CRISPR OLIGONCLEOTIDES AND GENE EDITING
The present disclosure generally relates to compositions and methods for the genetic modification of cells. In particular, the disclosure relates to CRISPR reagents and the use of such reagents.
This application is a continuation of U.S. patent application Ser. No. 15/842,664 filed Dec. 14, 2017, which is a divisional of U.S. patent application Ser. No. 14/879,872, filed Oct. 9, 2015, now U.S. Pat. No. 9,879,283 issued Jan. 30, 2018, which application claims the benefit of priority to U.S. Provisional Application No. 62/061,961, filed Oct. 9, 2014, U.S. Provisional Application No. 62/101,787, filed Jan. 9, 2015 and U.S. Provisional Application No. 62/218,826 filed Sep. 15, 2015, whose disclosures are incorporated by reference in their entirety.
SEQUENCE LISTINGThe instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Oct. 7, 2015, is named LT00948_SL.txt and is 98,513 bytes in size.
FIELDThe present disclosure generally relates to compositions and methods for the genetic modification of cells. In particular, the disclosure relates to CRISPR reagents and the use of such reagents.
BACKGROUNDA number of genome-editing systems, such as designer zinc fingers, transcription activator-like effectors (TALEs), CRISPRs, and homing meganucleases, have been developed. One issue with these systems is that they require a both the identification of target sites for modification and the designing of a reagents specific for those sites, which is often laborious and time consuming. In one aspect, the invention allows for the efficient design, preparation, and use of genome editing reagents.
SUMMARYThe present disclosure relates, in part, to compositions and methods for editing of nucleic acid molecules. There exists a substantial need for efficient systems and techniques for modifying genomes. This invention addresses this need and provides related advantages.
CRISPR systems do not require the generation of customized proteins to target specific sequences but rather a single Cas enzyme that can be directed to a target nucleotide sequence (a target locus) by a short RNA molecule with sequence complementarity to the target.
The present disclosure is directed, in part, to CRISPR editing system modifications that increase the usefulness of these systems. One problem associated with gene editing systems is the amount of time and labor required to design and produce target locus specific gene editing reagents. The invention provides, in part, compositions and methods for the efficient, cost-effective production of CRISPR components.
In some specific aspects, the invention is directed to three types of sequence specific nucleic acid binding activities. Using the Cas9 proteins as an example, these three systems include those where Cas9 proteins are employed with (1) double-stranded cutting activity (e.g., one Cas9 protein gene editing systems), (2) nickase activity (e.g., two Cas9 protein gene editing systems, referred to as “dual nickase” systems), and (3) no cutting activity but with the retention of nucleic acid binding activity (e.g., “dead” Cas9, referred to as dCas9, useful, for example, for gene repression, gene activation, DNA methylation, etc.).
In some aspects, the invention provides methods for producing nucleic acid molecules, including methods comprising performing polymerase chain reactions (PCR) in reaction mixtures containing (i) a double-stranded nucleic acid segment and (ii) at least one oligonucleotide capable of hybridizing to nucleic acid at one terminus of the double-stranded nucleic acid segment, wherein the nucleic acid molecule is produced by the PCR reaction, and wherein the product nucleic acid molecule contains at or near one terminus a promoter suitable for in vitro transcription. In some instances, nucleic acid molecules produced by PCR reaction encode RNA molecules of lengths from about 20 to about 300 (e.g., from about 20 to about 250, from about 20 to about 200, from about 35 to about 150, from about 70 to about 150, from about 40 to about 200, from about 50 to about 200, from about 60 to about 200, from about 60 to about 125, etc.) nucleotides.
RNA molecules generated by methods of the invention (e.g., ligation) or encoded by nucleic acid molecules produced by methods of the invention may contain a region (e.g., from about 10 to about 50, from about 20 to about 50, from about 30 to about 50, from about 15 to about 40, from about 15 to about 30, etc. nucleotides) of sequence complementarity to a target locus. Such RNA molecules may also form one or more (e.g., two, three, four, five, etc.) hairpin turn under physiological conditions (e.g., 37° C., 10 mM Tris-HCl, pH 7.0, 0.9% sodium chloride). Further, such RNA molecules may be a CRISPR RNA such as a guide RNA molecule.
In additional aspects, the invention includes methods for producing nucleic acid molecules, these methods comprising performing polymerase chain reactions (PCR) in reaction mixtures comprising (i) a double-stranded nucleic acid segment comprising a first terminus and a second terminus, (ii) a first oligonucleotide comprising a first terminus and a second terminus, wherein the second terminus of the first oligonucleotide is capable of hybridizing to the first terminus of the double-stranded nucleic acid segment, and (iii) a second oligonucleotide comprising a first terminus and a second terminus, wherein the second terminus of the second oligonucleotide is capable of hybridizing to the first terminus of the first oligonucleotide, to produce the nucleic acid molecule. In some instances, the product nucleic acid molecule will contains one or more (e.g., one, two, three, etc.) promoter suitable for in vitro transcription at or near one terminus. Also, in some instances, the product nucleic acid molecule will encode one or more CRISPR RNA (e.g., a crRNA molecule, a tracrRNA molecule, a guide RNA molecule, etc.). In some instances, reaction mixtures further comprises a first primer and a second primer, wherein the first primer is capable of hybridizing at or near the first terminus of the second oligonucleotide and the second primer is capable of hybridizing at or near the second terminus of the double-stranded nucleic acid segment.
The invention also includes methods for producing nucleic acid molecules, the methods comprising performing polymerase chain reactions in reaction mixtures containing (i) a first double-stranded nucleic acid segment comprising a first terminus and a second terminus, (ii) a second double-stranded nucleic acid segment comprising a first terminus and a second terminus, and (iii) at least one oligonucleotide comprising a first terminus and a second terminus, wherein the first terminus of the oligonucleotide is capable of hybridizing to nucleic acid at the first terminus of the first double-stranded nucleic acid segment to produce the nucleic acid molecule, and wherein the second terminus of the oligonucleotide is capable of hybridizing to nucleic acid at the second terminus of the second double-stranded nucleic acid segment to produce the nucleic acid molecule. In some instances, the product nucleic acid molecule will contain one or more promoter suitable for in vitro transcription at or near one terminus.
The invention further includes methods for producing nucleic acid molecules, these method comprising performing polymerase chain reactions in reaction mixtures containing (i) a first double-stranded nucleic acid segment comprising a first terminus and a second terminus, (ii) a second double-stranded nucleic acid segment comprising a first terminus and a second terminus, (iii) a first oligonucleotide comprising a first terminus and a second terminus, and (iv) a second oligonucleotide comprising a first terminus and a second terminus, wherein the second terminus of the first oligonucleotide is capable of hybridizing to nucleic acid at the first terminus of the second double-stranded nucleic acid segment, wherein the second terminus of the second oligonucleotide is capable of hybridizing to the first terminus of the first oligonucleotide, wherein the second terminus of the second oligonucleotide is capable of hybridizing to the first terminus of the second double-stranded nucleic acid segment. In some instances, the product nucleic acid molecules contain one or more promoter suitable for in vitro transcription at or near (e.g., within 10 base pairs) one terminus.
The invention also includes methods for producing CRISPR RNA molecules, these methods comprise contacting two or more linear RNA segments with each other under conditions that allow for the 5′ terminus of a first RNA segment to be covalently linked with the 3′ terminus of a second RNA segment to form the CRISPR RNA. In some instances, the CRISPR RNA molecules are separated from reaction mixture components (e.g., by column chromatography, such as by high-performance liquid chromatography).
The invention additionally includes methods for producing a guide RNA molecules, these method comprise: (a) separately producing a crRNA molecule and a tracrRNA molecule and (b) contacting the crRNA molecule and the tracrRNA molecule with each other under conditions that allow for the covalently linking of the 3′ terminus of the crRNA to the 5′ terminus of the tracrRNA to produce the guide RNA molecule. Guide RNA molecules may have a region of sequence complementarity of at least 10 (e.g., from about 10 to about 50, from about 10 to about 40, from about 10 to about 35, from about 10 to about 30, from about 10 to about 25, from about 15 to about 25, from about 17 to about 22, etc.) nucleotides to a target locus. In many instances, the target locus is a naturally occurring chromosomal locus in a eukaryotic cell.
The invention also includes compositions comprising two RNA molecules connected by a triazole group, wherein one of the RNA molecules has a region of sequence complementarity of at least 10 nucleotides to a target locus.
In some aspects, the invention is directed to methods for gene editing at a target locus within a cell, these methods comprise introducing into the cell at least one CRISPR protein and at least one CRISPR RNA, wherein the at least one CRISPR RNA has a region of sequence complementarity of at least 10 base pairs to the target locus. In some instances, a linear DNA segment that has sequence homology at both termini to the target locus is also introduced into the cell. In some instances, one of the at least one CRISPR proteins is a Cas9 protein. This Cas9 protein may have the ability to make a double-stranded cut in DNA or to nick double-stranded DNA. In some instances, two Cas9 proteins are introduced into the cells, where one Cas9 protein has a mutation that renders to HNH domain inactive and the other Cas9 protein has a mutation that renders to RuvC domain rendering that domain inactive. In some instances, two RNA molecules (e.g., CRISPR RNA molecules), each with sequence complementarity to different target sequences, are introduced into the cell. Further, these different target sequences may be located within forty (e.g., from about 2 to about 40, from about 2 to about 25, from about 2 to about 20, from about 2 to about 15, from about 2 to about 10, from about 2 to about 8, from about 4 to about 20, from about 4 to about 15, from about 4 to about 10, from about 6 to about 20, etc.) base pairs of each other. Distances between sequences may be measured in reference to the double-stranded cut or nick site. In such instances, target sequences may overlap.
The invention further includes cells containing one or more CRISPR system components and cells made by methods set out herein. For example, the invention includes cells into which CRISPR complexes have been introduced (e.g., cells that contain (1) plasmids encoding Cas9 and guide RNA, (2) Cas9 mRNA and guide RNA, etc.). The invention further includes cells containing mRNA encoding dCas9 and fusion proteins thereof, as well as cells that have been modified by methods of the invention (e.g., cells that have undergone cleavage and relegation of cellular DNA with and without inserts at the cleavage site) that either contain or no longer contain one or more CRISPR system component.
For a more complete understanding of the principles disclosed herein, and the advantages thereof, reference is now made to the following descriptions taken in conjunction with the accompanying drawings, in which:
Oligonucleotides were designed in a manner to correct an alteration in nucleic acid encoding GFP resulting in the generation of fluorescence upon correction. Thus, homologous recombination corrects the alteration resulting in expression active GFP. “% of GFP+ cells” refers to the percentage of cells that were found to contain functionally active GFP. The same assay was used to score homologous recombination in a number of additional experiments set out herein.
As used herein the term “CRISPR activity” refers to an activity associated with a CRISPR system. Examples of such activities are double-stranded nuclease, nickase, transcriptional activation, transcriptional repression, nucleic acid methylation, nucleic acid demethylation, and recombinase.
As used herein the term “CRISPR system” refers to a collection of CRISPR proteins and nucleic acid that, when combined, result in at least CRISPR associated activity (e.g., the target locus specific, double-stranded cleavage of double-stranded DNA).
As used herein the term “CRISPR complex” refers to the CRISPR proteins and nucleic acid (e.g., RNA) that associate with each other to form an aggregate that has functional activity. An example of a CRISPR complex is a wild-type Cas9 (sometimes referred to as Csn1) protein that is bound to a guide RNA specific for a target locus.
As used herein the term “CRISPR protein” refers to a protein comprising a nucleic acid (e.g., RNA) binding domain nucleic acid and an effector domain (e.g., Cas9, such as Streptococcus pyogenes Cas9). The nucleic acid binding domains interact with a first nucleic acid molecules either having a region capable of hybridizing to a desired target nucleic acid (e.g., a guide RNA) or allows for the association with a second nucleic acid having a region capable of hybridizing to the desired target nucleic acid (e.g., a crRNA). CRISPR proteins can also comprise nuclease domains (i.e., DNase or RNase domains), additional DNA binding domains, helicase domains, protein-protein interaction domains, dimerization domains, as well as other domains.
CRISPR protein also refers to proteins that form a complex that binds the first nucleic acid molecule referred to above. Thus, one CRISPR protein may bind to, for example, a guide RNA and another protein may have endonuclease activity. These are all considered to be CRISPR proteins because they function as part of a complex that performs the same functions as a single protein such as Cas9.
In many instances, CRISPR proteins will contain nuclear localization signals (NLS) that allow them to be transported to the nucleus.
The amino acid sequence of a representative Cas9 protein is set out below in Table 1.
As used herein, the term “transcriptional regulatory sequence” refers to a functional stretch of nucleotides contained on a nucleic acid molecule, in any configuration or geometry, that act to regulate the transcription of (1) one or more structural genes (e.g., two, three, four, five, seven, ten, etc.) into messenger RNA or (2) one or more genes into untranslated RNA. Examples of transcriptional regulatory sequences include, but are not limited to, promoters, enhancers, repressors, and the like.
As used herein, the term “promoter” is an example of a transcriptional regulatory sequence, and is specifically a nucleic acid generally described as the 5′ region of a gene located proximal to the start codon or nucleic acid which encodes untranslated RNA. The transcription of an adjacent nucleic acid segment is initiated at the promoter region. A repressible promoter's rate of transcription decreases in response to a repressing agent. An inducible promoter's rate of transcription increases in response to an inducing agent. A constitutive promoter's rate of transcription is not specifically regulated, though it can vary under the influence of general metabolic conditions.
As used herein, the terms “vector” refers to a nucleic acid molecule (e.g., DNA) that provides a useful biological or biochemical property to an insert. Examples include plasmids, phages, autonomously replicating sequences (ARS), centromeres, and other sequences which are able to replicate or be replicated in vitro or in a host cell, or to convey a desired nucleic acid segment to a desired location within a host cell. A vector can have one or more restriction endonuclease recognition sites (e.g., two, three, four, five, seven, ten, etc.) at which the sequences can be cut in a determinable fashion without loss of an essential biological function of the vector, and into which a nucleic acid fragment can be spliced in order to bring about its replication and cloning. Vectors can further provide primer sites (e.g., for PCR), transcriptional and/or translational initiation and/or regulation sites, recombinational signals, replicons, selectable markers, etc. Clearly, methods of inserting a desired nucleic acid fragment which do not require the use of recombination, transpositions or restriction enzymes (such as, but not limited to, uracil N glycosylase (UDG) cloning of PCR fragments (U.S. Pat. Nos. 5,334,575 and 5,888,795, both of which are entirely incorporated herein by reference), T:A cloning, and the like) can also be applied to clone a fragment into a cloning vector to be used according to the present invention. The cloning vector can further contain one or more selectable markers (e.g., two, three, four, five, seven, ten, etc.) suitable for use in the identification of cells transformed with the cloning vector.
As used herein the term “nucleic acid targeting capability” refers to the ability of a molecule or a complex of molecule to recognize and/or associate with nucleic acid on a sequence specific basis. As an example, Hybridization Region 1 on a crRNA molecule confers nucleic acid targeting capability upon a CRISPR complex.
As used herein the term “target locus” refers to a site within a nucleic acid molecule for CRISPR system interaction (e.g., binding and cleavage). When a single CRISPR complex is designed to cleave double-stranded nucleic acid, then the target locus is the cut site and the surrounding region recognized by the CRISPR complex. When two CRISPR complexes are designed to nick double-stranded nucleic acid in close proximity to create a double-stranded break, then the region surrounding and including the break point is referred to as the target locus.
A “counter selectable” marker (also referred to herein a “negative selectable marker”) or marker gene as used herein refers to any gene or functional variant thereof that allows for selection of wanted vectors, clones, cells or organisms by eliminating unwanted elements. These markers are often toxic or otherwise inhibitory to replication under certain conditions which often involve exposure to a specific substrates or shift in growth conditions. Counter selectable marker genes are often incorporated into genetic modification schemes in order to select for rare recombination or cloning events that require the removal of the marker or to selectively eliminate plasmids or cells from a given population. One example of a negative selectable marker system widely used in bacterial cloning methods is the ccdA/ccdB toxin-antitoxin system.
Overview:
The invention relates, in part, to compositions and methods for the preparation of nucleic acid molecules. In particular, the invention relates to combinations of proteins and nucleic acid molecules designed to interact with other nucleic acid molecules. More specifically, the invention relates to protein nucleic acid complexes, where the nucleic acid component has sequence complementarity to a target nucleic acid molecule. In these systems, sequence complementarity between the complexed nucleic acid and the target nucleic acid molecule is the used to bring the complex into association with the target nucleic acid. Once this occurs, functional activities associated with the complex may be used to modify the target nucleic acid molecule.
The invention is exemplified by CRISPR systems. The term “CRISPR” is a general term that applies to three type of systems, and system sub-types. In general, the term CRISPR refers to the repetitive regions that encode CRISPR system components (e.g., encoded crRNAs). Three types of CRISPR systems (see Table 2) have been identified, each with differing features.
While the invention has numerous aspects and variations associated with it, the Type II CRISPR/Cas9 system has been chosen as a port of reference for explanation herein.
In certain aspects, the invention provides:
-
- 1. Individual oligonucleotides to make crRNA/tracrRNAs and collections of such oligonucleotides, as well as methods for generating and using such oligonucleotides.
- 2. Compositions and methods for introducing CRISPR complex components into cells.
A crRNA is shown in
There appears to be substantial sequence variation in tracrRNA sequence. It has been postulated that tracrRNA function relates more to RNA structure, than RNA sequence.
The Cas9 protein of Streptococcus pyogenes is 1368 amino acids in length (NCBI Reference Sequence: WP_030126706.1) and contains a number of domains for the binding and cutting of nucleic acid molecules. This protein has two domains (RuvC and HNH), each of which has DNA nickase activity. When this protein nicks DNA on both strands, the nicks are in close enough proximity to result in the formation of a double-stranded break.
In some instances, CRISPR proteins will contain one or more of the following amino acid sequences: (1) YSIGLDIGTNSVG (SEQ ID NO: 2), (2) PTIYHLR (SEQ ID NO: 3), (3) RGHFLIE (SEQ ID NO: 4), (4) TKAPLSASM (SEQ ID NO: 5), (5) LRKQRTFDNG (SEQ ID NO: 6), (6) LTFRIPYYVGPLAR (SEQ ID NO: 7), (7) TLTLFEDREMI (SEQ ID NO: 8), (8) AGSPAIKKGILQ (SEQ ID NO: 9), (9) RQLVETRQITKHVA (SEQ ID NO: 10) and/or (10) QTGGFSKESIL (SEQ ID NO: 11).
While not wishing to be bound by theory, in brief, as shown in
A number of features of the CRISPR/Cas9 system, any or all of which may be used in the practice of the invention, have been identified:
-
- 1. crRNA and tracrRNA may be combined to form a guide RNA (gRNA).
- 2. Mutations may be introduced into Cas9 proteins that inactivate either the RuvC or HNH domains resulting in proteins with strand specific nickase activity.
- 3. Mutations may be introduced into Cas9 proteins that inactivate all nucleic acid cleavage activities but allow for these proteins to retain nucleic acid binding activity.
- 4. Sequence alterations, including truncations and multi-nucleotide deletions, can be made to the CRISPR system RNA components.
One limitation on Type II CRISPR systems is the requirement of a protospacer adjacent motif (PAM) for high level activity. Efficient binding and cleavage of DNA by Cas9-RNA requires recognition of a PAM. Typically, PAMs are three nucleotides in length.
In many instances, it will be desirable to make two nicks in close proximity to each other when cleaving nucleic acid using methods of the invention. This is especially so when the target locus is in a cellular genome. The use of CRISPR system components that nick nucleic acid is believed to limit “off-target effects” in that a single nick at a location other than the target locus is unlikely to result in single-stranded cleavage of the nucleic acid.
The two sites exemplified in
In many instances, CRISPR complexes bind with high affinity to the target locus. In many such instances, when double-stranded breaks at the target locus are desired CRISPR complexes will be directed to the target locus in a manner such that they do not strictly interfere with each other. Thus, the invention includes methods in which CRISPR complex binding sites at a target locus are selected such that nicking activity on each strand is not significantly altered by the binding of a CRISPR complex directed to the nicking of the other strand. The invention further includes compositions for performing such methods.
S. pyogenes Cas9 protein has a number of domains (see Table 3), two of which are nuclease domains. The discontinuous RuvC-like domain is encompassed by approximately amino acids 1-62, 718-765 and 925-1102. The HNH nuclease domain is encompassed by approximately amino acids residues 810-872. The recognition lobe, approximately amino acids 60-718, recognizes and binds regions of guide RNAs in a sequence-independent manner. Deletions of some parts of this lobe abolishes CRISPR activity. The PAM-interacting domain, approximately amino acids 1099-1368, recognizes the PAM motif.
The nicking activity may be accomplished in a number of ways. For example, the Cas9 protein has two domains, termed RuvC and HNH, that nick different strands of double-stranded nucleic acid. Cas9 proteins may be altered to inactivate one domain or the other. The result is that two Cas9 proteins are required to nick the target locus in order for a double-stranded break to occur. For example, an aspartate-to-alanine substitution (D10A) in the RuvC catalytic domain of Cas9 from S. pyogenes converts Cas9 from a nuclease that cleaves both strands to a nickase (cleaves a single strand). Other examples of mutations that render Cas9 a nickase include H840A, N854A, and N863A.
CRISPR proteins (e.g., Cas9) with nickase activities may be used in combination with guide sequences (e.g., two guide sequences) which target respectively sense and antisense strands of the DNA target.
Another way to generate double-stranded breaks in nucleic acid using nickase activity is by using CRISPR proteins that lack nuclease activity linked to a heterologous nuclease domain. One example of this is a mutated form of Cas9, referred to as dCas9, linked to FokI domain. FokI domains require dimerization for nuclease activity. Thus, in such instances, CRISPR RNA molecules are used to bring two dCas9-FokI fusion proteins into sufficiently close proximity to generate nuclease activity that results in the formation of a double-stranded cut. Methods of this type are set out in Tsai et al., “Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing,” Nature Biotech., 32:569-576 (2014) and Guilinger et al., “Fusion of catalytically inactive Cas9 to FokI nuclease improves the specificity of genome modification,” Nature Biotech., 32:577-582 (2014).
Transient Activity
One need is for a genome editing system having transient or highly regulatable activity. Transient activity is important for a number of applications. For example, for construction of cells lines involving one or more nuclease activity. Once a cellular nucleic acid, for example, has been effectively exposed to a nuclease and appropriately cut, repair of the nucleic acid (e.g., via non-homologous end-joining) normally takes place. Repair of the cellular nucleic acid is generally required for the cell to remain viable. In many cases, the cell will either integrate nucleic acid into the repaired nucleic acid molecule or nucleic acid will be removed (e.g., from 1 base pair to about 100 base pairs) for the repaired nucleic acid molecule. In either instance, a heritable change occurs within the genome of the cell. Cells with genetic changes can then be screened to identify ones with a desired alteration. Once cells with desired changes are identified, for most applications, it is beneficial to maintain the cells without further nuclease induced genetic change. Thus, it is generally desirable that the nuclease activity used to facilitate the genetic changes not be active within the cells.
Transient activity can be achieved in a number of ways, some of which are represented in
The invention thus includes compositions and methods for transient CRISPR mediate activities (e.g., nuclease activity). Transient activity may be the generated in any number of ways. One feature of CRISPR systems is that all components typically need to come together for activity. These components are (1) one or more CRISPR proteins (e.g., Cas9), (2) Hybridization Region 1 (e.g., crRNA), and (3) nucleic acid that associates with both Hybridization Region 1 and the one or more CRISPR proteins. Thus, if one or more components required for CRISPR mediate activity is removed, then the activity is inhibited.
Using the Cas9 based CRISPR system for purposes of illustration, three components are required for CRISP mediated activity: (1) Cas9 protein, (2) crRNA, and (3) tracrRNA. Thus, transient systems can be generated by the time limited presence of any one of these components. A number of variations are represented in
As noted above, in Cas9 mediated system, Cas9 protein must be present for activity. Further, proteins normally are fairly stable molecules within cells. Cas9 proteins may be modified to enhance intracellular degradation (e.g., proteosome mediated degradation) by, for example, ubiquitination.
Cas9 protein may be either introduced into cells (Row 2, Column A) or produced intracellularly (Rows 1, 3, 4, and 5, Column A). Further, the duration of time that Cas9 protein is taken up or produced intracellularly and the amount that is present intracellularly may be controlled or regulated. As an example, a chromosomally integrated Cas9 protein coding sequence may be operably linked to a regulatable promoter. Further, the amount of mRNA encoding Cas9 protein introduced into cells may be regulated.
With respect to non-coding CRISPR RNA needed to high level CRISPR activity, at least two formats are possible: (1) separate crRNA and tracrRNA molecules and (2) Guide RNA (see Table 4).
The invention thus includes compositions and method for transient production of CRISPR mediated activities within cells. Such methods include, for example, the use of a combination of stable and unstable CRISPR system components. One example is a system where mRNA encoding wild-type Cas9 protein and a guide RNA are introduced into a cell in roughly equal amounts. In this example, the presence of Cas9 mRNA will result in the production of a stable Cas9 protein and the limiting factor on CRISPR mediated activity will typically be the determined by the amount of guide RNA present and guide RNA degradation.
The production and/or intracellular introduction of various components of CRISPR mediated systems in a number of ways. For example, a cell designed for convenient CRISPR system reconstitution could be produced. One example of such a cell would be a mammalian cell line (e.g., CHO, 293, etc.) that contains nucleic acid encoding Cas9 protein and tracrRNA integrated into the genome. CRISPR mediated activities can then be directed to a specific target sequence by the introduction into the cell line (e.g., via transfection) of crRNA. In such an exemplary cell line, Cas9 and/or tracrRNA coding sequences may be constitutively expressed or regulatably expressed (e.g., operably linked to an inducible or a repressible promoter).
The invention thus includes cell lines (e.g., eukaryotic cells lines) that contain one or more component of a CRISPR system, as well as methods for directing one or more CRISPR mediated activity to specific target loci within such cells. In many instances, this will result from the addition to or production of at least one additional component that results in target locus CRISPR mediated activities within the cell.
Hybridization Region 1 (HR1)
HR1 (also referred to as Target Complementary crRNA) is believed to determine the target nucleic acid sequence to which the CRISPR complex associates with. HR1 may vary in length, nucleotide composition (e.g., AT/CG ratio), and level of sequence complementarity with the target sequence (e.g., 100%).
As noted above, the length of HR1 may vary. The length of HR1 is determined by the number of nucleotides of sequence complementarity to target nucleic acid, not including internal mismatches. For example, if the crRNA or guide RNA has a twenty-two nucleotide region where the ten 5′ most terminal nucleotide and the ten 3′ most terminal nucleotides are 100% complementary to the sequence of a target nucleic acid, then the HR1 region is twenty-two nucleotides in length with two internal mis-matches. In such an instance, HR1 would share about 91% sequence complementarity with the sequence of the target nucleic acid.
HR1 used in compositions and methods of the invention may vary from about 12 nucleotides to about 35 nucleotides (e.g., from about 13 nucleotides to about 33 nucleotides, from about 15 nucleotides to about 33 nucleotides, from about 17 nucleotides to about 33 nucleotides, from about 18 nucleotides to about 33 nucleotides, from about 19 nucleotides to about 33 nucleotides, from about 20 nucleotides to about 33 nucleotides, from about 21 nucleotides to about 33 nucleotides, from about 13 nucleotides to about 30 nucleotides, from about 15 nucleotides to about 30 nucleotides, from about 18 nucleotides to about 30 nucleotides, from about 20 nucleotides to about 30 nucleotides, from about 13 nucleotides to about 27 nucleotides, from about 15 nucleotides to about 27 nucleotides, from about 18 nucleotides to about 27 nucleotides, from about 20 nucleotides to about 27 nucleotides, from about 13 nucleotides to about 25 nucleotides, from about 15 nucleotides to about 25 nucleotides, from about 17 nucleotides to about 25 nucleotides, from about 18 nucleotides to about 25 nucleotides, from about 20 nucleotides to about 25 nucleotides, from about 13 nucleotides to about 23 nucleotides, from about 15 nucleotides to about 23 nucleotides, from about 18 nucleotides to about 23 nucleotides, from about 20 nucleotides to about 23 nucleotides, etc.).
HR1 may be designed with sequence complementarity to target nucleic acid with particular ratios AT/CG. AT/CG may be altered to adjust hybridization “affinity” between HR1 and the specific target nucleic acid. A-T pairs hybridize less tightly than C-G pairs. Thus, hybridization strength can be varied by altering the AT/CG ratio of HR1. In some instance, higher binding affinity and in some instances lower binding affinity may be desired.
Further, crRNA and guide RNA molecules may be designed with AT/CG contents for the reduction of off target effects. The human genome, for example, has an average CG content of around 41 to 42%. Thus, nucleic acids containing an HR1 with a CG content of greater or less than 41 to 42% are less likely to share significant sequence complementarity with nucleic acid other than intended the target nucleic acid. Also, fewer off target effects would be expected the further the AT/CG ratio of HR1 and the target nucleic acid are from the average AT/CG ratio of the genome or other nucleic acid molecule being altered.
HR1 used in compositions and methods of the invention thus may have AT/CG ratios in the range of from about 1:5 to about 5:1 (e.g., from about 1:4 to about 5:1, from about 1:3 to about 5:1, from about 1:2 to about 5:1, from about 1:1 to about 5:1, from about 1:5 to about 4:1, from about 1:4 to about 4:1, from about 1:3 to about 4:1, from about 1:2 to about 4:1, from about 1:1 to about 4:1, from about 1:5 to about 3:1, from about 1:4 to about 3:1, from about 1:3 to about 3:1, from about 1:2 to about 3:1, from about 1:1 to about 3:1, from about 1:5 to about 2:1, from about 1:4 to about 2:1, from about 1:3 to about 2:1, from about 1:2 to about 2:1, or from about 1:1 to about 2:1).
Binding affinity between HR1 and the target nucleic acid can be varied by a combination of HR1 length, AT/CG content, and percent sequence complementarity. In most instances, sequence between HR1 and the target nucleic acid will be 100% but this can vary between from about 80% to about 100%, from about 90% to about 100%, from about 95% to about 100%, from about 80% to about 95%, from about 85% to about 95%, or from about 90% to about 95%. HR1 used in compositions and methods of the invention may have sequence complementarity characteristics referred to above.
HR1 may also be designed using bioinformatic data to limit off-target effects. Complete genome sequence data is available for thousands of genomes. When a CRISPR system is engineered to modify the genome of a specific organism, the genome of that organism (assuming the genome sequence is known) may be analyzed the select a region that is unique and/or has no counter-part region with a sequence similar enough for substantial levels of CRISPR complex binding. This may be done through a combination of site selection and preparation of HR1 to binding to the selected site.
Hybridization Region 2 (HR2)
HR2 is a region of sequence complementarity either (1) between the crRNA and the tracrRNA or (2) within the guide RNA. In a guide RNA, this region forms a hairpin (Hairpin Region 1 in
CRISPR Proteins
Depending upon the type of CRISPR system, one or more CRISPR proteins (e.g., Cas9) may be used. These CRISPR proteins are targeted to a first nucleic acid of defined sequence (a target locus) by a second nucleic acid and function either alone or in conjunction with other proteins. Thus, the CRISPR complex is a nucleic acid guided, nucleic acid recognition system.
CRISPR proteins or protein complexes will typically have binding activity for one or more CRISPR oligonucleotides and a nucleic acid modification activity (e.g., recombinase activity, methylase activity, etc.). Further, a nuclear localization signal may be present in CRISPR proteins or protein complexes, especially when (1) generated in or (2) designed or produced for introduction into a eukaryotic cell.
Thus, CRISPR proteins may be fusion proteins comprising, for example, the CRISPR protein or fragment thereof and an effector domain. Suitable effector domains include, for example nucleic acid cleavage domains (e.g., heterologous cleavage domains such as the cleavage domain of the endonuclease FokI), epigenetic modification domains, transcriptional activation domains (e.g., a VP16 domain), and transcriptional repressor domains. Each fusion protein may be guided to a specific chromosomal locus, for example, by a specific guide RNA, wherein the effector domain mediates targeted genome modification or gene regulation.
In some aspects, the fusion proteins can function as dimers thereby increasing the length of the target site and increasing the likelihood of its uniqueness in the genome (thus, reducing off target effects). For example, endogenous CRISPR systems modify genomic locations based on DNA binding word lengths of approximately 13-20 bp (Cong et al., Science, 339:819-823 (2013).
CRISPR proteins may be synthesized and/or purified by any number of means. In many instances, CRISPR proteins will be produced within the cell in which activity is desired. In some instances, CRISPR proteins may be produced extracellular to the cell in which activity is desired and then introducing into the cell. Example of methods for producing such CRISPR proteins is by in vitro translation, extraction of the proteins from cell that express these proteins encoded by an expression vector, and extraction of these proteins from cell that normally express them.
CRISPR Oligonucleotides
CRISPR oligonucleotides may be produced by a number of methods and may be generated to have varying features. In many instances, CRISPR oligonucleotides will be one component or two components. By “one component” is meant that only one oligonucleotide (e.g., guide RNA) is necessary for CRISPR activity. By “two components” is meant that only two different oligonucleotides (e.g., crRNA and tracrRNA) are required for CRISPR activity. CRISPR systems with more than two components may also be designed, produced and used. Thus, the invention contemplates multi-components CRISPR oligonucleotides where functionality involves three, four, five, etc. oligonucleotides.
In some instances, two or more oligonucleotides may be generated separately and then joined to each other to form, for example, one oligonucleotide that functions as part of a CRISPR system. The number of components of a system is determined by interaction with Cas9. As an example, if two oligonucleotides are produced and then joined prior to introduction into a cell, where the joined oligonucleotide requires no additional oligonucleotides to facilitate a CRISPR mediated activity, then this is said to be a one component system.
Of course, the nucleotide sequences and other features of CRISPR oligonucleotides may vary with specific systems and desired functions. Common features of CRISPR oligonucleotides include association with one or more CRISPR complex protein (e.g., Cas9) and nucleic acid “targeting” capability.
The invention thus includes compositions and methods for the production of CRISPR oligonucleotides, as well as collections of oligonucleotides generated, for example, using such compositions and methods.
In some embodiments, compositions and methods of the invention are directed to one of or a combination of molecular biology synthesis (e.g., PCR) and/or chemical synthesis for the generation of CRISPR oligonucleotides. Using the schematic representation shown in
The T7 promoter may also be used to generate guide RNA in an in vitro transcription system. In this instance, the double-stranded nucleic acid molecule would be used to generate guide RNA extracellularly for introduction into a cell.
Advantages of the guide RNA generation methods set out in
Two oligonucleotides suitable for the generation of double-stranded DNA suitable for transcription as set out in
-
- a. identification of a target locus,
- b. the in silico design of one or more CRISPR RNA molecules with sequence complementarity to that locus,
- c. the production of a first oligonucleotide with a promoter sequence, a region of sequence complementarity (e.g., 15 to 25 nucleotides in length) to the target locus,
- d. incubating the first oligonucleotide with (i) a second oligonucleotide and (ii) a polymerase under conditions suitable for performing polymerase chain reaction (PCR) to generate a double-stranded nucleic acid molecule, wherein the first oligonucleotide and the second oligonucleotide have a region of sequence complementarity of sufficient length to allow for hybridization between the two oligonucleotides, and
- e. performing an in vitro transcription reaction on the PCR generated double-stranded nucleic acid molecule to produce a guide RNA molecule, and
- f. purifying the guide RNA molecule from the other components of the reaction mixture.
In the work flow shown in
The two oligonucleotides form the full length double-stranded nucleic acid segment via a polymerase mediated assembly reaction. Once the full length product molecule is assembled, further PCR reactions amplify the product. The primers prevent the two oligonucleotides from being PCR “limiting” components. In other words, once the product nucleic acid molecule has been generated, the primers allow for amplification to continue after the first and second oligonucleotides have been consumed.
With respect to CRISPR RNA coding sequence construction, the First Oligonucleotide and the Second Oligonucleotide may be synthesized to hybridize with the First Nucleic Acid Segment and the Second Nucleic Acid Segment. Each of these oligonucleotides also encode all or part of Hybridization Region 1. Assembly reactions may thus be designed to generate, for example, a DNA molecule that encodes a target locus specific guide RNA operably linked to a promoter.
While only one oligonucleotide is required for assembly reactions of the type shown in
The second issue above occurs when heterogeneous PCR assembled nucleic acid (e.g., DNA) are transcribed (e.g., via in vitro transcription) and then introduced into cells. In general, the lower the level of sequence fidelity in the original assembly oligonucleotide population, the greater the variation in Hybridization Region 1 of the expressed guide RNA population. One way to address this problem is to use oligonucleotides generated with high sequence fidelity.
The invention further includes compositions and methods for the assembly of CRISPR RNA molecules (e.g., guide RNA molecules). CRISPR RNA molecules may be assembled by the connection of two or more (e.g., two, three, four, five, etc.) RNA segments with each other. In particular, the invention includes methods for producing nucleic acid molecules, these methods comprising contacting two or more linear RNA segments with each other under conditions that allow for the 5′ terminus of a first RNA segment to be covalently linked with the 3′ terminus of a second RNA segment.
This form of assembly has the advantage that it allows for rapid and efficient assembly of CRISPR RNA molecules. Using the schematic shown in
The invention also includes compositions and methods for the production of guide RNA molecules with specificity for a target site, the method comprising: (1) identification of the target site, (2) production of a crRNA segment, and (3) connection of the crRNA segment with a tracrRNA segment. In such methods, the tracrRNA segment may be produced prior to connection with the crRNA and stored as a “stock” component or the tracrRNA segment may be generated from a DNA molecule that encodes the tracrRNA.
RNA molecules/segments connected to each other in the practice of the invention may be produced by any number of means, including chemical synthesis and transcription of DNA molecules. In some instances, RNA segments connected to each other may be produced by different methods. For example, a crRNA molecule produced by chemical synthesis may be connected to a tracrRNA molecule produced by in vitro transcription of DNA or RNA encoding the tracrRNA.
RNA segments may also be connected to each other by covalent coupling. RNA ligase, such as T4 RNA ligase, may be used to connect two or more RNA segments to each other. When a reagent such as an RNA ligase is used, a 5′ terminus is typically linked to a 3′ terminus. If two segments are connected, then there are two possible linear constructs that can be formed (i.e., (1) 5′-Segment 1-Segment 2-3′ and (2) 5′-Segment 2-Segment 1-3′). Further, intramolecular circularization can also occur. Both of these issues can be addressed by blocking one 5′ terminus or one 3′ terminus so that RNA ligase cannot ligate the terminus to another terminus. Thus, if a construct of 5′-Segment 1-Segment 2-3′ is desired, then placing a blocking group on either the 5′ end of Segment 1 or the 3′ end of Segment 2 will result in the formation of only the correct linear ligation product and will prevent intramolecular circularization. The invention thus includes compositions and methods for the covalent connection of two nucleic acid (e.g., RNA) segments. Methods of the invention include the use of an RNA ligase to directionally ligate two single-stranded RNA segments to each other.
One example of an end blocker that may be used in conjunction with, for example, T4 RNA ligase is a dideoxy terminator.
T4 RNA ligase catalyzes the ATP-dependent ligation of phosphodiester bonds between 5′-phosphate and 3′-hydroxyl termini. Thus, when one uses T4 RNA ligase, suitable termini must be present on the termini being ligated. One means for blocking T4 RNA ligase on a terminus is by failing to have the correct terminus format. In other words, termini of RNA segments with a 5-hydroxyl or a 3′-phosphate will not act as substrates for T4 RNA ligase.
Another method that may be used to connect RNA segments is by “click chemistry” (see, e.g., U.S. Pat. Nos. 7,375,234 and 7,070,941, and US Patent Publication No. 2013/0046084, the entire disclosures of which are incorporated herein by reference). For example, one click chemistry reaction is between an alkyne group and an azide group (see
In one embodiment the present invention uses the “Azide-Alkyne Huisgen Cycloaddition” reaction, which is a 1,3-dipolar cycloaddition between an azide and a terminal or internal alkyne to give a 1,2,3-triazole for the ligation of RNA segments. One advantage of this ligation method is that this reaction can initiated by the addition of required Cu(I) ions.
Other mechanism by which RNA segments may be connected include the use of halogens (F—, Br—, I—)/alkynes addition reactions, carbonyls/sulfhydryls/maleimide, and carboxyl/amine linkages.
For example, one RNA molecule may be modified with thiol at 3′ (using disulfide amidite and universal support or disulfide modified support), and the other RNA molecule may be modified with acrydite at 5′ (using acrylic phosphoramidite), then the two RNA molecules can be connected by Michael addition reaction. This strategy can also be applied to connecting multiple RAN molecules stepwise.
The invention also includes methods for linking more than two (e.g., three, four, five, six, etc.) RNA molecules to each other. One reason this may be done is when an RNA molecule longer than about 40 nucleotides is desired, as noted elsewhere herein, chemical synthesis efficiency degrades.
By way of example, a tracrRNA is typically around 80 nucleotides. Such RNA molecules may be produced by processes such as in vitro transcription or chemical synthesis. When chemical synthesis is used to produce such RNA molecules, they may be produced as a single synthesis product or by linking two or more synthesized RNA segments to each other. Further, when three or more RNA segments are connected to each other, different methods may be used to link the individual segments together. Also, the RNA segments may be connected to each other in one “pot”, all at the same time, or in one “pot” at different times or in different “pots” at different times.
For purposes of illustration, assume one wishes to assemble RNA Segments 1, 2 and 3 in numerical order. RNA Segments 1 and 2 may be connected, 5′ to 3′, to each other. The reaction product may then be purified for reaction mixture components (e.g., by chromatography), then placed in a second vessel, “pot”, for connection of the 3′ terminus with the 5′ terminus of RNA Segment 3. The final reaction product may then be connected to the 5′ terminus of RNA Segment 3.
A second, more specific illustration of one embodiment of the invention is as follows. RNA Segment 1 (about 30 nucleotides) is the target locus recognition sequence of a crRNA and a portion of Hairpin Region 1. RNA Segment 2 (about 35 nucleotides) contains the remainder of Hairpin Region 1 and some of the linear tracrRNA between Hairpin Region 1 and Hairpin Region 2. RNA Segment 3 (about 35 nucleotides) contains the remainder of the linear tracrRNA between Hairpin Region 1 and Hairpin Region 2 and all of Hairpin Region 2. In this illustration, RNA Segments 2 and 3 are linked, 5′ to 3′, using click chemistry. Further, the 5′ and 3′ end termini of the reaction product are both phosphorylated. The reaction product is then contacted with RNA Segment 1, having a 3′ terminal hydroxyl group, and T4 RNA ligase to produce a guide RNA molecule.
A number of additional linking chemistries may be used to connect RNA segments according to method of the invention. Some of these chemistries are set out in Table 6.
One issue with methods for linking RNA segments is that often they do not result in complete conversion of the segments to connected RNA molecules. For example, some chemical linkage reactions only result in 50% of the reactants forming the desired end product. In such instances, it will often be desirable to remove reagents and unreacted RNA segments. This may be done by any number of means such as dialysis, chromatography (e.g., HPLC), precipitation, electrophoresis, etc. Thus, the invention includes compositions and method for linking RNA segments, where the reaction products RNA molecules are separated from other reaction mixture components.
As noted above, CRISPR system components may be “generic” with respect to target loci (e.g., Cas9 protein) or may be specific for a particular target locus (e.g., crRNA). This allows for the production of “generic” components that may be used in conjunction with target sequence specific components. Thus, when a target locus of interest is identified, one need only produce a component or components specific for that target locus. In the instance where one seeks to make two closely associated “nicks” at the target sequence, then, for example, two crRNA molecules will typically need to be produced. These crRNA molecules may be produced when the target sequence of interest is identified or they may be produced in advance and stored until needed.
The invention further includes collections of crRNA molecules with specificity for individual target sites. For example, the invention includes collections of rRNA molecules with specificity for target sites within particular types of cell (e.g., human cells). The members of such collection of cells may be generated based upon sequence information for these particular types of cells. As an example, one such collection could be generated using the complete genome sequence of a particular type of cell. The genome sequence data can be used to generate a library of crRNA molecules with specificity for the coding region of each gene within the human genome. Parameters that could be used to generate such a library may include the location of protospacer adjacent motif (PAM) sites, off target effects (e.g., sequences unique to the target region), and, when gene “knockouts” are desired, locations within coding regions likely to render the gene expression product fully or partially non-functional (e.g., active site coding regions, intron/exon junctions, etc.).
Collections or libraries of crRNA molecules or the invention may include a wide variety of individual molecules such as from about five to about 100,000 (e.g., from about 50 to about 100,000, from about 200 to about 100,000, from about 500 to about 100,000, from about 800 to about 100,000, from about 1,000 to about 100,000, from about 2,000 to about 100,000, from about 4,000 to about 100,000, from about 5,000 to about 100,000, from about 50 to about 50,000, from about 100 to about 50,000, from about 500 to about 50,000, from about 1,000 to about 50,000, from about 2,000 to about 50,000, from about 4,000 to about 50,000, from about 50 to about 10,000, from about 100 to about 10,000, from about 200 to about 10,000, from about 500 to about 10,000, from about 1,000 to about 10,000, from about 2,000 to about 10,000, from about 4,000 to about 10,000, from about 50 to about 5,000, from about 100 to about 5,000, from about 500 to about 5,000, from about 1,000 to about 5,000, from about 50 to about 2,000, from about 100 to about 2,000, from about 500 to about 2,000, etc.).
RNA molecules generated by and used in the practice of the invention may be stored in a number of ways. RNA molecules are generally not as stable as DNA molecules and, thus, to enhance stability, RNA molecules may be stored at low temperature (e.g., −70° C.) and/or in the presence of one or more RNase inhibitor (e.g., RN
Further, RNA molecules may be chemically modified to be resistant to RNases by, for example, being generated using RNase-resistant ribonucleoside triphosphates. Examples of RNase-resistant modified ribonucleosides include, but are not limited to, 2-fluoro ribonucleosides, 2-amino ribonucleosides, and 2-methoxy ribonucleosides. Additional examples of RNase-resistant modified ribonucleosides are disclosed in U.S. Patent Publ. 2014/0235505 A1, the entire disclosure of which is incorporated herein by reference. 2′-O-allyl-ribonucleotides may also be incorporated into RNA molecules of the invention.
Chemical modification used in the practice of the invention will often be selected based upon a series of criteria, such as effectiveness for the purpose that the chemical modification is used (e.g., RNase resistance), level of toxicity to cells (low generally being better than high), ease of incorporation into the nucleic acid molecules, and minimal interference with the biological activities of the nucleic acid molecule (e.g., the activities of a guide RNA molecule).
Further, RNA molecules of and used in the practice of the invention may be stored in a number of different formats. For example, RNA molecules may be stored in tubes (e.g., 1.5 ml microcentrifuge tubes) or in the wells of plates (e.g., 96 well, 384 well, or 1536 well plates).
The invention thus includes compositions and methods for the production of libraries and/or collections of CRISPR system components, as well as the libraries and/or collections of CRISPR system components themselves.
The invention also includes compositions and methods for the isolation of gRNA molecules. Such methods will often be based upon hybridization of a gRNA region to another nucleic acid molecule, followed by separation of the hybridized complex from other molecules (e.g., nucleic acid molecules) present in a mixture.
As an example, beads containing a nucleic acid molecule with sequence homology to a gRNA molecule may be used to purify the gRNA from a solution. In some instances, the bead will be a magnetic bead. Further, the nucleic acid molecule designed to hybridize to the gRNA molecule may be designed with homology to a sequence present in gRNA molecules or gRNA molecules may be designed to contain a sequence that is used for hybridization. The invention thus includes gRNA molecules that are designed to contain what is effectively a hybridization “tag”.
Such “tags” are particularly useful in high throughput applications. As an example, a 96 well plate may contain different gRNA molecules in each well, wherein each gRNA molecules contains the same tag. A magnetic bead may be placed in one or more well of the plate and then removed after a specified period of time to allow for gRNA/bead bound hybridization to take place. These beads may then be individually placed in wells of another plate containing cells and donor DNA under conditions that allow for release of gRNA molecules from the beads (e.g., competition with an oligonucleotide of identical or similar sequence to the tag).
As noted above, hybridization tags may be naturally resident with gRNA molecules or may be introduced into or added to gRNA molecules. Such tags may be added by the alteration of a region present in a gRNA molecule or may be added to the gRNA either internally or at a terminus. Further, tags may be generated during synthesis of gRNA molecules or added after gRNA molecules are produced (e.g., via “click chemistry”).
Hybridization tags will typically be less than 25 (e.g., from about 10 to about 25, from about 15 to about 25, from about 16 to about 25, from about 10 to about 20, from about 15 to about 25, from about 15 to about 20, etc.) bases in length. Such tags will typically be able to hybridize to homologous sequences with sufficient affinity for association but will not associate so strongly that they do not efficiently release when desired. Further, shorter tags will often have a higher GC content. In many instances, tags will have a GC content of at least 45% (e.g., from about 45% to about 75%, from about 50% to about 75%, from about 55% to about 75%, from about 60% to about 75%, from about 65% to about 75%, etc.).
Also, tagged gRNA molecules may contain a label. This label may be used to quantify the amount of gRNA present. Labels may also be useful when seeking to determine the amount of gRNA transferred by hybridization based means. Such labels may also be used to measure cellular uptake as set out elsewhere herein.
CRISPR Activities
CRISPR complexes of the invention can have any number of activities. For example, CRISPR proteins may be fusion proteins comprising one or more heterologous protein domains (e.g., one, two, three, four, five, etc.). A CRISPR fusion protein may comprise any additional protein sequence, and optionally a linker sequence between any two domains. Examples of protein domains that may be fused to a CRISPR protein include, without limitation, epitope tags, reporter gene sequences, and protein domains having one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity, and nucleic acid binding activity.
Non-limiting examples of epitope tags include histidine (His) tags, V5 tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags. Examples of reporter genes include, but are not limited to, glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, beta-glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins including blue fluorescent protein (BFP).
A CRISPR protein may be fused to a gene sequence encoding a protein or a fragment of a protein that bind DNA molecules or bind other cellular molecules, including but not limited to maltose binding protein (MBP), S-tag, Lex A DNA binding domain (DBD) fusions, GALA DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions. Additional domains that may form part of a fusion protein comprising a CRISPR protein are described in US 2011/0059502, incorporated herein by reference.
In particular, provided herein, in part, are CRISPR protein endonucleases, which comprise at least one nuclear localization signal, at least one nuclease domain, and at least one domain that interacts with a guide RNA to target the endonuclease to a specific nucleotide sequence for cleavage. Also provided are nucleic acids encoding CRISPR protein endonucleases, as well as methods of using CRISPR protein endonucleases to modify chromosomal sequences of eukaryotic cells or embryos. CRISPR protein endonucleases interacts with specific guide RNAs, each of which directs the endonuclease to a specific targeted site, at which site the CRISPR protein endonucleases introduces a double-stranded break that can be repaired by a DNA repair process such that the chromosomal sequence is modified. Since the specificity is provided by the guide RNA (or the crRNA), the CRISPR protein endonucleases are universal and can be used with different guide RNAs to target different genomic sequences. Methods disclosed herein can be used to target and modify specific chromosomal sequences and/or introduce exogenous sequences at targeted locations in the genome of cells or embryos.
CRISPR complexes may also be employed to activate or repress transcription. For example, a dCas9-transcriptional activator fusion protein (e.g., dCas9-VP64) may be used in conjunction with a guide RNA to activate transcription of nucleic acid associated with a target locus. Similarly, dCas9-repressor fusions (e.g., dCas9-KRAB transcriptional repressor) may be used to repress transcription of nucleic acid associated with a target locus. Transcriptional activation and repression such as the referred to above are discussed in, for example, Kearns et al., Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells, Development, 141:219-223 (2014).
The invention thus includes compositions and methods for the production and use of CRISPR system components for the activation and repression of transcription.
CRISPR Systems
CRISPR systems that may be used in the practice of the invention vary greatly. These systems will generally have the functional activities of a being able to form complex comprising a protein and a first nucleic acid where the complex recognizes a second nucleic acid. CRISPR systems can be a type I, a type II, or a type III system (see Table 2). Non-limiting examples of suitable CRISPR proteins include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9, Cas10, Casl Od, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csz1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu1966.
In some embodiments, the CRISPR protein (e.g., Cas9) is derived from a type II CRISPR system. In specific embodiments, the CRISPR system is designed to acts as an oligonucleotide (e.g., DNA or RNA)-guided endonuclease derived from a Cas9 protein. The Cas9 protein for this and other functions set out herein can be from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, or Acaryochloris marina.
Vector Components and Cells:
A number of functional nucleic acid components (e.g., promoters, polyA signal, origins of replication, selectable markers, etc.) may be used in the practice of the invention. The choice of functional nucleic acid components used in the practice of the invention, when employed, will vary greatly with the nature of the use and the specifics of the system (e.g., intracellular, extracellular, in vitro transcription, coupled in vitro transcription/translation, etc.).
Promoter choice depends upon a number of factors such as the expression products and the type of cell or system that is used. For example, non-mRNA molecules are often production using RNA polymerase I or III promoters. mRNA is generally transcribed using RNA polymerase II promoters. There are exceptions, however. One is microRNA expression systems where a microRNA can be transcribed from DNA using an RNA polymerase II promoter (e.g., the CMV promoter). While RNA polymerase II promoters do not have “sharp” stop and stop points, microRNAs tend to be processed by removal of 5′ and 3′ termini. Thus, “extra” RNA segments at the termini are removed. mRNA (e.g., cas9 mRNA) is normally produced via RNA polymerase II promoters.
The choice of a specific promoter varies with the particular application. For example, the T7, T3 and SP6 promoters are often used for in vitro transcription and in vitro transcription/translations systems. When intracellular expression in desired, the promoter or promoters used will generally be designed to function efficiently within the cells employed. The CMV promoter, for example, is a strong promoter for use within mammalian cells. The hybrid Hsp70A-Rbc S2 promoter is a constitutive promoter that functions well in eukaryotic algae such as Chlamydornonas reinhardtii. (see the product manual “GeneArt® Chlamydornonas Protein Expression Kit”, cat. no. A24244, version B.0, from Life Technologies Corp., Carlsbad, Calif.). Additional promoters that may be used in the practice of the invention include AOX1, GAP, cauliflower mosaic virus 35S, pGC1, EF1α, and Hsp70 promoters.
The DNA segment in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct RNA synthesis. Suitable eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the promoters of retroviral LTRs, such as those of the Rous Sarcoma Virus (RSV), and metallothionein promoters, such as the mouse metallothionein-I promoter. Exemplary promoters suitable for use with the invention are from the type III class of RNA polymerase III promoters. Additionally, the promoters may be selected from the group consisting of the U6 and H1 promoters. The U6 and H1 promoters are both members of the type III class of RNA polymerase III promoters.
RNA polymerase III promoters are suitable for in vivo transcription of nucleic acid molecules produced by methods of the invention. For example, linear DNA molecules produced as set out in
Promoters in compositions and methods of the invention may also be inducible, in that expression may be turned “on” or “off.” For example, a tetracycline-regulatable system employing the U6 promoter may be used to control the production of siRNA. Expression vectors may or may not contain a ribosome binding site for translation initiation and a transcription terminator. Vectors may also include appropriate sequences for amplifying expression.
A great variety of cloning/expression systems can be used to express proteins and nucleic acid molecules in the practice of the invention. Such vectors include, among others, chromosomal-, episomal- and viral-derived vectors, for example, vectors derived from plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, adeno-associated viruses, avipox (e.g., fowl pox) viruses, suipox viruses, capripox viruses, pseudorabies viruses, picornaviruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids. The expression system constructs can contain control regions that regulate as well as engender expression. Generally, any system or vector suitable to maintain, propagate or express polynucleotides or to express a polypeptide in a host can be used for expression in this regard. The appropriate DNA sequence can be inserted into the expression system by any of a variety of well-known and routine techniques, such as, for example, those set forth in Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbour Laboratory Press, Cold Spring Harbour. N.Y. (1989).
Cells suitable for use with the present invention include a wide variety of prokaryotic and eukaryotic cells. In many instances, the cells one or more CRISPR system component will not be naturally associated with the cell (i.e., will be exogenous to the cell).
Representative cells that may be used in the practice of the invention include, but are not limited to, bacterial cells, yeast cells, plant cells and animal cells. Exemplary bacterial cells include Escherichia spp. cells (particularly E. coli cells and most particularly E. coli strains DH10B, Stb12, DH5□, DB3, DB3.1), Bacillus spp. cells (particularly B. subtilis and B. megaterium cells), Streptomyces spp. cells, Erwinia spp. cells, Klebsiella spp. cells, Serratia spp. cells (particularly S. marcessans cells), Pseudomonas spp. cells (particularly P. aeruginosa cells), and Salmonella spp. cells (particularly S. typhimurium and S. typhi cells). Exemplary animal cells include insect cells (most particularly Drosophila melanogaster cells, Spodoptera frugiperda Sf9 and Sf21 cells and Trichoplusa High-Five cells), nematode cells (particularly C. elegans cells), avian cells, amphibian cells (particularly Xenopus laevis cells), reptilian cells, and mammalian cells (more particularly NIH3T3, CHO, COS, VERO, BHK CHO-K1, BHK-21, HeLa, COS-7, HEK 293, HEK 293T, HT1080, PC12, MDCK, C2C12, Jurkat, NIH3T3, K-562, TF-1, P19 and human embryonic stem cells like clone H9 (Wicell, Madison, Wis., USA)). Exemplary yeast cells include Saccharomyces cerevisiae cells and Pichia pastoris cells. These and other cells are available commercially, for example, from Thermo-Fisher Scientific (Waltham, Mass.), the American Type Culture Collection, and Agricultural Research Culture Collection (NRRL; Peoria, Ill.). Exemplary plant cells include cells such as those derived from barley, wheat, rice, soybean, potato, Arabidopsis and tobacco (e.g., Nicotiana tabacum SR1).
Introduction of Crispr System Components into Cells:
The invention also includes compositions and methods for introduction of CRISPR system components into cells. Introduction of a molecules into cells may be done in a number of ways including by methods described in many standard laboratory manuals, such as Davis et al., BASIC METHODS IN MOLECULAR BIOLOGY, (1986) and Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbour Laboratory Press, Cold Spring Harbour. N.Y. (1989), such as, calcium phosphate transfection, DEAE-dextran mediated transfection, transfection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction, nucleoporation, hydrodynamic shock, and infection.
The invention includes methods in which different CRISPR system components are introduced into cells by different means, as well as compositions of matter for performing such methods. For example, a lentiviral vector may be used to introduce Cas9 coding nucleic acid operably linked to an suitable and guide RNA may be introduced by transfection.
CRISPR system components may be the functional CRISPR system molecules or they may be molecules encoding the functional molecules (e.g., DNA, RNA encoding Cas9, etc.) transfection of CRISPR system components into cells. Methods of the invention relate to the introduction into cells one or more of the following:
-
- a. Guide RNA,
- b. crRNA,
- c. tracrRNA,
- d. DNA encoding Cas9 or dCas9 (as well as fusion proteins of each), and
- e. mRNA encoding Cas9 or dCas9 (as well as fusion proteins of each).
In most instances, CRISPR system components will be introduced into a cell in a manner that results in the generation of CRISPR activities within the cell. Thus, in instances where a cell expresses Cas9 protein (e.g., from chromosomally integrated CRISPR encoding nucleic acid operably linked to a promoter), crRNA and tracrRNA or guide may be introduced into the cell by transfection.
Transfection agents suitable for use with the invention include transfection agents that facilitate the introduction of RNA, DNA and proteins into cells. Exemplary transfection reagents include TurboFect Transfection Reagent (Thermo Fisher Scientific), Pro-Ject Reagent (Thermo Fisher Scientific), T
The invention further includes methods in which one molecule is introduced into a cell, followed by the introduction of another molecule into the cell. Thus, more than one CRISPR system components molecule may be introduced into a cell at the same time or at different times. As an example, the invention includes methods in which Cas9 is introduced into a cell while the cell is in contact with a transfection reagent designed to facilitate the introduction of proteins in to cells (e.g., TurboFect Transfection Reagent), followed by washing of the cells and then introduction of guide RNA while the cell is in contact with L
Conditions will normally be adjusted on, for example, a per cell type basis for a desired level of CRISPR system component introduction into the cells. While enhanced conditions will vary, enhancement can be measure by detection of intracellular CRISPR system activity. Thus, the invention includes compositions and methods for measurement of the intracellular introduction of CRISPR system components in cells.
The invention also includes compositions and methods related to the formation and introduction of CRISPR complexes into cells. One exemplary method of the invention comprises:
-
- a. forming a complex comprising at least one CRISPR system protein with at least one CRISPR RNA,
- b. contacting the complexed CRISPR system protein and RNA with a cell,
- c. incubating or culturing the resulting cell for a period of time (e.g., from about 2 minutes to about 8 hours, from about 10 minutes to about 8 hours, from about 20 minutes to about 8 hours, from about 30 minutes to about 8 hours, from about 60 minutes to about 8 hours, from about 20 minutes to about 6 hours, from about 20 minutes to about 3 hours, from about 20 minutes to about 2 hours, from about 45 minutes to about 3 hours, etc.), and
- d. measuring CRISPR system activity within the cell.
In some instances, during the practice of methods of the invention, molecules introduced into cells may be labeled. One schematic example of this is set out in
Labels may be attached to one or more CRISPR system component and/or other molecules (e.g., a donor nucleic acid molecule) for introduction in the cells. In many instances, labels will be detectable either visually or by cell sorting instruments. Exemplary labels include cyan florescent protein (CFP), green florescent protein (GFP), orange florescent protein (OFP), red florescent protein (RFP), and yellow florescent protein (YFP). Additional labels include AMCA-6-dUTP, DEAC-dUTP, dUTP-ATTO-425, dUTP-XX-ATTO-488, Fluorescein-12-dUTP, Rhodamine-12-dUTP, dUTP-XX-ATTO-532, dUTP-Cy3, dUTP-ATTO-550, dUTP-Texas Red, dUTP-J647, dUTP-Cy5, dUTP-ATTO-647N, dUTP-ATTO-655, Fluorescein-12-dCTP, Rhodamine-12-dCTP, dCTP-Cy3dCTP-ATTO-550, dCTP-Texas Red, dCTP-J647, dCTP-Cy5 and dCTP-ATTO-647N available from multiple sources including Jena Bioscience.
Labels may be located in nucleic acid molecules and proteins at one or both termini and/or interior portions of the particular molecules.
When cells are sorted, a number of separation parameters may be employed. In most instances, sorting may be designed to obtain cells having enhanced probability of undergoing genetic modification. For example, cells may be labeled as shown in
The invention thus includes methods, as well as compositions for performing such methods, for obtaining cell populations wherein the cells therein have an enhanced probabilities of undergoing genetic modification. In some instances, such methods will involve one or both of the following: (1) selection of cell (e.g., via cell sorting) of cells that have taken up one or more component necessary for genetic modification (e.g., one or more CRISPR system component and one or more donor DNA molecule) and (2) introduction of one or more one or more component necessary for genetic modification into cells by processes designed to result in high cellular uptake (e.g., sequence component introduction, as set out herein).
As noted elsewhere herein, in some instances, sequential addition of components may be employed. As shown from the data set out in
When sequential delivery is employed, various components may be introduced into cells in a number of orders. For example, Cas9 protein, gRNA, or Cas9 RNP may be introduced into cells first followed by the introduction of donor DNA. Of course, the reverse order may be used too. Further, Cas9 protein may be expressed within cells and gRNA and donor DNA may be co-delivered or sequentially delivered to the cells in any order. Additionally, gRNA may be expressed within cells and Cas9 protein and donor DNA may be co-delivered or sequentially delivered to the cells in any order. In some instances, gRNA may be introduced into cells first, followed by Cas9 protein, then followed by donor DNA. Of course, other delivery orders may be used too, so long as all of the components required for genetic modification are not delivered simultaneously.
In some instances, methods of the invention include the contacting a cell with a linear DNA segment that has sequence homology at both termini to the target locus (e.g., a donor DNA molecule) under conditions that allow for uptake of the linear DNA segment by the cell (e.g., in conjunction with electroporation, contacting with a transfection reagent, etc.), followed by contacting the cell with one or more CRISPR system components (e.g., Cas9 mRNA, guide RNA, Cas9 mRNA and guide RNA, a Cas9 protein/guide RNA complex, etc.) under conditions that allow for uptake of the one or more CRISPR system components by the cell.
In specific aspects, the invention includes methods comprising steps (a), (b) and (c) below. Furthers, step (c) and step (a) may be swapped in order.
Step (a) involves contacting a cell with a linear DNA segment that has sequence homology at both termini to the target locus (e.g., a donor DNA molecule) under conditions that allow for uptake of the linear DNA segment by the cell. This may be done in any number of means. As examples, cell may be subjected to electroporation in the presence of the linear DNA segment or a transfection reagent may be used.
Step (b) involves waiting a period of time. This time period may be determined in a number of ways.
Step (c) involves contacting a cell with a Cas9 RNP complex under conditions that allow for uptake of the linear DNA segment by the cell.
As shown in
Data in
Data in
The invention further includes compositions and methods for the insertion and correction of single-nucleotide polymorphisms (SNPs). In some instances, such methods involve the use of single-stranded donor nucleic acid with terminal regions having homology to a target site in conjunction with CRISPR system components. Of course, double-stranded donor nucleic acid may also be used for SNP insertion or correction.
Data in
The invention thus includes compositions containing and methods employing donor nucleic acid molecules having chemical modifications. In many instances, these chemical modifications will render nucleic acid molecules containing them resistant to one or more nuclease (e.g., exonuclease and/or endonuclease). Chemical modifications that may be used in the practice of the invention include the following: Phosphorothioate groups, 5′ blocking groups (e.g., 5′ diguanosine caps), 3′ blocking groups, 2′-fluoro nucleosides, 2′-O-methyl-3′ phosphorothioate, or 2′-O-methyl-3′ thioPACE, inverted dT, inverted ddT, and biotin. Further, a phosphoramidite C3 Spacer can be incorporated internally, or at either end of an oligo to introduce a long hydrophilic spacer arm for the attachment of fluorophores or other groups and can also be used to inhibit degradation by 3′ exonucleases.
In some instances, the terminal base at one or each end of a donor DNA molecule will be chemically modified. In other instances, terminal two or three bases at one or each end will be chemically modified. In still other instances, internal bases will be chemically modified. In some instances, from about 1% to about 50% (e.g., from about 1% to about 45%, from about 1% to about 40%, from about 1% to about 35%, from about 1% to about 25%, from about 1% to about 15%, from about 5% to about 50%, from about 10% to about 50%, from about 15% to about 50%, from about 15% to about 35%, etc.) of the total number of bases present in donor nucleic acid molecules will be chemically modified.
A number of compositions and methods may be used to form CRISPR complexes. For example, Cas9 mRNA and a guide RNA may be encapsulated in I
For Cas9 mRNA transfection with cell culture such as 293 cells, 0.5 μg mRNA was added to 25 μl of Opti-MEM, followed by addition of 50-100 ng gRNA. Meanwhile, two μl of L
A CRISPR system activity may comprise expression of a reporter (e.g., green fluorescent protein, β-lactamase, luciferase, etc.) or nucleic acid cleavage activity. Using nucleic acid cleavage activity for purposes of illustration, total nucleic acid can be isolated from cells to be tested for CRISPR system activity and then analyzed for the amount of nucleic acid that has been cut at the target locus. If the cell is diploid and both alleles contain target loci, then the data will often reflect two cut sites per cell. CRISPR systems can be designed to cut multiple target sites (e.g., two, three four, five, etc.) in a haploid target cell genome. Such methods can be used to, in effect, “amplify” the data for enhancement of CRISPR system component introduction into cells (e.g., specific cell types). Conditions may be enhanced such that greater than 50% of the total target loci in cells exposed to CRISPR system components (e.g., one or more of the following: Cas9 protein, Cas9 mRNA, crRNA, tracrRNA, guide RNA, complexed Cas9/guide RNA, etc.) are cleaved. In many instances, conditions may be adjusted so that greater than 60% (e.g., greater than 70%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, from about 50% to about 99%, from about 60% to about 99%, from about 65% to about 99%, from about 70% to about 99%, from about 75% to about 99%, from about 80% to about 99%, from about 85% to about 99%, from about 90% to about 99%, from about 95% to about 99%, etc.) of the total target loci are cleaved.
Any number of conditions may be altered to enhance the introduction of CRISPR system components into cells. Exemplary incubation conditions are pH, ionic strength, cell type, energy charge of the cells, the specific CRISPR system components present, the ratio of CRISPR system components (when more than one CRISPR system component is present), the CRISPR system component/cell ratio, concentration of cells and CRISPR system components, incubation times, etc.
One factor that may be varied, especially when CRISPR complexes are formed, is ionic strength. Ionic strength is the total ion concentration in solution. CRISPR complexes are formed from the association of CRISPR protein with CRISPR RNA and this association is partially dependent upon the ionic strength of the surrounding environment. One method for calculating the ionic strength of a solution is by the Debye and Huckel formula. In many instances, the ionic strength of solutions used in the practice of the invention will be from about 0.001 to about 3 (e.g., from about 0.001 to about 2, from about 0.001 to about 1.5, from about 0.001 to about 1, from about 0.001 to about 0.7, from about 0.001 to about 0.5, from about 0.001 to about 0.25, from about 0.001 to about 0.1, from about 0.01 to about 1, from about 0.01 to about 0.5, from about 0.01 to about 0.2, from about 0.01 to about 0.1, etc.).
pH is another factor that may affect transfection efficiency. Typically, complexation and/or transfection will occur at near physiological pH (e.g., pHs from about 6.5 to about 7.5, pHs from about 6.8 to about 7.5, pHs from about 6.9 to about 7.5, pHs from about 6.5 to about 7.3, pHs from about 6.5 to about 7.1, pHs from about 6.8 to about 7.2, etc.). In some instances, transfection efficiency is known to be sensitive to small variations in pH (e.g., =/−0.2 pH units).
The ratio of CRISPR system components to each other and to other mixture components (e.g., cells) also affects the efficiency of CRISPR system component cellular update. Using Cas9 protein and guide RNA for purposes of illustration, Cas9 protein may be complexed with guide RNA before contact with a cell or simultaneously with cellular contact. In many instances, CRISPR protein and CRISPR RNA components will be present in set ratios (e.g., 1:1, 1.5:1, 2:1, 2.5:1, 3:1, 1:1.5, 1:2, 1:2.5, 1:3, from about 0.2:1 to about 4:1, from about 0.2:1 to about 3:1, from about 0.2:1 to about 2:1, from about 0.5:1 to about 6:1, from about 0.5:1 to about 4:1, etc.). One useful ratio for Cas9 protein to guide RNA is 1:1, where each Cas9 protein has available to it one guide RNA molecular partner for complex formation.
The uptake of CRISPR complexes by cells is partially determined by the concentration of the CRISPR complexes and the cell density and the ratio of the CRISPR complexes to the cells. Typically, high CRISPR complex concentrations will result in higher amounts of uptake by available cells. Exemplary CRISPR complex/cell density conditions include 107 CRISPR complexes per cell. Additionally, CRISPR complexes per cell may be in the range of 102 to 1012 complexes per cell (e.g., from about 102 to about 1011, from about 102 to about 1010, from about 102 to about 109, from about 102 to about 108, from about 102 to about 107, from about 102 to about 106, from about 103 to about 1012, from about 104 to about 1012, from about 105 to about 1012, from about 106 to about 1012, from about 107 to about 1012, from about 108 to about 1012, from about 103 to about 1010, from about 104 to about 1010, from about 105 to about 1011, etc.). Also, the cell density will typically be about 105 cells per ml. Typically, cell density will be in the range of 102 to 108 cells per ml (e.g., from about 102 to about 107, from about 102 to about 106, from about 102 to about 105, from about 102 to about 104, from about 103 to about 108, from about 103 to about 107, from about 104 to about 107, etc.).
The invention includes methods in which one or both of the CRISPR complex/cell density and/or the total cell density are adjusted such that, when double-stranded target locus cutting is assayed, the percentage of target loci cut are between 80 and 99.9% (e.g., from about 80% to about 99%, from about 85% to about 99%, from about 90% to about 99%, from about 95% to about 99%, from about 96% to about 99%, from about 80% to about 95%, from about 90% to about 97%, etc.).
One exemplary set of conditions that may be use is where ˜55 cells are contacted with 500 ng of Cas9 (˜212 molecules) complexed with target locus specific guide RNA.
The invention also includes compositions and methods for storing reagent for intracellular genetic modification.
Data shown in
For purposes of illustration, the invention includes multi-well plates, as well as high throughput methods employing such plates, in which different wells contain Cas9 protein and a transfection reagent. Further, different wells contain different gRNA molecules. Such plates may be used in high throughput methods for altering multiple genetic sites within cells. Each well may further contain, for example, donor DNA with termini homologous to the gRNA directed cleavage site for alteration of different loci within cells.
The invention also includes CRISPR system reagents that remain stable when stored for specified periods of time. For purposes of illustration, the invention provides CRISPR system reagents that retain at least 75% (e.g., from about 75% to about 100%, from about 80% to about 100%, from about 85% to about 100%, from about 90% to about 100%, from about 95% to about 100%, from about 75% to about 90%, from about 80% to about 90%, etc.) of their original CRISPR related activity after 3 months of storage at −20° C. Of course, CRISPR system reagents may be stored at different temperatures (e.g., 4° C., −20° C., −70° C., from about 4° C. to about −70° C., from about −20° C. to about −70° C., etc.). Further, the invention also includes CRISPR system reagents and method for storing such reagents where at least 75% of their original CRISPR related activity after up to 1 year (e.g., from about 1 month to about 12 months, from about 2 months to about 12 months, from about 3 months to about 12 months, from about 4 months to about 12 months, from about 5 months to about 12 months, from about 1 months to about 9 months, from about 3 months to about 9 months, from about 2 months to about 6 months, etc.).
In some instances, CRISPR complexes may not be stable during storage, especially under certain conditions. For example, under some conditions Cas9, gRNA and transfection reagents may be stable under one set of conditions but not under another set of conditions. It has been determined that under some conditions (e.g., in certain buffer formulations), Cas9, gRNA and transfection reagent mixtures are not stable upon freezing but are stable upon storage at 4° C. The invention this includes compositions that are stable under on set of storage conditions but not another set of storage conditions.
The data set out in
Storage data was generated using reagent mixtures contained in wells of multiwall plates. Cas9 was present in wells in an amount of 500 ng/well (0.5 μl of a 0.5 μg/μl stock solution) and gRNA was present in an amount of 200 ng/well (0.7 μl of a 300 ng/μl stock solution). All reagents were stored as 4× solutions. Cas9/gRNA samples were placed under storage conditions as 1.2 μl aliquots in each well. Cas9/gRNA/O
The above reagents were then used after storage in cleavage assay after being combined with additional reagents and cells. The data set out in
For transfection, 293FT cells were seeded one day prior to transfection at 20,000 cells per well in a 96 well plate format to get around 50% to 60% cell confluency on the day of transfection. Each well at the time of seeding has 100 μl of cell culture media (DMEM, 10% FBS, and 5% each of sodium pyruvate, non-essential amino acids and GlutaMAX™). At the time of transfection 10 μl of final transfection mix (containing Cas9, gRNA, L
In one aspect, the invention relates to compositions and methods related to ready to use reagents. A ready to use reagent may be in any number of forms. For example, a ready to use reagent may contain one or more Cas9 protein, one or more gRNA, one or more transfection reagent, and one or more cell culture medium. As specific example is a reagent that contains a Cas9 protein, two gRNAs, and L
Another example of a ready to use reagent includes a combination of one or more Cas9 protein, one or more gRNA, and one or more cell culture medium. As specific example is a reagent that contains a Cas9 protein and two gRNAs in 2× concentration and O
Ready to use reagents such as those set out above may be stored at 4° C. for a period of time prior to use. As noted elsewhere herein, under some conditions, Cas9, gRNA and transfection reagent mixtures are not stable upon freezing but are stable upon storage at 4° C.
Ready to use reagents may be labeled with preferred storage conditions and expiration dates that are designed to reflect a specified decrease in activity (e.g., less than 80% of activity). For example, expiration dates may range from about two weeks to about one year (e.g., from about two weeks to about ten months, from about two weeks to about eight months, from about two weeks to about six months, from about two weeks to about four months, from about one month to about one year, from about one month to about ten months, from about one month to about six months, from about one month to about four months, from about three months to about one year, from about three months to about eight months, etc.).
It has also been found that, in some instances, higher concentrations of CRISPR system components result in higher stability upon storage. Thus, in some aspects, the invention includes reagents that contain greater than 50 ng/μl (e.g., from about 50 ng/μl to about 500 ng/μl, from about 100 ng/μl to about 500 ng/μl, from about 150 ng/μl to about 500 ng/μl, from about 200 ng/μl to about 500 ng/μl, from about 250 ng/μl to about 500 ng/μl, from about 300 ng/μl to about 500 ng/μl, from about 400 ng/μl to about 500 ng/μl, etc.) of gRNA. In many instances, the molar amount of Cas9 protein, when present, to gRNA will be in the range of from about 5:1 to about 1:5 (e.g., from about 5:1 to about 1:4, from about 5:1 to about 1:3, from about 5:1 to about 1:2, from about 5:1 to about 1:1, from about 5:1 to about 1:1, from about 4:1 to about 1:5, from about 5:1 to about 1:5, from about 2:1 to about 1:5, from about 1:2 to about 1:5, from about 4:1 to about 1:4, from about 3:1 to about 1:3, from about 2:1 to about 1:2, etc.).
Kits:
The invention also provides kits for, in part, the assembly and/or storage of nucleic acid molecules and for the editing of cellular genomes. As part of these kits, materials and instruction are provided for both the assembly of nucleic acid molecules and the preparation of reaction mixtures for storage and use of kit components.
Kits of the invention will often contain one or more of the following components:
1. One or more nucleic acid molecule (e.g., one or more primer, one or more DNA molecule encoding Cas9, dCas9, guide RNA, etc., one or more mRNA encoding a CRISPR system component, such as Cas9, dCas9, etc.),
2. One or more polymerase,
3. One or more protein (e.g., one or more CRISPR protein such as Cas9, dCas9, etc.),
4. One or more partial vector (e.g., one or more nucleic acid segment containing an origin of replication and/or a selectable marker) or complete vector, and
5. Instructions for how to use kits components.
In particular, some kits of the invention may include one or more of the following: (a) a double-stranded nucleic acid molecule encoding the 3′ end of a guide RNA molecule (see
In some embodiments, kits may comprise one or more reagents for use in a process utilizing one or more of the CRISPR system components discussed herein or for producing one or more CRISPR system component discussed herein.
Kit reagents may be provided in any suitable container. A kit may provide, for example, one or more reaction or storage buffers. Reagents may be provided in a form that is usable in a particular reaction, or in a form that requires addition of one or more other components before use (e.g., in concentrate or lyophilized form). A buffer can be any buffer, including but not limited to a sodium carbonate buffer, a sodium bicarbonate buffer, a borate buffer, a Tris buffer, a MOPS buffer, a HEPES buffer, and combinations thereof. In some embodiments, the buffer is alkaline. In some embodiments, the buffer has a pH from about 7 to about 10.
EXAMPLES Example 1: One Step Synthesis of gRNA Template and High Efficiency Cell Engineering WorkflowAbstract
CRISPR-Cas9 systems provide innovative applications in genome engineering. To edit the genome, expression of Cas9, mature crRNA and tracrRNA or a single guide RNA (gRNA) is required. Elements of the mature crRNA and tracrRNA or a gRNA are often built into a Cas9 expression plasmid or constructed in a standard plasmid driven by a U6 promoter for mammalian expression. A novel method for the rapid synthesis of gRNA template is described in this example, which combines gene synthesis and DNA fragment assembly technologies with an accuracy of assembly of >96%. In other words, over 96% of the assembled nucleic acid molecules are the desired assembly products. The method allows rapid synthesis of guide RNA (gRNA) via in vitro transcription using short DNA oligonucleotides. In conjunction with Cas9 protein delivery, Cas9/gRNA complexes can be transfected into the cells through processes such as lipid-mediated methods, electroporation, and cell penetrating peptide mediated delivery. Overall, cell engineering workflows can be reduced to at least four days and, in some instances, two days. Methods described herein are applicable for high throughput gRNA synthesis and genome-wide editing.
Introduction
CRISPR-Cas9 mediated genome engineering enables researchers to modify genomic DNA in vivo directly and efficiently. Three components (Cas9, mature crRNA and tracrRNA) are essential for efficient cell engineering. Although the mature crRNA and tracrRNA can be synthesized chemically, the quality of the synthetic RNA is often not sufficient for in vivo cell engineering due, for example, to the presence of truncated by-products. Thus, mature crRNA and tracrRNA or a combined single gRNA are often transcribed from a Cas9 expression plasmid or built into a separate plasmid driven by a U6 promoter. The resulting plasmids are then transfected or co-transfected into the cells. Because the constructs are relatively large, the delivery of plasmid DNA often becomes the limiting step, especially for suspension cells. Recently Cas9 mRNA has employed to increase the rate of DNA cleavage. To make gRNA, a pre-cloned all-in-one plasmid based upon, for example, a vector shown in
Overall, it is time-consuming to prepare the gRNA template for in vitro transcription. A gRNA template can be assembled via PCR in about one hour. Further, gRNA can be generated in vitro transcription in about 3 hours. DNA oligonucleotides can be converted to into gRNA in about 4 hours. A workflow with the above timing elements was tested and. Furthermore, in combination with Cas9 protein transfection technology, cell engineering cycle was accomplished as described herein in four days.
Materials and Methods
Materials
293FT cells, DMEM medium, Fetal Bovine Serum (FBS), O
Methods
One Step Synthesis of gRNA Template
The design of oligonucleotides for the synthesis of gRNA template is depicted in
5′-GTT TTA GAG CTA GAA ATA GCA AG-3′ (SEQ ID NO: 13) and reverse primer:
5′-AAA AGC ACC GAC TCG GTG CCA C-3′ (SEQ ID NO: 14) were used to amplify the 80 bp constant region of tracrRNA from a G
To determine the error rate, the PCR product was cloned into Z
In Vitro Transcription
The in vitro transcription of gRNA template was carried out using T
Expression and Purification of Cas9 Protein
A glycerol stock BL21(DE3) star E. coli strain expressing NLS Cas9 protein was inoculated in 20 ml BRM medium and grown overnight at 37° C. in a shaking incubator. The overnight culture was then added to 1 liter of BRM medium and grown cells to an OD600 nm of 0.6-0.8 at 37° C. in a shaking incubator (˜4-5 hours). An aliquot of un-induced sample was taken for monitoring protein induction with IPTG. 0.5 ml of 1 M IPTG was added to the culture and incubated overnight at room temperature in a shaking incubator. An aliquot of induced sample along with un-induced sample were analyzed by SDS-PAGE. Upon validation of protein induction, the culture medium was centrifuged at 5000 rpm for 15 minutes to harvest the cell pellets (˜24 grams of wet weight). 100 ml of buffer A containing 20 mM Tris (pH7.5), 100 mM NaCl, 10% Glycerol, and 1 mM PMSF was used to resuspend the cell pellet. The cell suspension was sonicated on ice for 30 minutes with power level of medium tip set at 8, 10 sec “on”, and 20 sec “off”. The cell lysate was clarified by centrifugation at 16500 rpm for 30 minutes. The supernatant was filtered through a 0.2 μm filter device prior to loading to a 16 ml heparin column previously equilibrated with buffer A at a flow rate of 2 ml/min. The column was first washed with five column volume of buffer A and then gradually increased to 40% of buffer B containing 20 mM Tris (pH7.5), 1.2 M NaCl and 10% glycerol. The Cas9 protein was eluted with a 5 CV gradient from 40% to 100% buffer B. The fractions were analyzed by SDS-PAGE. Fractions containing Cas9 protein were combined and concentrated using two 15 ml Amicon Centrifugal filter units (EMD Millipore, Cat. No. UFC905024). The concentrated protein was filtered through a 0.2 μm filter device and loaded twice onto a 120 ml of H
Cell Culture
293FT cells were maintained in DMEM medium supplemented with 10% FBS in a 5% CO2 incubator. One day prior to transfection, the cells were seeded in a 24-well plate at a cell density of 2.5×105 cells/0.5 ml medium. For transfection, 500 ng of purified Cas9 was added to 25 μl of O
Results and Discussion
One Step Synthesis of gRNA Template
Since gRNA synthesis is one of the limiting steps in genome engineering, an attempt was made to reduce the time for gRNA synthesis. As an example, HPRT-T1 target catttctcagtcctaaaca (SEQ ID NO: 17) was chosen, but these methods were also found to work for GFP and VEGFA-T3 targets (data not shown). Initially, a gene synthesis approach was utilized to assemble a gRNA template using a set of 6 synthetic DNA oligonucleotides (Set 1 oligonucleotides in Table 8). Through optimization of oligonucleotide pool concentration and PCR condition, a clean PCR product was obtained on an agarose gel (data not shown). An aliquot of the PCR product served as template to synthesize the gRNA via in vitro transcription. The quality of synthetic gRNA was analyzed by a denaturing gel.
To test the functionality of synthetic gRNA, gRNA was associated with Cas9 protein. The resulting complexes were then delivered to the 293FT cells via lipid-based transfection. However, the evaluation of in vivo genome cleavage assay indicated that gRNA did not work well (data not shown). To determine the problem, gRNA templates were cloned into a Z
As described in Materials and Methods, the gRNA template was assembled in a single PCR reaction using a pool of DNA oligonucleotides and tracrRNA fragment (
To examine in vivo functionality of synthesized gRNA, the Cas9 protein from E. coli was expressed and purified. The Cas9 protein was pre-incubated with synthetic gRNA to form the complexes prior to cell transfection. The gRNA prepared from an all-in-one plasmid served as a positive control. The genome modification was examined by Genome Cleavage and Detection assay. As depicted in Gel Image B of
Because the 80 bp tracrRNA contains a polyT at the 3′ end, there was a possibility that the Poly T had no effect on genome editing. To test this, serial deletions of PolyT at the 3′ end of gRNA (set 3 oligos in Table 8) were made. Based on in vivo genome cleavage assay, removal of the PolyT at 3′ end of gRNA appeared to have no effect on the performance of gRNA. The addition of three extra Ts at the 3′ end also did not affect the functionality of gRNA either (data not shown).
The standard T7 promoter sequence “taatacgactcactataggg” (SEQ ID NO: 18) contains GGG at the 3′ end, which is thought to be essential for maximal production of gRNA via in vitro transcription. However, because the transcription starts from the first G, three extra G will be added to the gRNA sequence assuming the target does not have a G at the 5′ end, which might affect the functionality of gRNA. To examine this, the AAVS target ccagtagccagccccgtcc (SEQ ID NO: 19) and the IP3R2 target tcgtgtccctgtacgcgga (SEQ ID NO: 20) were chosen and G deletions at the 3′ end of T7 promoter were made (see
In conclusion, compositions and methods provided herein related to gRNA synthesis and associated workflows allow for four day cell engineering. On Day 1, the biologists (1) design and (2) synthesize or order short DNA oligonucleotides and seed the cells of interest. On Day 2, the biologists prepare the gRNA template by one pot PCR, followed by in vitro transcription for making gRNA. Upon association of gRNA with purified Cas9 protein, the Cas9 protein/gRNA complexes are transfected into the cells via lipid-mediated method or electroporation. On Day 4, the biologists harvest the cells to analyze genome modification. Thus, the invention provides compositions and methods related to improve workflows for genome engineering. In some aspects, these workflows allow for the genome modification experiments to occur in four days from concept to completion.
Abstract
CRISPR-Cas9 systems provide a platform for high efficiency genome editing that are enabling innovative applications of mammalian cell engineering. However, the delivery of Cas9 and synthesis of guide RNA (gRNA) remain as steps that can limit overall efficiency and general ease of use. Described here are methods for rapid synthesis of gRNA and for delivery of Cas9 protein/gRNA ribonucleoprotein complexes (Cas9 RNPs) into a variety of mammalian cells through liposome-mediated transfection or electroporation. Using these methods, nuclease-mediated indel rates of up to 94% in Jurkat T cells and 87% in induced pluripotent stem cells (iPSC) for a single target are reported. When this approach is used for multigene targeting in Jurkat cells, it was found that two-locus and three-locus indels were achieved in approximately 93% and 65% of the resulting isolated cell lines, respectively. Further, in this study, it was found that the off-target cleavage rate is significantly reduced using Cas9 protein when compared to plasmid DNA transfection. Taken together, a streamlined cell engineering workflow is presented that enables gRNA design to analysis of edited cells in as little as four days and results in highly efficient genome modulation in hard-to-transfect cells. The reagent preparation and delivery to cells requires no plasmid manipulation, and is thus amenable to high throughput, multiplexed genome-wide cell engineering.
Introduction
CRISPR-Cas9 mediated genome engineering enables researchers to modify genomic DNA in vivo directly and efficiently (Cho et al., “Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease,” Nat. Biotechnol. 31:230-232 (2013); Mali et al., “RNA-guided human genome engineering via Cas9,” Science 339:823-826 (2013); Jiang et al., “RNA-guided editing of bacterial genomes using CRISPR-Cas systems,” Nat. Biotechnol. 31:233-239 (2013); Wang et al., “One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering,” Cell 153:910-918 (2013)). Three components (Cas9, mature crRNA and tracrRNA) are essential for functional activity. Although the mature crRNA and tracrRNA can be synthesized chemically, the quality of the synthetic RNA is not sufficient for in vivo cell engineering due to the presence of truncated by-products (data not shown). Therefore, templates for the mature crRNA and tracrRNA or a combined single gRNA are often cloned into a Cas9 expression plasmid or built into separate plasmids driven by either U6 or H1 promoters for transcription after transfection of mammalian cells. Because the constructs are relatively large, delivery rates can be low, which would limit genomic cleavage efficiency, especially for hard-to-transfect cells. Recently, the use of Cas9 delivered as mRNA has led to increases in the rate of genomic cleavage in some cells. For example, a mixture of Cas9 mRNA and a single species of gRNA were co-injected into mouse embryonic stem (ES) cells resulting in biallelic mutations in 95% of newborn mice (Wang et al., “One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering,” Cell 153:910-918 (2013)). To make guide RNA, often precloned plasmid is used directly or a linear template is created via PCR amplification of the targeting sequence from a plasmid. If a 5′ T7 promoter does not appear in the plasmid, it is often added at this step and the resulting PCR product can be used in an in vitro transcription reaction. Alternatively, a synthetic DNA fragment containing a T7 promoter, crRNA and tracerRNA can be used as a template to prepare a gRNA by in vitro transcription. Overall, these represent a labor-intensive and time-consuming workflow, which led us to seek a simpler method to synthesize high quality gRNA. To that, describe here is a streamlined modular approach for gRNA production in vitro. Starting with two short single stranded oligos, the gRNA template is assembled in a ‘one pot’ PCR reaction. The product is then used as template in an in vitro transcription (IVT) reaction which is followed by a rapid purification step, yielding transfection-ready gRNA in as little as four hours.
To streamline the cell engineering workflow further, it was sought to eliminate any remaining cellular transcription or translation by directly introducing Cas9/gRNA ribonucleoprotein (RNP) complexes directly to the cells. Microinjection of Cas9 protein and gRNA complexes into C. elegans was first described in 2013 (Cho et al., “Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9-sgRNA ribonucleoproteins,” Genetics 195:1177-1180 (2013)) and was subsequently used to generate gene-knockout mice and zebrafish with mutation rates of up to 93% in newborn mice (Sung et al., “Highly efficient gene knockout in mice and zebrafish with RNA-guided endonucleases,” Genome Res. 24:125-131 (2014)). Following that report, Cas9 protein/gRNA complexes were delivered into cultured human fibroblasts and induced pluripotent stem cells (iPSC) via electroporation with high efficiency and relatively low off-target effects (Kim et al., “Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins” Genome Res. 24:1012-1019 (2014)). In that study, a large amount of Cas9 protein (4.5 to 45 μg) and gRNA (6 to 60 μg) were necessary for efficient genome modification (up to 79% indel efficiency). Most recently, delivery of Cas9 protein-associated gRNA complexes via liposomes was reported, in which RNAiMAX was used to deliver Cas9:sgRNA nuclease complexes into cultured human cells and into the mouse inner ear in vivo with up to 80% and 20% genome modification efficiency respectively (Zuris et al., “Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo” Nat Biotechnol. October 30. doi: 10.1038/nbt.3081 (2014)).
The CRISPR/Cas system has been demonstrated as an efficient gene-targeting tool for multiplexed genome editing (Wang et al., “One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering,” Cell 153:910-918 (2013); Kabadi et al., “Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector” Nucleic Acids Res. October 29; 42(19):e147. doi: 10.1093/nar/gku749 (2014); Sakuma et al., “Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system,” Sci Rep. June 23; 4:5400. doi: 10.1038/srep05400 (2014); Cong et al., “Multiplex genome engineering using CRISPR/Cas systems. Science. 339: 819-823 (2013)). For example, co-transfections of mouse ES cells with constructs expressing Cas9 and three sgRNAs targeting Tet1, 2, and 3 resulted in 20% of cells having mutations in all six alleles of the three genes based on restriction fragment length polymorphism (RFLP) assay (Wang et al., “One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering,” Cell 153:910-918 (2013)). Lentiviral delivery of a single vector expressing Cas9 and four sgRNAs into primary human dermal fibroblasts resulted in about 30% simultaneous editing of four genomic loci among ten clonal populations based upon genomic cleavage detection assays (Kabadi et al., “Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector” Nucleic Acids Res. October 29; 42(19):e147. doi: 10.1093/nar/gku749 (2014)). In one recent study, ‘all-in-one’ expression vectors containing seven guide RNA expression cassettes and a Cas9 nuclease/nickase expression cassette were delivered into 293T cells with genome cleavage efficiency ranging from 4 to 36% for each individual target (Sakuma et al., “Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system,” Sci Rep. June 23; 4:5400. doi: 10.1038/srep05400 (2014)). In general, the efficiency of editing multiple genes in the human genome using plasmid-based delivery methods remains relatively low which subsequently increases the workload for downstream clonal isolation.
An in vitro gRNA production system has been developed and used a systematic approach to optimize the conditions for delivery of Cas9:gRNA complexes via lipid-mediated transfection or electroporation. A variety of mammalian cell lines were tested, including primary cells and other hard-to-transfect cells. Plasmid DNA, mRNA and Cas9 protein transfections were evaluated side by side. Using Cas9 protein transfection via electroporation, a superior genome editing efficiencies even in hard-to-transfect cells was achieved. In addition, the genome editing of multiple targets simultaneously using the Cas9 RNPs delivery system were assessed and are described here. It was found that delivery of Cas9 RNPs not only led to high indel production at single locus, but supports highly efficient biallelic modulation of at least two genes in a single transfection.
Materials and Methods
Materials: 293FT cells, The Gibco® Human Episomal iPSC Line, DMEM medium, RPMI 1640 medium, IMDM, DMEM/F-12, Fetal Bovine Serum (FBS), Knockout™ Serum Replacement, Non-Essential Amino Acid solution, basic fibroblast growth factor, Collagenase IV, TrypLE™ Express Enzyme, Geltrex, Opti-MEM Medium, FluoroBrite™ DMEM, Lipofectamine 2000, Lipofectamine 3000, RNAiMAX, Lipofectamine® MessengerMAX, GeneArt® CRISPR Nuclease Vector with OFP Reporter, 2% E-Gel® EX Agarose Gels, PureLink® PCR Micro Kit, TranscriptAid T7 High Yield Transcription Kit, MEGAclear™ Transcription Clean-Up Kit, Zero Blunt® TOPO® PCR Cloning Kit, PureLink® Pro Quick96 Plasmid Purification Kit, Endotoxin Quantitation Kit, Qubit® RNA BR Assay Kit, TRA-1-60 Alexa Fluor® 488 conjugated antibodies, SSEA4 Alexa Fluor®647, and Phusion Flash High-Fidelity PCR Master Mix were from Thermo Fisher Scientific. Jurkat T cells and K562 cells were obtained from the American Type Culture Collection (ATCC). MEF feeder cells and ROCK inhibitor Y-27632 were purchased from EMD Millipore. Monoclonal Cas9 antibody was ordered from Diagenode. Recombinant Cas9 protein was purified as described by Kim et al. (7). All oligonucleotides used for gRNA synthesis were from Thermo Fisher Scientific (Supplementary Table 1s).
One Step Synthesis of gRNA Template
The 80 nt constant region of tracrRNA from a GeneArt® CRISPR Nuclease Vector was amplified by PCR and purified via agarose gel extraction. The concentration of PCR product was measured by Nanodrop (Thermo Fisher Scientific) and the molarity was calculated based on the molecular weight of 49.6 kDa. To prepare a pool of oligonucleotides, an aliquot of the 80 nt PCR product was mixed with two end primers and target-specific forward and reverse primers, with a final concentration of 0.15 μM for the 80 nt PCR product and 10 μM for each of the end primers. For a specific target, a 34 nt forward primer consisting of the T7 promoter sequence and 5′ end target sequence, and a 34 nt reverse primer consisting of the target sequence and 5′ end tracrRNA sequence were chemically synthesized with a 15 nt overlap. To set up the synthesis of gRNA template, aliquots of the pooled oligonucleotides were added to a Phusion Flash High-Fidelity PCR Master Mix and amplified using manufacturer's recommended reaction conditions. The PCR product was analyzed by a 2% E-Gel® EX Agarose Gel, followed by purification using Purelink PCR micro column. The gRNA template was eluted with 13 μl water and the concentration was determined by Nanodrop instrument.
To determine the error rate, the PCR product was cloned into Zero Blunt® TOPO® vector, followed by plasmid DNA isolation and sequencing with a 3500xl DNA analyzer (Thermo Fisher Scientific).
In Vitro Transcription
The in vitro transcription of gRNA template was carried out using TranscriptAid T7 High Yield Transcription Kit using the manufacturer's recommended conditions. The gRNA product was purified using MEGAclear™ Transcription Clean-Up kit as described in the manual. The concentration of RNA was determined using Qubit® RNA BR Assay Kit.
Cell Culture
HEK 293FT cells were maintained in DMEM medium supplemented with 10% FBS. Jurkat T cells were propagated in RPMI medium containing 10% FBS, whereas K562 cells were cultured in IMDM medium supplemented with 10% FBS. Feeder-dependent human episomal iPSC were cultured on mitotically inactivated MEF feeder cells in human ESC (hESC) media containing 20% Knockout™ Serum Replacement, 10 μM Non-Essential Amino Acid solution, 55 μM 2-Mercaptoethanol, and 4 ng/ml basic fibroblast growth factor in DMEM/F-12. All cultures were maintained in a 5% CO2, 37° C. humidified incubator. iPSC cultures were maintained with daily media changes and were passaged regularly using Collagenase IV.
Lipid-Mediated Cell Transfection
One day prior to transfection, the cells were seeded in a 24-well plate at a cell density of 2.5×105 cells per well. For plasmid DNA transfection, 0.5 μg DNA was added to 25 μl of Opti-MEM medium, followed by addition of 25 μl of Opti-MEM containing 2 μl of Lipofectamine 2000. The mixture was incubated at room temperature for 15 minutes and then added to the cells. For Cas9 mRNA transfection, 0.5 μg Cas9 mRNA (Thermo Fisher Scientific) was added to 25 μl of Opti-MEM, followed by addition of 50-100 ng gRNA. Meanwhile, 2 μl of Lipofectamine 3000 was diluted into 25 μl of Opti-MEM and then mixed with mRNA/gRNA sample. The mixture was incubated for 15 minutes prior to addition to the cells. For Cas9 protein transfection, 500 ng of purified Cas9 protein (Thermo Fisher Scientific) was added to 25 μl of Opti-MEM medium, followed by addition of 120 ng gRNA. The molar ratio of gRNA over Cas9 protein was approximately 1:1.2. The sample was mixed by gently tapping the tubes a few times and then incubated at room temperature for 10 minutes. To a separate test tube, 2 μl of RNAiMAX or Lipofectamine 3000 was added to 25 μl of Opti-MEM medium. The diluted transfection reagent was transferred to the tube containing Cas9 protein/gRNA complexes, followed by incubation at room temperature for 15 minutes. The entire solution was then added to the cells in a 24-well plate and mixed by gently swirling the plate. The plate was incubated at 37° C. for 48 hours in a 5% CO2 incubator. The percentage of locus-specific indel formation was measured by GeneArt® Genomic Cleavage Detection Kit. The band intensities were quantitated using built-in software in Alpha Imager (Bio-Rad).
Electroporation
For suspension cells, such as Jurkat T cells or K562 cells, 2×105 cells were used per electroporation using Neon® Transfection System 10 μL Kit (Thermo Fisher Scientific). To maximize the genome cleavage efficiency, the Neon 24 optimized protocol was applied according to the manufacturer's instruction. To set up a master mix, 24 μg of purified Cas9 protein was added to 240 μL of Resuspension Buffer R provided in the kit, followed by addition of 4.8 μg of gRNA. The mixture was incubated at room temperature for 10 minutes. Meanwhile, 4.8×106 cells were transferred to a sterile test tube and centrifuged at 500×g for 5 minutes. The supernatant was aspirated and the cell pellet was resuspended in 1 ml of PBS without Ca2+ and Mg2+. Upon centrifugation, the supernatant was carefully aspirated so that almost all the PBS buffer was removed with no or minimum loss of cells. The Resuspension Buffer R containing the Cas9 protein/gRNA complexes was then used to resuspend the cell pellets. A 10 μl cell suspension was used for each of the 24 optimized conditions, which varied in pulse voltage, pulse width and the number of pulses. The electroporated cells were transferred immediately to a 24 well containing 0.5 ml of the corresponding growth medium and then incubated for 48 hours in a 5% CO2 incubator. The cells were harvested by centrifugation and then washed once with PBS, followed by Genomic Cleavage and Detection assay as described by the manual. Upon optimization of electroporation condition, a higher amount of Cas9 protein (1.5 to 2 μg) and gRNA (300 to 400 ng) could be applied to further increase the genome editing efficiency. For each target in the multiplexing assays, 1 to 2 μg of Cas9 protein and 200-400 ng of gRNA were pre-incubated separately prior to mixing with cell pellet for electroporation. For clonal isolation, the cell number of transfected cells was counted upon 48 hour incubation, followed by a serial of dilution to 96 well plates with a cell density of 10-20 cells per plate based on the cell count. After clonal expansion for three weeks, cells from each individual well were harvested, followed by PCR amplification of the target locus. The PCR fragments were then cloned using a TOPO vector and transformed into TOP10 competent cells. Approximately 8 E. coli colonies were randomly picked for sequencing for each individual target locus. The single cell population was determined by the homogeneity of sequences for each allele. Single cells containing bi-allelic mutations on all desired targets were considered homozygotic indels. Downstream sequence analysis to confirm frame-shift induced stop codon introduction was not done.
For transfection of feeder free adaptation of iPSC, feeder dependent iPSC were grown to 80% confluency prior to harvest with collagenase. Following removal of the cell clusters from the feeder layer, they were gravity sedimented to prevent MEF contamination. The cell clusters were then seeded on to tissue culture dishes coated with Geltrex® in MEF conditioned media supplemented with 4 ng/mL bFGF. MEF conditioned media was produced using inactivated feeder cells, which was harvested on 7 continuous days, sterile filtered and frozen until usage. The cultures were allowed to reach 80-90% confluence. The day prior to transfection, the cultures were pretreated with 5 μM ROCK inhibitor Y-27632. On the day of harvest the cultures were inspected for signs of differentiation and any contamination differentiated cells were removed via micro-dissection. The cultures were washed once with DPBS and then harvested using TrypLE™ Express Enzyme. Single cells suspensions were counted using the Countess® automated cell counter. Following transfections, the cells were seeded onto multi-well (24 well) tissue culture dish coated with Geltrex® and incubated overnight with MEF conditioned media containing 5 μM ROCK. Media was replaced daily, without ROCK inhibitor, prior to analysis.
Cell Surface Immunostaining
To ensure maintenance of pluripotency post transfection and genome editing, iPSC cells were tested for expression of cell surface markers of self-renewal. The wells to be probed were washed with DMEM/F12 basal media. TRA-1-60 Alexa Fluor® 488 conjugated antibodies and SSEA4 Alexa Fluor®647 were multiplexed in basal DMEM/F-12 media. Both antibodies were added at a concentration of 2 μl of each antibody into 0.5 mL of pre-warmed DMEM/F-12 media and incubated at 37° C. for 45 minutes. Following the incubation, the antibody solution was removed and the wells were washed twice with DMEM/F-12. Prior to observation the media was exchanged with pre-warmed FluoroBrite™ DMEM. Images were taken using a Zeiss Axiovision microscope using a FITC and Cy5 laser/filter combination.
Analysis of Pluripotency Markers
Cultures were detached and dissociated using TrypLE™ Select and trituration. Single cell suspensions were incubated with TRA-1-60 Alexa Fluor® 488 conjugated antibodies and SSEA4 Alexa Fluor®647 for 1 hour at room temperature with gentle agitation. Two microliters (50×) of each antibody were added to 0.5 mL of DMEM/F-12. Following the incubation, the cells were centrifuged and washed once with Dulbecco's Phosphate-Buffered Saline (DPBS). After the removal of the DPBS wash, the pelleted cells were gently resuspended in 1 mL of DPBS and stained through a strainer capped tube. The cells were then measured for the expression of both markers using the A
Western Blot Analysis
293FT cells were transfected with either plasmid DNA, mRNA or Cas9 protein as described above. Cells were harvested at indicated times to perform both Genome Cleavage and Detection assay and Western Blot analysis. The cell lysate was fractionated using a 4-12% Novex Bis-tris gel. The proteins were transferred to a PVDF membrane using an iBlot following the manufacturer's protocol. Upon blocking, the membrane was incubated for 2 hours with monoclonal mouse Cas9 antibody at 1:3000 dilution. After washing, the membrane was incubated for 1 hour with rabbit anti-mouse antibody-HRP conjugate at 1:2000 dilution. Upon extensive washing, the membrane was developed with Pierce ECL reagent, followed by imaging using a Fuji imager LAS 4000 instrument.
Results
Three Day Cell Engineering Workflow
To streamline the genome engineering workflow, it was sought to simplify the gRNA synthesis procedure and shorten the time from experimental design to initial analysis as much as possible. Presented herein is a process where on day 1, the researcher designs and orders short DNA oligonucleotides and seeds the cells of interest for next day transfection (
To assemble the DNA template for gRNA production, a total of 4 synthetic DNA oligonucleotides and a purified PCR product representing the constant (non-targeting) crRNA region and tracrRNA sequence (gRNA lacking target sequence) are used (
Liposome-Mediated Cas9 Protein Transfection
To examine the activity of synthetic gRNA, pre-complexed purified synthetic IVT gRNA with Cas9 protein were produced. It was hypothesizing that creating complexes of purified gRNAs with Cas9 protein prior to delivery to the cells might lead to higher genome editing efficiency due to the protection of the gRNA as it transits to the nucleus during the transfection process. To examine in vivo functionality of the system, human embryonic kidney (HEK293) cells were transfected with pre-complexed Cas9/gRNA ribonucleoproteins (Cas9 RNPs) using a set of cationic lipid reagents, followed by a genomic cleavage detection assay. Interestingly, the commonly-used plasmid DNA or RNA transfection reagents were able to efficiently deliver Cas9 RNPs. Lipofectamine 3000 and RNAiMAX outperformed Lipofectamine 2000 in HEK 293 cells (data not shown), which is in agreement with the recent finding that RNAiMAX performed better than Lipofectamine 2000 for delivery of Cas9 mRNA (Zuris et al., “Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo” Nat Biotechnol. October 30. doi: 10.1038/nbt.3081 (2014)). For protein transfection, serum-free medium is generally used to avoid serum protein inference. In this study however, it was observed that the complete medium containing 10% FBS facilitated protein transfection and genome modification (
Next examined was the kinetics of genome cleavage by transfecting cells with either plasmid DNA, mRNA or Cas9 RNPs, followed by genome cleavage assays and Western Blot analysis of cell lysates. In this study, it was observed similar cleavage kinetics between Cas9 delivered as plasmid DNA, mRNA and protein with efficient cleavage seen at 24 hours plateauing at 48 to 72 hours post-transfection in HEK293 cells (
Because of the difference in protein appearance and apparent turnover rates, it was hypothesized that the off-target cleavage activity for Cas9 RNP transfection would be lower than that of plasmid DNA transfection. This was tested by targeting a locus in the VEGFA gene which has been identified as having several high activity off-target sites (Tsai et al., “GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases,” Nat Biotechnol. doi:10.1038/nbt.3117 (2014)) via DNA, mRNA, and Cas9 RNP protein transfection followed by genome cleavage and locus sequencing analysis. Among the six potential off-target sites that have been studied previously (OT3-1, OT3-2, OT3-4, OT3-9, OT3-17 and OT3-18), only OT3-2 and OT3-18 were detected to harbor off-target mutation based on genome cleavage analysis. Further analysis of locus OT3-2 by sequencing indicated that the ratio of indel mutation of OT3-2 over on target in mRNA and Cas9 RNP transfected cells was 2 fold and 2.5 fold lower than that in DNA-transfected cells, respectively. The ratio of indel mutation of OT3-18 over on on-target was 1.6 fold and 28 fold lower in mRNA or Cas9 RNP-transfected cells respectively than in DNA-transfected cells (
Electroporation-Mediated Cas9 Protein Transfection
Many biologically and physiologically relevant cell lines, such as patient derived iPSC and progenitor cells, are refractory to efficient transfection by lipid-based reagents. Any improvement in the efficiency of genome modulation would facilitate isolation of appropriately engineered cells for experimentation and therapy so alternate means of delivering Cas9 RNPs and Cas9 mRNA/gRNA formulations and their effect on indel generation were explored. Using Jurkat T cells as an initial model, the delivery of Cas9 and gRNA plasmid DNA, Cas9 mRNA/gRNA formulations and Cas9 RNPs were compared using microporation (described in Materials and Methods, data not shown). Our results showed that, compared with plasmid DNA and mRNA deliveries, superior genome editing efficiency was achieved via delivery of Cas9 RNPs with approximately 90% HPRT locus-specific modification under several electroporation conditions (
Discussion
The ability to easily modulate the sequence specificity of the Cas9 nuclease by simply changing the 20 nucleotide targeting sequence of the gRNA offers significant versatility in delivery options over other nucleases that have been utilized for genome editing, such as zinc finger nucleases and TAL effectors. Now, researchers are able to choose from cost-effective and rapid design options by formulating the nuclease as either plasmid DNA, pre-made mRNA or purified protein. The design versatility is enabled by rapid production of the guide RNA component. Until recently, the gRNA was generally produced via cloning of a template sequence into a plasmid vector or vectors and expressing the Cas9 and gRNA in vivo. Described here is a streamlined protocol where gRNA design and template construction is facilitated by synthesis of two short single stranded oligonucleotides. The oligonucleotides are incorporated into gRNA templates via a short PCR reaction followed by conversion to gRNA by in vitro transcription. Target-specific oligos can be designed, ordered, and converted to purified gRNA in as little as two days. On the second day, the gRNA is formulated with either Cas9 mRNA or protein, and immediately used to transfect cells. The entire process consists completely of liquid handling and enzymatic reaction steps, which make it amenable to higher throughput gRNA production and transfection in multi-well plates.
The streamlined gRNA workflow was compared across the three delivery options and found that in general, Cas9/gRNA ribonucleoprotein complexes (Cas9 RNPs) offered superior indel production efficiency in most of the cell lines was used as a test bed. It is currently not clear why Cas9 RNP and total RNA formulations perform as they do but a factor could be overall size of the lipid complexes, the ability of Cas9 protein to protect the gRNA from cellular degradation, and the elimination of DNA-based cellular toxicity. In relation to plasmid delivery, Cas9 introduced as a Cas9 RNP or mRNA appears in the cell at low but evidently functional levels and is cleared rapidly which could also reduce the opportunity for off-target binding and cleavage. The data presented above suggests that this could be the case but a significantly more detailed evaluation is needed for confirmation.
Much progress has been made to reduce or eliminate off-target cleavage in CRISPR systems, such as use of paired Cas9 nickases and dimeric ‘dead Cas9’ FokI fusions, which has been shown to reduce off-target activity by 50- to 1,500-fold (Tsai et al., “GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases,” Nat Biotechnol. doi:10.1038/nbt.3117 (2014); Fu et al., “High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells,” Nat. Biotechnol. 31:822-826 (2013)). Perhaps delivery of these tools via Cas9 RNPs would lead to even higher specificity while retaining high activity levels.
In this work, it was shown that it is possible to multiplex three Cas9 RNP species targeting separate loci in Jurkat T cells while achieving high levels indel production at all three loci. Further, it was observed high rates of biallelic modification at two diploid alleles (AAVS1 and RelA) in these experiments even when also modifying a haploid locus (HPRT) at similarly high levels. Taken together, the high rates of biallelic modification in cell populations suggest that employing Cas9 RNP delivery would significantly simplify the workflow by facilitating the selection of multigene knockout cell lines from a single experiment.
A survey was performed of eleven commonly used mammalian cell lines comparing CRISPR delivery via plasmid, Cas9 mRNA/gRNA, and Cas9 RNP (Table 11) and found that Cas9 mRNA/gRNA or Cas9 RNPs were superior to plasmid delivery in all cell lines tested. Delivery of these reagents via microporation offered the highest target-specific indel production under the conditions tested. In all but one case (NHEK cells), Cas9 RNP out performed Cas9 mRNA/gRNA and in human CD34+ cord blood cells, Cas9 RNP delivered via microporation was the only method that yielded a significantly robust editing solution.
Described here is a streamlined approach to the mammalian genome engineering workflow that takes as few three days to modify mammalian genomes from CRISPR target design to evaluation of genome editing. To achieve a high mutagenesis efficiency in hard-to-transfect cells, a systematic approach was used to optimize transfection conditions and compare delivery of CRISPR editing tools via plasmid DNA, Cas9 mRNA/purified guide RNA (gRNA) formulations, and pre-complexed Cas9 protein and gRNA ribonucleoproteins (Cas9 RNPs). It was found Cas9 mRNA/gRNA and Cas9 RNP performance superior to ‘all-in-one’ plasmid DNA constructs in the variety of cell lines analyzed in this work. Most likely due to the high efficiency of Cas9 RNP delivery, it was possible to efficiently modify the genome at multiple loci simultaneously, thereby reducing the workload for downstream clonal isolation in schemes where more than one gene knock-out is desired. Further, it was found that delivery of Cas9 RNPs to cell lines considered hard to transfect (Jurkat, iPSC, CD4+) via electroporation yielded high levels of locus specific modification.
While the foregoing embodiments have been described in some detail for purposes of clarity and understanding, it will be clear to one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the embodiments disclosed herein. For example, all the techniques, apparatuses, systems and methods described above can be used in various combinations.
Claims
1. A method for producing a nucleic acid molecule, the method comprising performing polymerase chain reaction (PCR) in a reaction mixture containing (i) a double-stranded nucleic acid segment and (ii) at least one oligonucleotide capable of hybridizing to nucleic acid at one terminus of the double-stranded nucleic acid segment,
- wherein the nucleic acid molecule is produced by the PCR reaction, and
- wherein the product nucleic acid molecule contains at or near one terminus a promoter suitable for in vitro transcription.
2. The method of claim 1, wherein the nucleic acid molecule produced by the PCR reaction encodes an RNA molecule from 35 to 150 nucleotides in length.
3. The method of claim 1, wherein the nucleic acid molecule produced by the PCR reaction is from 70 to 150 base pairs in length.
4. The method of claim 1, wherein the nucleic acid molecule is produced by the PCR reaction encodes an RNA molecule with at least two hairpin turns.
5. The method of claim 1, wherein the nucleic acid molecule is produced by the PCR reaction encodes a CRISPR RNA.
6. The method of claim 5, wherein the nucleic acid molecule is produced by the PCR reaction encodes a guide RNA.
7.-26. (canceled)
27. A ligated RNA molecule comprising two RNA regions that differ in nucleotide sequence connected by a ligation group, wherein the ligated RNA molecule is capable of binding to a Cas9 protein and has a region of sequence complementarity of at least 10 nucleotides to a target locus.
28. The ligated RNA molecule of claim 27, wherein one region is composed of a crRNA molecule and the other region is a tracrRNA molecule.
29. A method of making the ligated RNA molecule of claim 27, the method comprising covalently linking a crRNA molecule and a tracrRNA molecule.
30. A method for gene editing at a target locus within a cell, the method comprising forming an intracellular complex comprising a Cas9 protein and the ligated RNA molecule of claim 27, under conditions that allow for cleavage of the target locus.
31. A method for performing homologous recombination in a cell, the method comprising:
- (a) introducing into the cell a nucleic acid cutting entity capable of generating a double-stranded break at a specified location in a nucleic acid molecule present inside a cell to produce a cleaved nucleic acid molecule, and
- (b) introducing a donor nucleic acid molecule into the cell,
- wherein step (a) is performed before step (b) or wherein step (b) is performed before step (a).
32. The method of claim 31, wherein the introduction of the nucleic acid cutting entity or the donor nucleic acid molecule into the cell is mediated by electroporation.
33. The method of claim 31, wherein the donor nucleic acid molecule is double-stranded and has either blunt termini or 5′ overhangs.
34. The method of claim 31, wherein the donor nucleic acid molecule is single stranded.
35. The method of claim 31, wherein the donor nucleic acid molecule contains one or more nuclease resistant group at one or both termini.
Type: Application
Filed: May 21, 2021
Publication Date: Feb 3, 2022
Inventors: Namritha RAVINDER (San Diego, CA), Korbinian HEIL (Munich), Yizhu GUO (Chatsworth, CA), Xiquan LIANG (Escondido, CA), Robert POTTER (San Marcos, CA), Sanjay KUMAR (Carlsbad, CA)
Application Number: 17/327,002