USE OF ERK5 INHIBITORS FOR TREATING GLIOMAS IN PEDIATRIC SUBJECTS

Info

Publication number: 20220031710
Type: Application
Filed: Oct 21, 2021
Publication Date: Feb 3, 2022
Applicant: UNIVERSITY OF PITTSBURGH - OF THE COMMONWEALTH SYSTEM OF HIGHER EDUCATION (Pittsburgh, PA)
Inventors: Sameer Agnihotri (Pittsburgh, PA), Alberto Broniscer (Pittsburgh, PA), Ian F. Pollack (Pittsburgh, PA)
Application Number: 17/506,959

Abstract

The present disclosure relates to uses of an ERK5 inhibitor, e.g., ERK5-in-1, for treating a glioma in a pediatric human subject. In certain embodiments, the glioma can be a pediatric high-grade glioma (PHGG), e.g., a diffuse intrinsic pontine glioma (DIPG), and/or a H3.3-mutated glioma (e.g., a H3K27M-mutated glioma). The present disclosure further provides pharmaceutical compositions and kits that include an ERK5 inhibitor.

Description

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a Continuation of International Patent Application No. PCT/US2020/029403, filed on Apr. 22, 2020, which claims priority to U.S. Provisional Patent Application Ser. No. 62/837,049, filed on Apr. 22, 2019 and U.S. Provisional Patent Application Ser. No. 62/907,019, filed on Sep. 27, 2019, the contents of which are hereby incorporated by reference herein in their entireties, and priority to each of which is claimed.

SEQUENCE LISTING

The instant application contains a Sequence Listing which has been submitted via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Oct. 21, 2021, is named 072396_0872_SL.txt and is 11,696 bytes in size.

1. INTRODUCTION

The present disclosure relates to uses of an ERK5 inhibitor for treating a glioma in a pediatric human subject. The present disclosure further provides pharmaceutical compositions and kits that include an ERK5 inhibitor.

2. BACKGROUND

Primary brain and CNS tumors are a leading cause of cancer-related mortality in children ages 0-14. Many deaths are due to pediatric high-grade gliomas (PHGG), which are a commonly diagnosed type of malignant brain tumor in children (Ostrom et al., Neuro-oncology 2015; 17 Suppl 4:iv1-iv62). PHGGs can be largely incurable with a poor median survival post diagnosis of 9-15 months (Ostrom et al., Neuro-oncology 2015; 17 Suppl 4:iv1-iv62; Cancer Genome Atlas Research Network et al., The New England journal of medicine 2015; 372(26):2481-98). A particularly aggressive type of PHGG that originates primarily in the midline and pons is known as diffuse intrinsic pontine glioma (DIPG). Presenting nearly exclusively in children, DIPG has a two-year survival rate post diagnosis of only 10% and a median survival time of 9-12 months (Jones et al., Neuro-oncology 2017; 19(2):153-61). This poor prognosis is partly due to the tumor's anatomical location, preventing surgical excision, and narrowing therapeutic options to blood-brain barrier penetrating agents (Hoffman et al., Journal of clinical oncology 2018; 36(19):1963-72). Furthermore, radiation therapy may provide only temporary benefits while chemotherapy and targeted therapeutics in clinical trials can be relatively ineffective in treating DIPG (Warren et al., Frontiers in oncology 2012; 2:205).

As molecular profiling techniques have progressed, the understanding of cancer biology is shifting from a histopathological perspective to one informed by the genomics and epigenetics modulating disease pathogenesis. This reevaluation of tumor biology has revealed certain differences between PHGGs and their corresponding adult tumors, as well as the molecular heterogeneity amongst PHGGs (Mackay et al., Cancer cell 2017; 32(4):520-37 e5). It has also indicated certain shortcomings associated with traditional treatment of PHGG, which help explain the ineffectiveness of treatments used in previous clinical trials (Mackay et al., Cancer cell 2017; 32(4):520-37 e5; Filbin et al., Science 2018; 360(6386):331-35; Jones et al., Nature reviews Cancer 2014; 14(10)).

The discovery of novel DIPG-associated hotspot mutations (K27M) in the genes encoding histone H3.3 and H3.1 have increased the understanding that pediatric and adult HGGs possess distinct genetic as well as epigenetic characteristics (Sturm et al., Cancer cell 2012; 22(4):425-37). Amongst PHGGs, those with K27M or G34R H3 mutations exist as distinct tumor subtypes with certain clinical, biological, and pathological features (Sturm et al., Cancer cell 2012; 22(4):425-37; Mackay et al., Cancer cell 2017; 32(4):520-37 e5). H3K27M mutations in DIPG can lead to an altered epigenetic state characterized by a global reduction of histone trimethylation (H3K27Me3), as the mutant histone can suppress the Polycomb repressive complex 2 (PRC2) through interaction with the EZH2 subunit of PRC2 (Lewis et al., Science 2013; 340(6134):857-61). Decreased H3K27Me3 can result in the transcriptional activation of several oncogenic proteins. The discovery of H3K27M mutation effects has fostered interest in using epigenetic-based therapies to counteract the transcriptional dependencies resulting from the H3K27M mutation (Grasso et al., Nature medicine 2015; 21(6):555-9; Piunti et al., Nature medicine 2017; 23(4):493-500; Nagaraja et al., Cancer cell 2017; 31(5):635-52 ebb; Bitler et al., Nature medicine 2015; 21(3):231-8). Moreover, H3K27M mutations may not be only required for tumor initiation but also required for tumor maintenance (Silveira et al., Acta neuropathologica 2019; Larson et al., Cancer cell 2019; 35:140-55 e7).

Therefore, there remains a need in the art for improved techniques to treat pediatric gliomas.

3. SUMMARY

The present disclosure provides for uses of one or more ERK5 inhibitors for treating pediatric gliomas.

In one aspect, the present disclosure provides a method for treating a glioma in a pediatric human subject, comprising administering to the subject a therapeutically effective amount of an ERK5 inhibitor, wherein the ERK5 inhibitor is not (16E)-14-methyl-20-oxa-5,7,14,26-tetraazatetracyclo[19.3.1.1(2,6).1(8,12)]-heptacosa-1(25),2(26),3,5,8(27),9,11,16,21,23-decaene (TG02) or a pharmaceutically acceptable salt thereof.

In certain embodiments, the glioma is a pediatric high-grade glioma (PHGG). In certain embodiments, the glioma is a diffuse intrinsic pontine glioma (DIPG). In certain embodiments, the glioma is an H3-mutant glioma. In certain embodiments, the glioma is a H3K27M-mutant glioma. In certain embodiments, the glioma is a H3K27M-mutant DIPG. In certain embodiments, the glioma is a H3.3-mutant non-DIPG high grade glioma.

In certain embodiments, the ERK5 inhibitor is an ERK5 specific inhibitor. In certain embodiments, the ERK5 specific inhibitor is ERK5-IN-1 or a pharmaceutically acceptable salt form thereof.

In certain embodiments, the ERK5 inhibitor is a dual ERK5 inhibitor. In certain embodiments, the dual ERK5 inhibitor is BIX02189, XMD8-92, or a pharmaceutically acceptable salt form thereof.

In certain embodiments, the ERK5 inhibitor is administered orally.

In certain embodiments, the ERK5 inhibitor is administered in an amount between about 20 mg/m²and about 200 mg/m²per day. In certain embodiments, the ERK5 inhibitor is administered in an amount of about 35 mg/m²per day, about 50 mg/m²per day, about 65 mg/m²per day, or about 85 mg/m²per day.

In certain embodiments, the pediatric human subject has a body surface area of at least about 50 m², or at least about 55 m².

In certain embodiments, the pediatric human subject has a body surface area of at least about 55 m², and the ERK5 inhibitor is administered in an amount of about 35 mg/m²per day or about 50 mg/m²per day. Alternatively, the pediatric human subject has a body surface area of at least about 50 m², and the ERK5 inhibitor is administered in an amount of about 65 mg/m²per day or about 85 mg/m²per day.

In certain embodiments, the ERK5 inhibitor is administered cyclically. In certain embodiments, the number of cycles is from one to 24 cycles. In certain embodiments, the duration of each cycle is 28 days.

In certain embodiments, the ERK5 inhibitor is administered intermittently.

In certain embodiments, the method disclosed herein further includes administration of a second anti-cancer treatment is administered to the pediatric human subject. In certain embodiments, the second anti-cancer treatment is a radiotherapeutic agent or a radiotherapy. In certain embodiments, the second anti-cancer treatment is temozolomide. In certain embodiments, the second anti-cancer treatment is an EZH2 inhibitor.

In certain embodiments, wherein the glioma is a newly diagnosed glioma, a refractory glioma, a relapsed glioma, or a relapsed and refractory glioma.

In certain embodiments of the present disclosure, the method includes administering to the pediatric human subject a pharmaceutical composition, wherein the pharmaceutical composition comprises the ERK5 inhibitor and a pharmaceutically acceptable carrier.

In another aspect, the present disclosure provides an ERK5 inhibitor for use in treating a glioma in a pediatric human subject, wherein the ERK5 inhibitor is not (16E)-14-methyl-20-oxa-5,7,14,26-tetraazatetracyclo[19.3.1.1(2,6).1(8,12)]-heptacosa-1(25),2(26),3,5,8(27),9,11,16,21,23-decaene (TG02) or a pharmaceutically acceptable salt thereof.

In certain embodiments, the glioma is a pediatric high-grade glioma (PHGG). In certain embodiments, the glioma is a diffuse intrinsic pontine glioma (DIPG). In certain embodiments, the glioma is a H3-mutant glioma. In certain embodiments, the glioma is a H3K27M-mutant glioma. In certain embodiments, the glioma is a H3K27M-mutant DIPG. In certain embodiments, the glioma is a H3.3-mutant non-DIPG high grade glioma.

In certain embodiments, the ERK5 inhibitor is an ERK5 specific inhibitor.

In certain embodiments, the ERK5 specific inhibitor is ERK5-IN-1 or a pharmaceutically acceptable salt form thereof.

In certain embodiments, the ERK5 inhibitor is a dual ERK5 inhibitor.

In certain embodiments, the dual ERK5 inhibitor is BIX02189, XMD8-92, or a pharmaceutically acceptable salt form thereof.

In certain embodiments, the ERK5 inhibitor is administered orally.

In certain embodiments, the ERK5 inhibitor is administered in an amount between about 20 mg/m²and about 200 mg/m²per day. In certain embodiments, the ERK5 inhibitor is administered in an amount of about 35 mg/m²per day, about 50 mg/m²per day, about 65 mg/m²per day, or about 85 mg/m²per day.

In certain embodiments, the pediatric human subject has a body surface area of at least about 50 m².

In certain embodiments, the pediatric human subject has a body surface area of at least about 55 m2, and the ERK5 inhibitor is administered in an amount of about 35 mg/m²per day or about 50 mg/m²per day. Alternatively, the pediatric human subject has a body surface area of at least about 50 m², and the ERK5 inhibitor is administered in an amount of about 65 mg/m²per day or about 85 mg/m2 per day.

In certain embodiments, the ERK5 inhibitor is administered cyclically.

In certain embodiments, the number of cycles is from one to twenty-four cycles. In certain embodiments, the duration of each cycle is 28 days.

In certain embodiments, the ERK5 inhibitor is administered intermittently.

In certain embodiments, a second anti-cancer treatment is administered to the pediatric human subject.

In certain embodiments, the second anti-cancer treatment is a radiotherapeutic agent or a radiotherapy. In certain embodiments, the second anti-cancer treatment is temozolomide. In certain embodiments, the second anti-cancer treatment is an EZH2 inhibitor.

In certain embodiments, the ERK5 inhibitor is administered once per week during and/or after the administration of the radiation. In certain embodiments, the ERK5 inhibitor is administered for about 3 weeks or about 4 weeks after the administration of the radiation. In certain embodiments, the ERK5 inhibitor is administered twice per week for about 3 weeks or about 4 weeks after the administration of the radiation. In certain embodiments, the ERK5 inhibitor is administered on the same day as the radiation, and the ERK5 inhibitor is administered between about 1 hour and about 8 hours, between about 2 hours and 8 hours, between 3 hours and 8 hours, between about 4 hours and 8 hours, between about 5 hours and 8 hours, between about 6 hours and 8 hours, or between about 7 hours and 8 hours prior to the administration of the radiation. In certain embodiments, the ERK5 inhibitor is administered about 1 hour prior to the administration of the radiation. In certain embodiments, the ERK5 inhibitor is administered about 2 hours prior to the administration of the radiation. In certain embodiments, the ERK5 inhibitor is administered about 3 hours prior to the administration of the radiation. In certain embodiments, the ERK5 inhibitor is administered about 4 hours prior to the administration of the radiation. In certain embodiments, the ERK5 inhibitor is administered about 5 hours prior to the administration of the radiation. In certain embodiments, the ERK5 inhibitor is administered about 6 hours prior to the administration of the radiation. In certain embodiments, the ERK5 inhibitor is administered about 7 hours prior to the administration of the radiation. In certain embodiments, the ERK5 inhibitor is administered about 8 hours prior to the administration of the radiation.

In certain embodiments, the glioma is a newly diagnosed glioma, a refractory glioma, a relapsed glioma, or a relapsed and refractory glioma.

In certain embodiments, the use of the ERK5 inhibitor for use in treating a glioma in a pediatric human subject includes administering to the pediatric human subject a pharmaceutical composition, wherein the pharmaceutical composition comprises the ERK5 inhibitor, and a pharmaceutically acceptable carrier.

In certain embodiments, the present disclosure provides for a use of an ERK5 inhibitor for the preparation of a medicament for treating a glioma in a pediatric human subject, wherein the ERK5 inhibitor is not (16E)-14-methyl-20-oxa-5,7,14,26-tetraazatetracyclo[19.3.1.1(2,6).1(8,12)]-heptacosa-1(25),2(26),3,5, 8(27),9,11,16,21,23-decaene (TG02) or a pharmaceutically acceptable salt thereof.

In another aspect, the present disclosure provides kits for treating a glioma in a pediatric human subject, comprising an ERK5 inhibitor, wherein the ERK5 inhibitor is not (16E)-14-methyl-20-oxa-5,7,14,26-tetraazatetracyclo[19.3.1.1(2,6).1(8,12)]-heptacosa-1(25),2(26),3,5,8(27),9,11,16,21,23-decaene (TG02) or a pharmaceutically acceptable salt thereof.

In certain embodiments, the kit includes instructions for using the EKRS inhibitor in treating the glioma in a pediatric human subject. In certain embodiments, the glioma is a pediatric high-grade glioma (PHGG). In certain embodiments, the glioma is a diffuse intrinsic pontine glioma (DIPG). In certain embodiments, the glioma is a H3-mutant glioma. In certain embodiments, the glioma is a H3K27M-mutant glioma. In certain embodiments, the glioma is a H3K27M-mutant DIPG. In certain embodiments, the glioma is a H3.3-mutant non-DIPG high grade glioma.

In certain embodiments of the present disclosure, the ERK5 inhibitor in the kits is an ERK5 specific inhibitor. In certain embodiments of the present disclosure, the ERK5 inhibitor in the kits is ERK5-IN-1 or a pharmaceutically acceptable salt form thereof. In certain embodiments of the present disclosure, the ERK5 inhibitor in the kits is a dual ERK5 inhibitor. In certain embodiments of the present disclosure, the ERK5 inhibitor in the kits is BIX02189, XMD8-92, or a pharmaceutically acceptable salt form thereof.

In certain embodiments of the present disclosure, the instructions in the kits include ERK5 inhibitor that is administered orally. In certain embodiments, the instructions include the ERK5 inhibitor being administered in an amount between about 20 mg/m²and about 200 mg/m²per day. In certain embodiments, the instructions include the ERK5 inhibitor being administered in an amount of about 35 mg/m²per day, about 50 mg/m²per day, about 65 mg/m²per day, or about 85 mg/m²per day.

In certain embodiments, the pediatric human subject has a body surface area of at least about 50 m².

In certain embodiments, the kit of the present disclosure includes instructions that include (a) the pediatric human subject having a body surface area of at least about 55 m², and the ERK5 inhibitor being administered in an amount of about 35 mg/m²per day or about 50 mg/m²per day, or (b) the pediatric human subject having a body surface area of at least about 50 m², and the ERK5 inhibitor being administered in an amount of about 65 mg/m²per day or about 85 mg/m²per day.

In certain embodiments, the instructions of the kit include that the ERK5 inhibitor is administered cyclically. In certain embodiments, the number of cycles is from one to twenty-four cycles. In certain embodiments, the duration of each cycle is 28 days.

In certain embodiments, the instructions of the kit include that the ERK5 inhibitor is administered intermittently.

In certain embodiments, the instructions of the kit include that a second anti-cancer treatment is administered to the pediatric human subject. In certain embodiments, the second anti-cancer treatment is a radiotherapeutic agent or a radiotherapy. In certain embodiments, the second anti-cancer treatment is temozolomide. In certain embodiments, the second anti-cancer treatment is an EZH2 inhibitor.

In certain embodiments, the kits for treating a glioma in a pediatric human subject, wherein the glioma is a newly diagnosed glioma, a refractory glioma, a relapsed glioma, or a relapsed and refractory glioma.

In certain embodiments, the instructions of the kit include administering to the pediatric human subject a pharmaceutical composition, wherein the pharmaceutical composition includes the ERK5 inhibitor, and a pharmaceutically acceptable carrier.

In certain embodiments, the kit of the present disclosure further includes a means for detecting an H3.3 mutation in a sample obtained from the pediatric human subject.

In certain embodiments the kit of the present disclosure further includes a means for detecting an H3K27M mutation in a sample obtained from the pediatric human subject.

4. BRIEF DESCRIPTION OF THE DRAWINGS

FIGS. 1A-1O provide that H3K27M increased activated RAS signaling. (1A) Direct Trypan-Blue automated cell count of control and H3K27M expressing cells over 120 h (5 days). (1B) Western blot of H9 Neural stem cells (NSC) confirming wildtype and H3K27M mutant expression, loss of H3K27Me3, and total H3. NSC control cells were transduced with empty vector. (1C) Active GTP-bound RAS immunoprecipitation (IP) in control, wildtype and H3K27M expressing cells. Whole cell lysate (W.C.L.). (1D) Densitometry ratio of active GTP-bound RAS immunoprecipitation (IP) to total RAS in NSC empty vector (EV) control and NSC H3K27M pooled clones from FIG. 1C. (1E-1G) siRNA targeting H-RAS, K-RAS, N-RAS in control (EV, 1E), wildtype H3 (1F) and H3K27M NSC (1G) cells. (1H-1I). Western blot (1H) and densitometry ratio (1I) of active GTP-bound RAS immunoprecipitation (IP) to total RAS in NSC control (con), NSC H3K27M (K27M) and several DIPG cell lines. (1J-1K). Western blot (1J) and densitometry ratio (1K) of active GTP-bound RAS immunoprecipitation (IP) to total RAS in NSC control (con), NSC H3K27M (K27M), NSC PDGFRA, PDGFRA and H3K27M co-transfected (dual) and several DIPG cell lines. Western blot (1L) and densitometry ratio (1M) of active GTP-bound RAS immunoprecipitation (IP) to total RAS in NSC control (con), NSC PDGFRA, NSC H3K27M, and NSC co-transfected with PDGFRA and H3K27M (dual). Western blot (1N) and densitometry ratio (1O) of active GTP-bound RAS immunoprecipitation (IP) to total RAS in H3WT DIPG cell line, H3K27M cells and hemispheric pGBM cells. *P<0.05, ***P<0.0001.

FIGS. 2A-2L provide the results of a RAS targeted siRNA screen for identifying novel RAS effector genes that drive H3K27M growth. (2A) Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) of NSC control and NSC H3K27M cells for several RAS-GAPs. (2B) Western blot of RASAL1 and RASA3 in normal human astrocytes (NHA), two NSC lines and DIPG lines. (2C) Western blot from Whole Cell Lysate (W.C.L.) of lentiviral expression of HA-tagged RASAL1 or control vector into NSC-H3K27M or DIPG-13p cells. Active GTP-bound RAS immunoprecipitation (IP) in empty vector control and RASAL1 expressing cells was performed to assess RAS activity. (2D) Direct Trypan-Blue automated cell count of control and RASAL1 expressing cells over 7 days. (2E) Schematic of Targeted RAS siRNA screen. (2F-2G) NSC control, NSC H3K27M (2F) and DIPG-007 (2G) cells were transfected with a 294 DNA siRNA pool library. Cell viability was assessed by the Alamar blue cell viability assay 120 hours after siRNA transfection. Data were normalized using the standard z-score method. Significance of potential hits were determined using z-score cut-off values ±2 (dotted line), which corresponded to a P value of <0.05 in all three biologic replicates (Rep. 1-3). (2H). Venn diagram of overlapping targets and unique targets between H3K27M NSC cells and DIPG-007 cells. (24 Re-screen of top targets using siRNA and direct Trypan-Blue automated cell count of DIPG-007 cells over 7 days. (2J) Quantitative real-time PCR (qRT-PCR), for growth factors in control, wildtype expressing and H3K27M NSC cells. (2K) qRT-PCR for growth factors in control, wildtype expressing and H3K27M NSC cells. (2L) Western blot confirmation of EGFR and PDGFRA activity in H3K27M NSCs.

FIGS. 3A-3I provide that ERK5 was up-regulated and activated in DIPG. (3A) Schematic of the ERK5 signaling cascade. (3B) Western blot of phospho and total ERK5 in NSC cell expressing empty vector (EV), wildtype H3.3 and H3K27M. (3C) Oncoprint map of genomic alterations in H3K27M mutant DIPG patients with ERK5, NF1 and PDGFRA alterations. (3D) Western blot and densitometry of pERK5 and ERK5 in five DIPG patient samples compared to three pediatric pons from non-tumor patients. (3E) Western blot of the MAPK signing network in patient derived DIPG cultured cells compared to NSCs and NHAs. (3F) Western blot after a cellular fractionation assay for ERK5. GAPDH was used to confirm cytoplasmic purity and H3.3 for nuclear purity. (3G) Western blot of the MAPK signing network in patient derived DIPG cultured cells compared to empty vector NSCs and NSCs expressing wildtype H3 or H3K27M. (3H) Oncoprint map of genomic alterations in H3K27M mutant DIPG, H3.1 K27M, and hemispheric pGBM patient samples with ERK5 and additional MAPK signaling alterations. Dataset used was from the Paediatric High Grade Glioma dataset (ICR London, Cancer Cell 2017)(Mackay et al., Cancer cell 2017; 32(4):520-37 e5). Data was analyzed in the pediatric cBIO data-portal (https://pedcbioportal.org/, Mar. 15, 2019). (3I) ERK5 (MAPK7) RNA-seq expression (Log2 RSEM) of all adult cancers from the TCGA pan-Cancer normalized data study. Data was accessed and analyzed in the cBIO data portal (http://www.cbioportal.org/, Mar. 15, 2019). GBM and low-grade gliomas express among the higher amounts of ERK5 expression.

FIGS. 4A-4K provide that ERK5 loss inhibited growth in DIPG cells. (4A) Western blot of control and doxycycline (Dox) treated cells (2 ug/ml) confirming ERK5 knockdown and analysis of activated ERK1/2 and AKT. Cells were treated with Dox for 5 days. (4B-4D). 5-bromo-2′-deoxyuridine (BrdU) cell proliferation assay of DIPG-13p cells (4B), DIPG-IV cells (4C) and SF8628 cells (4D). Cells were treated with no Dox or Dox starting 5 days prior to the assay. (4E). Kaplan-Meir survival curves of DIPG-13p orthotopic xenograft models (n=5 per group, p<0.05). ERK5 inducible shRNA for knockdown (ERK5 KD) was accomplished by administration of doxycycline (2 mg/mL) with 5% sucrose in drinking water. (4F) Western blot in control mice versus doxycycline mice from (4E) confirming ERK5 KD. (4G) Schematic of ERK5 rescue constructs with alterations made to the kinase domain (KD, kinase dead), transcriptional activation domain (ATAD, TAD deleted) or both (KD ATAD). (4H) Western blot in SF8628 cells confirming shRNA targeting ERK5 3′UTR inhibits ERK5 at the protein level. (4I) HA Western blot confirming ERK5 constructs expression in SF8628 cells by lentiviral transduction 72 h after infection. (4J) BrdU cell proliferation assay of DIPG-IV cells transduced with various ERK5-HA tagged constructs from (4G). (4K) Statistical analysis of (4J) compared to Dox treated cells. *p<0.05.

FIGS. 5A-5P provide that pharmacological inhibition of ERK5 triggered cell death and apoptosis in DIPG cells.

FIGS. 5A-5C provide EC50 dose response curves at 96 h in DIPG-007 cells using varying inhibitors of ERK5: BIX02189 (5A), XMD8-92 (5B), and ERK5-IN-1 (5C).

FIGS. 5D-5F provide EC50 dose response curves at 96 h in DIPG-IV cells using varying inhibitors of ERK5: BIX02189 (5D), XMD8-92 (5E), and ERK5-IN-1(5F).

FIGS. 5G-5I provide Direct Trypan-Blue automated cell count of cells treated with DMSO vehicle (control), and ERK5-IN-1 (500 nM) for DIPG-007 cells (5G), DIPG-IV cells (5H) and SF8628 cells (5I).

FIG. 5J provides Annexin-PI quantification of DIPG cells treated with ERK5 inhibitors at 48 h from (5K). Compared to DMSO vehicle control cells ERK5-IN-1 had decreased viable cells (Annexin negative, PI negative) and increased populations in early apoptosis (Annexin positive, PI negative), late apoptosis (Annexin and PI positive) and necrosis (PI positive, Annexin negative). (5K) Representative Annexin-PI contour plots with quadrant gates showing four populations in DIPG-007 and DIPG-IV cells treated with vehicle (DMSO), and ERK5-IN-1.

FIGS. 5L-5M Western blot confirming ERK5-IN-1 inhibits the ERK5 autophosphorylation site at various doses in DIPG-007 (5L) and DIPG-IV cells (5M).

FIG. 5N provides EC50 dose response curves at 96 h in DIPG-007 cells using varying inhibitors of ERK5: BIX02189, XIVID8-92, and ERK5-IN-1.

FIG. 5O provides EC50 dose response curves at 96 h in DIPG-IV cells using varying inhibitors of ERK5: BIX02189, XMD8-92, and ERK5-IN-1.

FIG. 5P provides EC50 values for ERK5-IN-1 at 96 h in H3K27M or H3 WT cell lines.

FIGS. 6A-6H provide that ERK5 inhibition reduced MYC protein stability. (6A) Schematic of identifying differentially expressed phospho-proteins in DIPG-IV cells expressing ERK5 and ERK5 knockdown. (6B) Ratio of phospho:total protein changes in ERK5 knockdown versus ERK5 control DIPG-IV cells. Ratios in blue were down-regulated (Z-score<2), while ratios in red were up-regulated (Z-score>2). (6C) Western blot of phospho MYC S62 in DIPG cells treated with Dox (ERK5 KD), or ERK5-IN-1 (500 nM). (6D) Western blot of MYC in DIPG-IV cells treated with Dox and MG132 (10 uM). (6E) Immunoprecipitation of MYC and ERK5 followed by western blot of ERK5 and MYC. (6F) In vitro kinase assay of purified recombinant ERK5 and MYC in presence or absence of ERK5 inhibitors. (6G) Western blot of DIPG cells re-transfected with constitutively active MYC S62D in presence of ERK5 loss. (6H) Cell doubling times of control and ERK5 knockdown DIPG cells and the effect of MYC S62D rescue. SF8628 cells (left) and DIPG-IV cells (right).

FIGS. 7A-7J provide that ERK5 inhibition increases in vivo survival of DIPG patient derived xenograft models. (7A) Kaplan-Meir survival curves of SF8628 orthotopic xenograft models (n=7 per treatment group). Arrows indicate period of daily treatment (2 cycles of 5 days on 2 days off). (7B) Sagittal section and hematoxylin and eosin (H&E) staining confirming tumor growth in the mid-brain. (7C) High power magnification H&E confirming high-grade glioma histology of tumors. (7D) Ki67 proliferative marker staining of xenograft models treated with vehicle, ERK5-IN-1. (7E) Ki67 quantification from (7D). Three mice per group with average of Ki67 positive cells taken from 10 high power fields of view. (7F) Sagittal section and hematoxylin and eosin (H&E) staining confirming tumor growth in the mid-brain. (7G) High power magnification H&E confirming high-grade glioma histology of tumors. (7H) Ki67 proliferative marker staining of xenograft models treated with vehicle, ERK5-IN-1. (7I) Kaplan-Meir survival curves of DIPG-13p orthotopic xenograft models (n=7 per treatment group). Arrows indicate period of daily treatment (2 cycles of 5 days on 2 days off). (7J) Ki67 quantification from (7H). Three mice per group with average of Ki67 positive cells taken from 10 high power fields of view. Scale bars represent 50 uM. *p<0.05.

FIGS. 8A-8C provide independent siRNA targeting H-RAS, K-RAS, N-RAS in empty vector control (EV, 8A), wildtype H3F3A (8B) and H3K27M NSC (8C) cells.

FIG. 8D provides cleaved Caspase 3 and 7 Elisa assays 72 h post transfection of cells treated with RAS siRNA.

FIGS. 8E-8G provide qRT-PCR measuring fold change of H-RAS, N-RAS and K-RAS knockdown post siRNA treatment in control NSC (8E), NSCs expressing wildtype H3.3 (8F) or H3K27M (8G). *p<0.05.

FIG. 9A provides western blot measuring RAS activation and p16 expression in NSCs expressing wildtype H3 or H3K27M or treated with the EZH2 inhibitor GSK343 (5 μM).

FIG. 9B provides direct Trypan-Blue automated cell count of NSC control cells, NSC H3K27M expressing cells, NSC H3.3 WT overexpressing cells and NSCs treated with the EZH2 inhibitor GSK343 over 5 days. *p<0.05.

FIG. 9C provides RASAL1 microarray gene-expression in two DIPG datasets compared to two normal brain datasets.

FIG. 9D provides RNA-seq gene expression of RASAL1 comparing GTEX normal brain dataset to the Treehouse Childhood Cancer Initiative DIPG, pediatric GBM, adult GBM and adult glioma datasets.

FIG. 9E provides western blot of RASAL1 in five DIPG patient samples compared to three pediatric pons from non-tumor patients.

FIG. 9F provides western blot of stable expressing RASAL1 H3K27M NSC cells and DIPG-007 cells compared to endogenous RASAL1 in NSC and NHA.

FIG. 9G provides methylation specific PCR (MSP-PCR) of the RASAL1 promoter from methylated DNA isolated from various cells. 5mC RASAL1 refers to primers that only amplify methylated RASAL1 promoter. RASAL1 genomic DNA (bottom band) was used as a control to confirm total DNA isolation.

FIG. 911 provides western blot of RASAL1 DIPG-007 and H3K27M NSC treated five days with 1 μM decitabine (5-aza-2′-deoxycytidine) or vehicle (DMSO). *p<0.05.

FIG. 10A provides Alamar Blue viability assay of DIPG-007 cells following transfection (96 h) with a second set of independent siRNA for top candidate genes from FIGS. 2F-211.

FIGS. 10B-10C provides Alamar Blue viability assay of NSCs (10B) and H3K27M NSCs (10C) following transfection (96 h) with two independent siRNA sets for top candidate genes from FIGS. 2F-2H.

FIGS. 10D-10F provide qRT-PCR confirming effective gene knockdown by siRNA in DIPG-007 (10D), NSC-EV (10E) and NSC H3K27M (10F). *p<0.05.

FIG. 11A provides gene-expression analysis of ERK5 in two independent DIPG datasets compared to two normal brain datasets (Berchtold et al., Proceedings of the National Academy of Sciences of the United States of America 2008; 105(40):15605-10; Sturm et al., Cancer cell 2012; 22(4):425-37; Paugh et al., Journal of clinical oncology: official journal of the American Society of Clinical Oncology 2010; 28(18):3061-8; Bender et al., Cancer cell 2013; 24(5): 660-72).

FIG. 11B provides RNA-seq gene expression of ERK5 comparing GTEX normal brain dataset to the Treehouse Childhood Cancer Initiative DIPG dataset.

FIG. 11C provides activated cleaved Caspase 3/7 in control DIPG cell (DIPG-IV, DIPG-13p) compared ERK5 knockdown cells by doxycycline (+Dox).

FIG. 11D provides activated cleaved Caspase 3/7 in control DIPG cells (DIPG-IV, DIPG-13p and SF8628) compared ERK5 knockdown cells by doxycycline (+Dox).

FIGS. 12A-12C provide EC50 dose response curves at 96 h in SF8628 cells using varying inhibitors of ERK5: BIX02189 (12A), XMD8-92 (12B), and ERK5-IN-1 (12C).

FIGS. 12D-12F provide EC50 dose response curves at 96 h in DIPG-13p cells using varying inhibitors of ERK5: BIX02189 (12D), XMD8-92 (12E), and ERK5-IN-1 (12F).

FIGS. 12G-12H provide Annexin-PI contour plots with quadrant gates showing four populations in SF8628 (12G) and DIPG-13p (12H) cells treated with vehicle (DMSO), and ERK5-IN-1.

FIG. 12I provides Annexin-PI quantification of DIPG cells treated in biological triplicates with ERK5 inhibitors at 48 h from (FIGS. 12G-12H). Compared to DMSO vehicle control cells, ERK5-IN-1 had decreased viable cells (Annexin negative, PI negative) and increased populations in early apoptosis (Annexin positive, PI negative), late apoptosis (Annexin and PI positive) and necrosis (Annexin negative PI positive). *p<0.05.

FIG. 12J provides direct Trypan-Blue automated cell count of cells treated with DMSO vehicle (control) and ERK5-IN-1 (500 nM) for DIPG-13p cells.

FIG. 12K provides EC50 dose response curves at 96 h in SF8628 cells using varying inhibitors of ERK5: BIX02189, XMD8-92, and ERK5-IN-1.

FIG. 12L provides EC50 dose response curves at 96 h in DIPG-13p cells using varying inhibitors of ERK5: BIX02189, XMD8-92, and ERK5-IN-1.

FIG. 13A provides EC50 values at 96 h in DIPG cells and several normal human stem cell (NSC) and normal human astrocyte cell lines.

FIG. 13B provides western blot confirming expression of ERK5-HA and ERK5-HA T733E in DIPG-IV cells.

FIG. 13C provides EC50 values of ERK5-IN-1 treated DIPG-IV cells expressing empty vector control, ERK5-HA, or ERK5-HA T733E.

FIG. 13D provides cleaved Caspase 3/7 assay in DIPG-IV cells expressing empty vector, ERK5-HA overexpression or ERK5-HA T733E when treated with ERK5-IN-1 (500 nM). * p<0.05.

FIG. 13E provides Western blot confirming ERK5 knockdown in H3 WT DIPG cells (CNMC-XD-76) and a hemispheric pGBM line SU-pcGBM2. Pooled siRNA ERK5 lentiviral particles were delivered at an MOI of 2 using the piLenti-siRNA-GFP vector. piLenti-siRNA-GFP non-targeting shRNA was used as a control.

FIG. 13F provides cell count control and ERK5 knockdown infected cells over several days in CNMC-XD-76 cells.

FIG. 13G provides cell count control and ERK5 knockdown infected cells over several days in SU-pcGBM2 cells.

FIG. 14A provides qRT-PCR of MYC transcripts in DIPG-IV and SF8628 cells treated with vehicle, ERK5-shRNA (Dox), or ERK5-IN-1.

FIG. 14B provides western blot confirming expression of MYC and MYC S62D in DIPG-IV cells.

FIG. 14C provides EC50 values of ERK5-IN-1 for DIPG-IV cells expressing empty vector control, MYC or MYC S62D.

FIG. 14D provides qRT-PCR of MYCN transcript levels in DIPG-13p cells treated with vehicle, dox (ERK5 knockdown), or ERK5-IN-1.

FIG. 14E provides Western blot confirming MYCN protein levels decrease in DIPG-13p cells from FIG. 14D.

FIG. 14F provides western blot of tumor lysates from mice sacrificed immediately after day 10 of vehicle treatment (n=2), ERK5-IN-1 treatment (n=2). pERK5 at the auto-phosphorylation site confirms inhibition of ERK5 with cleaved PARP used as a marker of apoptosis. Total ERK5 was used as a loading control.

FIG. 14G provides western blot of ERK5 protein on cells treated with mouse Erk5 siRNA or control siRNA. Mouse DIPG lines genotypes are as follows: H3.3WT-HA or H3.3K27M-HA with both lines expressing PDGFB and loss of p53.

FIG. 1411 provides direct cell count of cells treated with ERK5 siRNA from FIG. 14G. *p<0.05.

FIG. 15 provides a schematic showing how ERK5 promotes tumor growth. H3K27M mutations activate RAS partially through activation of receptor tyrosine kinases (RTKs) and growth factors. ERK5 is activated and promotes tumor growth by phosphorylating and stabilizing MYC. Additionally, H3K27M may activate RAS signaling through other direct, indirect and epigenetic mechanisms.

FIG. 16 provides a schematic depicting the ERK5 pathway.

FIG. 17 provides the rate of growth of DIPG-007 cell line treated with shNull or shCDK9.

FIG. 18 provides representative images of 28 days after injection of BT 245 cell line treated with either shNull or shCDK9.

FIG. 19 provides a Venn diagram depicting overlapping and unique targets between NSC K27M and DIPG-007 cells.

FIG. 20 provides the screening of top targets using siRNA and automated cell count of DIPG-007 cells.

FIG. 21 provides expression levels of ERK5 in various cancers.

FIG. 22 provides a table listing of 294 genes known to directly activate, inactivate, or cooperate with RAS pathway signaling that were used in targeted siRNA screen.

5. DETAILED DESCRIPTION

The present disclosure provides for uses of an ERK5 inhibitor for treating a glioma in a pediatric human subject. For example, but not by way of limitation, the glioma is a pediatric high-grade glioma (PHGG), e.g., a diffuse intrinsic pontine glioma (DIPG), and/or a H3.3-mutated glioma (e.g., a H3K27M-mutated high-grade glioma). Non-limiting embodiments of the disclosed subject matter are described by the present specification and Examples.

For purposes of clarity of disclosure and not by way of limitation, the detailed description is divided into the following subsections:

5.1 Definitions;

5.2 ERK5 inhibitors;

5.3 Methods of treatment;

5.4 Pharmaceutical compositions; and

5.5 Kits.

5.1 Definitions

The terms used in this specification generally have their ordinary meanings in the art, within the context of the disclosed subject matter and in the specific context where each term is used. Certain terms are discussed below, or elsewhere in the specification, to provide additional guidance in describing the compositions and methods of the disclosed subject matter and how to make and use them.

As used herein, the use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and/or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.” Still further, the terms “having,” “including,” “containing” and “comprising” are interchangeable and one of skill in the art is cognizant that these terms are open ended terms.

The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within 3 or more than 3 standard deviations, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value.

As used herein, the term “inhibitor” refers to a compound or molecule (e.g., small molecule, peptide, peptidomimetic, natural compound, siRNA, anti-sense nucleic acid, aptamer, or antibody) that interferes with (e.g., reduces, prevents, decreases, suppresses, eliminates or blocks) the signaling function of a protein or pathway. An inhibitor can be any compound or molecule that changes any activity of a protein (signaling molecule, any molecule involved with the named signaling molecule or a named associated molecule), such as ERK5, or interferes with the interaction of a protein, e.g., ERK5, with signaling partners. Inhibitors also include molecules that indirectly regulate the biological activity of a named protein, e.g., ERK5, by intercepting upstream signaling molecules.

The terms “inhibiting,” “eliminating,” “decreasing,” “reducing” or “preventing,” or any variation of these terms, referred to herein, includes any measurable decrease or complete inhibition to achieve a desired result.

As used herein, the term “disease” refers to any condition or disorder that damages or interferes with the normal function of a cell, tissue, or organ.

A “therapeutically effective amount” of an agent, e.g., an ERK5 inhibitor, refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic or prophylactic result, e.g., treating a glioma in a pediatric subject. A therapeutically effective amount can be administered in one or more administrations.

A “subject,” as referred to herein, may be a human or non-human subject, such as, but not limited to, a non-human primate, a dog, a cat, a horse, a rodent, a rabbit, etc.

An “adult human subject,” as used herein, is a subject that has attained an age of at least 18 years or at least 21 years. A human subject that is not an adult is a pediatric human subject.

As used herein, “treatment” (and grammatical variations thereof such as “treat” or “treating”) refers to clinical intervention in an attempt to alter the natural course of the individual being treated and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, prolonging survival, preventing recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. In certain embodiments, antibodies of the presently disclosed subject matter are used to delay development of a disease or to slow the progression of a disease, e.g., pediatric gliomas, PPHG, DIPG, H3K27M-mutated high-grade gliomas, and H3K27M-mutated non-DIPG high-grade gliomas.

An “anti-cancer effect” refers to one or more of a reduction in aggregate cancer cell mass, a reduction in cancer cell growth rate, a reduction in cancer progression, a reduction in cancer cell proliferation, a reduction in tumor mass, a reduction in tumor volume, a reduction in tumor cell proliferation, a reduction in tumor growth rate and/or a reduction in tumor metastasis. In certain embodiments, an anti-cancer effect can refer to a complete response, a partial response, a stable disease (without progression or relapse), a response with a later relapse or progression-free survival in a patient diagnosed with cancer.

An “anti-cancer agent,” as used herein, can be any molecule, compound, chemical or composition that has an anti-cancer effect. Anti-cancer agents include, but are not limited to, chemotherapeutic agents, radiotherapeutic agents, cytokines, anti-angiogenic agents, apoptosis-inducing agents, anti-cancer antibodies and/or agents which promote the activity of the immune system including, but not limited to, cytokines such as but not limited to interleukin 2, interferon, anti-CTLA4 antibody, anti-PD-1 antibody and/or anti-PD-L1 antibody. In certain embodiments, an anti-cancer agent can be a radiotherapeutic agent. In certain embodiments, an anti-cancer agent can be a chemotherapeutic agent, e.g., temozolomide. Other non-limiting exemplary anti-cancer agents that can be used with the presently disclosed subject matter include tumor-antigen based vaccines, and chimeric antigen receptor T-cells.

As described herein, any concentration range, percentage range, ratio range or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated.

5.2 ERK5 Inhibitors

The present disclosure provides the use of ERK5 inhibitors to treat a glioma in a pediatric subject (e.g., a pediatric human subject) as disclosed herein. In certain embodiments, the glioma is a PHGG or a DIPG. In certain embodiments, the glioma is a H3.3-mutated glioma, e.g., a H3K27M-mutated high-grade glioma, and/or a H3K27M-mutated non-DIPG high-grade glioma.

Extracellular signal-regulated kinase 5, also known as mitogen-activated protein kinase 7 (MAPK7), BMK1, ERK4, and PRKM7, is denoted as ERK5 herein. ERK5 is encoded by the ERK5 gene. In certain embodiments, ERK5 is a human ERK5 protein. In certain embodiments, ERK5 is a mouse ERK5 protein or a rat ERK5 protein.

In certain embodiments, ERK5 can be a human ERK5 protein having an amino acid sequence as set forth in GenBank Accession No. AAA81381.1 or an amino acid sequence at least about 95 percent or at least about 98 percent homologous thereto.

In certain embodiments, ERK5 can be a mouse ERK5 protein having an amino acid sequence as set forth in GenBank Accession No. BAA82039.1 or an amino acid sequence at least about 95 percent or at least about 98 percent homologous thereto.

In certain embodiments, ERK5 can be a rat ERK5 protein having an amino acid sequence as set forth in GenBank Accession No. NP 001178476.1 or an amino acid sequence at least about 95 percent or at least about 98 percent homologous thereto.

In certain embodiments, a nucleic acid encoding a human ERK5 protein of the present disclosed subject matter can include a nucleic acid sequence as set forth in GenBank Accession No. U25278.1 or a nucleic acid sequence at least about 95 percent or at least about 98 percent homologous thereto.

Any suitable ERK5 inhibitors known in the art can be used with the presently disclosed subject matter. Non-limiting exemplary ERK5 inhibitors include any compounds, molecules, chemicals, polypeptides and proteins that inhibit and/or reduce the expression, function and/or activity of ERK5.

In certain embodiments, the ERK5 inhibitors for use with the presently disclosed subject matter are small molecule compounds that inhibit ERK5 activity. In certain embodiments, the small molecule compounds can be in a crystalline or amorphous form as a free base or as a pharmaceutically acceptable salt or solvate.

In certain embodiments, the ERK5 inhibitor is selected from the group consisting of ERK5-IN-1, AX-15836, BIX02189, XMD8-92, free base forms thereof, solvate forms thereof, pharmaceutically acceptable salt forms thereof, derivatives thereof, mixtures thereof, and combinations thereof. Non-limiting examples of pharmaceutically acceptable salt forms include hydrochloride, hydrobromide, hydroiodide, sulfate, bisulfate, 2-hydroxyethansulfonate, phosphate, hydrogen phosphate, acetate, adipate, alginate, aspartate, benzoate, bisulfate, butyrate, camphorate, camphorsulfonate, digluconate, glycerolphsphate, hemi sulfate, heptanoate, hexanoate, formate, succinate, fumarate, maleate, ascorbate, isethionate, salicylate, methanesulfonate, mesitylenesulfonate, naphthylenesulfonate, nicotinate, 2-naphthalenesulfonate, oxalate, pamoate, pectinate, persulfate, 3-phenylproprionate, picrate, pivalate, propionate, trichloroacetate, trifluoroacetate, phosphate, glutamate, bicarbonate, undecanoate, lactate, citrate, tartrate, gluconate, ethanedi sulfonate, benzene sulfonate, and p-toluenesulfonate salts. Another ERK5 inhibitor is (16E)-14-methyl-20-oxa-5,7,14,26-tetraazatetracyclo[19.3.1.1(2,6).1(8,12)]-heptacosa-1(25),2(26),3,5,8(27),9,11,16,21,23-decaene (TG02). In particular embodiments, the methods disclosed herein do not include TG02 or pharmaceutically acceptable salts thereof.

In certain embodiments, the ERK5 inhibitors are ERK5 specific inhibitors, i.e., selective ERK5 inhibitors. In certain embodiments, the selective ERK5 inhibitor is a small molecule compound selected from the group consisting of ERK5-IN-1, pharmaceutically acceptable salt forms thereof, derivatives thereof, and mixtures thereof. In certain embodiments, ERK5-IN-1 can be obtained from Tocris Bioscience under catalog number 5393/10. “ERK5-IN-1” refers to a molecule with a CAS number of 1435488-37-1, a molecular formula of C₃₆H₄₆N₈O₃, and a chemical name of 11-cyclopentyl-2-[[2-ethoxy-4-[[4-(4-methyl-1-piperazinyl)-1-piperidinyl]carbonyl]phenyl]amino]-5,11-dihydro-5-methyl-6H-pyrimido[4,5b][1,4]benzodiazepin-6-one, for example, see formula 1:

In certain embodiments, the selective ERK5 inhibitor is a small molecule compound selected from the group consisting of AX-15836, pharmaceutically acceptable salt forms thereof, derivatives thereof, and mixtures thereof. In certain embodiments, AX-15836 can be obtained from Tocris Bioscience under catalog number 5843/10. “AX-15836” refers to a molecule with a CAS number of 2035509-96-5, a molecular formula of C₃₂H₄0N₈O₅S, and a chemical name of 5,11-dihydro-2-[[2-ethoxy-4-[[4-(4-methyl-1-piperazinyl)-1-piperidinyl]carbonyl]phenyl]amino]-5-methyl,11-(methylsulfonyl)-6H-pyrimido[4,5-b][1,4]benzodiazepin-6-one, for example, see formula 2:

In certain embodiments, the ERK5 inhibitors are dual ERK5 inhibitors, which inhibits the activity of ERK5 and one other kinase. In certain embodiments, the dual ERK5 inhibitors are dual MEK5 and ERK5 inhibitors. In certain embodiments, the dual MEK5 and ERK5 inhibitor is selected from the group consisting of BIX02189, pharmaceutically acceptable salt forms thereof, derivatives thereof, and mixtures thereof. In certain embodiments, BIX02189 can be obtained from Tocris Bioscience under catalog number 4842/10. “BIX02189” refers to a molecule with a CAS number of 1265916-41-3, a molecular formula of C₂₇H₂₈N₄O₂, and a chemical name of (3Z)-3-[[[3-[(dimethylamino)methyl]phenyl]amino]phenylmethylene]-2,3-dihydro-N,N-dimethyl-2-oxo-1H-indole-6-carboxamide, for example, see formula 3:

In certain embodiments, the dual ERK5 inhibitor is selected from the group consisting of XMD8-92, pharmaceutically acceptable salt forms thereof, derivatives thereof, and mixtures thereof. In certain embodiments, XMD8-92 can be obtained from Tocris Bioscience under catalog number 4132/10. “XMD8-92” refers to a molecule with a CAS number of 1234480-50-2, a molecular formula of C₂₆H₃₀N₆O₃, and a chemical name of 2-[[2-ethoxy-4-(4-hydroxy-1-piperidinyl)phenyl]amino]-5,11-dihydro-5,11-dimethyl-6H-pyrimido[4,5-b] [1,4]benzodiazepin-6-one, for example, see formula 4:

In certain embodiments, the dual ERK5 inhibitors are dual CDK5 and ERK5 inhibitors. In certain embodiments, the dual ERK5 inhibitor is not TG02 or pharmaceutically acceptable salts thereof.

In certain embodiments, the ERK5 inhibitors are selected from the group consisting of ribozymes, antisense oligonucleotides, shRNA molecules and siRNA molecules that specifically inhibit and/or reduce the expression or activity of ERK5.

In certain embodiments, the ERK5 inhibitor is an antisense nucleic acid, a shRNA, or a siRNA that is homologous to at least a portion of an ERK5 nucleic acid sequence, wherein the homology of the portion relative to the ERK5 sequence is at least about 75 or at least about 80 or at least about 85 or at least about 90 or at least about 95 or at least about 98 percent, where percent homology can be determined by, for example, BLAST or FASTA software. In certain embodiments, the homologous portion constitutes at least 10 nucleotides, at least 15 nucleotides, at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides. In certain embodiments, the antisense nucleic acid, shRNA, or siRNA molecules have up to 15, up to 20, up to 25, up to 30, up to 35, up to 40, up to 45, up to 50, up to 75, or up to 100 nucleotides in length. In certain embodiments, the antisense nucleic acid, shRNA, or siRNA molecules include DNA or atypical or non-naturally occurring residues, for example, but not limited to, phosphorothioate residues.

In certain embodiments, the antisense nucleic acid, shRNA, or siRNA molecules disclosed herein can be expressed from a vector or produced chemically or synthetically. Methods for selecting an appropriate dsRNA or dsRNA-encoding vector are well known in the art for genes whose sequence is known (e.g., see Tuschl, T. et al. (1999); Elbashir, S. M. et al. (2001); Hannon, G J. (2002); McManus, M T. et al. (2002); Brummelkamp, T R. et al. (2002); U.S. Pat. Nos. 6,573,099 and 6,506,559; and PCT Patent Application Nos. WO 2001/036646, WO 1999/032619 and WO 2001/068836, the contents of which are incorporated by reference herein in their entireties).

In certain embodiments, the ERK5 inhibitor is an antibody or an antibody fragment that partially or completely blocks ERK5 signaling and/or activity.

In certain embodiments, an ERK5 inhibitor of the present disclosure can be conjugated to a modality that specifically targets cancer cells. For example, and not by way of limitation, an ERK5 inhibitor can be conjugated to an antibody or antibody fragment and/or peptide, e.g., that recognizes an epitope on the surface of a cancer cell. In certain embodiments, the modality can be a nanoparticle that specifically targets cancer cells, e.g., by the presence of a targeting moiety conjugated to the nanoparticle.

5.3 Methods of Treatment

The present disclosure provides methods for treating a glioma in a pediatric subject (e.g., a pediatric human subject). In certain embodiments, the method includes administering to the subject a therapeutically effective amount of an ERK5 inhibitor. In certain embodiments, the ERK5 inhibitor is selected from the group consisting of ERK5-IN-1, AX-15836, BIX02189, XMD8-92, free base forms thereof, solvate forms thereof, pharmaceutically acceptable salt forms thereof, derivatives thereof, mixtures thereof, and combinations thereof. In certain embodiments, the ERK5 inhibitor is ERK5-IN-1 or a pharmaceutically acceptable salt form thereof.

Gliomas are divided into four grades, depending on the tumor cells' appearance under a microscope; the higher a tumor's grade number, the more severe it is. Grades 1 and 2 are considered low-grade gliomas and account for about two-thirds of all pediatric tumors. Grades 3 and 4 are considered high-grade gliomas.

In certain embodiments, the glioma is a pediatric high-grade glioma (PHGG). In certain embodiments, the glioma is a diffuse intrinsic pontine glioma (DIPG). DIPG is a particularly aggressive type of PHGG that originates primarily in the midline and pons. In certain embodiments, the glioma is a pediatric glioblastoma (GBM).

In certain embodiments, the glioma is a H3-mutant glioma. In certain embodiments, the glioma is a H3.1-mutant glioma, where the glioma has a mutation in the gene encoding histone H3.1. In certain embodiments, the glioma is a H3.3-mutant glioma, where the glioma has a mutation in the gene encoding histone H3.3. In certain embodiments, the H3.3 mutation is a H3K27M mutation or a H3G34R mutation. In certain embodiments, the glioma is a H3K27M-mutant glioma. In certain embodiments, the glioma is a H3G34R-mutant glioma. In certain embodiments, the H3.3-mutant glioma is a H3.3-mutant PHGG glioma. In certain embodiments, the H3.3-mutant glioma is a H3.3-mutant non-PHGG glioma. In certain embodiments, the H3.3-mutant glioma is a H3.3-mutant DIPG glioma. In certain embodiments, the H3.3-mutant glioma is a H3.3-mutant non-DIPG glioma. In certain embodiments, the H3K27M-mutant glioma is a H3K27M-mutant PHGG glioma. In certain embodiments, the H3K27M-mutant glioma is a H3K27M-mutant non-PHGG glioma. In certain embodiments, the H3K27M-mutant glioma is a H3K27M-mutant DIPG glioma. In certain embodiments, the H3K27M-mutant glioma is a H3K27M-mutant non-DIPG glioma. In certain embodiments, the H3G34R-mutant glioma is a H3G34R-mutant PHGG glioma. In certain embodiments, the H3G34R-mutant glioma is a H3G34R-mutant non-PHGG glioma. In certain embodiments, the H3G34R-mutant glioma is a H3G34R-mutant DIPG glioma. In certain embodiments, the H3G34R-mutant glioma is a H3G34R-mutant non-DIPG glioma.

In certain embodiments, the ERK5 inhibitors administered to the pediatric subject prolong the survival of the pediatric subject relative to a control pediatric subject or control pediatric subject population not receiving said ERK5 inhibitor treatment. In certain embodiments, the period of survival is extended at least about 10 percent, at least about 25 percent, at least about 30 percent, at least about 50 percent, at least about 60 percent or at least about 70 percent. In certain embodiments, the period of survival is extended by about 1 month, about 2 months, about 4 months, about 6 months, about 8 months, about 10 months, about 12 months, about 14 months, about 18 months, about 20 months, about 2 years, about 3 years, about 5 years or more. In certain embodiments, the ERK5 inhibitors administered to the pediatric subject prolong the remission of the glioma in the pediatric subject relative to a control pediatric subject or control pediatric subject population not receiving said ERK5 inhibitor treatment.

In certain embodiments, the methods disclosed herein include administering to a pediatric subject having a glioma a therapeutically effective amount of an ERK5 inhibitor (or a pharmaceutical composition thereof) to produce an anti-cancer effect in the pediatric subject. In certain embodiments, the anti-cancer effect is selected from the group consisting of a reduction in aggregate cancer cell mass, a reduction in cancer cell growth rate, a reduction in cancer cell proliferation, a reduction in tumor mass, a reduction in tumor volume, a reduction in cancer cell proliferation, a reduction in cancer growth rate, a reduction in cancer metastasis, and combinations thereof. In certain embodiments, the anti-cancer effect is a reduction in the number of cancer cells. In certain embodiments, the anti-cancer effect is a reduction in tumor size and/or a reduction in the rate of tumor growth. In certain embodiments, the anti-cancer effect is a reduction in the aggregate cancer cell burden. In certain embodiments, the anti-cancer effect is a reduction in the rate of cell proliferation and/or an increase in the rate of cell death. In certain embodiments, the anti-cancer effect is a prolongation of survival of the pediatric subject. In certain embodiments, the anti-cancer effect is a prolongation in the interval until relapse relative to a control pediatric subject or control pediatric subject population not receiving said ERK5 inhibitor treatment.

5.3.1 Dosing Regimen of ERK5 Inhibitors

In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of between about 20 mg/m²and 200 mg/m²body surface area (BSA) of the pediatric subject per day. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of between about 20 mg/m²and about 40 mg/m², between about 30 mg/m²and about 40 mg/m², between about 60 mg/m²and about 70 mg/m², between about 45 mg/m²and about 55 mg/m², between about 55 mg/m²and about 75 mg/m², between about 60 mg/m²and about 70 mg/m², or between about 75 mg/m²and about 95 mg/m²BSA of the pediatric subject per day. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of up to about 20 mg/m², up to about 30 mg/m², up to about 40 mg/m², up to about 50 mg/m², up to about 60 mg/m², up to about 70 mg/m², up to about 80 mg/m², up to about 90 mg/m², up to about 100 mg/m², up to about 110 mg/m², up to about 120 mg/m², up to about 130 mg/m², up to about 140 mg/m²up to about 150 mg/m², up to about 160 mg/m², up to about 170 mg/m², up to about 180 mg/m², up to about 190 mg/m², or up to about 200 mg/m²BSA of the pediatric subject per day. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of at least about 20 mg/m², at least about 30 mg/m², at least about 40 mg/m², at least about 50 mg/m², at least about 60 mg/m², at least about 70 mg/m², at least about 80 mg/m², at least about 90 mg/m², at least about 100 mg/m², at least about 110 mg/m², at least about 120 mg/m², at least about 130 mg/m², at least about 140 mg/m², at least about 150 mg/m², at least about 160 mg/m², at least about 170 mg/m², at least about 180 mg/m², at least about 190 mg/m², or at least about 200 mg/m²BSA of the pediatric subject per day. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of about 20 mg/m², about 30 mg/m², about 35 mg/m², about 45 mg/m², about 50 mg/m², about 55 mg/m², about 65 mg/m², about 75 mg/m², about 85 mg/m², about 100 mg/m², about 110 mg/m², about 120 mg/m², about 130 mg/m², about 140 mg/m², about 150 mg/m², about 160 mg/m², about 170 mg/m², about 180 mg/m², about 190 mg/m², or about 200 mg/m²BSA of the pediatric subject per day. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose in an amount of about 35 mg/m²BSA of the pediatric subject per day. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose in an amount of about 50 mg/m²BSA of the pediatric subject per day. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose in an amount of about 65 mg/m²BSA of the pediatric subject per day. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose in an amount of about 85 mg/m²BSA of the pediatric subject per day.

In certain embodiments, the dosage administered varies depending upon known factors, such as the pharmacodynamic characteristics of the particular agent, and its mode and route of administration; age, health, and weight of the recipient; nature and extent of symptoms, kind of concurrent treatment, frequency of treatment, and the effect desired. In certain embodiments, the dosage administered depends on the BSA of the pediatric subject. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of between about 20 mg/m²and 60 mg/m²BSA of the pediatric subject per day, where the pediatric subject has a BSA of at least about 55 m². In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of between about 60 mg/m²and 100 mg/m²BSA of the pediatric subject per day, where the pediatric subject has a BSA of at least about 50 m². In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose in an amount of about 35 mg/m²BSA of the pediatric subject per day, where the pediatric subject has a BSA of at least about 55 m². In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose in an amount of about 50 mg/m²BSA of the pediatric subject per day, where the pediatric subject has a BSA of at least about 55 m². In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose in an amount of about 65 mg/m²BSA of the pediatric subject per day, where the pediatric subject has a BSA of at least about 50 m². In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose in an amount of about 85 mg/m²BSA of the pediatric subject per day, where the pediatric subject has a BSA of at least about 50 m².

In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of between about 20 mg and 100 mg per day. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of between about 20 mg and about 30 mg, between about 30 mg and about 40 mg, between about 40 mg and about 50 mg, between about 50 mg and about 60 mg, between about 60 mg and about 70 mg, between about 70 mg and about 80 mg, between about 80 mg and about 90 mg, or between about 90 mg and about 100 mg per day. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of at least about 20 mg, at least about 30 mg, at least about 40 mg, at least about 50 mg, at least about 60 mg, at least about 70 mg, at least about 80 mg, at least about 90 mg, at least about 100 mg, up to about 20 mg, up to about 30 mg, up to about 40 mg, up to about 50 mg, up to about 60 mg, up to about 70 mg, up to about 80 mg, up to about 90 mg, or up to about 100 mg per day. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of about 20 mg, about 30 mg, about 40 mg, about 50 mg, about 60 mg, about 70 mg, about 80 mg, about 90 mg, or about 100 mg per day.

In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of between about 0.4 mg/kg and about 6.6 mg/kg per day. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of at least about 0.4 mg/kg, at least about 0.6 mg/kg, at least about 1.5 mg/kg, at least about 2.5 mg/kg, at least about 3.5 mg/kg, at least about 4.5 mg/kg, at least about 5.5 mg/kg, at least about 6.6 mg/kg, up to about 0.4 mg/kg, up to about 0.6 mg/kg, up to about 1.5 mg/kg, up to about 2.5 mg/kg, up to about 3.5 mg/kg, up to about 4.5 mg/kg, up to about 5.5 mg/kg, or up to about 6.6 mg/kg per day. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of between about 0.4 mg/kg and about 1.0 mg/kg, between about 1.0 mg/kg and about 2.0 mg/kg, between about 2.0 mg/kg and about 3.0 mg/kg, between about 3.0 mg/kg and about 4.0 mg/kg, between about 4.0 mg/kg and about 5.0 mg/kg, between about 5.0 mg/kg and about 6.0 mg/kg, or between about 6.0 mg/kg and about 6.6 mg/kg per day. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of about 0.4 mg/kg, about 0.6 mg/kg, about 1.5 mg/kg, about 2.5 mg/kg, about 3.5 mg/kg, about 4.5 mg/kg, about 5.5 mg/kg, or about 6.6 mg/kg per day.

In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of between about 1.3 mg/kg and about 6.6 mg/kg, wherein the pediatric subject has a body weight of about 15 kg, or at most about 15 kg. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of between about 1.3 mg/kg and about 6.6 mg/kg, wherein the pediatric subject has a body weight of about 15 kg. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of at least about 1.3 mg/kg, at least about 2.0 mg/kg, at least about 3.0 mg/kg, at least about 4.0 mg/kg, at least about 5.0 mg/kg, at least about 6.0 mg/kg, at least about 6.6 mg/kg, up to about 1.3 mg/kg, up to about 2.0 mg/kg, up to about 3.0 mg/kg, up to about 4.0 mg/kg, up to about 5.0 mg/kg, up to about 6.0 mg/kg, or up to about 6.6 mg/kg, wherein the pediatric subject has a body weight of about 15 kg, or at most about 15 kg. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of between about 1.3 mg/kg and about 2.0 mg/kg, between about 2.0 mg/kg and about 3.0 mg/kg, between about 3.0 mg/kg and about 4.0 mg/kg, between about 4.0 mg/kg and about 5.0 mg/kg, or between about 5.0 mg/kg and about 6.0 mg/kg, wherein the pediatric subject has a body weight of about 15 kg, or at most about 15 kg. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of about 1.3 mg/kg, about 2.0 mg/kg, about 3.0 mg/kg, about 4.0 mg/kg, about 5.0 mg/kg, about 6.0 mg/kg, or about 6.6 mg/kg, wherein the pediatric subject has a body weight of about 15 kg, or up to about 15 kg.

In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of between about 0.4 mg/kg and about 6.6 mg/kg, wherein the pediatric subject has a body weight of about 50 kg, at least about 50 kg, or between about 15 kg and about 50 kg. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of between about 0.4 mg/kg and about 6.6 mg/kg, wherein the pediatric subject has a body weight of about 50 kg. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of at least about 0.4 mg/kg, at least about 0.6 mg/kg, at least about 1.5 mg/kg, at least about 2.5 mg/kg, at least about 3.5 mg/kg, at least about 4.5 mg/kg, at least about 5.5 mg/kg, at least about 6.6 mg/kg, up to about 0.4 mg/kg, up to about 0.6 mg/kg, up to about 1.5 mg/kg, up to about 2.5 mg/kg, up to about 3.5 mg/kg, up to about 4.5 mg/kg, up to about 5.5 mg/kg, or up to about 6.6 mg/kg per day, wherein the pediatric subject has a body weight of about 50 kg, at least about 50 kg, or between about 15 kg and about 50 kg. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of between about 0.4 mg/kg and about 1.0 mg/kg, between about 1.0 mg/kg and about 2.0 mg/kg, between about 2.0 mg/kg and about 3.0 mg/kg, between about 3.0 mg/kg and about 4.0 mg/kg, between about 4.0 mg/kg and about 5.0 mg/kg, between about 5.0 mg/kg and about 6.0 mg/kg, or between about 6.0 mg/kg and about 6.6 mg/kg per day, wherein the pediatric subject has a body weight of about 50 kg, at least about 50 kg, or between about 15 kg and about 50 kg. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses in an amount of about 0.4 mg/kg, about 0.6 mg/kg, about 1.5 mg/kg, about 2.5 mg/kg, about 3.5 mg/kg, about 4.5 mg/kg, about 5.5 mg/kg, or about 6.6 mg/kg per day, wherein the pediatric subject has a body weight of about 50 kg, at least about 50 kg, or between about 15 kg and about 50 kg.

In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses per day, where the single dose or each divided dose is considered one unit dose. In certain embodiments, a one unit dose of ERK5 inhibitor includes between about 0.01 mg and about 1000 mg, e.g., between about 10 mg to about 500 mg, or between about 20 and about 100 mg of ERK5 inhibitor. In certain embodiments, a one unit dose of ERK5 inhibitor includes about 10 mg, about 20 mg, about 30 mg, about 40 mg, about 50 mg, about 60 mg, about 70 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 260 mg, about 270 mg, about 280 mg, about 290 mg, or about 300 mg of ERK5 inhibitor.

In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose or divided doses per day of one day, two days, three days, four days, five days, six days, or seven days per week. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject in a single dose per day of two days per week.

In certain embodiments, the duration of the ERK5 inhibitor treatment is between about one week to about two years. In certain embodiments, the duration of the ERK5 inhibitor treatment is at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, at least about 12 months, at least about 13 months, at least about 14 months, at least about 15 months, at least about 16 months, at least about 17 months, at least about 18 months, at least about 19 months, at least about 20 months, at least about 21 months, at least about 22 months, at least about 23 months, or at least about 24 months. In certain embodiments, the duration of the ERK5 inhibitor treatment is up to about 1 week, up to about 2 weeks, up to about 3 weeks, up to about 1 month, up to about 2 months, up to about 3 months, up to about 4 months, up to about 5 months, up to about 6 months, up to about 7 months, up to about 8 months, up to about 9 months, up to about 10 months, up to about 11 months, up to about 12 months, up to about 13 months, up to about 14 months, up to about 15 months, up to about 16 months, up to about 17 months, up to about 18 months, up to about 19 months, up to about 20 months, up to about 21 months, up to about 22 months, up to about 23 months, or up to about 24 months. In certain embodiments, the duration of the ERK5 inhibitor treatment is up to about 24 months or 2 years.

In certain embodiments, the ERK5 inhibitor is cyclically administered to a pediatric subject. Cycling therapy involves the administration of an active agent for a period of time, followed by a rest for a period of time, and repeating this sequential administration. Cycling therapy can reduce the development of resistance to one or more of the therapies, avoid or reduce the side effects of one of the therapies, and/or improves the efficacy of the treatment. In certain embodiments, the treatment stops after one cycle because the subject is intolerable to the adverse effects and toxicities associated with the ERK5 inhibitors.

In certain embodiments, the number of cycles is from about one to about twenty-four cycles. In certain embodiments, the number of cycles is more than twenty-four cycles. In certain embodiments, the number of cycles is about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, or about 24. In certain embodiments, the duration of a cycle is from about 21 to about 30 days. In certain embodiments, the duration of a cycle is about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or about 30 days. In certain embodiments, the duration of a cycle is about 27 days, about 28 days, about 29, or about 30 days. In certain embodiments, the number of cycles is about twenty-four cycles.

In certain embodiments, each cycle is followed by a rest period, where the ERK5 inhibitor are not administered to the pediatric subject. In certain embodiments, the rest period is from about two weeks to about six weeks, from three weeks to about five weeks, from about four weeks to about six weeks. In certain embodiments, the rest period is about three weeks, about four weeks, about five weeks, or about six weeks. The present disclosure further allows the frequency, number, and length of dosing cycles and rest period to be adjusted.

5.3.2 H3 Mutations

In certain embodiments, the methods disclosed herein further includes detecting a H3 mutation. In certain embodiments, the methods disclosed herein further includes detecting a H3.3 mutation in a sample from the pediatric subject, where the H3.3 mutation is in the gene encoding histone H3.3. In certain embodiments, the sample is obtained from the glioma of the pediatric subject. In certain embodiments, the H3.3 mutation is a H3K27M mutation or a H3G34R mutation. Any suitable detecting methods known in the art can be used with the presently disclosed subject matter to detect the H3.3 mutations (e.g., H3K27M mutation or a H3G34R mutation). Non-limiting exemplary detecting methods include Polymerase chain reaction (PCR), Reverse transcriptase PCR (RT-PCR), Multiplex PCR, Nested PCR, Amplification refractory mutation system (ARMS) PCR, Real time PCR, DNA microarray, Multiplex ligation-dependent probe amplification (MLPA), and Next Generation Sequencing.

5.3.3 Second Anti-Cancer Agent and Anti-Cancer Treatment

In certain embodiments, the methods disclosed herein further include administering to the subject a second anti-cancer agent. Non-limiting exemplary anti-cancer agents include, but are not limited to chemotherapeutic agents, radiotherapeutic agents, cytokines, anti-angiogenic agents, apoptosis-inducing agents, anti-cancer antibodies, a targeted drug, agents which promote the activity of the immune system, and checkpoint inhibitors. In certain embodiments, the second anti-cancer agent is a radiotherapeutic agent. In certain embodiments, the second anti-cancer agent is a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent is temozolomide. In certain embodiments, the second anti-cancer agent is a targeted drug. In certain embodiments, the targeted drug is bevacizumab. In certain embodiments, the second anti-cancer agent is an agent that promotes the activity of the immune system, including but not limited to interleukin 2, interferon, anti-CTLA4 antibody, anti-PD-1 antibody, and/or anti-PD-L1 antibody. Other non-limiting exemplary anti-cancer agents that can be used with the presently disclosed subject matter include tumor-antigen based vaccines, and chimeric antigen receptor T-cells.

In certain embodiments, the second anti-cancer agent is an EZH2 inhibitor. Non-limiting examples of EZH2 inhibitors include compounds, molecules, chemicals, polypeptides, proteins that inhibit and/or reduce the expression and/or activity of EZH2. Additional non-limiting examples of EZH2 inhibitors include S-adenosyl-methionine-competitive small molecule inhibitors. In certain embodiments, the EZH2 inhibitor is derived from tetramethylpiperidinyl compounds. In certain embodiments, the EZH2 inhibitor is selected from the group consisting of UNC1999, 3-Deazaneplanocin A (DZNcp), EI1, EPZ-5676, EPZ-6438, GSK343, EPZ005687, EPZ011989, GSK126, and combinations thereof.

Further non-limiting examples of EZH2 inhibitors are described in Garapaty-Rao et al., Chemistry and Biology, 20: pp. 1-11 (2013), PCT Patent Application Nos. WO 2013/138361, WO 2013/049770 and WO 2003/070887, and US Patent Application Nos. US 2014/0275081, US 2012/0071418, US 2014/0128393 and US 2011/0251216, the contents of which are hereby incorporated by reference herein in their entireties.

In certain embodiments, the presently disclosed methods include administering a radiotherapy and an ERK5 inhibitor to the pediatric subject. In certain embodiments, the methods disclosed herein include first administering an ERK5 inhibitor to the pediatric patient, then administering a radiotherapy to the pediatric patient. In certain embodiments, the methods disclosed herein include first administering the radiotherapy to the pediatric patient, then administering the ERK5 inhibitor to the pediatric patient. In certain embodiments, the methods disclosed herein include administering the radiotherapy and the ERK5 inhibitor to the pediatric patient substantially simultaneously, wherein the pediatric subject has received a therapeutically effective amount of the ERK5 inhibitor while receiving the radiotherapy.

Any suitable methods known in the art for delivering a therapeutic dose of radiation to a pediatric subject can be used with the presently disclosed subject matter. Non-limiting exemplary methods for delivering radiotherapy that can be used with the presently disclosed methods include gamma-radiation, neutron beam radiotherapy, electron beam radiotherapy, proton therapy, brachytherapy, systemic radioactive isotopes, photon radiotherapy, particle beam radiation therapy, other types of radiotherapies, and combinations thereof. In certain embodiments, the radiotherapy disclosed herein is delivered to the pediatric subject using a gamma knife. In certain embodiments, the radiotherapy disclosed herein is delivered to the pediatric subject using a linear accelerator. In certain embodiments, the radiotherapy used with the presently disclosed methods uses an ionizing radiation. Non-limiting exemplary ionizing radiation relevant to the cancer treatment include X-rays, gamma rays, and particulate radiation beams.

In certain embodiments, the source of radiation used with the presently disclosed subject matter is external to the pediatric subject. In certain embodiments, the external radiation therapy includes directing a beam of high-energy radiation to a tumor site through the skin using, for instance, a linear accelerator. In certain embodiments, the source of radiation used with the presently disclosed subject matter is internal to the pediatric subject. In certain embodiments, the internal radiation therapy includes implanting a radiation-emitting source, such as beads, wires, pellets, capsules, particles, and the like, inside the body at or near the tumor site, including the use of delivery systems that specifically target cancer cells (e.g., using particles attached to cancer cell binding ligands). Non-limiting exemplary internal radiation therapies include brachytherapy, interstitial irradiation, intracavity irradiation, radioimmunotherapy, and the like.

In certain embodiments, the methods disclosed herein further includes administering at least one radiosensitizer to the pediatric subject to enhance the killing of tumor cells. Non-limiting exemplary radiosensitizers include metronidazole, misonidazole, intra-arterial Budr, intravenous iododeoxyuridine (IudR), nitroimidazole, 5-substituted-4-nitroimidazoles, 2H-isoindolediones, [[(2-bromoethyl)-amino]methyl]-nitro-1H-imidazole-1-ethanol, nitroaniline derivatives, DNA-affinic hypoxia selective cytotoxins, halogenated DNA ligand, 1,2,4 benzotriazine oxides, 2-nitroimidazole derivatives, fluorine-containing nitroazole derivatives, benzamide, nicotinamide, acridine-intercalator, 5-thiotretrazole derivative, 3-nitro-1,2,4-triazole, 4,5-dinitroimidazole derivative, hydroxylated texaphrins, cisplatin, mitomycin, tiripazamine, nitrosourea, mercaptopurine, methotrexate, fluorouracil, bleomycin, vincristine, carboplatin, epirubicin, doxorubicin, cyclophosphamide, vindesine, etoposide, paclitaxel, and heat (hyperthermia).

In certain embodiments, the methods disclosed herein further includes administering at least one radioprotector to the pediatric subject to protect healthy tissue from the harmful effects of radiation. Non-limiting exemplary radioprotectors include cysteamine, aminoalkyl dihydrogen phosphorothioates, amifostine (WR 2721), IL-1, and IL-6.

In certain embodiments, the methods disclosed herein includes administering a total dose of between about 0.01 Gray (Gy) and about 100 Gy radiation to the pediatric subject. In certain embodiments, the methods disclosed herein includes administering a total dose of between about 10 Gy and about 65 Gy radiation to the pediatric subject. In certain embodiments, the methods disclosed herein includes administering a total dose of at least about 10 Gy, at least about 15 Gy, at least about 20 Gy, at least about 25 Gy, at least about 30 Gy, at least about 35 Gy, at least about 40 Gy, at least about 45 Gy, at least about 50 Gy, at least about 55 Gy, at least about 60 Gy, at least about 65 Gy, up to about 10 Gy, up to about 15 Gy, up to about 20 Gy, up to about 25 Gy, up to about 30 Gy, up to about 35 Gy, up to about 40 Gy, up to about 45 Gy, up to about 50 Gy, up to about 55 Gy, up to about 60 Gy, or up to about 65 Gy radiation to the pediatric subject. In certain embodiments, the methods disclosed herein includes administering a total dose of between about 10 Gy and about 15 Gy, between about 15 Gy and about 20 Gy, between about 20 Gy and about 25 Gy, between about 25 Gy and about 30 Gy, between about 30 Gy and about 35 Gy, between about 40 Gy and about 45 Gy, between about 45 Gy and about 50 Gy, between about 50 Gy and about 55 Gy, between about 55 Gy and about 60 Gy, or between about 60 Gy and about 65 Gy, to the pediatric subject.

In certain embodiments, the methods disclosed herein includes administering a total dose of about 10 Gy, about 15 Gy, about 20 Gy, about 25 Gy, about 30 Gy, about 35 Gy, about 40 Gy, about 45 Gy, about 50 Gy, about 55 Gy, about 60 Gy, or about 65 Gy radiation to the pediatric subject. In certain embodiments, the methods disclosed herein includes administering a total dose of about 54 Gy to the pediatric subject. In certain embodiments, the methods disclosed herein includes administering a total dose of between 54 and 59.4 Gy to the pediatric subject. In certain embodiments, the methods disclosed herein includes administering a total dose of about 54 Gy to the pediatric subject with DIPG. In certain embodiments, the methods disclosed herein includes administering a total dose of between 54 and 59.4 Gy to the pediatric subject with other non-DIPG H3.3-mutated HGGs.

In certain embodiment, the total dose of radiation is administered over the course of one day. In certain embodiments, the total dose of radiation is fractionated to maximize target cell exposure and to reduce toxicity. In certain embodiments, the total dose of radiation is fractionated and administered in between about 1 week and about 8 weeks. In certain embodiments, the total dose of radiation is fractionated and administered in at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least about 7 days, at least about 10 days, at least about 14 days, at least about 17 days, at least about 21 days, at least about 24 days, at least about 28 days, at least about 31 days, at least about 35 days, at least about 38 days, at least about 42 days, at least about 45 days, at least about 49 days, at least about 52 days, or at least about 56 days.

In certain embodiments, the radiotherapy is administered to the pediatric subject in a daily dose of between about 1 Gy and about 5 Gy, between about 1 Gy and about 2 Gy, or between about 1 Gy and about 1.5 Gy. In certain embodiments, the radiotherapy is administered to the pediatric subject in a daily dose of at least about 1 Gy, at least about 1.5 Gy, at least about 1.8 Gy, at least about 2 Gy, at least about 2.5 Gy, at least about 2.8 Gy, at least about 3 Gy, at least about 3.2 Gy, at least about 3.5 Gy, at least about 3.8 Gy, at least about 4 Gy, at least about 4.2 Gy, at least about 4.5 Gy, at least about 5 Gy, up to about 1 Gy, up to about 1.5 Gy, up to about 1.8 Gy, up to about 2 Gy, up to about 2.5 Gy, up to about 2.8 Gy, up to about 3 Gy, up to about 3.2 Gy, up to about 3.5 Gy, up to about 3.8 Gy, up to about 4 Gy, up to about 4.2 Gy, up to about 4.5 Gy, or up to about 5 Gy. In certain embodiments, the radiotherapy is administered to the pediatric subject in a daily dose of about 1 Gy, about 1.5 Gy, about 1.8 Gy, about 2 Gy, about 2.5 Gy, about 2.8 Gy, about 3 Gy, about 3.2 Gy, about 3.5 Gy, about 3.8 Gy, about 4 Gy, about 4.2 Gy, about 4.5 Gy, or about 5 Gy. In certain embodiments, daily doses of radiation should be sufficient to induce destruction of the targeted DIPG cells.

In certain embodiments, the radiotherapy is administered cyclically. In certain embodiments, the number of cycles is from about one to about twenty-four cycles. In certain embodiments, the number of cycles is more than twenty-four cycles. In certain embodiments, the number of cycles is about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, or about 24. In certain embodiments, the duration of each cycle is about 7 days, about 10 days, about 14 days, about 21 days, or about 28 days. In certain embodiments, the duration of a cycle is about 7 day.

In certain embodiments, each radiotherapy cycle includes a rest period, in which the radiation is not administered to the pediatric subject during the rest period. In certain embodiments, the rest period is about 21 days, about 20 days, about 19 days, about 18 days, about 17 days, about 16 days, about 15 days, about 14 days, about 13 days, about 12 days, about 11 days, about 10 days, about 9 days, about 8 days, about 7 days, about 6 days, about 5 days, about 4 days, about 3 days, about 2 days, or about 1 days.

In certain embodiments, the radiation is administered 5 days/cycle, where the duration of each cycle is 7 days, and each cycle includes a 2-day rest period. In certain embodiments, the radiation is administered on day 1, day 2, day 3, day 4, and day 5 of the 7-day cycle. In certain embodiments, the radiation is administered 1 day/cycle, 2 days/cycle, 3 days/cycle, 4 days/cycle, 5 days/cycle, 6 days/cycle, or 7 days/cycle, where the duration of each cycle is 7 days. The present disclosure further allows the frequency, number, and length of dosing cycles and rest period to be adjusted, depending on the responsiveness of the pediatric subject to the radiotherapy and the occurrence of the radiotherapy-associated side effect.

In certain embodiments, the radiotherapy can be initiated at any time during the ERK5 inhibitor treatment period. In certain embodiments, the radiotherapy is initiated on week 1 or week 2, and is administered for the remaining duration of the ERK5 inhibitor treatment period. In certain embodiments, the radiotherapy is administered from week 1 to week 6, or from week 2 to week 6 of a ERK5 inhibitor treatment period. In certain embodiments, the radiotherapy is administered from week 1 to week 5, or from week 2 to week 5, of a ERK5 inhibitor treatment period. In certain embodiments, the methods disclosed herein include administering a radiotherapy and an ERK5 inhibitor to the pediatric subject. In certain embodiments, the radiotherapy is administered fractionated over 6 weeks. In certain embodiments, the total dose of the radiotherapy is between about 54 and 59.5 Gy. In certain embodiments, the ERK5 inhibitor is administered twice a week, e.g., on Mondays and Thursdays, once a day, for the duration of the radiotherapy and afterwards for a up to 2 years or until the patient experiences disease progression or clinically significant toxicity. In certain embodiments, the ERK5 inhibitor is administered twice a week, once a day, for up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months after the radiotherapy. In another embodiment, the ERK5 inhibitor is administered once weekly during the radiotherapy and/or afterwards. In certain embodiments, the ERK5 inhibitor is administered twice weekly for 3 of 4 weeks after the radiotherapy. In certain embodiments, the ERK5 inhibitor is administered once weekly after the radiotherapy.

In certain embodiments, when the ERK5 inhibitor is administered on the same day as the radiotherapy, the ERK5 inhibitor is administered to the pediatric subject between about 1 hours and about 8 hours, between about 1 hours and about 7 hours, between about 1 hours and about 6 hours, between about 1 hours and about 5 hours, between about 1 hours and about 4 hours, between about 1 hour and about 3 hours, or between about 1 hour and about 2 hours. Alternatively, the ERK5 inhibitor is administered to the pediatric subject between about 2 hours and 3 hours, between about 2 hours and 4 hours, or between about 2 hours to about 5 hours prior to the administration of the radiotherapy. Alternatively, the ERK5 inhibitor is administered to the pediatric subject between about 5 hours and about 8 hours, between about 5 hours and about 7 hours, between about 5 hours and about 6 hours, or between about 6 hours and about 7 hours prior to the administration of the radiotherapy. In certain embodiments, the ERK5 inhibitor is administered to the pediatric subject about 1 hour, about 2 hours, about 3 hours about 4 hours, about 5 hours, about 6 hours, about 7 hours, or about 8 hours prior to the administration of the radiotherapy.

These exemplary dosing protocols are not intended, however, to limit the methods provided herein.

5.3.4 Administration Methods

Any suitable methods known in the art can be used for administering to the pediatric subject the ERK5 inhibitors disclosed herein. In certain embodiments, the ERK5 inhibitors can be administered to the subject orally or parenterally. For example, and not by way of limitation, the route of administration can be intravenous, intraarterial, intrathecal, intraperitoneal, intramuscular, subcutaneous, topical, intradermal, intranasal, vaginal, rectal, route, locally to the cancer, or combinations thereof. In certain embodiments, the ERK5 inhibitors are administered to the pediatric subject orally. In certain embodiments, the ERK5 inhibitors are administered to the pediatric subject intravenously.

In certain embodiments, the pediatric subject has a newly diagnosed glioma, where the pediatric subject has not received any treatment for the glioma previously. In certain embodiments, the glioma is a refractory glioma. In certain embodiments, the glioma is a relapsed glioma. In certain embodiments, the glioma is a relapsed and refractory glioma.

In certain embodiments, the ERK5 inhibitor treatment disclosed herein is administered after the subject has been treated with an additional anti-cancer treatment. In certain embodiments, the ERK5 inhibitor treatment disclosed herein is administered simultaneously or sequentially while the subject is being treated with the additional anti-cancer treatments. Examples of the additional cancer treatments include, but are not limited to, surgery, chemotherapy, checkpoint inhibitors, radiation therapy, and combinations thereof.

5.4 Pharmaceutical Compositions

The present disclosure also provides pharmaceutical compositions including an ERK inhibitor disclosed in Section 5.2 for use in treating a glioma in a pediatric human subject (e.g., a pediatric human subject). For example, but not by way of limitation, the ERK5 inhibitor is selected from the group consisting of ERK5-IN-1, AX-15836, BIX02189, X1VD8-92, free base forms thereof, solvate forms thereof, pharmaceutically acceptable salt forms thereof, derivatives thereof, mixtures thereof, and combinations thereof. In certain embodiments, the ERK5 inhibitor is ERK5-IN-1 or a pharmaceutically acceptable salt form thereof. In certain embodiments, the pediatric glioma is a PHGG or a DIPG. In certain embodiments, the glioma is a pediatric glioblastoma (GBM). In certain embodiments, the pediatric glioma is a H3-mutated glioma, e.g., a H3K27M-mutated high-grade glioma or a H3K27M-mutated non-DIPG high-grade glioma.

In certain embodiments, the pharmaceutical compositions further include a pharmaceutically acceptable carrier. Suitable pharmaceutically acceptable carriers that can be used with the presently disclosed subject matter have the characteristics of not interfering with the effectiveness of the biological activity of the active ingredients, e.g., ERK5 inhibitors, and that is not toxic to the patient to whom it is administered. Non-limiting examples of suitable pharmaceutical carriers include phosphate-buffered saline solutions, water, emulsions, such as oil/water emulsions, various types of wetting agents and sterile solutions. Additional non-limiting examples of pharmaceutically acceptable carriers include gels, bioabsorbable matrix materials, implantation elements containing the inhibitor and/or any other suitable vehicle, delivery or dispensing mechanism or material. Such pharmaceutically acceptable carriers can be formulated by conventional methods and can be administered to the subject. In certain embodiments, the pharmaceutical acceptable carriers can include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as, but not limited to, octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride, phenol, butyl or benzyl alcohol, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol, 3-pentanol and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein complexes); and/or non-ionic surfactants such as polyethylene glycol (PEG). In certain embodiments, the suitable pharmaceutically acceptable carriers can include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol or combinations thereof.

In certain non-limiting embodiments, the pharmaceutical compositions of the present disclosure can be formulated using pharmaceutically acceptable carriers well known in the art that are suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral or nasal ingestion by a patient to be treated. In certain embodiments, the pharmaceutical composition is formulated as a capsule. In certain embodiments, the pharmaceutical composition can be a solid dosage form. In certain embodiments, the tablet can be an immediate release tablet. Alternatively or additionally, the tablet can be an extended or controlled release tablet. In certain embodiments, the solid dosage can include both an immediate release portion and an extended or controlled release portion.

In certain embodiments, the pharmaceutical compositions of the present disclosure can be formulated using pharmaceutically acceptable carriers well known in the art that are suitable for parenteral administration. The terms “parenteral administration” and “administered parenterally,” as used herein, refers to modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion. For example, and not by way of limitation, pharmaceutical compositions of the present disclosure can be administered to the patient intravenously in a pharmaceutically acceptable carrier such as physiological saline. In certain embodiments, the present disclosure provides a parenteral pharmaceutical composition including an ERK5 inhibitor disclosed herein.

In certain embodiments, the pharmaceutical compositions suitable for use in the presently disclosed subject matter can include compositions where the active ingredients, e.g., ERK5 inhibitors, are contained in a therapeutically effective amount. The therapeutically effective amount of an active ingredient can vary depending on the active ingredient, e.g., ERK5 inhibitor, compositions used, the cancer and its severity, and the age, weight, etc., of the subject to be treated. In certain embodiments, a pediatric human subject can receive a therapeutically effective amount of an ERK5 inhibitor in single or multiple administrations of one or more composition, which can depend on the dosage and frequency as required and tolerated by the patient.

In certain embodiments, the pharmaceutical compositions further include a second anti-cancer agent. Non-limiting exemplary anti-cancer agents include, but are not limited to chemotherapeutic agents, radiotherapeutic agents, cytokines, anti-angiogenic agents, apoptosis-inducing agents, anti-cancer antibodies, a targeted drug, agents which promote the activity of the immune system, checkpoint inhibitors. In certain embodiments, the second anti-cancer agent is a radiotherapeutic agent. In certain embodiments, the second anti-cancer agent is a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent is temozolomide. In certain embodiment, the second anti-cancer agent is a targeted drug. In certain embodiments, the targeted drug is bevacizumab. In certain embodiments, the second anti-cancer agent is an agent that promotes the activity of the immune system, including but not limited to interleukin 2, interferon, anti-CTLA4 antibody, anti-PD-1 antibody, and/or anti-PD-L1 antibody. Other non-limiting exemplary anti-cancer agents that can be used with the presently disclosed subject matter include tumor-antigen based vaccines, and chimeric antigen receptor T-cells.

5.5 Kits

The present disclosure provides kits that can be used to practice the presently disclosed methods of treating a glioma in a pediatric subject. In certain embodiments, the kits disclosed herein include an ERK5 inhibitor or a pharmaceutical composition thereof. In certain embodiments, the kits include a pharmaceutical composition including a therapeutically effective amount of an ERK5 inhibitor. In certain embodiments, the kits further include a second anti-cancer agent disclosed herein, e.g., within the same container as the ERK inhibitor (or pharmaceutical compositions thereof) or within a second container. In certain embodiments, the second anti-cancer agent is a radiotherapeutic agent. In certain embodiments, the second anti-cancer agent is a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent is temozolomide. Other non-limiting exemplary anti-cancer agents that can be used with the presently disclosed subject matter include tumor-antigen based vaccines, and chimeric antigen receptor T-cells.

In certain embodiments, the kits further include instructions for using the kits in treating a pediatric subject. In certain embodiments, the instructions indicate that the ERK5 inhibitors can be administered in accordance with the methods disclosed in Section 5.3. In certain embodiments, the instructions indicate the ERK5 inhibitors can be administered orally as a single dose, twice per week. In certain embodiments, the instructions indicate the ERK5 inhibitors can be administered for up to 2 years.

In certain non-limiting embodiments, the present disclosure provides for a kit that includes a container including an ERK5 inhibitor, e.g., a therapeutically effective amount of an ERK5 inhibitor, and/or a container including a second anti-cancer agent, e.g., a therapeutically effective amount of a second anti-cancer agent, with instructions to use any combination of the components of the one or more containers together or separately for treating cancer. For example, and not by way of limitation, the instructions can include a description of an ERK5 inhibitor and/or a second anti-cancer agent, and, optionally, other components present in the kit. In certain embodiments, the instructions can describe methods for administration of the components of the kit, including methods for determining the proper state of the subject, the proper dosage amount and the proper administration method for administering one or more of the ERK5 inhibitor and/or other anti-cancer agent. Instructions can also include guidance for monitoring the subject over the duration of the treatment time. In certain embodiments, the kit may further include one or more containers including additional ERK5 inhibitors and/or other anti-cancer agents. In certain embodiments, a kit of the present disclosure includes a container that includes an ERK5 inhibitor and an anti-cancer agent.

In certain non-limiting embodiments, the present disclosure provides for a kit of this disclosure further including one or more of the following: devices and additional reagents, and components, such as tubes, containers, cartridges, and syringes for performing the methods disclosed in Section 5.3.

In certain embodiments, the kits disclosed herein is configured to detect an H3 mutation, e.g., an H3.1 mutation and/or an H3.3 mutation, in a sample from the pediatric subject. In certain embodiments, the H3.3 mutation is in the gene encoding histone H3.3. In certain embodiments, the H3.1 mutation is in the gene encoding histone H3.1. In certain embodiments, the sample is obtained from the glioma of the pediatric subject. In certain embodiments, the H3.3 mutation is a H3K27M mutation or a H3G34R mutation. Any suitable detecting means known in the art can be used with the presently disclosed subject matter to detect the H3.3 mutations (e.g., H3K27M mutation, H3G34R mutation). Non-limiting exemplary configurations for detecting an H3 mutation include a processor linked to one or more non-transitory memories storing instructions for performing polymerase chain reaction (PCR), Reverse transcriptase PCR (RT-PCR), Multiplex PCR, Nested PCR, Amplification refractory mutation system (ARMS) PCR, Real time PCR, DNA microarray, Multiplex ligation-dependent probe amplification (MLPA), and Next Generation Sequencing.

6. EXAMPLES

The presently disclosed subject matter will be better understood by reference to the following Example, which is provided as exemplary of the presently disclosed subject matter, and not by way of limitation.

Example 1: Identification of Novel Therapeutic Vulnerabilities in RAS Signaling for Diffuse Intrinsic Pontine Gliomas

The RAS-MAPK signaling pathway, which stimulates cell proliferation and survival, is included of clinically actionable targets, with several inhibitors that target specific pathway signaling mediators already in clinical use (Bhullar et al., Molecular cancer 2018; 17:48). RAS, though infrequently mutated, is often hyperactive in DIPG due to a variety of mechanisms including: recurrent growth factor activation, mutations in receptor tyrosine kinases such as platelet derived growth factor receptor alpha (PDGFRA), and genetic inactivation of RAS regulatory proteins such as Neurofibromin 1 (NF1) (Mackay et al., Cancer cell 2017; 32:520-37 e5; Sturm et al., Cancer cell 2012; 22:425-37; Schwartzentruber et al., Nature 2012; 482:226-31). However, the relationship between the H3K27M mutations and RAS pathway has yet to be explored.

Here the present disclosure shows that H3K27M mutations contribute to RAS pathway signaling, which is augmented by additional RAS activators including PDGFRA. The present disclosure observed that the H3K27M mutations lead to increased expression of receptor tyrosine kinases (RTKs). From a RAS pathway functional screen, ERK5, but not ERK1/2, was identified in accordance with the present disclosure as a RAS pathway effector important for DIPG growth. Suppression of ERK5, which is highly expressed in DIPG, decreased DIPG cell proliferation and induced apoptosis both in vitro and in vivo. Additionally, ERK5 knockdown or treatment with ERK5 inhibitor significantly increased survival of mice intracranially engrafted with DIPG cells. Mechanistically, the present disclosure shows that ERK5 directly activates and stabilizes the proto-oncogene MYC. ERK5 overexpression fully rescued ERK5-depleted cells and partial rescue was achieved by expression of ERK5 mutants lacking kinase activity or the transactivation domain (ATAD). However, no rescue was achieved with kinase-dead, ATAD double mutants. Additionally, ERK5 knockdown or treatment with ERK5 inhibitors significantly increased survival of mice intracranially engrafted with DIPG cells. Collectively, this data demonstrates a role of H3K27M contributing to RAS activation, and in so doing reveal novel therapeutic targets for treating these tumors.

Materials and Methods Cell Culture

Human Neural Stem Cells (H9 hESC-Derived) were purchased from Invitrogen and grown in DMEM/F12 containing penicillin/streptomycin/amphotericin B (1% vol/vol) supplemented with N2 (2% vol/vol; Invitrogen), EGF (20 ng/ml; Invitrogen), and FGF-2 (20 ng/ml; Invitrogen). DIPG cell lines (all with the H3K27M mutation) SU-DIPG-IV (DIPG-IV), SU-DIPG-13p (DIPG-13p), and HSJD-DIPG-007 (DIPG-007) were grown and passaged in DIPG medium as previously reported (Grasso et al., Nature medicine 2015; 21:555-9; Nagaraja et al., Cancer cell 2017; 31:635-52 e6; Vinci et al., Nature medicine 2018). SF8628 and immortalized NHAs were grown in DMEM (Invitrogen) supplemented with 10% FBS (Invitrogen). All cell lines were confirmed by STR profiling and tested mycoplasma negative by PCR. All tumor-derived cell lines used are described in Table 2.

TABLE 2 Description of tumor-derived cell lines Cell line Tumor of origin Histone 3 status SF8628 DIPG H3.3 K27M DIPG-IV DIPG H3.1 K27M ACVR1 G328V; MDM4, NTRK1 gain DIPG-VI DIPG H3.3 K27M TP53 mutant DIPG-007 DIPG H3.3 K27M DIPG-XIII DIPG H3.3 K27M CNMC-XD- DIPG H3 Wild-type 760 HSJD-GBM- Ped. GBM H3 Wild-type PDGFRA mutant 001 SU-pcGBM2 Ped. GBM H3 Wild-type TP53 mutant; EGFR amplified

Generation of Inducible ERK5 Knockdown Cells

To produce lentivirus, 400 μl of Opti-MEM I (Gibco) containing 2.4 μg pCMV-dR8.2 dvpr, 1.8 μg pCMV-VSV-G, 3 μg piSMART mCMV/TurboGFP shRNA plasmid (Dharmacon), and 20 μl FuGENE HD (Fugent LLC) was added to a 10 cm plate of HEK293T cells grown in complete media+10% FBS. Media was collected from the HEK293T cells 48 hours after transfection, spun at 2000×g, and the virus-containing supernatant was either used directly for lentiviral transduction or concentrated with Lenti-X lentiviral concentrator (Takara). Cells were transduced by overnight incubation with lentivirus in appropriate growth media containing 5-8 μg/ml Polybrene (EMD Millipore). Beginning two days after transduction, cells were cultured with 0.5-1 μg/ml puromycin (Gibco) for 5-7 days.

Plasmids and Plasmid Construction

Wildtype human H3F3A cDNA was ligated with a puromycin selection marker and a self-cleaving T2A sequence using Gibson Assembly Cloning and cloned into pLV with an EF1a promoter. HA-RASAL1 (NM_001193520.1) with an N-terminal HA tag, MYC (NM_002467.4), or MAPK7 (ERK5, NM_139033) were ligated with T2A mCherry and cloned into pLV under the control of the EF1a promoter. Cloning and plasmid sequence validation were performed by VectorBuilder Services (Santa Clara, Calif. 95050). Site-directed mutagenesis was performed to generate H3F3A K27M, H3F3A G34R, MYC S62D, and ERK5 mutant constructs using the QuikChange II Site-Directed Mutagenesis Kit and manufacturer's protocol (Agilent, Cat #200523, Santa Clara, Calif. 95051). Lentiviral ERK5 GIPZ shRNA plasmids were purchased from Dharmacon (Lafayette, Colo. 80026, Cat #RHS4531-EG5598 glycerol set: V2LHS 202701, V3LHS_366737, V3LHS_366738, V3LHS_366740, V3LHS_640828, V3LHS_640830).

Cell Proliferation Assays, Viability Assays, and Drug EC50 Analysis

Direct cell counts were performed using the Countess II FL Automated Cell Counter (ThermoFisher Scientific). Alamar blue viability (ThermoFisher Scientific) and the 5-bromo-2′-deoxyuridine (BrdU) incorporated cell proliferation assay (Cell Signaling Technology Cat #6813) were performed using the manufacturer's standard protocol. EC50 curve analysis was performed using raw fluorescent Alamar blue values that were inputted into PRISM 7.0. Drug concentrations were log 10 transformed and values normalized to percent viability with respect to vehicle treated cells. EC50 values were interpolated from a log inhibitor vs. normalized response with variable slope using a least square fit model.

Small Molecule Inhibitors

ERK5-IN-1 (Cat #5393/10), BIX02189 (Cat #4842/10), XMD 8-92 (Cat #4132), and MG132 (Cat #6033) were purchased from Tocris Bioscience.

Apoptosis Assay

Apoptosis was quantified using the Pacific Blue Annexin V Apoptosis Detection Kit with propidium iodide (BioLegend, San Diego, Calif. Cat #640926). Analysis was performed at the Flow Cytometry Core, Rangos Research Center, UPMC Children's Hospital of Pittsburgh.

RAS Activity Assay

RAS activity was measured using the RAS activation assay (Cell Signaling Technology, Cat #8814). Briefly, active Ras Detection GST-RAF1-RBD fusion protein was used to bind the activated form of GTP-bound RAS, which was then immunoprecipitated from 500 μg of total cell lysate with glutathione resin. RAS activation levels were then determined by western blot using a RAS Mouse mAb. Activated RAS immune-precipitate was normalized to total RAS from whole cell lysate.

RAS siRNA Screen

5000 NSC control, NSC H3K27M, and DIPG-007 cells were plated in black 96 well plates. 12 h post plating, cells were transfected with a custom Endoribonuclease-prepared siRNA library (esiRNA) (Sigma, St. Louis Mo.). 20 ng of esiRNA were used per target with X-tremeGENE HP DNA Transfection Reagent (Sigma, St. Louis Mo.). Cell viability was assessed 96 h later by the Alamar blue cell viability assay (Invitrogen, Cat #DAL1025). Data were normalized using the standard z-score using the percent viability difference of NSC control vs NSC H3K27M for each siRNA target and control siRNA DIPG-007 vs DIPG-007 siRNA target gene. For significance, z-score cut off values were +/−2 (p-value <0.05) in three biological replicates. Validation of esiRNA screen was performed using two individual Dicer-Substrate siRNA (DsiRNA) per gene-target (Integrated DNA Technologies, Iowa, USA).

Western Blotting and Immuno Precipitation

Cell pellets were lysed in PLC lysis buffer containing protease and phosphatase inhibitors (Roche Inc.). Protein lysates were quantified using the bicinchoninic acid (BCA) assay (Pierce Chemical Co., Rockford, Ill.). 30 μg of total protein lysate was loaded in 10% SDS-PAGE gels and electrophoresed. Proteins were transferred to PVDF membranes using a semi-dry transfer apparatus (Bio-Rad). Membranes were blocked for one hour and probed for various proteins overnight in 5% non-fat milk or 5% BSA in Tris Buffered Saline Solution, 0.5% Tween-20 (TBST) or Phosphate Buffered Saline Solution with 0.5% Tween-20 (PBST). Membranes were washed for 5 mins in TBST (3×) and incubated with horseradish peroxidase-conjugated antibodies specific for the primary antibody (BioRad Laboratories, Inc., CA, USA). Binding was detected using Chemiluminescence Reagent Plus (PerkinElmer Inc., MA, USA). Antibodies were used at the following dilutions:

H3K27M (1:1000, Abcam cat #190631), H3K27Me3 (1:1000, Cell Signaling cat #9733), H3K27Ac (1:1000, Cell Signaling cat #4353), B-actin (1:10000, Cell Signaling cat #3700), p-ERK1/2 (1:1000, Cell Signaling cat #8544), ERK1/2 (1:1000, Cell Signaling cat #4695), RASAL1 (1:1000, ThermoFisher Scientific cat #PAS-22031), RASA3 (1:3000, Invitrogen cat #PAS-30445), HA (1:1000, Cell Signaling cat #3724), RAS (1:1000, Cell Signaling cat #3965), _P-ERK5 (T218/Y220) (1:1000, Cell Signaling cat #3371), p-ERK5 (S731/T733) (ThermoFisher Scientific cat #PAB15919), ERK5 (1:1000, ThermoFisher cat #PAS-17689), MEKK3 (1:1000, Cell Signaling cat #5727), p-MEK5 (5311/T315) (1:1000, ThermoFisher Scientific cat #480024), MEK5 (ThermoFisher Scientific cat #PAS-15083), MEKK2 (Cell Signaling cat #19607), GAPDH (Cell Signaling cat #5174), H3.3 (1:500, Biolegend cat #601901), pAKT ser473 (1:2000, Cell Signaling cat #4060), AKT (1:1000, Cell Signaling cat #4691), MYC S62 (1:1000, ThermoFisher cat #PAS-36671), MYC (1:1000, BioLegend cat #626802). Immuno-precipitations and co-immuno-precipitations (co-IP) were performed using 500 μg total lysate using manufacturer specific dilutions. Denaturing IPs were performed as previously described (Smith et al., Journal of cell science 2013; 126:1366-80; Agnihotri et al., J Exp Med 2011; 208:689-702; Amanchy et al., Nature biotechnology 2007; 25:285-6).

In Vitro Kinase Assays

Purified active recombinant ERK5 protein was purchased from ThermoFisher Scientific (Cat #A32872) and purified recombinant MYC was purchased from Abcam (Cat #ab84132). Purified ERK5 and MYC were resuspended in 40 μl of 1× kinase buffer supplemented with 200 μM ATP, 0.25 μg substrate, and 1.0 μg purified recombinant and active kinase. Samples were incubated in the presence or absence of ERK5 inhibitors for 30 minutes at 30° C. The reaction was terminated with 20 μl 3×SDS sample buffer. Samples were then boiled at 100° C. for 5 minutes and then evaluated by western blotting using a phospho MYC ser62 antibody (1:1000). 1× Kinase Buffer recipe: 25 mM Tris (pH 7.5), 5 mM β-glycerophosphate, 2 mM DTT, 0.1 mM Na₃VO₄, 10 mM MgCl₂.

Cancer Signaling Antibody Array

The Cancer Signaling Antibody Array was purchased from Full Moon Biosystems and is an ELISA based Antibody Array platform including of 269 antibodies targeting proteins involved in cancer signaling (Table 3).

TABLE 3 Ratio Analysis for Paired Antibodies Signal Ratio Fold 4000022475 4000022476 Change Antibody List (Con) (KD) KD/Con cdc25A (Phospho-Ser75) cdc25A (Ab-75) 1.376757469 0.596004827 0.43 Myc (Phospho-Ser62) Myc (Ab-62) 1.803310929 0.831335536 0.46 MEK1 (Phospho-Ser217) MEK1 (Ab-217) 2.350363289 1.112725451 0.47 p44/42 MAP Kinase (Phospho- p44/42 MAP Kinase (Ab- 1.318134439 0.634102259 0.48 Thr202) 202) ERK8 (Phospho-Thr175/Tyr177) ERK8 (Ab-175/177) 1.18010269 0.615210176 0.52 elF4E (Phospho-Ser209) elF4E (Ab-209) 1.355683152 0.716018174 0.53 MEK1 (Phospho-Ser221) MEK1 (Ab-221) 1.920467644 1.016486405 0.53 MEK1 (Phospho-Thr291) MEK1 (Ab-291) 1.507179012 0.806152272 0.53 PDGF Receptor beta (Phospho- PDGF Receptor beta (Ab- 0.753164942 0.416551697 0.55 Tyr751) 751) HSP27 (Phospho-Ser78) HSP27 (Ab-78) 1.82431827 1.026803182 0.56 p44/42 MAP Kinase (Phospho- p44/42 MAP Kinase (Ab- 1.682729805 0.960610964 0.57 Tyr204) 204) HSF1 (Phospho-Ser303) HSF1 (Ab-303) 1.449795263 0.838215851 0.58 Src (Phospho-Tyr529) Src (Ab-529) 1.881542074 1.199719368 0.64 MSK1 (Phospho-Ser376) MSK1 (Ab-376) 1.804486272 1.246143228 0.69 Caspase 9 (Phospho-Ser196) Caspase 9 (Ab-196) 0.689699508 0.496113572 0.72 Trk B (Phospho-Tyr515) Trk B (Ab-515) 0.838735746 0.607967043 0.72 BRCA1 (Phospho-Ser1423) BRCA1 (Ab-1423) 0.262969712 0.193269039 0.73 eEF2K (Phospho-Ser366) eEF2K (Ab-366) 0.739526602 0.547743348 0.74 Caspase 9 (Phospho-Thr125) Caspase 9 (Ab-125) 0.785479804 0.587419736 0.75 Histone H2A.X (Phospho- Histone H2A.X (Ab-139) 1.318689415 0.998934064 0.76 Ser139) PI3-kinase p85-subunit PI3-kinase p85-subunit 1.446615825 1.101611825 0.76 alpha/gamma (Phospho- alpha/gamma (Ab- Tyr467/Tyr199) 467/199) FGF Receptor 1 (Phospho- FGF Receptor 1 (Ab-154) 0.998088891 0.760098522 0.76 Tyr154) c-Kit (Phospho-Tyr721) c-Kit (Ab-721) 0.806198509 0.624713886 0.77 IKK alpha (Phospho-Thr23) IKK alpha (Ab-23) 0.933442525 0.723912684 0.78 ERK3 (Phospho-Ser189) ERK3 (Ab-189) 1.400147384 1.092449083 0.78 HSP27 (Phospho-Ser15) HSP27 (Ab-15) 1.985330878 1.574279672 0.79 PI3-kinase p85-alpha (Phospho- PI3-kinase p85-alpha (Ab- 1.208067341 0.971288943 0.80 Tyr607) 607) SAPK/JNK (Phospho-Thr183) SAPK/JNK (Ab-183) 1.100005046 0.897738616 0.82 Chk1 (Phospho-Ser345) Chk1 (Ab-345) 0.960990033 0.78487433 0.82 Caspase 9 (Phospho-Tyr153) Caspase 9 (Ab-153) 0.460222918 0.377724911 0.82 FAK (Phospho-Tyr397) FAK (Ab-397) 1.271555556 1.047234336 0.82 mTOR (Phospho-Ser2448) mTOR (Ab-2448) 1.574956438 1.321486633 0.84 HSP90B (Phospho-Ser254) HSP90B (Ab-254) 0.966808799 0.812033111 0.84 Rac1/cdc42 (Phospho-Ser71) Rac1/cdc42 (Ab-71) 1.674215913 1.407425461 0.84 NFkB-p65 (Phospho-Ser529) NFkB-p65 (Ab-529) 1.320496385 1.113783426 0.84 4E-BP1 (Phospho-Thr36) 4E-BP1 (Ab-36) 1.412538281 1.192029955 0.84 CrkII (Phospho-Tyr221) CrkII (Ab-221) 0.578369689 0.488760149 0.85 Met (Phospho-Tyr1349) Met (Ab-1349) 0.903855563 0.764628512 0.85 IkB-alpha (Phospho-Ser32/Ser36) IkB-alpha (Ab-32/36) 2.971654921 2.514295117 0.85 EGFR (Phospho-Tyr1110) EGFR (Ab-1110) 1.103170163 0.952400111 0.86 IkB-epsilon (Phospho-Ser22) IkB-epsilon (Ab-22) 0.548142031 0.481385115 0.88 Pyk2 (Phospho-Tyr402) Pyk2 (Ab-402) 1.445392604 1.276802764 0.88 p70 S6 Kinase (Phospho- p70 S6 Kinase (Ab-424) 1.662963754 1.472030546 0.89 Ser424) p53 (Phospho-Ser315) p53 (Ab-315) 1.379283315 1.222080504 0.89 p53 (Phospho-Ser6) p53 (Ab-6) 1.288802083 1.143859498 0.89 MDM2 (Phospho-Ser166) MDM2 (Ab-166) 0.156484647 0.139536548 0.89 GSK3 alpha (Phospho-Ser21) GSK3 alpha (Ab-21) 1.078328643 0.961613217 0.89 14-3-3 zeta (Phospho-Ser58) 14-3-3 zeta (Ab-58) 1.529842073 1.367067513 0.89 Caspase 9 (Phospho-Ser144) Caspase 9 (Ab-144) 0.903882144 0.822593395 0.91 Rel (Phospho-Ser503) Rel (Ab-503) 1.260667287 1.151651086 0.91 eIF2a (Phospho-Ser51) eIF2a (Ab-51) 1.068809695 0.979140436 0.92 Caspase 3 (Phospho-Ser150) Caspase 3 (Ab-150) 1.027794016 0.943169254 0.92 Tau (Phospho-Ser404) Tau (Ab-404) 1.563963964 1.455132053 0.93 Elk-1 (Phospho-Ser383) Elk-1 (Ab-383) 1.282727961 1.202650469 0.94 JAK1 (Phospho-Tyr1022) JAK1 (Ab-1022) 0.975779967 0.920816075 0.94 IkB-alpha (Phospho-Tyr42) IkB-alpha (Ab-42) 1.744873596 1.687409025 0.97 c-Jun (Phospho-Thr239) c-Jun (Ab-239) 1.012094006 0.982871355 0.97 BAD (Phospho-Ser155) BAD (Ab-155) 1.196148024 1.16475916 0.97 CDC2 (Phospho-Tyr15) CDC2 (Ab-15) 0.874823125 0.856182134 0.98 CaMKII (Phospho-Thr286) CaMKII (Ab-286) 1.112145558 1.093010896 0.98 FAK (Phospho-Tyr925) FAK (Ab-925) 1.087976395 1.069581097 0.98 p27Kip1 (Phospho-Thr187) p27Kip1 (Ab-187) 1.279626026 1.263319266 0.99 MKK3 (Phospho-Ser189) MKK3 (Ab-189) 0.938914994 0.927140442 0.99 IGF-1R (Phospho-Tyr1161) IGF-1R (Ab-1161) 1.373625731 1.366458719 0.99 Integrin beta-3 (Phospho- Integrin beta-3 (Ab-773) 0.982494339 0.979691639 1.00 Tyr773) Keratin 18 (Phospho-Ser33) Keratin 18 (Ab-33) 1.544149178 1.541974046 1.00 GSK3 beta (Phospho-Ser9) GSK3 beta (Ab-9) 1.229211415 1.231616635 1.00 FAK (Phospho-Tyr861) FAK (Ab-861) 1.246727301 1.265083413 1.01 HDAC8 (Phospho-Ser39) HDAC8 (Ab-39) 1.276072195 1.29572945 1.02 c-Jun (Phospho-Ser243) c-Jun (Ab-243) 0.801891185 0.817173221 1.02 Integrin beta-3 (Phospho- Integrin beta-3 (Ab-785) 0.995267072 1.015035732 1.02 Tyr785) BAD (Phospho-Ser112) BAD (Ab-112) 1.124370087 1.15468039 1.03 Chk1 (Phospho-Ser317) Chk1 (Ab-317) 1.042771278 1.073853458 1.03 BAD (Phospho-Ser136) BAD (Ab-136) 1.652586265 1.721881712 1.04 NFkB-p105/p50 (Phospho- NFkB-p105/p50 (Ab-907) 1.124008228 1.175752184 1.05 Ser907) Chk2 (Phospho-Ser516) Chk2 (Ab-516) 0.882912318 0.924708425 1.05 p21Cip1 (Phospho-Thr145) p21Cip1 (Ab-145) 1.128235231 1.184705353 1.05 p27Kip1 (Phospho-Ser10) p27Kip1 (Ab-10) 1.576096491 1.657796258 1.05 Shc (Phospho-Tyr349) Shc (Ab-349) 0.90905601 0.956398979 1.05 P38 MAPK (Phospho-Tyr182) P38 MAPK (Ab-182) 0.272999551 0.289213363 1.06 MEK2 (Phospho-Thr394) MEK2 (Ab-394) 1.207165039 1.280730526 1.06 STAT1 (Phospho-Ser727) STAT1 (Ab-727) 1.527911018 1.621537642 1.06 Rb (Phospho-Ser780) Rb (Ab-780) 0.749743035 0.796436258 1.06 Akt2 (Phospho-Ser474) Akt2 (Ab-474) 1.327540754 1.419641264 1.07 NFkB-p100/p52 (Phospho- NFkB-p100/p52 (Ab-865) 0.583876789 0.627895188 1.08 Ser865) SHP-2 (Phospho-Tyr580) SHP-2 (Ab-580) 1.42393987 1.53969381 1.08 AMPK1 (Phospho-Thr174) AMPK1 (Ab-174) 1.557669903 1.694690482 1.09 CDK2 (Phospho-Thr160) CDK2 (Ab-160) 1.138415003 1.243811816 1.09 Raf1 (Phospho-Ser259) Raf1 (Ab-259) 0.77915804 0.853179475 1.10 Chk2 (Phospho-Thr68) Chk2 (Ab-68) 0.859213553 0.943780333 1.10 FKHR (Phospho-Ser256) FKHR (Ab-256) 0.818106015 0.908482618 1.11 TYK2 (Phospho-Tyr1054) TYK2 (Ab-1054) 1.208315044 1.342495518 1.11 Chk1 (Phospho-Ser280) Chk1 (Ab-280) 1.405465572 1.566394915 1.11 c-Jun (Phospho-Ser73) c-Jun (Ab-73) 0.208381165 0.233043575 1.12 Beta-Catenin (Phospho- Beta-Catenin (Ab-41/45) 1.561393152 1.758002937 1.13 Thr41/Ser45) BCL-2 (Phospho-Ser70) BCL-2 (Ab-70) 1.093494351 1.23242779 1.13 PDK1 (Phospho-Ser241) PDK1 (Ab-241) 0.77286827 0.886700202 1.15 NFkB-p100/p52 (Phospho- NFkB-p100/p52 (Ab-869) 0.962211277 1.117210682 1.16 Ser869) Beta-Catenin (Phospho-Ser37) Beta-Catenin (Ab-37) 0.772923099 0.902213269 1.17 Caveolin-1 (Phospho-Tyr14) Caveolin-1 (Ab-14) 1.727489605 2.025217672 1.17 VEGFR2 (Phospho-Tyr951) VEGFR2 (Ab-951) 0.165231286 0.19373722 1.17 NFkB-p105/p50 (Phospho- NFkB-p105/p50 (Ab-893) 0.912569966 1.077296462 1.18 Ser893) Estrogen Receptor-alpha Estrogen Receptor-alpha 1.397783319 1.67556349 1.20 (Phospho-Ser167) (Ab-167) Myc (Phospho-Thr58) Myc (Ab-58) 1.038891439 1.248259939 1.20 HER2 (Phospho-Tyr877) HER2 (Ab-877) 1.410503597 1.71645869 1.22 ICAM-1 (Phospho-Tyr512) ICAM-1 (Ab-512) 2.086383987 2.555767095 1.22 Akt (Phospho-Ser473) Akt (Ab-473) 0.787936476 0.968590517 1.23 BCL-XL (Phospho-Ser62) BCL-XL (Ab-62) 0.141542421 0.17480476 1.23 BRCA1 (Phospho-Ser1524) BRCA1 (Ab-1524) 0.603557988 0.748725965 1.24 PTEN (Phospho- PTEN (Ab-380/382/383) 0.644335784 0.801502933 1.24 Ser380/Thr382/Thr383) Akt (Phospho-Thr308) Akt (Ab-308) 0.739653601 0.937721701 1.27 Src (Phospho-Tyr418) Src (Ab-418) 0.228090157 0.290208117 1.27 JunB (Phospho-Ser79) JunB (Ab-79) 1.26164446 1.611336032 1.28 BCL-2 (Phospho-Thr56) BCL-2 (Ab-56) 1.015364419 1.30853697 1.29 CREB (Phospho-Ser133) CREB (Ab-133) 0.750202904 0.999545909 1.33 NFkB-p65 (Phospho-Thr254) NFkB-p65 (Ab-254) 0.863913306 1.156196348 1.34 STAT6 (Phospho-Tyr641) STAT6 (Ab-641) 1.319833119 1.796965517 1.36 cdc25C (Phospho-Ser216) cdc25C (Ab-216) 0.175394901 0.239431313 1.37 JunD (Phospho-Ser255) JunD (Ab-255) 1.27640738 1.772525337 1.39 STAT6 (Phospho-Thr645) STAT6 (Ab-645) 0.391640547 0.561082695 1.43 JAK2 (Phospho-Tyr221) JAK2 (Ab-221) 0.869563011 1.276100781 1.47 JunB (Phospho-Ser259) JunB (Ab-259) 1.211644149 1.841459559 1.52 STAT3 (Phospho-Ser727) STAT3 (Ab-727) 1.010848023 1.573108445 1.56 STAT1 (Phospho-Tyr701) STAT1 (Ab-701) 1.280646735 2.065109643 1.61 STAT5A (Phospho-Ser780) STAT5A (Ab-780) 0.194376876 0.316362771 1.63 STAT5A (Phospho-Tyr694) STAT5A (Ab-694) 1.146375693 1.91655525 1.67 Myc (Phospho-Thr358) Myc (Ab-358) 0.300234217 0.542465691 1.81 STAT3 (Phospho-Tyr705) STAT3 (Ab-705) 0.988335041 1.88976234 1.91 JAK2 (Phospho-Tyr1007) JAK2 (Ab-1007) 0.761005787 1.457101371 1.91 STAT4 (Phospho-Tyr693) STAT4 (Ab-693) 0.933033764 1.897658458 2.03 activating Myc (Phospho-Ser373) Myc (Ab-373) 0.809399042 1.683082156 2.08

The array involves: 1) Protein extraction with non-denaturing lysis buffer; 2) Biotinylation of protein samples; 3) Incubation of labeled samples with antibody array; and 4) Detection by dye conjugated streptavidin. Biological triplicates of ERK5 knockdown or control SU-DIPG IV cells were pooled and assayed on two independent arrays. The array was performed as per the manufacturer's protocol with image quantification and analysis performed by Full Moon Biosystems data service.

Immunohistochemistry

Paraffin embedded blocks were cut in 5 μm sections. Slides were processed as follows: de-waxed in xylene followed by rehydration in a standard alcohol series. Antigen retrieval was by pressure cooking for 20 minutes in citrate buffer (pH 6.0), followed by blocking of endogenous peroxidase in 3% H₂O₂. The antibodies were added and incubated overnight at 4° C. Antibodies were detected using a secondary-HRP labeled mouse or rabbit antibody detection system (Dako EnVision+ System-HRP cat #k4401, cat #k4403) followed by addition 3,3′-Diaminobenzidine (DAB) chromagen (Vector Labs) for visualization. Sections were counter-stained with hematoxylin (Fisher Scientific Inc., Canada) and slides dehydrated in 70, 80, and 100% ethanol and xylene. Slides were cover slipped and mounted in Permount (Fisher Scientific Inc.). Antibodies and concentrations for IHC are as follows: Ki67 (1:100, Dako, cat #F7268). All images were captured on a Leica DM 100 microscope using Leica Application Suite Software (Switzerland, Version 3.8.0).

Gene-Expression and Copy Number Analysis

Copy number analysis of ERK5, PDGFRA, and NF1 was performed using the Mackay et al. dataset (Mackay et al., Cancer cell 2017; 32:520-37 e5) using the pediatric cBioPortal website (https://pedcbioportal.org/). Using the R2 software (http://r2.amc.nl), the present disclosure analyzed gene expression levels in normal brain and two independent, non-overlapping patient cohorts (Paugh et al., Journal of clinical oncology: official journal of the American Society of Clinical Oncology 2010; 28:3061-8; Berchtold et al., Proceedings of the National Academy of Sciences of the United States of America 2008; 105:15605-10).

RASAL1 Promoter Methylation Assay.

Methylated DNA immunoprecipitation was performed as previously described (Paugh et al., Journal of clinical oncology: official journal of the American Society of Clinical Oncology 2010; 28:3061-8; Berchtold et al., Proceedings of the National Academy of Sciences of the United States of America 2008; 105:15605-10). Briefly, methylated DNA was captured using the Methylamp MethylatedDNA capture Kit (Epigentek). Methylation specific PCR and electrophoresis of PCR products were performed.

Real Time Quantitative Polymerase Chain Reaction

Total RNA isolation was performed using an RNA extraction kit according to the manufacturer's instructions (RNeasy kit, Qiagen). cDNA was synthesized from 100 ng of total RNA using the Quantitect RT kit which included DNAse treatment (Qiagen). Quantitative real-time PCR was performed on 10 ng of cDNA template in a final volume of 20 μl using the Chromo4 Real Time PCR detector (MJ Research, a Division of Bio-Rad Laboratories Ltd) using SYBR green fluorescence. RT-PCR data was analyzed using Opticon Monitor 3.1.3 analysis software. Data analysis was done using the delta CT method with HPRT1 as a reference/control gene. Specific Primers are available in Table 4.

TABLE 4 Primer Sequence Ampli- FWD REV con GENE FWD Primer 5′ → 3′ REV Primer 5′ → 3′ start end Size (bp) RASA1 GGGACATCCAATAAACGCCT TTTGCTACTTGGACACTATT 1949 2079 130 TCG CAGG RASA2 CTCACCTACCACAAACAGCC CCTGGACATAGAGTGGTTT 1949 2099 150 AG CTCC RASA3 TTCCACGCCATCACTGAGTC GGCGCAAAGAACCTCAGG 1912 2066 154 TG AAGA RASA4 GCTGAAGGACTTCATCACCA TTGCCCTTGGTCCTGTGGAT 1683 1811 128 AGC GA RASAL1 CTCCAGCAGAAGCCACCTAA TCCATGAGAGGCTGGTAGC 965 1116 151 AG ACT RASAL2 CCAAATGTCAGTGGAAGCCT CTGTGTTGTCCTGGCTTGG 2031 2133 102 CTC AGA RASAL3 CCTCACACTGATTGCCAAGG TACCTGGTCCAGGAAGCAT 148 302 154 TC TGC NF1 GCCTTGAGGAAAACCAGCGG TCCTACTGCACCGATGCTG 4375 4538 163 AA TTC DAB2IP TCATCGCCAAGGTCACCCAG CGCTGCATGTTGGTCCACT 1661 1772 111 AA CAT SYNGAP CAACCTGCGAATGTGCTGTG CGCTGATAAGCCTGTCTGC 1818 1966 148 AG GAT HRAS ATGACGGAATATAAGCTGGT GGCACGTCTCCCCATCAAT 206 359 153 GGT G KRAS CAGTAGACACAAAACAGGCT TGTCGGATCTCCCTCACCA 563 686 123 CAG ATG NRAS GAAACCTCAGCCAAGACCAG GGCAATCCCATACAACCCT 681 808 127 AC GAG AURKA GGAGAGCTTAAAATTGCAGA GCTCCAGAGATCCACCTTC 1312 1452 140 TTTTG TCAT LAMTOR GTGGTGAGTTTCATAGCCAG AGAAACTTCCACAACTTGT 493 600 107 3 CAG CTCAG LIN28A CCAGTGGATGTCTTTGTGCA GTGACACGGATGGATTCCA 338 453 115 CC GAC LIN28B CCTGTTTAGGAAGTGAAAGA CACTTCTTTGGCTGAGGAG 520 655 135 AGAC GTAG MAP2K3 CTACATGGCCCCTGAGAGGA TCCAGACGTCGGACTTGAC 1077 1147 70 T A MAP2K5 CCTTCCAGTTGGAGAGTTCT CGGCATTTCCATCATTGAA 1215 1351 136 CG CTGC MAP3K2 TACACCCGTCAGATTCTGGA ATGGTCTGAAGCCGTTTGC 1534 1679 145 GG TGG MAP3K7 CAGAGCAACTCTGCCACCAG CATTTGTGGCAGGAACTTG 1343 1445 102 TA CTCC MAPK7 GCTGATGGGCCACAGGAT TGGAGGTCAGGCAGGTCAG 2453 2616 163 MYC CGTCTCCACACATCAGCACA CACTGTCCAACTTGACCCT 2105 2190 85 A CT PDGFRA GGCATTCTTTGCAATACTGC CATCTGCCGATAGCACAGT 5303 5391 88 TTAA GA ZAK GCAGTCCAACTTGCCATTCA CCTCAGAGTATCTAACCAC 1832 1934 102 GAC TGGC

Animal Xenograft Studies

All animal procedures were carried out ethically according to animal user protocols approved by Institutional Animal Care Committee (IACUC). 4-6 week-old non-obese diabetic severe combined immune deficiency male or female mice (NOD-SCID-Prkdc^scid) were injected with 1×10⁵SU-DIPG-13p cells or 1×10⁵SF8628 DIPG cells. Cells were re-suspended in 2 μl of PBS and injected into the pons/midbrain using a stereotactic frame (Stoelting) and automated cell injector (Stoelting) with cells delivered over 4 minutes. Coordinates were as follows from the Lambda suture (x=0.8 mm, y=−0.8 mm, z=−5.0 mm). Ten days post injection mice were randomized into two groups: vehicle, and ERK5-IN-1 (50 mg/kg). Mice were treated for two cycles (5 days on, with two days off per cycle). Mice were sacrificed at sign of neurological duress and brains were extracted and fixed in 4% PFA.

Statistical Analysis

Statistical analysis was performed in GraphPad Prism 7.0 (La Jolla, Calif.). All in vitro experiments were performed in biological triplicates unless otherwise stated. Values reported are the mean and standard error of the mean. Analysis of variance (ANOVA) was conducted for multi-group comparisons followed by a post-hoc Tukey's test or post-hoc Dunnett's test to identify differences within groups. Z-score analysis was performed to identify significant genes from the siRNA screen and from the cancer phospho proteomic array. Survival analysis was performed using the Log-Rank Survival test. For direct pairwise comparisons where appropriate, an unpaired two-tailed Student's t-test was used. Significance was established as *p<0.05, **p<0.01, ***p<0.001.

Results H3K27M Activates RAS in Neural Stem Cells

H9 derived neural stem cells (NSC) were stably transfected with lentivirus expressing the mutant H3F3A K27M (H3K27M) and a selectable puromycin marker. Introduction of H3K27M promoted increased proliferation from 96 h onwards, as compared to NSC expressing wildtype H3F3A or empty vector controls (FIG. 1A). H3K27M mutant protein expression was confirmed by immunoblotting (FIG. 1B). Expression of H3K27M in NSCs leads to the reduction of H3 trimethylated Lysine 27 (H3K27Me3, FIG. 1B).

Given the relevance of activated RAS in cell growth, the present disclosure hypothesised that H3K27M may promote proliferation through activation of RAS. A pan-RAS activity pulls down assay confirmed that H3K27M mutant NSC lines harbored activated RAS as well as activated downstream signaling mediator phospho ERK1/2 (FIG. 1C). Increased active RAS was confirmed by densitometry (FIG. 1D). Stable expression of H3 WT did not increase activated RAS (FIGS. 1C-1D).

The present disclosure next performed siRNA knockdown of three major RAS isoforms (NRAS, KRAS, and HRAS) in NSCs expressing empty vector control, H3 WT, or H3K27M. Compared to scrambled control siRNA, loss of HRAS, KRAS, and NRAS had modest effects on cell proliferation in NSCs expressing empty vector control or wildtype H3 but had a significant effect on proliferation in H3K27M NSCs (FIGS. 1E-1G; FIGS. 8A-8C). Compared to control or H3 WT, H3K27M expressing NSCs treated with RAS siRNA had the greatest degree of apoptosis as evaluated by activated cleaved Caspase 3/7 (FIG. 8D). Reduced RAS expression was confirmed by quantitative reverse transcriptase real-time PCR (qRT-PCR, FIGS. 1E-1G). The present disclosure compared the H3K27M NSCs to patient derived H3K27M expressing DIPG cell lines: SU-DIPG-IV (DIPG-IV), HSJD-DIPG-007 (DIPG-007), and HSJD-DIPG-13p (DIPG-13p). Compared to NSC H3K27M, DIPG lines harbored significantly more active RAS (FIGS. 1H-1I, ***p<0.001).

DIPG cells harbor amplification of PDGFRA and loss of NF1, both of which result in RAS activation. The present disclosure hypothesized that H3K27M expression would be additive with known drivers of RAS signaling. Interestingly, overexpression of PDGFRA in NSCs increased activated RAS comparably to that of H3K27M, and combined PDGFRA+H3K27M expression was additive with respect to effect on activated RAS levels (FIGS. 1J-1M, *p<0.05). Active RAS pull downs in DIPG lines harbouring H3K27M mutations have comparable active RAS to hemispheric high-grade gliomas (FIGS. 1N-1O). Interestingly, CNMC-XD-760, an H3 wildtype DIPG cell line, had the least active RAS (FIGS. 1N-1O).

The Polycomb repressive complex 2 (PRC2) has histone methyltransferase activity and trimethylates H3K27 via EZH2 subunit activity. H3K27M inhibits EZH2 function with respect to H3K27 trimethylation (H3K27Me3). The present disclosure investigated whether pharmacologic inhibition of EZH2 would have similar effects on H3K27 methylation as ectopic H3K27M expression. EZH2 inhibition by GSK343 (504) resulted in loss of H3K27Me3 and reduced cell proliferation (FIGS. 9A-9B). In addition, EZH2 inhibition but not H3K27M resulted in activation of the CDKN2A locus as indicated by p16 protein immunoblot results (FIGS. 9A-9B). Also, EZH2 inhibition did not result in RAS activation as observed with H3K27M, but rather in reduced activated RAS (FIG. 9A).

Deregulation of RTKs in H3K27M Neural Stem Cells and DIPGs

RAS has weak intrinsic guanosine triphosphatase (GTPase) activity and the conversion of active RAS to its inactive state is highly dependent on RAS GTPase-activating proteins. At least ten different RAS-GAPs have been identified with only NF1 being reported as mutated or inactive in DIPG. The present disclosure hypothesized that H3K27M expressing NSC and DIPG cells may suppress the expression and/or activity of additional RAS-GAP genes. The present disclosure performed qRT-PCR for ten RAS-GAP proteins comparing NSC empty vector cells to H3K27M expressing NSCs and identified five RAS-GAPs (RASA3, RASAL1, RASA3, DAB2IP, and NF1) as significantly down-regulated in H3K27M NSCs compared to control cells (FIG. 2A, *p<0.05). Two of these, DAB2IP and RASAL1, were indicated as significantly down-regulated in independent DIPG datasets, as compared to normal brain (FIGS. 9C-9D, *p<0.05). In a limited patient cohort, the present disclosure confirmed loss of RASAL1 protein in DIPG tissue from three patients compared to three samples of normal pediatric pons tissue (FIG. 9E). Immunoblotting confirmed down-regulation of RASAL1 in NSC H3K27M cells and DIPG primary cell lines, as compared to NSC and normal human astrocytes (NHA) (FIG. 2B, *p<0.05). RASA3, although down-regulated at the transcript level, was not altered at the protein level (FIG. 2B, *p<0.05). Ectopic expression of hemagglutinin (HA) tagged RASAL1 reduced activated RAS in H3K27M NSC and DIPG-007 cells and reduced cell proliferation (FIGS. 2C-2D, *p<0.05). Ectopic expression of RASAL1 in cells was comparable to protein levels observed in NHAs and NSCs (FIG. 9F).

The present disclosure hypothesized that H3K27M results in loss of RASAL1 by promoter methylation, given this mutation results in epigenetic reorganization by loss of H3K27Me3 and altered DNA methylation (Fangusaro et al., Journal of child neurology 2009; 24:1409-17). Moreover, RASAL1 promoter methylation has been observed in cardiac fibrosis, gastric cancer, and liver cancer (Berchtold et al., Proceedings of the National Academy of Sciences of the United States of America 2008; 105:15605-10; Khuong-Quang et al., Acta neuropathologica 2012; 124:439-47; Hashizume et al., Nature medicine 2014; 20:1394-6). The present disclosure observed significantly increased RASAL1 promoter methylation in DIPG-007, DIPG-13p, and H3K27M-expressing NSC cells compared to NSC control cells as evaluated by methylation specific PCR analysis (MSP) (FIG. 9G, *p<0.05). Strikingly, treatment of DIPG-007 and NSC H3K27M cells with decitabine for 5 days restored expression of RASAL1 protein (FIG. 9H).

H3K27M mutations may de-regulate receptor tyrosine kinases (RTKs) involved in gliomagenesis as a potential source of RAS activation. qRT-PCR confirmed up-regulation of RTK growth factors EGF, PDGFA but not PDGFB (FIG. 2J, *p<0.05). An increased RNA expression of major glioma RTKs PDGFRA and EGFR was also observed (FIG. 2K, *p<0.05). It was confirmed that H3K27M NSCs but not control or H3 wildtype expressing NSC had increased total and activated PDGFRA (FIG. 2L).

siRNA Screening Identifies Novel Effectors of RAS Signaling Important to DIPG Cells

The RAS pathway is critical for tumor cell conversion of external signals from mitogens into signal transduction events that promote cell growth and proliferation (FIG. 2E). Given the importance of H3K27M in activating RAS signaling and promoting cell proliferation, the present disclosure set out to identify effectors of RAS signaling that are critical for its proliferative effect. To accomplish this, the present disclosure performed a targeted siRNA screen focused on 294 genes known to directly activate, inactivate, or cooperate with RAS pathway signaling (FIG. 2E, and FIG. 22).

The viability of NSC control, NSC H3K27M, and DIPG-007 cells was assessed at 96 h post siRNA transfection. The present disclosure next performed Z-score analysis of three individual experiments to identify gene suppressions that selectively target NSCs-H3K27M cells (FIG. 2F). Twenty-six genes were identified that when silenced led to inhibition of NSC-H3K27M growth (viability change >−40%, Z-score<−2, *p<0.05), and 15 genes were identified for which inhibition accelerated growth (viability change >40%, Z-score >2, *p<0.05) (FIG. 2F, FIG. 22). To complement the NSC data, the present disclosure performed a validation siRNA screen in DIPG-007 cells and identified 27 genes that when silenced led to inhibition of NSC-H3K27M growth (viability change >−50%, Z-score <−2, *p<0.05) and 6 genes where inhibition accelerated growth viability change >30%, Z-score >2, *p<0.05) (FIG. 2G, FIG. 22). Twenty-six genes were identified in both screens (FIG. 211). Interestingly, AKT2, AURKA, AURKB, MYC, and PDGFRA, previously identified as important oncogenes in DIPG, were identified by this approach. The present disclosure next rescreened and validated the top 10 candidates based on greatest viability decline at day 5 treatment, using two independent siRNAs per gene target to reduce the potential of off target effects that can be caused by pooled siRNA, with MYC and PDGFRA used as positive controls in DIPG-007 cells (FIG. 2I and FIGS. 10A-10F). siRNA knockdown efficiency was validated by qRT-PCR and reduced cell viability was confirmed for all 10 genes using a second set of siRNAs and in NSC and NSC H3K27M cells (FIGS. 10A-10F).

ERK5 is Active and Expressed in DIPG

Strikingly, three of the validated targets MAP3K2 (MEKK2), MAP2K5 (MEK5), and MAPK7 (ERK5) are interconnected and form the MEKK2-MEK5-ERK5 signaling cascade that signals in parallel with the more commonly studied RAF-MEK1/2-ERK1/2 signaling cascade (FIG. 3A). The present disclosure confirmed that the H3K27M NSCs expressed elevated phospho ERK5 compared to empty vector control NSCs (FIG. 3B). Although low in frequency, the present disclosure observed 4% of DIPG tumors have high-level amplification of the ERK5 gene. Interestingly, ERK5 gene amplification was mutually exclusive with PDGFRA mutation or amplification and also exclusive with NF1 mutation or deletion, as indicated in a dataset of H3.3 K27M mutant PHGGs for which mutation and copy number information are available (FIG. 3C). The present disclosure observed no amplification or mutations in this dataset for ERK1, ERK2, ERK3, ERK4, MEKK1, or activators of ERK5, namely MEK5, MEKK2, and MEKK3. Moreover, the present disclosure found increased total and phospho ERK5 in five DIPG patient samples compared to three normal pediatric pons (FIG. 3D, *p<0.05). Immunoblotting confirmed increased total MEKK2, activated MEK5 (Phospho Ser311, Thr315), total ERK5, and activated ERK5 (Phospho Thr218, Tyr220 and Phospho Ser731 and Thr733) in DIPG cell cultures compared to NSCs and normal human astrocytes (NHAs) (FIG. 3E), or compared to NSCs empty vector and NSC H3 WT over-expressing controls (FIG. 3G). Furthermore, the present disclosure observed robust nuclear ERK5 protein expression in the cytoplasm and nucleus of DIPG-IV and DIPG-007 cells (FIG. 3F). Significant increased ERK5 transcription was observed in DIPG compared to normal brain (FIGS. 11A-11B, *p<0.05). Expanding the analysis into all pediatric high-grade glioma (PHGG) subgroups revealed two additional amplification events of ERK5 in H3WT PHGG and no amplifications of ERK1 or ERK2 (FIG. 3H). Given the importance of ERKs in glioma and cancer, the analysis performed in accordance with the present disclosure was expanded, and it was observed that GBM had one of the highest ERK5 RNA expression levels of all adult cancers from TCGA RNA seq data (FIG. 3I).

Loss of ERK5 Inhibits Growth of DIPG

To assess the long-term effect of ERK5 knockdown, the present disclosure generated doxycycline (Dox) inducible shRNA stable DIPG cell lines (SF8628, DIPG-IV, and DIPG-13p). For all three lines Dox treatment (2 μg/ml) resulted in complete ERK5 knockdown at the protein level (FIG. 4A) and reduced cell proliferation, as measured by Alamar blue viability assay and 5-bromo-2′-deoxyuridine (Brdu) incorporation (FIGS. 4B-4D, *p<0.05). A significant increase in Caspase 3/7 cleavage, which is indicative of apoptosis, was observed on day 5 in ERK5 knockdown cells compared to control cells (FIGS. 11C-11D, *p<0.05). Interestingly, loss of ERK5 resulted in reduction of phosphorylation of ERK1/2 but not phosphorylation of AKT (Ser473 and Thr308), both of which are key signaling mediators of major glioma proliferation and survival pathways, including for DIPG (FIG. 4A). To validate the ERK5 knockdown phenotype in vivo, the present disclosure generated an orthotopic DIPG xenograft by injection of DIPG-13p cells into the midbrain of NOD-SCID mice. Mice were randomized into two groups, a control group and one receiving doxycycline administered through drinking water (2 μg/ml) to induce sustained ERK5 knockdown. Mice receiving doxycycline had significantly longer overall survival compared to the control group (FIG. 4E, *p<0.05). Immunoblotting confirmed absence of ERK5 in the doxycycline group compared to the control group (FIG. 4F).

Unlike ERK1/2, ERK5 contains both a kinase domain and a transactivation domain. To ascertain which domain or domains are responsible for ERK5 function the present disclosure generated lentiviral constructs containing HA-tagged complete or partial ERK5 coding sequence: wildtype, kinase dead (D200A), transactivation domain deleted (delta TAD), and kinase dead with delta TAD (FIG. 4G). The present disclosure also generated another inducible ERK5 shRNA stable cell line in SF8628 cells, in which the shRNA targets the 3′UTR of ERK5 to prevent gene-silencing of transduced ERK5 constructs (FIG. 4H). Re-introduction of ERK5 in knockdown cells was confirmed post infection with HA immunoblotting in SF8628 cells (FIG. 4I). Full length ERK5 was able to rescue the proliferation defect caused by shRNA-mediated suppression, with the kinase dead and delta TAD constructs partially rescuing growth defects as evaluated by Brdu incorporation (FIGS. 4J-4K, *p<0.05). Expression of double dead (kinase dead, delta TAD) ERK5 had no pro-proliferative effect (FIGS. 4J-4K).

Pharmacological Inhibition of ERK5 Inhibits DIPG Tumor Growth and Promotes Apoptosis

The present disclosure tested various ERK5 inhibitors that are specific for their effects on H3K27M cells: ERK5-IN-1 (ERK5 specific inhibitor), BIX02189 (dual MEK5 and ERK5 inhibitor), and XMD8-92 (dual MEK5 and ERK5 inhibitor). The present disclosure generated EC50 curves for DIPG-007 (FIGS. 5A-5C, 5N), DIPG-IV (FIGS. 5D-5F, 5O), SF8628 (FIGS. 12A-12C, 12K), and DIPG-13p cells (FIGS. 12D-12F, 12). EC50 values were lowest for ERK5-IN-1 (EC50s from ˜0.5-1 μM).

Next, the EC50 values of ERK5-IN-1 were evaluated in a DIPG histone wildtype H3 cell line, CNMC-XD-760 and hemispheric glioblastoma. CNMC-XD-760 had the highest EC50 values for ERK5-IN-1 compared to H3 mutant DIPG cells and hemispheric pGBM cells SU-pcGBM2 and HSJD-GBM-001 (FIG. 5R, *p<0.05). NSCs and NSCs over expressing wildtype H3 also had higher ERK5-IN-1 EC50 values compared to H3K27M DIPG and hemispheric pGBM lines, but EC50 values were significantly lower in NSCs expressing H3K27M (FIG. 5P).

Cell counting following 9 days of treatment for DIPG-007, DIPG-IV, and SF8628 cells showed significant decreases in cell number with 500 nM of ERK5-IN-1 as compared to cells treated with vehicle (FIGS. 5G-5I, *p<0.05). Annexin-PI flow cytometry confirmed DIPG-007 and DIPG-IV cells treated with ERK5-IN-1 were undergoing significantly higher rates of apoptosis lines compared to controls (FIGS. 5J-5K, *p<0.05). ERK5-IN-1 was confirmed to inhibit ERK5 auto-phosphorylation and ERK5 activity sites (Ser731 and Thr733) at 100 nM, but did not inhibit ERK5 Thr218/Tyr220, which is regulated by MEK5 (FIGS. 5L-5M). The present disclosure also observed diminished cell growth and induction of apoptosis in DIPG-13p and SF8628 cells treated with ERK5-IN-1 (FIGS. 12G-12I). Loss of ERK5 by siRNA or pharmacological inhibitors in a DIPG histone wildtype H3 cell line, CNMC-XD-760, also had a significant reduction in viability although the effect was not as pronounced in mutant histone DIPG cells (FIGS. 13A, 13E, 13F). Loss of ERK5 in a hemispheric pediatric GBM (SU-pcGBM2 EGFR amplified), displayed similar growth inhibition as the mutant H3K27M cells (FIG. 13G). Expression of wild-type HA-tagged ERK5 and constitutively active ERK5 (ERK5 T733E) promoted resistance to ERK5-IN-1 as indicated by increased EC50 values (FIG. 13B-13C) and reduced cleaved Caspase 3/7 levels, with the greatest resistance occurring in cells expressing the ERK5 T733E constitutively active mutant (FIG. 13D).

MYC is a direct target of ERK5

The present disclosure performed a high-throughput ELISA-based antibody array for quantitative protein phosphorylation profiling using 269 phospho antibodies (94 known cancer proteins in total) to identify ERK5 signaling mediators. The initial screen was performed using DIPG-IV cells with or without ERK5 knockdown. The present disclosure identified 24 differentially phosphorylated peptides associated with 15 proteins in ERK5 knockdown DIPG-IV cells compared to controls (FIGS. 6A-6B). Strikingly, the present disclosure observed significant reduction of phosphorylation at MYC serine residue 62 (S62), a critical phosphorylation site for MYC stability. The present disclosure confirmed down-regulation of total MYC and phospho MYC (S62) in ERK5 knockdown cells compared to control (FIG. 6C). Moreover, ERK5 inhibition by ERK5-IN-1 leads to reduced phospho and total MYC (FIG. 6C) in DIPG-IV and SF8628 cells. MG132, a proteasome inhibitor, restored protein expression of total MYC in DIPG-IV cells, indicating that loss of ERK5 results in proteasomal degradation of MYC (FIG. 6D). The present disclosure observed no transcriptional changes of MYC at the RNA level (FIG. 14A).

Several kinases including CDK1, ERK1, and ERK2 have been reported to stabilize MYC at (S62). The results suggest ERK5 may play a role in MYC S62 phosphorylation. Immunoprecipitations (IPs) of ERK5 from DIPG-007, DIPG-IV, and SF8628 cells co-precipitated MYC, and reverse IPs of MYC co-precipitated ERK5 (FIG. 6E). The present disclosure performed an in vitro kinase assay with purified MYC and ERK5 and observed direct phosphorylation on MYC(S62) in the presence of ERK5 and ATP (FIG. 6F). Phosphorylation of MYC(S62) was inhibited in the presence of ERK5-IN-1 (FIG. 6F). Introduction of non-degradable MYC (S62D) in DIPG cells significantly rescued proliferation defects of ERK5 knockdown (FIGS. 6G-611, *p<0.01). Also, MYC S62D promoted resistance to ERK5-IN-1 (FIGS. 14B-14C, *p<0.05). DIPG-13p cells harbor MYCN amplification and, interestingly, the present disclosure observed that ERK5 loss or inhibition by ERK5-IN-1 resulted in MYCN protein and transcriptional down-regulation (FIGS. 14D-14E, *p<0.05).

ERK5 Inhibitors Increase Survival of Mice Bearing DIPG Xenografts and for Mice Bearing Syngeneic DIPG.

The present disclosure next examined whether ERK5-IN-1 could extend survival in an orthotopic DIPG xenograft model. Mice bearing SF8628 intracranial xenografts were treated with vehicle or ERK5-IN-1 (50 mg/kg) for 2 weeks. Mice receiving ERK5-IN-1 had a median survival of 40 days compared to vehicle treated mice whose median survival was 33 days (FIG. 7A, *p<0.05). Hematoxylin and eosin (H&E) staining confirmed high-grade tumor histology and no gross histology differences between treatment arms, but mice treated with ERK5-IN-1 showed reduced KI-67 staining, a marker of cell proliferation (FIGS. 7B-7E, *p<0.05). Similar results were obtained in a second xenograft model using DIPG-13p cells, with ERK5-IN-1 treated mice showing a median survival of 30 days. Both median survivals were significantly greater than vehicle control mice whose median survival was 22.5 days (FIGS. 7F-7J, *p<0.05). The present disclosure confirmed in vivo inhibition of ERK5 auto-phosphorylation and induction of apoptosis by cleaved PARP on mice sacrificed after 5 days of treatment with ERK5-IN-1 (FIG. 14G). Also, the present disclosure used two established cell lines derived from transgenic mouse models of DIPG. Both lines are p53 null and express PDGFB, differing only in their H3.3 mutation status. Strikingly, H3K27M cells were more sensitive than H3 wildtype cells to ERK5 knockdown (FIGS. 14H-14I).

Discussion

There are currently no sufficiently effective treatment options for DIPG patients (Mohammad et al., Nature medicine 2017; 23:483-92). Certain recent large-scale genomic analyses of DIPG patient samples have redirected the course of treatment development toward targeted therapies. Importantly, genomic analyses revealed that a majority of DIPG cases have the H3K27M mutation (Mackay et al., Cancer cell 2017; 32:520-37 e5; Schwartzentruber et al., Nature 2012; 482:226-31; Khuong-Quang et al., Acta neuropathologica 2012; 124:439-47). The high frequency and predictability of H3K27M mutation in DIPG render it and its consequences attractive therapeutic targets.

H3K27M can result in inhibition of the PRC2 complex, specifically the catalytic subunit of the complex, EZH2. EZH2 inhibition results in global reduction of H3K27 trimethylation and attendant alterations in cell transcriptomes (Lewis et al., Science (New York, N.Y.) 2013; 340:857-61). Several studies have demonstrated therapeutic possibilities associated with targeting histone modifiers and transcriptional regulators in DIPG models. Notably, certain DIPG growth has proven vulnerable to the: (1) inhibition of histone demethylases (Hashizume et al., Nature medicine 2014; 20:1394-6); (2) inhibition of residual EZH2 function (Mohammad et al., Nature medicine 2017; 23:483-92); (3) inhibition of histone deacetylases (HDAC) by panobinostat, a drug that is currently being evaluated in a DIPG clinical trial (NCT02717455) (Grasso et al., Nature medicine 2015; 21:555-9); and (4) disruption of transcription by bromodomain inhibitors and CDK7 inhibitors (Nagaraja et al., Cancer cell 2017; 31:635-52 e6). The efficacy indicated by the results of preclinical success for certain therapies suggests that disrupting epigenetic and transcriptional effects of H3K27M may be an effective strategy for DIPG treatment. Moreover, a study characterizing the transcriptional dependencies of DIPG identified several DIPG-specific transcripts and super enhancers of gene targets of the MAPK pathway (Nagaraja et al., Cancer cell 2017; 31:635-52 e6). Notable were MAP3K2, an upstream activator of ERK5, and MEF2A/MEF2C transcription factors, both direct targets of ERK5 (Hayashi et al., The Journal of clinical investigation 2004; 113:1138-48; Wang et al., Brain research 2009; 1255:32-41).

Since H3K27M causes global epigenetic and transcriptional changes in DIPG cells, the present disclosure hypothesized that it is likely activating the transcription of known oncogenic pathways to sustain tumor growth and survival. To address this hypothesis, the present disclosure investigated the impact of H3K27M mutations on RAS-MAPK/ERK5 signaling. It has been shown by others that RAS-MAPK/ERK activation in DIPG can result from: (1) PDGFRA amplification, (2) the loss of RAS-GAP NF1, and rarely, (3) point mutations in K-RAS and N-RAS (Mackay et al., Cancer cell 2017; 32:520-37 e5; Recurrent et al., Nature medicine 2016; 22:1314-20). However, transcriptional effects that would connect H3K27M with RAS activation have not been previously explored. While the primary oncogenic function of H3K27M can be PRC2 inhibition and loss of H3K27 trimethylation, it was observed that while either H3K27M expression or treatment with an EZH2 inhibitor reduced H3K27 trimethylation, EZH2 inhibition resulted in decreased active RAS (FIG. 9H). The present observation supports that EZH2 inhibition and H3K27M mutation may not be synonymous. EZH2 inhibitors can ablate focal H3K27 trimethylation that persists in H3K27M DIPG (Harutyunyan et al., Nature communications 2019; 10:1262; Mohammad et al., Nature medicine 2017; 23:483-92). Additionally, EZH2 inhibition causes loss of H3K27 dimethylation and trimethylation while H3K27M disproportionately affects trimethylation (Harutyunyan et al., Nature communications 2019; 10:1262). Such differences between H3 mutation and EZH2 inhibition can be important, given their opposing effects on RAS activity, and worthy of further investigation

RAS protein activity is known to be important in multiple cancers, yet despite sustained efforts RAS has remained largely undruggable. Targeting key effectors of RAS signaling may prove more feasible than, and perhaps as effective, as targeting RAS itself. The RAS-MAPK signaling pathway is included of a highly diverse family of proteins with interactions that are extensively networked. To identify potential therapeutic vulnerabilities within this network the present disclosure used a targeted siRNA screen that revealed less-studied signaling arms of the RAS pathway as being important to DIPG growth. Among these, ERK5 was of particular interest as a treatment target because, unlike ERK1/2, it has two distinct functional domains. Interestingly, the present disclosure uncovered an unreported feedback between ERK5 and ERK1/2, whereby loss of ERK5 inhibits activation of ERK1/2. H3K27M is not necessarily the sole driver of RAS activation and active ERK5 is not exclusive to DIPG. Other tumors may also be sensitive to ERK5 inhibition as ERK5 has been shown to have oncogenic activity in other cancers and is known to promote proliferation as well as angiogenesis (Umapathy et al., Science signaling 2014; 7:ra102; Tusa et al., Oncogene 2018; 37:2601-14; Pavan et al., Oncogene 2018; 37:4197-213). Notable H3K27M DIPG and H3 WT pediatric hemispheric GBM cell lines tested had similar active RAS levels, which were higher than that observed in the H3 WT DIPG cell line. The lower relative active RAS supports H3K27M having a function in RAS activation. The H3 WT DIPG cell line was also the least sensitive to ERK5 inhibition, while the H3 WT pediatric GBM and H3K27M DIPG cell lines were similarly responsive. While H3K27M mutation results in sensitivity to ERK5 loss or inhibition, targeting ERK5 in pediatric GBM also warrants consideration.

ERK5 suppression through inducible shRNA or pharmacological inhibition attenuated DIPG growth through destabilization of MYC protein. The presently disclosed working model posits that MYC and activation of ERK1/2, in association with RAS activation, are critical to tumor growth (FIG. 15). ERK5 has been shown to promote phosphorylation of MYC as a compensatory response to ERK1/2 inhibition, and direct targeting of ERK5 inhibits MYC stability and activity of ERK1/2 have been identified (English et al., The Journal of biological chemistry 1998; 273:3854-60; Vaseva et al., Cancer cell 2018; 34:807-22 e7). Moreover, the present disclosure shows that ERK5-mediated MYC regulation can be important in DIPG pathobiology. However, a non-degradable version of MYC was not fully able to rescue anti-tumor effects of ERK5 suppression, thereby suggesting that additional ERK5 targets may contribute to its pro-proliferative activity.

Both RAS and MYC can be undruggable, whereas small molecule inhibitors of ERK5 are available and could be rationally combined with therapies in DIPG, such as radiation. ERK5 inhibition by gene silencing or small molecule inhibition also led to reduction of MYCN RNA and protein in DIPG-13p cells, suggesting that ERK5 has importance in MYCN transcription. This relationship between ERK5 and MYCN has been observed in neuroblastoma (Umapathy et al., Science signaling 2014; 7:ra102).

The presently disclosed ERK5 inhibitor tests included the use of in vivo models that yielded results showing that treatment with inhibitor ERK5-IN-1 increased survival of mice bearing patient-derived xenograft (PDX) tumors. Interestingly, the present disclosure observed reduced KI-67, a marker of proliferation, in tumors collected from mice weeks after treatment of ERK5-IN-1 had ceased. This may reflect a potential treatment escape known as cancer cell dormancy, where tumor cells recovering from minimal residual disease (MRD) have been shown to have a less proliferative state. Moreover, this phenomenon is known to occur when targeting the RAS-MAPK or PI3K-AKT signaling pathways (Townson et al., Cell cycle (Georgetown, Ill.) 2006; 5:1744-50; Yeh et al., Cancer research 2015; 75:5014-22; Gupta et al., Cell 2011; 146:633-44). However, the present disclosure treated mice 5 days each week for two weeks and this potential resistance mechanism may possibly be negated by either treatment regimen optimization or combination therapies. Targeting CDKs in DIPG has been considered as a therapeutic strategy, and the presently disclosed data supports dual CDK and ERK5 inhibition as a strategy that merits consideration.

The presently disclosed phospho-proteomic array revealed activation of the JAK/STAT pathway in response to ERK5 knockdown. Interestingly, STAT3 is a transcriptional regulator of MEK5, the activator of ERK5 (Song et al., Oncogene 2004; 23:8301-9). Activation of the JAK/STAT pathway may be a compensation mechanism to elicit additional ERK5 activation. Elucidating the relative importance of JAK/STAT activation in the context of ERK5 inhibition requires further investigation, as it may have translational relevance.

Although the impact of the H3K27M mutation is well characterized for its ability to activate and alter both transcription and epigenetics, its role in cell signaling has not been well-characterized. Here, the role of H3K27M in cell signaling was investigated and the present disclosure determined that this mutation engages multiple unreported effectors of RAS signaling that are essential for promoting DIPG tumor growth. Certain effectors are therapeutically accessible, and their discovery as key contributors to the tumor biology of DIPG could motivate clinical trials to assess potential patient benefit from their targeted inhibition.

Although the presently disclosed subject matter and its advantages have been described in detail, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the disclosed subject matter. Moreover, the scope of the present application is not intended to be limited to the particular embodiments of the process, machine, manufacture, and composition of matter, methods and processes described in the specification. As one of ordinary skill in the art will readily appreciate from the disclosed subject matter of the presently disclosed subject matter, processes, machines, manufacture, compositions of matter, methods, or steps, presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the presently disclosed subject matter. Accordingly, the appended claims are intended to include within their scope such processes, machines, manufacture, compositions of matter, methods, or steps.

Various patents, patent applications, publications, product descriptions, protocols, and sequence accession numbers are cited throughout this application, the inventions of which are incorporated herein by reference in their entireties for all purposes.

Claims

1. A method for treating a glioma in a pediatric human subject, comprising administering to the subject a therapeutically effective amount of an ERK5 inhibitor, wherein the ERK5 inhibitor is not (16E)-14-methyl-20-oxa-5,7,14,26-tetraazatetracyclo[19.3.1.1(2,6).1(8,12)]-heptacosa-1(25),2(26),3,5,8(27),9,11,16,21,23-decaene (TG02) or a pharmaceutically acceptable salt thereof.

2. The method of claim 1, wherein the glioma is selected from the group consisting of a pediatric high-grade glioma (PHGG), a diffuse intrinsic pontine glioma (DIPG), a H3-mutant glioma, a H3K27M-mutant glioma, a H3K27M-mutant DIPG, and a H3.3-mutant non-DIPG high grade glioma.

3. The method of claim 1, wherein the ERK5 inhibitor is an ERK5 specific inhibitor.

4. The method of claim 3, wherein the ERK5 specific inhibitor is ERK5-IN-1 or a pharmaceutically acceptable salt form thereof.

5. The method of claim 1, wherein the ERK5 inhibitor is a dual ERK5 inhibitor.

6. The method of claim 5, wherein the dual ERK5 inhibitor is BIX02189, XMD8-92, or a pharmaceutically acceptable salt form thereof.

7. The method of claim 1, wherein the ERK5 inhibitor is administered orally.

8. The method of claim 1, wherein the ERK5 inhibitor is administered in an amount between about 20 mg/m2 and about 200 mg/m2 per day.

9. The method of claim 1, wherein the ERK5 inhibitor is administered in an amount of about 35 mg/m2 per day.

10. The method of claim 1, wherein the pediatric human subject has a body surface area of at least about 50 m2.

11. The method of claim 1, wherein (a) the pediatric human subject has a body surface area of at least about 55 m2, and the ERK5 inhibitor is administered in an amount of about 35 mg/m2 per day or about 50 mg/m2 per day, or (b) the pediatric human subject has a body surface area of at least about 50 m2, and the ERK5 inhibitor—is administered in an amount of about 65 mg/m2 per day or about 85 mg/m2 per day.

12. The method of claim 1, wherein the ERK5 inhibitor is administered cyclically.

13. The method of claim 12, wherein the number of cycles is from one to twenty-four cycles.

14. The method of claim 12, wherein the duration of each cycle is 28 days.

15. The method of claim 1, wherein the ERK5 inhibitor is administered intermittently.

16. The method of claim 1, wherein a second anti-cancer treatment is administered to the pediatric human subject.

17. The method of claim 16, wherein the second anti-cancer treatment is selected from the group consisting of a radiotherapeutic agent, a radiotherapy, temozolomide, and an EZH2 inhibitor.

18. The method of claim 1, wherein the glioma is a newly diagnosed glioma, a refractory glioma, a relapsed glioma, or a relapsed and refractory glioma.

19. The method of claim 1, comprising administering to the pediatric human subject a pharmaceutical composition, wherein the pharmaceutical composition comprises the ERK5 inhibitor, and a pharmaceutically acceptable carrier.

20. A kit for treating a glioma in a pediatric human subject, comprising an ERK5 inhibitor, wherein the ERK5 inhibitor is not (16E)-14-methyl-20-oxa-5,7,14,26-tetraazatetracyclo[19.3.1.1(2,6).1(8,12)]-heptacosa-1(25),2(26),3,5,8(27),9,11,16,21,23-decaene (TG02) or a pharmaceutically acceptable salt thereof.