activator. For the final cycle a phosphoramidite with desired modifications can be used, e.g. a C6 linker for attaching a conjugate group or a conjugate group as such. Thiolation for introduction of phosphorthioate linkages is carried out by using xanthane hydride (0.01 M in acetonitrile/pyridine 9:1). Phosphordiester linkages can be introduced using 0.02 M iodine in THF/Pyridine/water 7:2:1. The rest of the reagents are the ones typically used for oligonucleotide synthesis.

Purification by RP-HPLC:

The crude compounds are purified by preparative RP-HPLC on a Phenomenex Jupiter C18 10μ 150×10 mm column. 0.1 M ammonium acetate pH 8 and acetonitrile is used as buffers at a flow rate of 5 mL/min. The collected fractions are lyophilized to give the purified compound typically as a white solid.

Abbreviations:

DCI: 4,5-Dicyanoimidazole

DCM: Dichloromethane

DMF: Dimethylformamide

DMT: 4,4′-Dimethoxytrityl

THF: Tetrahydrofurane

Bz: Benzoyl

Ibu: Isobutyryl

RP-HPLC: Reverse phase high performance liquid chromatography

Tm Assay

Oligonucleotide and RNA target duplexes are diluted to 3 mM in 500 ml RNase-free water and mixed with 500 ml 2× Tm-buffer (200 mM NaCl, 0.2 mM EDTA, 20 mM Naphosphate, pH 7.0). The solution is heated to 95° C. for 3 min and then allowed to anneal in room temperature for 30 min. The duplex melting temperatures (Tm) is measured on a Lambda 40 UV/VIS Spectrophotometer equipped with a Peltier temperature programmer PTP6 using PE Templab software (Perkin Elmer). The temperature is ramped up from 20° C. to 95° C. and then down to 25° C., recording absorption at 260 nm. First derivative and the local maximums of both the melting and annealing are used to assess the duplex Tm.

Preparation of Mouse Primary Cortical Neuron Cell Cultures

Primary cortical neuron cultures were prepared from mouse embryo brains of 15 days of age according to standard procedure. In brief, culture plates were coated with Poly-L-Lysine (50 μg/ml Poly-L-Lysine, 10 mM Na-tetraborate, pH 8 buffer) for 2-3 hrs at room temperature. The plates were washed with 1× PBS before use. Harvested mouse embryo brains were dissected and homogenized by a razor blade and submerged into 38 ml dissection medium (HBSS, 0.01 M Hepes, Penicillin/Streptomycin). Then, 2 ml trypsin was added and cells were incubated for 30 min at 37 ° C. and centrifuged down. The cells were dissolved in 20 ml DMEM (+10% FBS) and passed through a syringe for further homogenization. This was followed by centrifugation at 500 rpm for 15 mins. The cells were dissolved in DMEM (+10% FBS) and seeded in 96 well plates (0.1×10̂6 cells/well in 100 μl). The neuronal cell cultures were ready for use directly after seeding.

Screening Oligonucleotides in Mouse Primary Cortical Neuron Cell Cultures

Cells were cultured in growth medium (Gibco Neurobasal medium, B27 supplement, Glutamax, Pencillin-streptomycin) in 96-well plates and incubated with oligonucleotides for 3 days at the desired concentrations. Total RNA was isolated from the cells and the knock-down efficacy was measured by qPCR analysis using the gScript™ XLT One-Step RT-qPCR ToughMix®, Low ROX™ kit from Quanta Bioscience (95134-500). A commercial taqman assays from Thermo Fisher Scientific was used to measure Ube3a_ATS including GAPDH for normalization.

Generation of Human Primary Neuronal Cell Cultures

Any cell lines at any described time point was incubated at 37° C., 5% CO2 concentration and 95% relative humidity.

Human Induced Pluripotent Stem Cells (hIPSC) Culture

Whole human blood samples were obtained from patients diagnosed with Angelman syndrome. The subsequent cultures of primary Peripheral Blood Mononuclear Cells (PBMCs) were enriched for erythroblasts. Patient-specific IPSC lines were generated by reprogramming erythroblast with CytoTune-iPS Sendai Reprogramming Kit (Thermo Fisher Scientific). Derived IPSC lines were maintained in feeder-free conditions using hESC-qualified Matrigel (Corning) in mTESR1 (STEMCELL Technologies) with daily medium replacement. Upon reaching confluence, colonies were dissociated into cell cluster of 50-200 μm in size using Gentle Cell Dissociation Reagent (STEMCELL Technologies) and subcultured at a ratio of 1:10-1:20 in the presence of 10 μM Y-27632 (Calbiochem).

Differentiation into Neural Progenitor Cells (NPC)

Upon induction of neural differentiation IPSC-derived cells were maintained in basal medium composed of equal volumes of DMEM:F12 Glutamax medium and Neurobasal medium (Gibco, Invitrogen), supplemented with 1× B27 (Gibco, Invitrogen), 1× N2 (Gibco, Invitrogen), 0.1 mM beta-mercaptoethanol (Gibco, Invitrogen) and indicated supplements.

Neural progenitor cells (NPCs) were derived from hIPSCs by dual SMAD inhibition and according to published procedures with slight modifications (Chambers et al. 2009 Nat Biotechnol. Vol. 3 pp. 275-80, Boissart et al., 2013 Transl Psychiatry. 3:e294). HIPSCs were dissociated with Accutase (Innovative Cell Technologies Inc.) into a single cell suspension and resuspended in MT medium further supplemented with 10 μM Y-27632 (Calbiochem), 5 ng/ml FGF (Peprotech), 10 μM SB-431542 (Calbiochem) and 100 nM LDN (Calbiochem). Single cell suspension was transferred to AggreWell800 plates (STEMCELL Technologies) enabling the formation of aggregates consisting of 8000 cells. After 5 days neural aggregates were transferred onto plates coated with poly-L-ornithine (Sigma) and laminin (Roche) and allowed to form neural rosettes under continued dual SMAD inhibition (SB-431542 and LDN) in basal medium supplemented with FGF. Neural rosettes were selectively isolated using STEMdiff™ Neural Rosette Selection Reagent (STEMCELL Technologies), replated onto dishes coated with poly-L-ornithine and Laminin521 (BioLamina) and expanded in basal medium supplemented with 10 ng/ml FGF (Peprotech), 10 ng/ml EGF (RnD), and 20 ng/ml BDNF (Peprotech). When reaching confluency, cells were enzymatically dissociated with 0.05% Trypsin/EDTA (Gibco, Invitrogen) and sub-cultured. Continued passaging in basal medium supplemented with FGF, EGF and BDNF leads to a stable neural progenitor cell line (NPC line) within 10 to 20 passages. A stable neural progenitor cell line is defined by its capacity to self-renew and by the expression of the developmental stage-specific markers Sox2 and Nestin. Upon specific stimuli, NPCs differentiate into neuronal (MAP2+, Tau+, HuC/D+) and astroglial (GFAP+) progenies (Dunkley et al., 2015 Proteomics Clin Appl. Vol. 7-8 pp. 684-94).

NPC Culture

Conditions for NPC culture have been described previously and were used with slight modifications (Boissart et al., 2013 Transl Psychiatry. 3:e294). In brief, cells were maintained in dishes coated with Laminin521 (BioLamina) and cultured in basal medium [composed of equal volumes of DMEM:F12 Glutamax medium and Neurobasal medium (Gibco, Invitrogen), supplemented with 1× B27 (Gibco, Invitrogen), 1× N2 (Gibco, Invitrogen), 0.1 mM beta-mercaptoethanol (Gibco, Invitrogen)] and supplemented with 10 ng/ml FGF (Peprotech), 10 ng/ml EGF (RnD), and 20 ng/ml BDNF (Peprotech).

Differentiation into Neuronal Cell Culture

To induce neuronal differentiation of NPC, cells were dissociated with 0.05% Trypsin/EDTA (Gibco, Invitrogen) into single cell suspension and seeded onto Laminin521 (BioLamina) coated dishes at a density of 12.000 cells/cm2 and maintained in basal medium supplemented with 200 ng/ml Shh (Peprotech), 100 ng/ml FGF8 (Peprotech), and 100 μM ascorbic acid phosphate (Sigma) for a period of 7 days. Subsequently, cells were replated in basal medium supplemented with 20 ng/ml BDNF (Peprotech), 10 ng/ml GDNF (Peprotech), 0.5 mM cAMP (BIOLOG Life Science), and 100 μM ascorbic acid phosphate (Sigma) at a density of 45000 cells/cm2 and differentiated for a period of 21 days. At day 21 of differentiation, differentiated neuronal cultures were replated onto the screening-compatible plate format. Replating was performed by dissociating the cultures with Accutase (Innovative Cell Technologies Inc.) into a single cell suspension. Cells were seeded at a density of 200.000 cells/cm2 in presence of 10 μm Y-27632 (a cell-permeable, reversible, inhibitor of Rho kinases from Calbiochem) into the 384 well microtiter plates for final oligonucleotides screening assay. Neuronal cultures were further differentiated for additional 7 days in basal medium supplemented with 20 ng/ml BDNF (Peprotech), 10 ng/ml GDNF (Peprotech), 0.5 mM cAMP (BIOLOG Life Science), and 100 μM ascorbic acid phosphate (Sigma). Differentiation medium was exchanged twice per week. After a total differentiation period of 35 days neuronal cell cultures were ready for oligonucleotide treatment.

Screening Oligonucleotides in Human Neuronal Cell Cultures

For screening, oligonucleotide stocks were pre-diluted to the indicated concentrations with water into 384 well microtiter plates (compound plate). The plate layout served as a treatment template. Two microliter oligonucleotide dilution from each well was transferred from the compound plate to a respective culture plate. All liquid handling was done under sterile conditions in a laminar flow using a semi-automated laboratory robotic system (Beckmancoulter). Neuronal cell cultures were incubated with oligonucleotides for 5 days without media change. Subsequently, neuronal cultures were lysed and processed for qPCR assay with RealTime ready Cell lysis and RNA Virus Master kit (Roche). Liquid handling was performed using a semi-automated laboratory robotic system (Beckmancoulter). Samples were analyzed by a Lightcycler480 real-time PCR system (Roche).

Activity of the oligonucleotides was assessed by qPCR monitoring transcript abundance of UBE3A using the following primers and probes

UBE3a-Sense: Forward primer: ATATGTGGAAGCCGGAATCT, Reverse primer: TCCCAGAACTCCCTAATCAGAA, Internal probe labeled with dye FAM: ATGACGGTGGCTATACCAGG

The RT-qPCR was multiplexed with PPIA (peptidylprolyl isomerase A) as housekeeping gene for normalization. PPIA primers and probe labeled with the dye VIC were purchased from

Thermo Fisher Scientific (assay ID Hs99999904_m1). Each plate includes a non-targeting oligonucleotide (mock) as negative control (TTGaataagtggaTGT) and a reference oligonucleotide CMP ID NO: 41_1, resulting in up-regulation of UBE3A mRNA.

Selectivity of oligonucleotides was verified by counter screening for SNORD 115 transcript, which is located upstream of SNORD109B on chromosome 15. Expression of SNORD115 was monitored by qPCR using the following primers and probe

Forward primer: GGGTCAATGATGAGAACCTTAT, Reverse primer: GGGCCTCAGCGTAATCCTATT, Internal probe labeled with the dye FAM: TTCTGAAGAGAGGTGATGACTTAAAA

The RT-qPCR was multiplexed with PPIA (Thermo Fisher Scientific) upon oligonucleotide treatment.

The reduction of the SNHG14 transcript downstream of SNORD109B (also termed the UBE3A suppressor) was measured by RT-qPCR using the following primers and probe

Forward primer: ATCCGAGGCATGAATCTCAC, Reverse primer: CAGGCCAAAACCCTTGATAA, Internal probe labeled with dye FAM: TTGCTGAGCATTTTTGCATC)

The RT-qPCR was multiplexed with PPIA (Thermo Fisher Scientific).

Data are presented as average % expression relative to mock across all plates and normalized to the reference oligonucleotide to account for plate to plate variation

Screening Oligonucleotides in Human Neuronal Cell Cultures —96 Well System

For screening, oligonucleotide stocks were pre-diluted to the indicated concentrations with water into 96 well microtiter plates (compound plate). The plate layout served as a treatment template. Two microliter oligonucleotide dilution from each well was transferred from the compound plate to a respective culture plate. All liquid handling was done under sterile conditions in a laminar flow using a semi-automated laboratory robotic system (Beckman Coulter). Neuronal cell cultures were incubated with oligonucleotides for 5 days without media change. Subsequently, neuronal cultures were lysed and RNA purified using RNA purification kit Pure Link Pro96 (12173011A) LifeTechnologies. Liquid handling was performed using a semi-automated laboratory robotic system (Beckmancoulter). qPCR analysis of Ube3a and Ube3a-ATS was carried out on a ViiA™ 7 Real-Time PCR System Thermo Fisher Scientific using the qScript™ XLT 1-Step RT-qPCR ToughMix Low ROX, from Quanta (95134-50). The following primers and probes were used: qPCR UBE3a-Sense:

Forward primer: ATATGTGGAAGCCGGAATCT, Reverse primer: TCCCAGAACTCCCTAATCAGAA, Internal probe labeled with dye FAM: ATGACGGTGGCTATACCAGG

qPCR SNHG14 transcript downstream of SNORD109B (also termed the UBE3A suppressor): Commercially available primer and probe set from Thermo Fisher: Hs01372957_m1. These primers amplifies a 87 bp exon-exon spanning sequence in the Genbank transcript AF400500.1 QPCR GAPDH transcript:

Commercially available primer and probe set from Thermo Fisher: Gene Symbol: with following assay details: RefSeq: NM_002046.3, Probe Exon Location:3, Amplicon Size: 122 bp. Corresponding TaqMan Assay ID: Hs99999905_m1.

The RT-qPCR for both Ube3a and Ube3a-ATS was multiplexed with GAPDH as housekeeping gene for normalization. Each plate includes a non-targeting oligonucleotide (mock) as negative control (TTGaataagtggaTGT) and a reference oligonucleotide CMP ID NO: 21_1, resulting in up-regulation of UBE3A mRNA. Moreover panel of control oligonucleotides not targeting Ub3a or SNHG14 transcript downstream of SNORD109B (also termed the UBE3A suppressor) were included to monitor the assay noise and risk of detecting false positives. These were randomly distributed over the plates.

Control Oligonucleotides:

SEQUENCE CGAaccactgaaCAA CGAaccactgaacAAA CGAagtgcacaCG GCGtaaagagaGGT GAGAaggcacagaCGG GCGaagtgcacaCGG GAGaaggcacagaCGG CGAaccactgAACA GAAccactgaacAAA caGCGtaaagagaGG GCgtaaagagAGG CGAaccactgaAC CGAAccactgaaCAAA AGCgaagtgcacaCGG AGGtgaagcgaAGTG TAGTaaactgagCCA AGAaggcacagaCGG CCGcagtatggaTCG

Generation of Cynomolgus Primary Neuronal Cell Cultures

Any cell lines at any described time point was incubated at 37° C., 5% CO2 concentration and 95% relative humidity.

Cynomolgus Induced Pluripotent Stem Cells (cIPSC) Culture

All animal procedures were performed in accordance with the guidelines of the National Institutes of Health and approved by the Institutional Animal Care and Use Committee (IACUC) affiliated with Roche 340 Kingsland Street Nutley, N.J. 07110, USA (closed 2014). Cynomolgus IPSCs were established from kidney fibroblasts from a female, 14-year-old Mauritian Cynomolgus monkey using Sendai virus particles (CytoTune-iPS Sendai Reprogramming Kit, Thermo Fisher Scientific) harboring the Yamanaka factors (Oct4, Sox2, Klf4, and C-Myc) (Takahashi, K. & Yamanaka, S., 2006). Five days post-transfection, cells were passed onto mitomycin C inactivated feeders at varying densities and cultured in hESC media (knock-out DMEM:F12 supplemented with 20% knock-out serum replacement, 0.1 mM non-essential amino acids, 2 mM L-glutamine, 0.1 mM 2-mercaptoethanol, and 8 ng/ml bFGF, all from Life Technologies). Twenty days post-transfection clones with ES-like morphologies were selected for further passaging. The cells were routinely passaged every 3-4 days by manual dissociation of colonies. After at least 10 passages, cIPSCs were adapted to feeder-free culture conditions (MT medium supplemented with 15 ng/ml FGF2 (Peprotech) and 10 ng/ml ActivinA (Peprotech)) based on Ono et al.; 2014 with the modification that cells were cultured on Matrigel (BD

Bioscience)-coated plates and that Y-27632 (Calbiochem) was used instead of Thiazovivin when the cells were in single cell suspension. MT medium is a defined medium that contains Dulbecco's Modified Eagle Medium with Ham's F12 Nutrient Mixture (DMEM/F12) with 2.5 mM GlutaMAX™, 7 μg/ml insulin, 450 μM monothioglycerole, 1× Lipid concentrate, 5 mg/ml BSA, 14 ng/ml sodium selenite, 1× non-essential amino acids, 2 mg/ml heparin, 15 μg/ml transferrin, and 220 μM ascorbic acid-2-phosphate. The cells were passaged every 2-4 days using Gentle Cell Dissociation Reagent (Stem Cell Technologies). One clone was chosen for further experiments and used for all the following assays.

Differentiation into Neural Progenitor Cells (NPC)

Upon induction of neural differentiation cIPSC-derived cells (see FIG. 4: day 1) were maintained in basal medium composed of equal volumes of DMEM:F12 Glutamax medium and Neurobasal medium (Gibco, Invitrogen), supplemented with 1× B27 (Gibco, Invitrogen), 1× N2 (Gibco, Invitrogen), 0.1 mM beta-mercaptoethanol (Gibco, Invitrogen) and indicated supplements. Neural progenitor cells (NPCs) were derived from cIPSCs by dual SMAD inhibition and according to published procedures with slight modifications (Chambers et al. 2009 Nat Biotechnol. Vol. 3 pp. 275-80, Boissart et al., 2013 Transl Psychiatry. 3:e294). CynolPSCs were dissociated with Accutase (Innovative Cell Technologies Inc.) into a single cell suspension and resuspended in MT medium supplemented with 10 μM Y-27632 (Calbiochem). Single cell suspension was transferred to AggreWell800 plates (STEMCELL Technologies) enabling the formation of aggregates consisting of 12000 cells (see FIG. 4: EB formation). For the next five consecutive days 1.5 ml of medium per AggreWell was replaced by basal medium supplemented with 5 ng/ml FGF (Peprotech), 10 μM SB-431542 (Calbiochem) and 100 nM LDN-193189 (Calbiochem). After 5 days neural aggregates were transferred onto plates coated with poly-L-ornithine (Sigma) and laminin (Roche) and allowed to form neural rosettes under continued dual SMAD inhibition (SB-431542 and LDN-193189) in basal medium supplemented with FGF (see FIG. 4: Harvesting). Neural rosettes were selectively isolated by manual dissection, thereafter replated onto dishes coated with poly-L-ornithine and Laminin521 from BioLamina (see FIG. 4: neural rosette isolation) and expanded in basal medium supplemented with 10 ng/ml FGF (Peprotech), 10 ng/ml EGF (RnD), and 20 ng/ml BDNF (Peprotech). When reaching confluency, cells were enzymatically dissociated with 0.05% Trypsin/EDTA (Gibco, Invitrogen) and sub-cultured. Continued passaging in basal medium supplemented with FGF, EGF and BDNF leads to a stable neural progenitor cell line (NPC line) within 5 to 10 passages (see FIG. 4, day 24-45). A stable neural progenitor cell line is defined by its capacity to self-renew and by the expression of the developmental stage-specific markers Sox2 and Nestin. Upon specific stimuli, cyno NPCs differentiate into neuronal MAP2+ cells.

NPC Culture

Conditions for NPC culture have been described previously and were used with slight modifications (Boissart et al., 2013 Transl Psychiatry. 3:e294). In brief, cells were maintained in dishes coated with Laminin521 (BioLamina) and cultured in basal medium [composed of equal volumes of DMEM:F12 Glutamax medium and Neurobasal medium (Gibco, Invitrogen), supplemented with 1× B27 (Gibco, Invitrogen), 1× N2 (Gibco, Invitrogen), 0.1 mM beta-mercaptoethanol (Gibco, Invitrogen)] supplemented with 10 ng/ml FGF (Peprotech), 10 ng/ml EGF (RnD), and 20 ng/ml BDNF (Peprotech).

Differentiation into Neuronal Cell Culture

To induce neuronal differentiation of NPC, cells were dissociated with 0.05% Trypsin/EDTA (Gibco, Invitrogen) into single cell suspension and seeded onto Laminin521 (BioLamina) coated dishes at a density of 30.000 cells/cm2 and maintained in basal medium supplemented with 200 ng/ml Shh (Peprotech), 100 ng/ml FGF8 (Peprotech), and 100 μM ascorbic acid phosphate (Sigma) for a period of 7 days. Subsequently, cells were replated in basal medium supplemented with 20 ng/ml BDNF (Peprotech), 10 ng/ml GDNF (Peprotech), 0.5 mM cAMP (BIOLOG Life Science), and 100 μM ascorbic acid phosphate (Sigma) at a density of 45000 cells/cm2 and differentiated for a period of 21 days. At day 21 of differentiation, differentiated NCs were dissociated and reseeded onto the screening-compatible plate format. Replating was performed by dissociating the cultures with Accutase (Innovative Cell Technologies Inc.) into a single cell suspension. Cells were seeded at a density of 200000 cells/cm2 in presence of 10 μM Y-27632 (a cell-permeable, reversible, inhibitor of Rho kinases from Calbiochem) into the 384 well microtiter plates for final oligonucleotides screening assay. Neuronal cultures were further differentiated for additional 7 days in basal medium supplemented with 20 ng/ml BDNF (Peprotech), 10 ng/ml GDNF (Peprotech), 0.5 mM cAMP (BIOLOG Life Science) and 100 μM ascorbic acid phosphate (Sigma). Differentiation medium was exchanged twice per week. After a total differentiation period of 35 days neuronal cell cultures were ready for oligonucleotide treatment.

Screening Oligonucleotides in Cyno Neuronal Cell Cultures—96 Well System

For screening, oligonucleotide stocks were pre-diluted to the indicated concentrations with water into 96 well microtiter plates (compound plate). The plate layout served as a treatment template. Two microliter oligonucleotide dilution from each well was transferred from the compound plate to a respective culture plate. All liquid handling was done under sterile conditions in a laminar flow using a semi-automated laboratory robotic system (Beckmancoulter). Neuronal cell cultures were incubated with oligonucleotides for 5 days without media change. Subsequently, neuronal cultures were lysed and purified using PureLink® Pro 96 total RNA Purification Kit (Thermo Fisher) and thereafter processed for qPCR assay with qScript XLT One-Step RT-qPCR Tough Mix, Low ROX (Quanta Biosiences). Liquid handling was performed using a semi-automated laboratory robotic system (Integra Assist and Integra Viaflo). Samples were analyzed by a Lightcycler480 real-time PCR system (Roche).

Activity of the oligonucleotides was assessed by qPCR monitoring transcript abundance of UBE3A-Sense and UBE3A-Antisense using the following primers and probes:

UBE3a-Sense: HS00166580_VIC Taqman assay (Thermo Fisher)

UBE3A-Antisense: HS01372957_VIC Taqman assay (Thermo Fisher)

The RT-qPCR was multiplexed with TBP (TATA-Box Binding Protein) as housekeeping gene for normalization. TBP primers and FAM labeled probe were purchased from Roche (REF.:05532957001, Assay Id. 101145). Each plate includes a non-targeting oligonucleotide (mock) as negative control (TTGaataagtggaTGT).

Data are presented as average percentage expression relative to mock treated conditions.

Immunocytofluorescence Staining

Cells were fixed with 4% PFA and permeabilized with 0.1% TritonX (Sigma) in PBS (with Ca2+ and Mg2+). Blocking was performed using SuperBlock solution (Thermo Fisher Scientific) supplemented with 0.1% TritonX. Cells were stained with the following primary antibodies: anti-SOX2 (Milipore AB5603), anti-GFAP (Dako Z033401), anti-HuC/D (Invitrogen A21271), anti-Nestin (Millipore mab5326) and anti-Map2 (Neuromics CH22103). Subsequently, the cells were washed and stained with secondary antibodies conjugated either to Alexa488, Alexa555 or Alexa647 (all Molecular Probes). Nuclei were stained with Hoechst 1:1000 (Molecular Probes). The cells were imaged using an Axiovert microscope (Zeiss) or an Operetta high content imaging system (Perkin Elmer). Images were analyzed using ImageJ software.

qPCR Analysis

RNA from cIPSC, cyno differentiated NCs, hESCs and human differentiated NCs was isolated using the miRNeasy Mini kit (QIAGEN) and qPCR analysis was performed (for human cells using the Ag-Path-ID One-Step RT-PCR kit, Ambion; for cyno cells reverse transcription was performed using the Transcriptor First Strand cDNA synthesis kit, Roche and qPCR using LightCycler 480 Probes Master, Roche). The following primers and probes were used: for human cells: NES Hs04187831_g1; MAP2 Hs00258900_m1; ASCL1 Hs00269932_m1; SOX2 Hs01053049_s1; ELAVL3 Hs00154959_m1; GAPDH 4352665, all from Thermo Fisher/Applied Biosystems; UBE3A-ATS Fw primer: CAA ATG CCT CAC CCA CTC TT, RV primer: CCA GCT GTC AAC ATG TGC TT, internal oligo: AAG TGC GCT CCT GTG AAA AG; UBE3A Fw primer: TCT GGG AAA TCG TT CATT CA, RV primer: TGT AGG TAA CCT TTC TGT GTC TGG, internal oligo TAC AAC GGG CAC AGA CAG AG. For cyno cells: NANOG Assay ID 700103, POU5F1 Assay ID 113034, SOX2 Assay ID 111867, NESTIN Assay ID 138150, PAX6 Assay ID 136139, SOX1 Assay ID 136988, ZIC1 Assay ID 112077, ASCL1 Assay ID 700027, TUBB3 Assay ID 700047, GAPDH Cat N.04694333001, Probe #147; TBP Assay ID 101145, all purchased from Roche.

UBE3A-ATS Fw primer: AATGCAAAGGCAGCAGTACA, Rv primer: TTGGGGAGTTGGTTATTGGA, internal oligo TGACACCACCAGAAGAACACA; UBE3A sense: Fw primer: ATATGTGGAAGCCGGAATCT, Rv primer: TCCCAGAACTCCCTAATCAGAA, internal oligo: ATGACGGTGGCTATACCAGG.

RNA Sequencing Analysis

RNA isolation was performed using the miRNeasy Mini kit (QIAGEN). Library preparation was performed using the TruSeq Stranded Total RNA LT kit (illumina) with Ribo-Zero Gold depletion. Cluster generation was performed using the cBOT instrument and the HiSeq PE Cluster kit v4. Sequencing was performed on the HiSeq 2500 instrument as paired-end Single-indexed Sequencing run (2×125 cycles) with the following reagents: HiSeq SBS Kit v4 250 cycles (illumina).

Western Blot Analysis

For protein expression studies, the cells were collected by scraping and flash frozen. The pellets were lysed using Cytobuster (Millipore) completed with phosphatase and protease inhibitors and DNAse (all from Roche). The protein concentration in the extracts was measured by BCA assay (Thermo Scientific) and the solution loaded to a polyacrylamide gel (Invitrogen). After electrophoresis, the proteins were blotted on a nitrocellulose membrane using the iBlot system (Invitrogen). The antibodies used to detect the proteins of interest were anti-hTau HT7 (Pierce MN1000), anti-pTauS422 (Roche) anti-pTauS404 (Abcam ab92676); these were detected by an appropriate HRP-conjugated secondary antibody. The complex was detected by luminescence using SuperSignal West Dura Extended Duration Substrate (Thermo Fisher) using an imager (Biorad).

REFERENCES

Ono, T. et al. A single-cell and feeder-free culture system for monkey embryonic stem cells. PLoS One 9, e88346, doi: 10.1371/journal.pone.0088346 (2014).

Takahashi, K. & Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676, doi: 10.1016/j.ce11.2006.07.024 (2006).

Example 1 Oligonucleotide Activity in Mouse Primary Neuronal Cell Cultures

Oligonucleotides targeting the part of SNHG14 long non-coding RNA which is antisense to the UBE3A pre-mRNA (position 55319 to 141053 of SEQ ID NO: 1) were tested for their ability to reduce the SNHG14 long non-coding RNA transcript preventing UBE3A expression (also termed UBE3A suppressor or UBE3A-SUP in the data table) and their ability to induce UBE3A mRNA re-expression in mouse primary cortical neuron cell cultures, obtained as described in the “Materials and methods” section above. The oligonucleotide concentration was 5 microM.

The oligonucleotides were screened according to the protocol for screening in mouse cortical neuron cell cultures described in the section “Materials and methods”. The results are shown in table 4.

TABLE 4 Oligonucleotide activity in primary mouse neuronal cell cultures. CMP % of Mock % of Mock ID NO oligonucleotide UBE3A_SUP sd UBE3A sd  95_1 CTCAtacttgctttaAT  3.6  0.1 154.1 15.1  95_2 CTcatacttgctttaAT 15.9  2.6 119.8 12.4  96_1 ACatctcatacttGCTT  4.0  0.5 149.9 11.5  96_2 ACatctcatacttgcTT  9.3  3.9 139.9 36.4  96_3 ACatctcatacttgCTT  3.1  0.2 143.2  3.9  97_1 ACatctcatactTGCT  4.0  1.5 154.5 10.0  97_2 ACatctcatacttgCT  6.1  1.7 141.1 14.1  97_3 ACatctcatacttGCT  3.7  0.6 162.7 15.0  97_4 ACATctcatacttgCT  5.2  0.4 156.7 24.4  98_1 TAcatctcatactTGCT  5.0  0.9 159.0 15.6  98_2 TAcatctcatacttgCT 15.5  5.3 130.4  3.4  98_3 TACAtctcatacttgCT  4.7  0.4 140.3 38.2 101_1 TACatctcatactTGC  2.6  0.5 152.6 10.2 101_2 TAcatctcatacttGC 19.2  6.0 112.0 15.0 101_3 TAcatctcatactTGC  3.5  0.4 117.2 13.7 101_4 TACAtctcatacttGC  3.0  0.7 140.5 12.4 100_1 CTAcatctcatactTGC  5.4  0.8 160.4  4.1 100_2 CTacatctcatacttGC  9.6  3.7 159.2 14.5 100_3 CTacatctcatactTGC  3.0  0.1 133.2  5.9 99_2 CCtacatctcatacttGC  7.8  1.4 150.7 11.0 99_3 CCtacatctcatactTGC  3.2  0.6 134.7 12.5 99_4 CCtacatctcatacTTGC  2.7  0.2 145.2  4.7 102_1 CCTAcatctcatactTG  5.8  1.7 127.0 24.5 102_2 CCtacatctcatactTG 20.2  6.6 129.7  9.2 102_4 CCTacatctcatacTTG  4.0  0.6 140.2  7.2 102_3 CCTacatctcatactTG  3.9  1.0 133.3 10.0 104_1 CCTacatctcataCTT  6.6  1.5 136.5  8.7 104_3 CCtacatctcatACTT  3.5  0.4 131.4  6.0 103_1 ACCtacatctcataCTT  5.8  1.4 130.8  0.7 103_2 ACctacatctcatacTT 11.4  2.2 123.6 12.4 103_3 ACctacatctcatACTT  5.8  0.8 132.2  4.5 105_1 TACCtacatctcatacTT  5.2  0.8 152.3  7.2 106_1 TTAcctacatctcataCTT 13.3  3.0 140.1 17.5 106_2 TTacctacatctcatacTT 21.0  1.4 116.9 15.0 107_1 ACCTacatctcataCT  6.2  0.9 119.2  3.4 107_2 ACctacatctcataCT 14.3  7.4 142.9 13.7 108_1 TACCtacatctcataCT  5.6  1.0 127.0 10.7 108_2 TAcctacatctcataCT 21.4 12.5 117.1  8.5 109_1 TTacctacatctcaTACT  4.4  0.4 138.9  1.2 109_2 TTacctacatctcataCT 22.9  3.3 117.1 13.0 110_1 TTAcctacatctcaTAC  8.7  2.1 133.2  5.1 110_2 TTacctacatctcatAC 21.0  5.1 111.4 11.1 111_1 GTtacctacatctCATA  8.0  2.4 143.8 14.8 111_2 GTtacctacatctcaTA 19.0  2.3 115.4  4.1 112_1 GTTacctacatctCAT  6.6  1.4 145.5 16.8 112_2 GTtacctacatctcAT 15.8  4.5 120.3  8.1 126_1 TCACtttccagatatCA  8.0  1.9 133.8  5.4 126_3 TCactttccagatatCA 53.4 75.9 112.0 11.4 128_1 ACATgtccdttataTT 16.3  2.5 114.7 11.1 128_2 ACatgtccdttataTT 14.8  1.1 136.9  6.2 129_1 ACAtgtccdttaTAT 11.8  1.9 135.0 14.3 132_1 CTCAtccctccaagaAA  9.1  1.6 131.7  8.4 132_2 CTcatccctccaagaAA 11.2  3.9 159.3 17.7

Example 2 Oligonucleotide Activity in Human Neuronal Cell Cultures

Oligonucleotides targeting human SNHG14 in the region downstream of SNORD109B corresponding to position 25278410 to 25419462 on chromosome 15 (SEQ ID NO: 1) were tested in patient derived human neuronal cell cultures (see protocol in “Materials and methods” section). The oligonucleotides ability to reduce the SNHG14 transcript in the region downstream of SNORD109B (also termed UBE3A suppressor or UBE3A-SUP in the data table), without affecting expression of SNORD115 was analyzed. Furthermore, the ability to induce UBE3A mRNA re-expression was analyzed.

The oligonucleotides were screened according to the protocol for screening oligonucleotides in human neuronal cell cultures described in the section “Materials and methods” above.

The results are shown in table 5. The expression of UBE3A mRNA has been measured for all compounds, whereas the knock-down of the UBE3A suppressor and the maintenance of SNORD1115 levels have not been analyzed for all compounds.

TABLE 5 Oligonucleotide activity in patient derived human neuronal cell cultures. Start % of Mock % of Mock % of Mock SEQ ID CMP Oligo conc Oligo conc Oligo conc NO 1 ID NO Target 0.2 μM sd 1.0 μM sd 5.0 μM sd 1678  10_1 UBE3A 107 14 88 10 151 8 1679  12_2 UBE3A 100 9 87 14 158 16 1687  20_1 UBE3A 87 7 102 22 213 44 1712  21_1 UBE3A 127 23 166 6 178 13 1712  21_1 UBE3A-SUP 81 3 82 8 72 12 1712  21_1 SNORD115 115 6 142 24 169 26 4167  22_1 UBE3A 87 5 90 8 146 20 4170  27_1 UBE3A 94 16 106 11 170 10 4171  29_2 UBE3A 86 13 100 12 194 35 4172  30_1 UBE3A 96 6 121 12 209 27 9210  35_1 UBE3A 88 5 112 23 195 27 10838  37_1 UBE3A 77 7 85 9 169 24 15565  38_2 UBE3A 93 11 108 6 167 34 22209  42_1 UBE3A 125 16 143 14 180 17 22209  42_1 UBE3A-SUP 108 14 98 15 85 18 22209  42_1 SNORD115 101 14 93 25 127 21 30449  43_1 UBE3A 99 5 95 13 115 8 30451  44_1 UBE3A 99 15 80 20 141 17 30451  44_2 UBE3A 98 31 104 16 119 7 30697  46_1 UBE3A 91 8 87 5 167 20 36066  49_1 UBE3A 95 6 111 10 155 29 36066  49_1 UBE3A-SUP 76 7 84 24 110 31 36066  49_1 SNORD115 99 14 111 20 94 6 36068  50_1 UBE3A 109 15 105 11 92 14 36068  50_1 UBE3A-SUP 122 24 93 28 73 7 36068  50_1 SNORD115 120 15 113 12 99 6 37206  51_1 UBE3A 114 16 101 7 101 3 37206  51_1 UBE3A-SUP 128 21 67 9 84 13 37206  51_1 SNORD115 140 26 110 9 100 11 46130  52_1 UBE3A 139 3 160 1 236 36 46130  52_1 UBE3A-SUP 135 16 133 26 160 32 46130  52_1 SNORD115 104 8 119 14 100 8 48145  59_1 UBE3A 179 3 122 17 115 NA 48170  76_1 UBE3A 85 16 100 8 155 12 48171  80_1 UBE3A 120 7 114 10 172 20 48171  78_1 UBE3A 136 31 103 20 169 11 48172  82_2 UBE3A 96 11 121 4 186 32 48172  84_1 UBE3A 95 14 100 8 158 14 49343  85_1 UBE3A 97 22 121 10 189 17 49722  87_1 UBE3A 111 9 126 11 177 22 52417  92_1 UBE3A 133 7 140 30 140 8 52417  92_1 UBE3A-SUP 88 14 80 14 82 8 52417  92_1 SNORD115 102 8 114 20 91 9 52420  93_1 UBE3A 111 14 120 9 126 16 52420  93_1 UBE3A-SUP 104 23 82 20 79 8 52420  93_1 SNORD115 110 11 114 17 95 7 53953  94_1 UBE3A 117 12 147 15 166 15 53953  94_1 UBE3A-SUP 92 18 81 5 86 22 53953  94_1 SNORD115 124 33 122 17 106 14 60819  95_1 UBE3A 103 11 131 14 175 7 60819  95_1 UBE3A-SUP 93 13 87 3 74 6 60819  95_1 SNORD115 162 19 158 20 201 11 60819  95_2 UBE3A 147 10 129 20 117 2 60819  95_2 UBE3A-SUP 118 24 87 13 83 8 60819  95_2 SNORD115 104 17 118 10 129 6 60823  96_1 UBE3A 115 16 135 19 174 17 60823  96_1 UBE3A-SUP 104 25 93 32 91 11 60823  96_2 UBE3A 108 7 114 9 115 13 60823  96_2 UBE3A-SUP 99 17 92 19 93 10 60824  97_1 UBE3A 111 12 134 23 169 14 60824  97_1 UBE3A-SUP 110 27 105 33 92 10 60824  97_2 UBE3A 124 13 126 12 124 11 60824  97_2 UBE3A-SUP 113 17 107 33 96 20 60824  98_1 UBE3A 111 16 119 11 138 14 60824  98_1 UBE3A-SUP 118 34 98 23 82 19 60824  98_1 SNORD115 109 11 123 18 114 16 60824  98_2 UBE3A 128 10 109 7 136 12 60824  98_2 UBE3A-SUP 91 15 77 11 110 16 60824  98_2 SNORD115 101 3 110 7 124 11 60825  99_1 UBE3A 125 6 115 5 131 10 60825  99_1 UBE3A-SUP 139 18 121 34 127 45 60825  99_1 SNORD115 110 18 112 12 99 19 60825  99_2 UBE3A 120 21 111 11 135 22 60825  99_2 UBE3A-SUP 96 21 79 15 75 11 60825  99_2 SNORD115 104 34 113 22 131 24 60825 100_1 UBE3A 123 34 139 34 145 21 60825 100_1 UBE3A-SUP 104 37 127 46 99 17 60825 100_2 UBE3A 124 46 138 37 145 31 60825 100_2 UBE3A-SUP 111 36 120 47 92 11 60825 101_1 UBE3A 112 18 123 15 150 13 60825 101_1 UBE3A-SUP 96 18 102 14 88 12 60825 101_2 UBE3A 118 15 138 24 139 32 60825 101_2 UBE3A-SUP 100 29 110 39 92 10 60826 102_1 UBE3A 132 17 120 7 125 9 60826 102_1 UBE3A-SUP 113 16 83 5 88 18 60826 102_1 SNORD115 121 36 131 23 100 9 60826 102_2 UBE3A 90 6 116 23 103 7 60826 102_2 UBE3A-SUP 91 7 90 12 64 18 60826 102_2 SNORD115 116 15 146 27 183 28 60827 103_1 UBE3A 106 8 112 10 115 9 60827 103_1 UBE3A-SUP 99 15 110 28 94 8 60827 103_2 UBE3A 107 14 120 13 112 14 60827 103_2 UBE3A-SUP 97 14 118 38 93 20 60827 104_1 UBE3A 128 14 111 9 111 6 60827 104_1 UBE3A-SUP 111 12 97 9 87 19 60827 104_1 SNORD115 114 10 110 12 109 13 60827 104_2 UBE3A 108 10 111 16 109 10 60827 104_2 UBE3A-SUP 103 13 103 33 89 9 60827 105_1 UBE3A 122 13 121 12 121 4 60827 105_1 UBE3A-SUP 119 7 97 15 93 7 60827 105_1 SNORD115 114 21 128 12 118 9 60827 105_2 UBE3A 123 5 110 9 114 8 60827 105_2 UBE3A-SUP 110 11 89 17 94 21 60827 105_2 SNORD115 102 15 108 16 107 18 60827 106_1 UBE3A 114 17 133 23 125 9 60827 106_1 UBE3A-SUP 112 35 103 15 87 12 60827 106_2 UBE3A 110 12 130 22 123 14 60827 106_2 UBE3A-SUP 105 19 107 27 93 10 60828 107_1 UBE3A 83 11 117 13 112 6 60828 107_1 UBE3A-SUP 86 11 114 16 67 7 60828 107_1 SNORD115 108 17 130 21 137 24 60828 107_2 UBE3A 143 42 117 10 122 11 60828 107_2 UBE3A-SUP 116 12 92 4 100 8 60828 107_2 SNORD115 108 4 127 16 108 14 60828 108_1 UBE3A 120 7 127 31 132 31 60828 108_1 UBE3A-SUP 153 33 118 34 89 17 60828 108_1 SNORD115 114 9 114 9 105 15 60828 108_2 UBE3A 122 18 133 26 128 9 60828 108_2 UBE3A-SUP 101 19 100 28 89 17 60828 109_1 UBE3A 108 10 129 14 128 5 60828 109_1 UBE3A-SUP 106 21 107 24 84 8 60828 109_2 UBE3A 109 11 110 8 111 13 60828 109_2 UBE3A-SUP 95 15 86 14 83 9 60829 110_1 UBE3A 104 6 83 3 101 15 60829 110_1 UBE3A-SUP 100 13 95 12 79 4 60829 110_1 SNORD115 126 21 125 6 182 13 60829 110_2 UBE3A 92 7 87 8 96 7 60829 110_2 UBE3A-SUP 99 7 108 9 81 5 60829 110_2 SNORD115 118 15 139 22 198 39 60830 111_1 UBE3A 110 6 122 13 124 10 60830 111_1 UBE3A-SUP 104 14 90 28 79 11 60830 111_2 UBE3A 115 10 120 15 121 10 60830 111_2 UBE3A-SUP 114 20 89 19 87 9 60831 112_1 UBE3A 93 8 94 13 106 10 60831 112_1 UBE3A-SUP 97 1 68 29 82 7 60831 112_1 SNORD115 116 20 110 13 158 20 60831 112_2 UBE3A 83 8 78 7 83 6 60831 112_2 UBE3A-SUP 106 35 80 23 69 9 60831 112_2 SNORD115 107 6 106 8 159 21 62198 113_1 UBE3A 110 3 122 6 134 9 62198 113_1 UBE3A-SUP 113 20 85 19 79 24 62198 113_1 SNORD115 116 18 123 9 91 9 62284 115_1 UBE3A 105 14 98 19 141 36 62422 116_1 UBE3A 130 19 142 29 172 18 62423 117_1 UBE3A 76 8 93 13 171 17 62439 118_1 UBE3A 75 7 88 9 150 19 66378 119_1 UBE3A 96 14 93 5 110 10 77565 126_1 UBE3A 94 6 113 5 125 14 77565 126_1 UBE3A-SUP 83 17 95 33 85 5 77565 126_1 SNORD115 105 11 123 19 152 15 77565 126_2 UBE3A 95 5 126 9 111 2 77565 126_2 UBE3A-SUP 77 27 106 21 83 15 77565 126_2 SNORD115 115 17 157 13 180 15 92321 128_1 UBE3A 102 7 91 5 111 13 92321 128_1 UBE3A-SUP 115 3 104 25 91 13 92321 128_1 SNORD115 135 9 132 12 196 35 92321 128_2 UBE3A 91 5 96 8 104 8 92321 128_2 UBE3A-SUP 112 20 92 20 79 7 92321 128_2 SNORD115 125 7 111 13 169 12 92322 129_1 UBE3A 101 5 103 2 110 7 92322 129_1 UBE3A-SUP 99 39 113 12 94 13 92322 129_1 SNORD115 124 25 114 6 140 13 92322 129_2 UBE3A 93 2 100 4 113 16 92322 129_2 UBE3A-SUP 109 4 102 22 85 7 92322 129_2 SNORD115 103 11 99 9 152 31 97154 132_1 UBE3A 100 10 128 13 142 13 97154 132_1 UBE3A-SUP 103 9 115 8 109 6 97154 132_1 SNORD115 49 7 90 12 143 25 97154 132_2 UBE3A 111 8 128 17 128 17 97154 132_2 UBE3A-SUP 95 7 116 9 105 13 97154 133_2 SNORD115 86 7 106 9 121 9 97154 133_1 UBE3A 101 3 107 11 124 19 97154 133_1 UBE3A-SUP 112 9 117 7 146 25 97154 133_1 SNORD115 60 7 110 15 141 15 97154 133_2 UBE3A 94 13 116 14 138 12 97154 133_2 UBE3A-SUP 116 6 128 13 148 38 97154 132_2 SNORD115 70 5 108 9 160 34 106137 137_1 UBE3A 83 12 74 11 124 20 109404 138_1 UBE3A 80 20 92 7 120 21 110766 139_1 UBE3A 76 5 85 12 121 17 114826 140_1 UBE3A 87 10 88 11 136 9 118637 143_1 UBE3A 83 7 104 30 141 28 118639 144_1 UBE3A 74 17 31 39 106 33 124160 145_2 UBE3A 89 6 95 10 115 25 125499 146_1 UBE3A 83 13 76 7 124 16 125499 146_2 UBE3A 123 30 79 14 102 23 125538 150_2 UBE3A 82 17 82 7 119 24

Of the 187 compounds tested approximately 90% showed re-expression of UBE3A when compared to the mock oligonucleotide at the 5 micro Molar concentration. The number of oligonucleotides capable of inducing re-expression of UBE3A is higher in the region between position 1 to 55318 of SEQ ID NO: 1 (non-overlapping region) then in the region complementary to UBE3A coding region (overlapping region. FIG. 2 plots the distribution of the oligonucleotides according to their position on chromosome 15 versus the UBE3A mRNA expression relative to the mock oligonucleotide.

For the oligonucleotides where SNORD115 has been tested there is no significant down regulation when compared to mock at 1 and 5 microM.

Example 3 Generation and Validation of Cyno Neuronal Differentiation In Vitro System

Cyno IPSCs were induced to differentiate into NPCs following the protocol as described in the Materials and Methods section and depicted in FIG. 4. The protocol allows to derive NPCs which can be maintained and expanded in basal medium supplemented with FGF, EGF and BDNF. To verify the efficient induction of cyno NPCs, expression of the neural stem cell markers SOX2 and NESTIN was evaluated by immunostaining (see FIG. 5A, FIG. 5B). Cyno NPCs express SOX2 and NESTIN and the expression pattern is highly comparable to human NPCs.

To derive differentiated NCs, expanding NPCs are dissociated and plated in SFA medium for a week. Afterwards the cells are exposed to differentiation medium (BGAA). To evaluate the neuronal differentiation potential of cyno NPCs, a transcriptional analysis was performed and results were compared to the transcriptional profile of differentiated human NPCs (see FIG. 6A, FIG. 6B, FIG. 6C, FIG. 6D). After 14 days of differentiation in BGAA medium, cyno cultures show decrease in the expression of pluripotency markers like NANOG and POU5F1 and increased expression of ectodermal and neuronal markers like PAX6, SOX1, ZIC1, ASCL1, TUBB3 if compared to cIPSCs (see FIG. 6A). Similarly, transcriptional analysis (RNA sequencing in FIG. 6B and qPCR in FIG. 6C) of human pluripotent stem cell-derived NCs differentiated for 14 days in BGAA reveals decreased expression of pluripotency markers and increased expression of ectodermal and neuronal markers in day 14 BGAA differentiated NCs if compared to hESCs. Importantly, changes in the expression of UBE3A, a disease gene implicated in Angelman syndrome, and UBE3A-ATS, a non-coding transcript described to be expressed in neurons, are comparable between differentiated cyno and human NCs (see FIG. 6D). These data demonstrate that cyno IPCS differentiate into NCs and the expression profile of specific markers is similar to differentiated human NCs.

Example 4 Dissociation and Reseeding of Differentiated Cynomolgus NCs

Stem cell-derived cells have a great potential as in vitro system for drug screening, especially if the corresponding primary cell type is not available or only in limited quantities as it is the case for neurons. However, drug screening requires robust cellular screening systems, which are available in suitable plate formats. For this purpose, we tested different strategies to differentiate NPCs derived from NHP-IPSCs into neuronal cells (NCs). In order to identify a robust cellular system with uniformly distributed NCs, expanding NPCs were dissociated and exposed to differentiation medium in one of two ways: either they were plated directly in the final assay format or, alternatively, the cells were plated in a cell culture flask and, thereafter, dissociated and reseeded into the final assay format after further differentiation (see FIG. 7). In method A and B, NPCs were differentiated for 23 days in flasks and then dissociated and reseeded in the assay format. After an additional differentiation period of 7 days cells were treated with oligonucleotides. Alternatively, in methods C and D, NPCs were dissociated and directly plated onto 96 well plates. The differentiation medium in method A and C was supplemented with a mitotic inhibitors cocktail (Uridine 35 μg/ml and 15 μg/ml 5-Fuoro-2′-deoxyuridine) to inhibit cell proliferation. On day 35 cultures were fixed and stained for the neural progenitor cell and glia cell marker SOX2 and neuronal marker MAP2 (see FIG. 8). The method B (with replating and without mitotic inhibitor) resulted in a more uniformly distributed cell culture with MAP2 positive cells and with fewer SOX2 positive cells than in the other methods. For this reason, the neuronal differentiation method B was chosen for subsequent described oligonucleotide treatments.

Example 5 Dissociation and Reseeding of Differentiated Human NCs

As described in Example 4, we established that replating differentiating cyno neurons was a necessary step to make these cells amenable for screening purposes. We therefore set out to verify whether it was possible to utilize a similar procedure for human IPSC-derived neurons. To this end, previously established neural progenitor cells (NPCs) from two IPSC lines (ED4 and SFC808) were differentiated following the procedure described in the Materials and Methods section. Briefly, expanding NPCs were dissociated and plated in SFA medium for a week. Afterwards the cells were exposed to differentiation medium (BGAA) in one of two ways: either they were plated directly in assay format or in a cell culture flask. In the latter case, the cells were differentiated for 21 days and then dissociated and reseeded in the assay format. Both experimental groups (i.e. directly differentiated or dissociated and reseeded) were differentiated for a total of 6 weeks (6 weeks in assay format or 3 weeks in flask and 3 weeks in assay format, respectively) before being processed.

For a first set of experiments, the neurons were analyzed by immunofluorescence and high content imaging. The markers used were specific for neural progenitors (SOX2), glial cells (GFAP) or neurons (MAP2 and HuC/D). As exemplified in FIG. 9, the replating process did not seem to influence the differentiation or morphology of the human IPSC-derived neurons. This was further verified by the quantitation of the staining, which showed no significant difference in the presence of HuC/D positive cells in the direct differentiation and replated groups (FIG. 10; for ED4, p=0.542, for SFC808, p=0.579).

To further confirm that it is possible to dissociate and replate differentiated human IPSC-derived neurons without altering their features, we wanted to confirm that cytoskeleton-associated proteins were not disrupted by the dissociation process. We analyzed the expression of the microtubule associated protein Tau as it is crucial for neuronal function and is directly implicated in neurodegenerative diseases such as Frontotemporal dementia and Alzheimer's disease. The cells were cultured as described above (with and without dissociation and reseeding), and the protein extracts were analyzed by Western Blot. As shown in FIG. 11, the constant expression of Tau and two of its phosphorylated forms proves that replating did, surprisingly, not disrupt the cytoskeletal characteristics of human IPSC-derived neurons, suggesting that physiological features will not be altered by the process.

These results demonstrate that human IPSC-derived neurons can undergo dissociation and reseeding during differentiation and maintain their key features, suggesting that the replating step (dissociation and reseeding) is feasible for the differentiation of primate stem cell derived neurons.

Example 6 High-Throughput Screening Using Primate IPSC-Derived Dissociated and Reseeded Differentiated NCs

The primate IPSC-derived neuronal cultures described above are highly flexible and reproducible systems amenable to be used for screening purposes. We developed a workflow to treat the cells with oligonucleotides and verify the expression of target and associated genes by quantitative polymerase chain reaction (qPCR) (see FIG. 12). To this end, either human or cynomolgus neural progenitors were treated as described above. For screening, the cells were dissociated after 3 weeks of differentiation and reseeded in 96 well plates at the density of 200,000 cells/cm2. After one additional week of differentiation, the cells were treated with oligonucleotides for 5 days and then processed for expression analysis as described in the Materials and Methods section. This method allows constant availability of samples to be tested in a high-throughput manner.

For this example, we utilized 5 different oligonucleotides that target the Ube3A antisense (Ube3A_ATS) transcript at 8 concentrations, starting at 20 μM and decreasing by 3 fold at each step, resulting in doses of 20.000, 6.325, 2.000, 0.632, 0.200, 0.063, 0.020 and 0.006 μM. We tested these compounds on neurons differentiated from Angelman Syndrom patient IPSCs (human) or cynomologus IPSCs (cyno).

After the treatment, the cells were lysed, the RNA was extracted and the qPCR reaction was performed by using commercially available TaqMan assays for Ube3A and Ube3A_ATS; GAPDH was used in human cells and TBP in cyno cells as housekeeping gene to normalize the expression data. In all cases, the treatment resulted in a marked decrease of Ube3A_ATS, which was matched by increased expression of the sense transcript. This effect was evident in a dose-response manner; for simplicity of visualization, we report in FIG. 13A, FIG. 13B, FIG. 13C, FIG. 13D the expression levels at a high (2 μM) and a low (0.02 μM) dose.

At the dose 2 μM, the antisense transcript was expressed at ˜50% of the level of vehicle (PBS) treated cells; this was true for both human and cyno cells. The knockdown of Ube3A_ATS resulted in the increased expression of Ube3A, to levels of ˜250% and ˜130% of vehicle for human and cyno, respectively. This discrepancy is not surprising, as the patient derived neurons, because of the deletion of one allele of the Ube3A gene, express very low levels of the sense transcript.

These experiments demonstrate target engagement of oligonucleotides directed at Ube3A_ATS in human and cyno neurons. Therefore, the method described is suitable for high-throughput screening of therapeutic oligonucleotides in primate IPSC-derived neurons.

Claims

1. An in vitro method for producing standardized cell cultures of uniformly distributed differentiated neural cells (NCs) from different primate species, the method comprising the steps of

a) providing neuronal precursor cells (NPCs);
b) differentiating the NPCs to neural cells (NCs) comprising the steps of (i) dissociating the differentiated NCs from its support after about 20 days to about 45 days of differentiation; and (ii) reseeding the cells in a suitable cell culture format and continuing differentiation of the NCs for about 4 days to about 15 days.

2. The method according to claim 1, wherein the primate species are selected from the group consisting of human (Homo sapiens), Cynomolgus monkey (Macaca fascicularis) and Rhesus monkey (Macaca mulatta).

3. The method according to claim 1, wherein standardized cell cultures of differentiated NCs are individually produced for 2 primate species, wherein the first primate species is human (Homo sapiens) and the second primate species is Cynomolgus monkey (Macaca fascicularis).

4. The method according to any one of claims 1 to 3, wherein the NPCs are derived from induced pluripotent stem cells (IPSCs).

5. The method according to claim 1, wherein step b)(i) comprises cultivating the cells in basal medium comprising Shh, FGF8 and ascorbic acid phosphate for a period of about 5 to about 10 days followed by cultivating the cells in basal medium comprising BDNF, GDNF, cAMP and ascorbic acid phosphate for a further period of about 15 days to about 35 days prior to dissociating the differentiated NCs from its support.

6. The method according to claim 1, wherein step b)(i) comprises dissociating the cells with a cell detachment solution.

7. The method according to claim 6, wherein the cell detachment solution is Accutase.

8. The method according to claim 1, wherein the cells are reseeded in 96 well or 384 well plates.

9. The method according to any one of claims 1, wherein step b)(ii) comprises continuing differentiation by cultivating the cells in basal medium supplemented with BDNF, GDNF, cAMP and ascorbic acid after reseeding the cells.

10. The method according to any one of claim 1, wherein the differentiated NCs are essentially uniformly distributed over the cell culture area as assessed by cell nucleus staining.

11. Use of the cell cultures obtained according to claim 1 for in vitro testing of the toxicity of a drug candidate.

12. Use of the cell cultures obtained according to claim 1 for in vitro testing of the efficacy of a drug candidate.

13. Use of the cell cultures obtained according to claim 1 for selecting a drug candidate, in particular for selecting a drug candidate for further development.

14. The cell cultures for use according to any one of claims 11 to 13 wherein the drug candidate comprises a polynucleotide or targets a specific sequence of a polynucleotide.

15. The cell cultures for use according to any one of claims 11 to 13 wherein the drug candidate comprises at least one nucleic acid molecule such as a RNAi agent or an antisense oligonucleotide.

16. (canceled)

Patent History
Publication number: 20190144824
Type: Application
Filed: May 11, 2018
Publication Date: May 16, 2019
Applicant: Hoffmann-La Roche Inc. (Little Falls, NJ)
Inventors: Carlo CUSULIN (Binningen), Veronica COSTA (Basel), Marius HOENER (Basel), Christoph PATSCH (Basel), Eva Christina THOMA (Basel)
Application Number: 15/977,895
Classifications
International Classification: C12N 5/0793 (20060101); C12N 5/074 (20060101); C12N 5/00 (20060101); C12N 15/11 (20060101);