MODULATORS OF YAP1 EXPRESSION

Abstract

The present embodiments provide methods, compounds, and compositions useful for inhibiting YAP1 expression, which may be useful for treating, preventing, or ameliorating a cancer associated with YAP1.

Description

SEQUENCE LISTING

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0352USC1SEQ_ST25.txt created Nov. 9, 2021, which is 814 kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

FIELD

The present embodiments provide methods, compounds, and compositions useful for inhibiting YAP1 expression, which can be useful for treating, preventing, or ameliorating a cancer associated with YAP1.

BACKGROUND

Yes-associated protein (YAP1) is a transcriptional coactivator that is frequently activated in multiple human cancer types due to alterations in the tumor suppressive ‘Hippo’ pathway or its amplification. YAP1 is the downstream regulator of the Hippo pathway and promotes tumor growth through both tumor autonomous and immune-regulatory mechanisms. An active Hippo pathway is tumor suppressive and phosphorylates YAP1, resulting in its inactivation. When the Hippo pathway is inactive, YAP1 is dephosphorylated and translocated into the nucleus where it promotes expression of multiple genes.

SUMMARY

Certain embodiments provided herein are directed to potent and tolerable compounds and compositions useful for inhibiting YAP1 expression, which can be useful for treating, preventing, ameliorating, or slowing progression of cancer associated with YAP1.

DETAILED DESCRIPTION

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the embodiments, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank and NCBI reference sequence records are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

It is understood that the sequence set forth in each SEQ ID NO contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Compounds described by ION number indicate a combination of nucleobase sequence, chemical modification, and motif.

Unless otherwise indicated, the following terms have the following meanings:

“2′-deoxynucleoside” means a nucleoside comprising 2′-H(H) furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2′-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).

“2′-O-methoxyethyl” (also 2′-MOE and 2′-O(CH₂)₂—OCH₃) refers to an O-methoxy-ethyl modification at the 2′ position of a furanosyl ring. A 2′-O-methoxyethyl modified sugar is a modified sugar.

“2′-MOE nucleoside” (also 2′-O-methoxyethyl nucleoside) means a nucleoside comprising a 2′-MOE modified sugar moiety.

“2′-substituted nucleoside” or “2-modified nucleoside” means a nucleoside comprising a 2′-substituted or 2′-modified sugar moiety. As used herein, “2′-substituted” or “2-modified” in reference to a sugar moiety means a sugar moiety comprising at least one 2′-substituent group other than H or OH.

“3′ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 3′-most nucleotide of a particular compound.

“5′ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 5′-most nucleotide of a particular compound.

“5-methylcytosine” means a cytosine with a methyl group attached to the 5 position.

“About” means within ±10% of a value. For example, if it is stated, “the compounds affected about 70% inhibition of YAP1”, it is implied that YAP1 levels are inhibited within a range of 60% and 80%.

“Administration” or “administering” refers to routes of introducing a compound or composition provided herein to an individual to perform its intended function. An example of a route of administration that can be used includes, but is not limited to parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.

“Administered concomitantly” or “co-administration” means administration of two or more compounds in any manner in which the pharmacological effects of both are manifest in the patient. Concomitant administration does not require that both compounds be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive. Concomitant administration or co-administration encompasses administration in parallel or sequentially.

“Amelioration” refers to an improvement or lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. In certain embodiments, amelioration includes a delay or slowing in the progression or severity of one or more indicators of a condition or disease. The progression or severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.

“Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

“Antibody,” as used in this disclosure, refers to an immunoglobulin or a fragment or a derivative thereof, and encompasses any polypeptide comprising an antigen-binding site, regardless of whether it is produced in vitro or in vivo. The term includes, but is not limited to, polyclonal, monoclonal, monospecific, polyspecific, non-specific, humanized, single-chain, chimeric, synthetic, recombinant, hybrid, mutated, and grafted antibodies. Unless otherwise modified by the term “intact,” as in “intact antibodies,” for the purposes of this disclosure, the term “antibody” also includes antibody fragments such as Fab, F(ab′)2, Fv, scFv, Fd, dAb, and other antibody fragments that retain antigen-binding function, i.e., the ability to bind, for example, CTLA-4 or PD-L1 specifically. Typically, such fragments would comprise an antigen-binding domain.

“Anti-CTLA-4 antibody” refers to an antibody or antigen binding fragment thereof that specifically binds a CTLA-4 polypeptide. Exemplary anti-CTLA-4 antibodies are described for example at U.S. Pat. Nos. 6,682,736; 7,109,003; 7,123,281; 7,411,057; 7,824,679; 8,143,379; 7,807,797; and 8,491,895 (Tremelimumab is 11.2.1, therein), which are herein incorporated by reference. Tremelimumab (U.S. Pat. No. 6,682,736) is an exemplary anti-CTLA-4 antibody. Tremelimumab VL, VH, and CDR amino acid sequences are provided at SEQ ID NOs: 1-8, herein.

“Anti-OX40 antibody” refers to an antibody or antigen binding fragment thereof that specifically binds OX40. OX40 antibodies include monoclonal and polyclonal antibodies that are specific for OX40 and antigen-binding fragments thereof. In certain aspects, anti-OX40 antibodies as described herein are monoclonal antibodies (or antigen-binding fragments thereof), e.g., murine, humanized, or fully human monoclonal antibodies. In one particular embodiment, the OX40 antibody is an OX40 receptor agonist, such as the mouse anti-human OX40 monoclonal antibody (9B12) described by Weinberg et al., J Immunother 29, 575-585 (2006). In another embodiment, an OX40 antibody is MEDI0562 as described in US 2016/0137740, incorporated herein by reference. MEDI0562 VH and VL amino acid sequences are provided at SEQ ID NOs: 25-26, herein. In other embodiments, the antibody which specifically binds to OX40, or an antigen-binding fragment thereof, binds to the same OX40 epitope as mAb 9B12.

“Anti-PD-L1 antibody” refers to an antibody or antigen binding fragment thereof that specifically binds a PD-L1 polypeptide. Exemplary anti-PD-L1 antibodies are described for example at US2013/0034559, U.S. Pat. Nos. 8,779,108 and 9,493,565 which are herein incorporated by reference. Durvalumab (MEDI4736) is an exemplary anti-PD-L1 antibody. Durvalumab VL, VH, and CDR amino acid sequences are provided at SEQ ID NOs: 9-16, herein. Other anti-PD-L1 antibodies include BMS-936559 (Bristol-Myers Squibb) and MPDL3280A (atezolizumab) (Roche).

“Anti-PD-1 antibody” refers to an antibody or antigen binding fragment thereof that specifically binds a PD-1 polypeptide. Exemplary anti-PD-1 antibodies are described for example at U.S. Pat. Nos. 7,521,051; 8,008,449; 8,354,509; 9,073,994; 9,393,301; 9,402,899; and 9,439,962, which are herein incorporated by reference. Exemplary anti-PD-1 antibodies include, without limitation, nivolumab, pembrolizumab, pidilizumab, and AMP-514.

“Antigen-binding domain,” “antigen-binding fragment,” and “binding fragment” refer to a part of an antibody molecule that comprises amino acids responsible for the specific binding between the antibody and the antigen. In instances, where an antigen is large, the antigen-binding domain may only bind to a part of the antigen. A portion of the antigen molecule that is responsible for specific interactions with the antigen-binding domain is referred to as “epitope” or “antigenic determinant.” An antigen-binding domain typically comprises an antibody light chain variable region (VL) and an antibody heavy chain variable region (VH), however, it does not necessarily have to comprise both. For example, a so-called Fd antibody fragment consists only of a VH domain, but still retains some antigen-binding function of the intact antibody. Binding fragments of an antibody are produced by recombinant DNA techniques, or by enzymatic or chemical cleavage of intact antibodies. Binding fragments include Fab, Fab′, F(ab′)2, Fv, and single-chain antibodies. An antibody other than a “bispecific” or “bifunctional” antibody is understood to have each of its binding sites identical. Digestion of antibodies with the enzyme, papain, results in two identical antigen-binding fragments, known also as “Fab” fragments, and a “Fc” fragment, having no antigen-binding activity but having the ability to crystallize. Digestion of antibodies with the enzyme, pepsin, results in the a F(ab′)2 fragment in which the two arms of the antibody molecule remain linked and comprise two-antigen binding sites. The F(ab′)2 fragment has the ability to crosslink antigen. “Fv” when used herein refers to the minimum fragment of an antibody that retains both antigen-recognition and antigen-binding sites. “Fab” when used herein refers to a fragment of an antibody that comprises the constant domain of the light chain and the CH1 domain of the heavy chain.

“mAb” refers to monoclonal antibody. Antibodies of the present disclosure comprise without limitation whole native antibodies, bispecific antibodies; chimeric antibodies; Fab, Fab′, single chain V region fragments (scFv), fusion polypeptides, and unconventional antibodies.

“Antisense activity” means any detectable and/or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound to the target.

“Antisense compound” means a compound comprising an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, oligonucleotides, ribozymes, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.

“Antisense inhibition” means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.

“Antisense mechanisms” are all those mechanisms involving hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.

“Antisense oligonucleotide” means an oligonucleotide having a nucleobase sequence that is complementary to a target nucleic acid or region or segment thereof. In certain embodiments, an antisense oligonucleotide is specifically hybridizable to a target nucleic acid or region or segment thereof.

“Bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety. “Bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

“Branching group” means a group of atoms having at least 3 positions that are capable of forming covalent linkages to at least 3 groups. In certain embodiments, a branching group provides a plurality of reactive sites for connecting tethered ligands to an oligonucleotide via a conjugate linker and/or a cleavable moiety.

“Cell-targeting moiety” means a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.

“cEt” or “constrained ethyl” means a bicyclic furanosyl sugar moiety comprising a bridge connecting the 4′-carbon and the 2′-carbon, wherein the bridge has the formula: 4′-CH(CH₃)—O-2′.

“cEt nucleoside” means a nucleoside comprising a cEt modified sugar moiety.

“Chemical modification” in a compound describes the substitutions or changes through chemical reaction, of any of the units in the compound relative to the original state of such unit. “Modified nucleoside” means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase. “Modified oligonucleotide” means an oligonucleotide comprising at least one modified internucleoside linkage, a modified sugar, and/or a modified nucleobase.

“Chemically distinct region” refers to a region of a compound that is in some way chemically different than another region of the same compound. For example, a region having 2′-O-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2′-O-methoxyethyl modifications.

“Chimeric antisense compounds” means antisense compounds that have at least 2 chemically distinct regions, each position having a plurality of subunits.

“Chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more sterorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.

“Cleavable bond” means any chemical bond capable of being split. In certain embodiments, a cleavable bond is selected from among: an amide, a polyamide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, a di-sulfide, or a peptide.

“Cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.

“Complementary” in reference to an oligonucleotide means the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions. Nucleobase matches or complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methyl cytosine (^mC) and guanine (G) unless otherwise specified. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. By contrast, “fully complementary” or “100% complementary” in reference to oligonucleotides means that such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.

“Conjugate group” means a group of atoms that is attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

“Conjugate linker” means a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

“Conjugate moiety” means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

“Contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.

“Designing” or “Designed to” refer to the process of designing a compound that specifically hybridizes with a selected nucleic acid molecule.

“Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition can be a liquid, e.g. saline solution.

“Differently modified” means chemical modifications or chemical substituents that are different from one another, including absence of modifications. Thus, for example, a MOE nucleoside and an unmodified DNA nucleoside are “differently modified,” even though the DNA nucleoside is unmodified. Likewise, DNA and RNA are “differently modified,” even though both are naturally-occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified. For example, a nucleoside comprising a 2′-OMe modified sugar and an unmodified adenine nucleobase and a nucleoside comprising a 2′-OMe modified sugar and an unmodified thymine nucleobase are not differently modified.

“Dose” means a specified quantity of a compound or pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in two or more boluses, tablets, or injections. For example, in certain embodiments, where subcutaneous administration is desired, the desired dose may require a volume not easily accommodated by a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain embodiments, a dose may be administered in two or more injections to minimize injection site reaction in an individual. In other embodiments, the compound or pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week or month.

“Dosing regimen” is a combination of doses designed to achieve one or more desired effects.

“Double-stranded antisense compound” means an antisense compound comprising two oligomeric compounds that are complementary to each other and form a duplex, and wherein one of the two said oligomeric compounds comprises an oligonucleotide.

“Effective amount” means the amount of compound sufficient to effectuate a desired physiological outcome in an individual in need of the compound. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.

“Efficacy” means the ability to produce a desired effect.

“Expression” includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to, the products of transcription and translation.

“Gapmer” means an oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.”

“Hybridization” means the annealing of oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target.

“Immediately adjacent” means there are no intervening elements between the immediately adjacent elements of the same kind (e.g. no intervening nucleobases between the immediately adjacent nucleobases).

“Individual” means a human or non-human animal selected for treatment or therapy.

“Inhibiting the expression or activity” refers to a reduction or blockade of the expression or activity relative to the expression of activity in an untreated or control sample and does not necessarily indicate a total elimination of expression or activity.

“Internucleoside linkage” means a group or bond that forms a covalent linkage between adjacent nucleosides in an oligonucleotide. “Modified internucleoside linkage” means any internucleoside linkage other than a naturally occurring, phosphate internucleoside linkage. Non-phosphate linkages are referred to herein as modified internucleoside linkages.

“Lengthened oligonucleotides” are those that have one or more additional nucleosides relative to an oligonucleotide disclosed herein, e.g. a parent oligonucleotide.

“Linked nucleosides” means adjacent nucleosides linked together by an internucleoside linkage.

“Linker-nucleoside” means a nucleoside that links an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of a compound. Linker-nucleosides are not considered part of the oligonucleotide portion of a compound even if they are contiguous with the oligonucleotide.

“Mismatch” or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned. For example, nucleobases including but not limited to a universal nucleobase, inosine, and hypoxanthine, are capable of hybridizing with at least one nucleobase but are still mismatched or non-complementary with respect to nucleobase to which it hybridized. As another example, a nucleobase of a first oligonucleotide that is not capable of hybridizing to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned is a mismatch or non-complementary nucleobase.

“Modulating” refers to changing or adjusting a feature in a cell, tissue, organ or organism. For example, modulating YAP1 RNA can mean to increase or decrease the level of YAP1 RNA and/or YAP1 protein in a cell, tissue, organ or organism. A “modulator” effects the change in the cell, tissue, organ or organism. For example, a YAP1 compound can be a modulator that decreases the amount of YAP1 RNA and/or YAP1 protein in a cell, tissue, organ or organism.

“MOE” means methoxyethyl.

“Monomer” refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides.

“Motif” means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.

“Natural” or “naturally occurring” means found in nature.

“Non-bicyclic modified sugar” or “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

“Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.

“Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid. As used herein a “naturally occurring nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). A “modified nucleobase” is a naturally occurring nucleobase that is chemically modified. A “universal base” or “universal nucleobase” is a nucleobase other than a naturally occurring nucleobase and modified nucleobase, and is capable of pairing with any nucleobase.

“Nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage.

“Nucleoside” means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. “Modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase.

“Oligomeric compound” means a compound comprising a single oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.

“Oligonucleotide” means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another. Unless otherwise indicated, oligonucleotides consist of 8-80 linked nucleosides. “Modified oligonucleotide” means an oligonucleotide, wherein at least one sugar, nucleobase, or internucleoside linkage is modified. “Unmodified oligonucleotide” means an oligonucleotide that does not comprise any sugar, nucleobase, or internucleoside modification.

“Parent oligonucleotide” means an oligonucleotide whose sequence is used as the basis of design for more oligonucleotides of similar sequence but with different lengths, motifs, and/or chemistries. The newly designed oligonucleotides may have the same or overlapping sequence as the parent oligonucleotide.

“Parenteral administration” means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.

“Pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to an individual. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution, such as PBS or water-for-injection.

“Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds or oligonucleotides, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

“Pharmaceutical agent” means a compound that provides a therapeutic benefit when administered to an individual.

“Pharmaceutical composition” means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise one or more compounds or salt thereof and a sterile aqueous solution.

“Phosphorothioate linkage” means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom. A phosphorothioate internucleoside linkage is a modified internucleoside linkage.

“Phosphorus moiety” means a group of atoms comprising a phosphorus atom. In certain embodiments, a phosphorus moiety comprises a mono-, di-, or tri-phosphate, or phosphorothioate.

“Portion” means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an oligomeric compound.

“Prevent” refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely.

“Prodrug” means a compound in a form outside the body which, when administered to an individual, is metabolized to another form within the body or cells thereof. In certain embodiments, the metabolized form is the active, or more active, form of the compound (e.g., drug). Typically conversion of a prodrug within the body is facilitated by the action of an enzyme(s) (e.g., endogenous or viral enzyme) or chemical(s) present in cells or tissues, and/or by physiologic conditions.

“Reduce” means to bring down to a smaller extent, size, amount, or number.

“RefSeq No.” is a unique combination of letters and numbers assigned to a sequence to indicate the sequence is for a particular target transcript (e.g., target gene). Such sequence and information about the target gene (collectively, the gene record) can be found in a genetic sequence database. Genetic sequence databases include the NCBI Reference Sequence database, GenBank, the European Nucleotide Archive, and the DNA Data Bank of Japan (the latter three forming the International Nucleotide Sequence Database Collaboration or INSDC).

“Region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.

“RNAi compound” means an antisense compound that acts, at least in part, through RISC or Ago2, but not through RNase H, to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.

“Segments” are defined as smaller or sub-portions of regions within a nucleic acid.

“Side effects” means physiological disease and/or conditions attributable to a treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise. For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver function abnormality.

“Single-stranded” in reference to a compound means the compound has only one oligonucleotide. “Self-complementary” means an oligonucleotide that at least partially hybridizes to itself. A compound consisting of one oligonucleotide, wherein the oligonucleotide of the compound is self-complementary, is a single-stranded compound. A single-stranded compound may be capable of binding to a complementary compound to form a duplex.

“Sites” are defined as unique nucleobase positions within a target nucleic acid.

“Specifically hybridizable” refers to an oligonucleotide having a sufficient degree of complementarity between the oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids. In certain embodiments, specific hybridization occurs under physiological conditions.

“Specifically inhibit” with reference to a target nucleic acid means to reduce or block expression of the target nucleic acid while exhibiting fewer, minimal, or no effects on non-target nucleic acids. Reduction does not necessarily indicate a total elimination of the target nucleic acid's expression.

“Standard cell assay” means assay(s) described in the Examples and reasonable variations thereof.

“Standard in vivo experiment” means the procedure(s) described in the Example(s) and reasonable variations thereof.

“Stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

“Sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. “Unmodified sugar moiety” or “unmodified sugar” means a 2′-OH(H) furanosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2′-H(H) moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties have one hydrogen at each of the 1′, 3′, and 4′ positions, an oxygen at the 3′ position, and two hydrogens at the 5′ position. “Modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate. “Modified furanosyl sugar moiety” means a furanosyl sugar comprising a non-hydrogen substituent in place of at least one hydrogen of an unmodified sugar moiety. In certain embodiments, a modified furanosyl sugar moiety is a 2′-substituted sugar moiety. Such modified furanosyl sugar moieties include bicyclic sugars and non-bicyclic sugars.

“Sugar surrogate” means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary compounds or nucleic acids.

“Synergy” or “synergize” refers to an effect of a combination that is greater than additive of the effects of each component alone at the same doses.

“YAP1” means any nucleic acid or protein of YAP1. “YAP1 nucleic acid” means any nucleic acid encoding YAP1. For example, in certain embodiments, a YAP1 nucleic acid includes a DNA sequence encoding YAP1, an RNA sequence transcribed from DNA encoding YAP1 (including genomic DNA comprising introns and exons), and an mRNA sequence encoding YAP1. “YAP1 mRNA” means an mRNA encoding a YAP1 protein. The target may be referred to in either upper or lower case.

“YAP1 specific inhibitor” refers to any agent capable of specifically inhibiting YAP1 RNA and/or YAP1 protein expression or activity at the molecular level. For example, YAP1 specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of YAP1 RNA and/or YAP1 protein.

“Target gene” refers to a gene encoding a target.

“Targeting” means the specific hybridization of a compound to a target nucleic acid in order to induce a desired effect.

“Target nucleic acid,” “target RNA,” “target RNA transcript” and “nucleic acid target” all mean a nucleic acid capable of being targeted by compounds described herein.

“Target region” means a portion of a target nucleic acid to which one or more compounds is targeted.

“Target segment” means the sequence of nucleotides of a target nucleic acid to which a compound is targeted. “5′ target site” refers to the 5′-most nucleotide of a target segment. “3′ target site” refers to the 3′-most nucleotide of a target segment.

“Terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.

“Therapeutically effective amount” means an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to an individual.

“Treat” refers to administering a compound or pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal.

Certain Embodiments

Certain embodiments provide methods, compounds and compositions for inhibiting YAP1 expression.

Certain embodiments provide compounds targeted to a YAP1 nucleic acid. In certain embodiments, the YAP1 nucleic acid has the sequence set forth in RefSeq or GENBANK Accession No. NM_001282101.1 (SEQ ID NO: 1) or NC_000011.10 truncated from nucleotides 102107001 to 102236000 (SEQ ID NO: 2), each of which is incorporated by reference in its entirety. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 9 to 80 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 80 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 11 to 80 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 11 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 12 to 80 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 12 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide comprises an at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 2565-2580, 2566-2581, or 4600-4615 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide comprises an at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 123590-123605, 117330-117345, 117761-117776, 117757-117772, 117758-117773, 117330-117345, 119672-119687, 123591-123606, 125625-125640, or 117755-117770 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is complementary within nucleotides 2565-2580, 2566-2581, or 4600-4615 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is complementary within nucleotides 123590-123605, 117330-117345, 117761-117776, 117757-117772, 117758-117773, 117330-117345, 119672-119687, 123591-123606, 125625-125640, or 117755-117770 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide comprises an at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion of any one of the nucleobase sequences of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

In certain embodiments, a compound targeted to YAP1 is ION 1198440. Out of over 3,000 compounds that were screened as described in the Examples section below, ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872 emerged as the top lead compounds. In particular, ION 1198440 exhibited the best combination of properties in terms of potency and tolerability out of over 3,000 compounds.

In certain embodiments, any of the foregoing modified oligonucleotides has at least one modified internucleoside linkage, at least one modified sugar, and/or at least one modified nucleobase.

In certain embodiments, at least one nucleoside of any of the foregoing modified oligonucleotides comprises a modified sugar. In certain embodiments, the modified sugar comprises a 2′-O-methoxyethyl group. In certain embodiments, the modified sugar is a bicyclic sugar, such as a 4′-CH(CH₃)—O-2′ group, a 4′-CH₂—O-2′ group, or a 4′-(CH₂)₂—O-2′ group.

In certain embodiments, at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage, such as a phosphorothioate internucleoside linkage.

In certain embodiments, at least one nucleobase of the foregoing modified oligonucleotides is a modified nucleobase, such as 5-methylcytosine.

In certain embodiments, any of the foregoing modified oligonucleotides has:

• • a gap segment consisting of linked 2′-deoxynucleosides;
  • a 5′ wing segment consisting of linked nucleosides; and
  • a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 80 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides and has a nucleobase sequence consisting of the nucleobase sequence recited in any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 23-2940, wherein the modified oligonucleotide has:

• • a gap segment consisting of linked 2′-deoxynucleosides;
  • a 5′ wing segment consisting of linked nucleosides; and
  • a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863, wherein the modified oligonucleotide has:

• • a gap segment consisting of linked 2′-deoxynucleosides;
  • a 5′ wing segment consisting of linked nucleosides; and
  • a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 810 and 1404, wherein the modified oligonucleotide has:

• • a gap segment consisting often linked 2′-deoxynucleosides;
  • a 5′ wing segment consisting of three linked nucleosides; and
  • a 3′ wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NO: 2868, wherein the modified oligonucleotide has a gapmer consisting of a 5′-region, a 3′-region, and a central region positioned between the 5′-region and the 3′-region wherein:

the 5′-region consists of 3 linked modified nucleosides, wherein each nucleoside of the 5′-region comprises a cEt nucleoside;

the 3′-region consists of 3 linked modified nucleosides, wherein each nucleoside of the 3′-region comprises a cEt nucleoside;

the central region consists of 10 linked nucleosides, wherein the second nucleoside from the 5′ end of the central region comprises a 2′-O-methyl modified sugar moiety and the first and third through tenth nucleosides from the 5′ end of the central region each comprises a 2′ deoxynucleoside;

wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NO: 2868; wherein the modified oligonucleotide comprises the sugar motif kkk-d-y-d(8)-kkk, wherein “k” indicates a cEt modified sugar moiety, “d” indicates an unmodified 2′-deoxyribosyl sugar moiety, and “y” indicates a 2′-O-methyl modified sugar moiety; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of ION 1197270 having the nucleobase sequence and chemical motif: TksTksAksAdsAysGdsTdsGdsTdsAdsTdsGdsTdsmCksAksGk, wherein “d” represents a 2′-deoxyribose sugar, “k” represents a cEt modified sugar, “y” represents a 2′-O-methyl sugar, “s” represents a phosphorothioate internucleoside linkage, and “mC” refers to a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NO: 2864, wherein the modified oligonucleotide has:

a gap segment consisting often linked 2′-deoxynucleosides;

a 5′ wing segment consisting of one linked nucleoside; and

a 3′ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NOs: 1404 or 1101, wherein the modified oligonucleotide has:

a gap segment consisting of nine linked 2′-deoxynucleosides;

a 5′ wing segment consisting of three linked nucleosides; and

a 3′ wing segment consisting of four linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a cEt nucleoside, a cEt nucleoside, and a 2′-O-methoxyethyl nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NO: 2812, wherein the modified oligonucleotide has:

a gap segment consisting of nine linked 2′-deoxynucleosides;

a 5′ wing segment consisting of three linked nucleosides; and

a 3′ wing segment consisting of four linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein the 3′ wing segment comprises a 2′-O-methoxyethyl nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NOs: 1200 or 2863, wherein the modified oligonucleotide has:

a gap segment consisting of nine linked 2′-deoxynucleosides;

a 5′ wing segment consisting of two linked nucleosides; and

a 3′ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NO: 2865, wherein the modified oligonucleotide has:

a gap segment consisting often linked 2′-deoxynucleosides;

a 5′ wing segment consisting of one linked nucleoside; and

a 3′ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

Certain embodiments provide a modified oligonucleotide, wherein the anion form of the modified oligonucleotide has the following chemical structure:

or a salt thereof.

Certain embodiments provide a modified oligonucleotide according to the following chemical structure:

or a salt thereof.

Certain embodiments provide a modified oligonucleotide according to the following chemical structure:

Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. Unless otherwise indicated, an oligonucleotide described herein and the term “oligonucleotide” are intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or a salt thereof” expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with a cation. In certain instances, one or more specific cation is identified.

In any of the foregoing embodiments, the compound or oligonucleotide can be at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to a nucleic acid encoding YAP1.

In any of the foregoing embodiments, the compound can be single-stranded. In certain embodiments, the compound comprises deoxyribonucleotides. In certain embodiments, the compound is double-stranded. In certain embodiments, the compound is double-stranded and comprises ribonucleotides. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

In any of the foregoing embodiments, the compound can consist of 8 to 80, 10 to 30, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked nucleosides. In certain embodiments, the compound comprises or consists of an oligonucleotide.

In certain embodiments, compounds or compositions provided herein comprise a salt of the modified oligonucleotide. In certain embodiments, the salt is a sodium salt. In certain embodiments, the salt is a potassium salt.

In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having at least one of an increase an alanine transaminase (ALT) or aspartate transaminase (AST) value of no more than 4 fold, 3 fold, or 2 fold over saline treated animals or an increase in liver, spleen, or kidney weight of no more than 30%, 20%, 15%, 12%, 10%, 5%, or 2% compared to control treated animals.

In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase of ALT or AST over control treated animals. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase in liver, spleen, or kidney weight over control animals.

Certain embodiments provide a composition comprising the compound of any of the aforementioned embodiments or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition has a viscosity less than about 40 centipoise (cP), less than about 30 centipose (cP), less than about 20 centipose (cP), less than about 15 centipose (cP), or less than about 10 centipose (cP). In certain embodiments, the composition having any of the aforementioned viscosities comprises a compound provided herein at a concentration of about 100 mg/mL, about 125 mg/mL, about 150 mg/mL, about 175 mg/mL, about 200 mg/mL, about 225 mg/mL, about 250 mg/mL, about 275 mg/mL, or about 300 mg/mL. In certain embodiments, the composition having any of the aforementioned viscosities and/or compound concentrations has a temperature of room temperature or about 20° C., about 21° C., about 22° C., about 23° C., about 24° C., about 25° C., about 26° C., about 27° C., about 28° C., about 29° C., or about 30° C.

Non-limiting numbered embodiments include:

E1. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940.

E2. A compound comprising a modified oligonucleotide 9 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940.

E3. A compound comprising a modified oligonucleotide 10 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940.

E4. A compound comprising a modified oligonucleotide 11 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940.

E5. A compound comprising a modified oligonucleotide 12 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940.

E6. A compound comprising a modified oligonucleotide consisting of 16 to 80 linked nucleosides having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940.

E7. A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940.

E8. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides complementary within nucleotides 2565-2580, 2566-2581, or 4600-4615 of SEQ ID NO: 1 or within nucleotides 123590-123605, 117330-117345, 117761-117776, 117757-117772, 117758-117773, 117330-117345, 119672-119687, 123591-123606, 125625-125640, or 117755-117770 of SEQ ID NO: 2.

E9. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

E10. A compound comprising a modified oligonucleotide 9 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

E11. A compound comprising a modified oligonucleotide 10 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

E12. A compound comprising a modified oligonucleotide 11 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

E13. A compound comprising a modified oligonucleotide 12 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

E14. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides having a nucleobase sequence comprising any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

E15. A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

E16. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides having a nucleobase sequence comprising any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

E17. A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.

E18. The compound of any one of embodiments E1-E17, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar, or at least one modified nucleobase.

E19. The compound of embodiment E18, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

E20. The compound of embodiment E18 or E19, wherein the modified sugar is a bicyclic sugar.

E21. The compound of embodiment E20, wherein the bicyclic sugar is selected from the group consisting of: 4′-(CH₂)—O-2′ (LNA); 4′-(CH₂)₂—O-2′ (ENA); and 4′-CH(CH₃)—O-2′ (cEt).

E22. The compound of embodiment E18 or E19, wherein the modified sugar is 2′-O-methoxyethyl.

E23. The compound of any one of embodiments E18-E22, wherein the modified nucleobase is a 5-methylcytosine.

E24. The compound of any one of embodiments E1-E23, wherein the modified oligonucleotide comprises:

a gap segment consisting of linked 2′-deoxynucleosides;

a 5′ wing segment consisting of linked nucleosides; and

a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

E25. A compound comprising a modified oligonucleotide consisting of 16 to 80 linked nucleosides having a nucleobase sequence comprising any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863, wherein the modified oligonucleotide comprises:

• • a gap segment consisting of linked 2′-deoxynucleosides;
  • a 5′ wing segment consisting of linked nucleosides; and
  • a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

E26. A compound comprising a modified oligonucleotide consisting of 16-80 linked nucleobases having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 810 and 1404, wherein the modified oligonucleotide comprises:

a gap segment consisting of ten linked 2′-deoxynucleosides;

a 5′ wing segment consisting of three linked nucleosides; and

a 3′ wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.

E27. A compound comprising a modified oligonucleotide consisting of 16-80 linked nucleobases having a nucleobase sequence comprising the sequence recited in SEQ ID NOs: 2864, wherein the modified oligonucleotide comprises:

a gap segment consisting often linked 2′-deoxynucleosides;

a 5′ wing segment consisting of one linked nucleoside; and

a 3′ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.

E28. A compound comprising a modified oligonucleotide consisting of 16-80 linked nucleobases having a nucleobase sequence comprising the sequence recited in SEQ ID NO: 2868, wherein the modified oligonucleotide comprises a gapmer consisting of a 5′-region, a 3′-region, and a central region positioned between the 5′-region and the 3′-region wherein:

• • the 5′-region consists of 3 linked modified nucleosides, wherein each nucleoside of the 5′-region comprises a cEt nucleoside;

the 3′-region consists of 3 linked modified nucleosides, wherein each nucleoside of the 3′-region comprises a cEt nucleoside;

the central region consists of 10 linked nucleosides, wherein the second nucleoside from the 5′ end of the central region comprises a 2′-O-methyl modified sugar moiety and the first and third through tenth nucleosides from the 5′ end of the central region each comprises a 2′ deoxynucleoside;

wherein each internucleoside linkage is a phosphorothioate linkage; and

wherein each cytosine is a 5-methylcytosine.

E29. A compound comprising a modified oligonucleotide consisting of 16-80 linked nucleobases having a nucleobase sequence comprising the sequence recited in SEQ ID NOs: 1200 or 2863, wherein the modified oligonucleotide comprises:

a gap segment consisting of nine linked 2′-deoxynucleosides;

a 5′ wing segment consisting of two linked nucleosides; and

a 3′ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.

E30. A compound comprising or consisting of a modified oligonucleotide consisting of 16-80 linked nucleobases having a nucleobase sequence comprising the sequence recited in SEQ ID NO: 2865, wherein the modified oligonucleotide comprises:

a gap segment consisting of ten linked 2′-deoxynucleosides;

a 5′ wing segment consisting of one linked nucleoside; and

a 3′ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.

E31. The compound of any one of embodiments E1-E30, wherein the oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of SEQ ID NOs: 1-10.

E32. The compound of any one of embodiments E1-E31, wherein the compound is single-stranded.

E33. The compound of any one of embodiments E1-E31, wherein the compound is double-stranded.

E34. The compound of any one of embodiments E1-E33, wherein the compound comprises ribonucleotides.

E35. The compound of any one of embodiments E1-E33, wherein the compound comprises deoxyribonucleotides.

E36. The compound of any one of embodiments E1-E35, wherein the modified oligonucleotide consists of 16 to 30 linked nucleosides.

E37. The compound of any preceding embodiment E1-E36, wherein the compound consists of the modified oligonucleotide.

E38. A compound consisting of a pharmaceutically acceptable salt of any of the compounds of embodiments E1-E36.

E39. The compound of embodiment E38, wherein the pharmaceutically acceptable salt is a sodium salt.

E40. The compound of embodiment E38, wherein the pharmaceutically acceptable salt is a potassium salt.

E41. A compound having the formula:

or a salt thereof.

E42. A compound having the formula:

E43. A composition comprising the compound of any one of embodiments E1-E42 and a pharmaceutically acceptable diluent or carrier.

E44. A composition comprising the compound of any one of embodiments E1-E42 and water.

E45. A composition comprising a compound or modified oligonucleotide of any preceding embodiment E1-E44, for use in therapy.

E46. A combination comprising the compound of any one of embodiments E1-E42 or the composition of any of embodiments E43-E45 and a secondary agent.

E47. The combination of embodiment E46, wherein the secondary agent is a CDK4/6 inhibitor.

E48. The combination of embodiment E47, wherein the CDK4/6 inhibitor is palbociclib, ribociclib, or abemaciclib.

E49. The combination of embodiment E46, wherein the secondary agent is an EGFR inhibitor.

E50. The combination of embodiment E49, wherein the EGFR inhibitor is cetuximab, necitumumab, panitumumab, vandetanib, dacomitinib, neratinib, osimertinib, gefitinib, lapatinib, or erlotinib.

E51. The combination of embodiment E46, wherein the secondary agent is a kinase inhibitor.

E52. The combination of embodiment E51, wherein the kinase inhibitor is sorafenib, regorafenib, or carbozantinib.

E53. A method of treating or ameliorating cancer in an individual comprising administering to the individual a compound targeted to YAP1, thereby treating or ameliorating the cancer.

E54. The method of embodiment E53, wherein the compound is an antisense compound targeted to YAP1.

E55. The method of embodiment E53 or E54, further comprising administering a secondary agent.

E56. The method of embodiment E55, wherein the secondary agent is a CDK4/6 inhibitor.

E57. The method of embodiment E56, wherein the CDK4/6 inhibitor is palbociclib, ribociclib, or abemaciclib.

E58. The method of embodiment E55, wherein the secondary agent is an EGFR inhibitor.

E59. The method of embodiment E58, wherein the EGFR inhibitor is cetuximab, necitumumab, panitumumab, vandetanib, dacomitinib, neratinib, osimertinib, gefitinib, lapatinib, or erlotinib.

E60. The method of embodiment E55, wherein the secondary agent is a kinase inhibitor.

E61. The method of embodiment E60, wherein the kinase inhibitor is sorafenib, regorafenib, or carbozantinib.

E62. The method of any of embodiments E53-E61, wherein the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, or a cancer having a heterozygous FAT1 gene mutation, a squamous cell carcinoma (SCC) having a mutant FAT1 gene, a head and neck squamous cell carcinoma (HNSCC) having a mutant FAT1 gene, an oral tongue squamous cell carcinoma (OTSCC) having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.

E63. The method of any of embodiments E53-E62, wherein administering the compound inhibits or reduces cancer cell proliferation, tumor growth, or metastasis.

E64. A method of inhibiting expression of YAP1 in a cell comprising contacting the cell with a compound targeted to YAP1, thereby inhibiting expression of YAP1 in the cell.

E65. The method of embodiment E64, wherein the cell a cancer cell.

E66. The method of embodiment E65, wherein the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, or a cancer having a heterozygous FAT1 gene mutation, a squamous cell carcinoma (SCC) having a mutant FAT1 gene, a head and neck squamous cell carcinoma (HNSCC) having a mutant FAT1 gene, an oral tongue squamous cell carcinoma (OTSCC) having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.

E67. A method of reducing or inhibiting cancer cell proliferation, tumor growth, or metastasis in an individual having cancer comprising administering a compound targeted to YAP1 to the individual, thereby reducing or inhibiting cancer cell proliferation, tumor growth, or metastasis in the individual.

E68. The method of embodiment E67, wherein the individual has hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, or a cancer having a heterozygous FAT1 gene mutation, a squamous cell carcinoma (SCC) having a mutant FAT1 gene, a head and neck squamous cell carcinoma (HNSCC) having a mutant FAT1 gene, an oral tongue squamous cell carcinoma (OTSCC) having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.

E69. The method of any one of embodiments E64-E68, wherein the compound is an antisense compound targeted to YAP1.

E70. The method of any one of embodiments E64-E69, wherein the compound is the compound of any one of embodiments 1-42 or composition of any one of embodiments 43-45.

E71. The method of any of embodiments E64-E70, wherein the compound is administered parenterally.

E72. Use of a compound targeted to YAP1 for treating, preventing, or ameliorating a cancer associated with YAP1.

E73. Use of a compound targeted to YAP1 and a secondary agent for treating, preventing, or ameliorating a cancer associated with YAP1.

E74. The use of embodiment E73, wherein the secondary agent is a CDK4/6 inhibitor.

E75. The use of embodiment E74, wherein the CDK4/6 inhibitor is palbociclib, ribociclib, or abemaciclib.

E76. The use of embodiment E73, wherein the secondary agent is an EGFR inhibitor.

E77. The use of embodiment E76, wherein the EGFR inhibitor is cetuximab, necitumumab, panitumumab, vandetanib, dacomitinib, neratinib, osimertinib, gefitinib, lapatinib, or erlotinib.

E78. The use of embodiment E73, wherein the secondary agent is a kinase inhibitor.

E79. The use of embodiment E78, wherein the kinase inhibitor is sorafenib, regorafenib, or carbozantinib.

E80. The use of any of embodiments E72-E79, wherein the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, or a cancer having a heterozygous FAT1 gene mutation, a squamous cell carcinoma (SCC) having a mutant FAT1 gene, a head and neck squamous cell carcinoma (HNSCC) having a mutant FAT1 gene, an oral tongue squamous cell carcinoma (OTSCC) having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.

E81. The use of any of embodiments E72-E80, wherein the compound is an antisense compound targeted to YAP1.

E82. The use of any of embodiments E72-E81, wherein the compound is the compound of any one of embodiments E1-E42 or composition of any one of embodiments E43-E45.

E83. Use of a compound targeted to YAP1 in the manufacture of a medicament for treating or ameliorating a cancer associated with YAP1.

E84. The use of embodiment E83, wherein the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, or a cancer having a heterozygous FAT1 gene mutation, a squamous cell carcinoma (SCC) having a mutant FAT1 gene, a head and neck squamous cell carcinoma (HNSCC) having a mutant FAT1 gene, an oral tongue squamous cell carcinoma (OTSCC) having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.

E85. The use of embodiment E83 or E84, wherein the compound is an antisense compound targeted to YAP1.

E86. The use of any one of embodiments E83-E85, wherein the compound is the compound of any one of embodiments 1-42 or composition of any one of embodiments E43-E45.

E87. Use of a compound targeted to YAP1 in the preparation of a medicament for treating or ameliorating a cancer associated with YAP1.

E88. The use of embodiment E87, wherein the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, or a cancer having a heterozygous FAT1 gene mutation, a squamous cell carcinoma (SCC) having a mutant FAT1 gene, a head and neck squamous cell carcinoma (HNSCC) having a mutant FAT1 gene, an oral tongue squamous cell carcinoma (OTSCC) having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.

E89. The use of embodiment E87 or E88, wherein the compound is an antisense compound targeted to YAP1.

E90. The use of any one of embodiments E87-E89, wherein the compound is the compound of any one of embodiments 1-42 or composition of any one of embodiments E43-E45.

Certain Indications

Certain embodiments provided herein relate to methods of inhibiting YAP1 expression, which can be useful for treating, preventing, or ameliorating a cancer associated with YAP1 in an individual, by administration of a compound that targets YAP1. In certain embodiments, the compound can be a YAP1 specific inhibitor. In certain embodiments, the compound can be an antisense compound, oligomeric compound, or oligonucleotide targeted to YAP1.

Examples of cancers associated with YAP1 treatable, preventable, and/or ameliorable with the compounds and methods provided herein include hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma.

In certain embodiments, a method of treating, preventing, or ameliorating a cancer associated with YAP1 in an individual comprises administering to the individual a compound comprising a YAP1 specific inhibitor, thereby treating, preventing, or ameliorating the cancer. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound inhibits or reduces cancer cell proliferation, tumor growth, or metastasis.

In certain embodiments, a method of treating or ameliorating caner comprises administering to the individual a compound comprising a YAP1 specific inhibitor, thereby treating or ameliorating the cancer. In certain embodiments, the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound inhibits or reduces cancer cell proliferation, tumor growth, or metastasis. In certain embodiments, the individual is identified as having or at risk of having a cancer associated with YAP1.

In certain embodiments, a method of inhibiting expression of YAP1 in an individual having, or at risk of having, a cancer associated with YAP1 comprises administering to the individual a compound comprising a YAP1 specific inhibitor, thereby inhibiting expression of YAP1 in the individual. In certain embodiments, administering the compound inhibits expression of YAP1 in a cancer cell in the individual. In certain embodiments, the individual has, or is at risk of having hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound inhibits or reduces cancer cell proliferation, tumor growth, or metastasis. In certain embodiments, the individual is identified as having or at risk of having a cancer associated with YAP1.

In certain embodiments, a method of inhibiting expression of YAP1 in a cell comprises contacting the cell with a compound comprising a YAP1 specific inhibitor, thereby inhibiting expression of YAP1 in the cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a liver cancer cell or squamous cancer cell. In certain embodiments, the cancer cell is in the liver, head, or neck of an individual having cancer. In certain embodiments, the cell is in an individual who has, or is at risk of having cancer, such as hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

In certain embodiments, a method of reducing or inhibiting cancer cell proliferation, tumor growth, or metastasis of an individual having, or at risk of having, a cancer associated with YAP1 comprises administering to the individual a compound comprising a YAP1 specific inhibitor, thereby reducing or inhibiting cancer cell proliferation, tumor growth, or metastasis in the individual. In certain embodiments, the individual has, or is at risk of having, hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, the individual is identified as having or at risk of having a cancer associated with YAP1.

Certain embodiments are drawn to a compound comprising a YAP1 specific inhibitor for use in treating cancer. In certain embodiments, the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

Certain embodiments are drawn to a compound comprising a YAP1 specific inhibitor for use in reducing or inhibiting cancer cell proliferation, tumor growth, or metastasis in an individual having cancer. In certain embodiments, the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

Certain embodiments are drawn to use of a compound comprising a YAP1 specific inhibitor for the manufacture or preparation of a medicament for treating cancer. Certain embodiments are drawn to use of a compound comprising a YAP1 specific inhibitor for the preparation of a medicament for treating a cancer associated with YAP1. In certain embodiments, the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

Certain embodiments are drawn to use of a compound comprising a YAP1 specific inhibitor for the manufacture or preparation of a medicament for reducing or inhibiting cancer cell proliferation, tumor growth, or metastasis in an individual having cancer. In certain embodiments, the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

In any of the foregoing methods or uses, the compound can be targeted to YAP1. In certain embodiments, the compound comprises or consists of a modified oligonucleotide, for example a modified oligonucleotide consisting of 8 to 80 linked nucleosides, 10 to 30 linked nucleosides, 12 to 30 linked nucleosides, or 20 linked nucleosides. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 1-10. In certain embodiments, at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage, at least one nucleoside of the modified oligonucleotide comprises a modified sugar and/or at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage, the modified sugar is a bicyclic sugar or a 2′-O-methoxyethyl, and the modified nucleobase is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide has a gap segment consisting of linked 2′-deoxynucleosides; a 5′ wing segment consisting of linked nucleosides; and a 3′ wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

In any of the foregoing embodiments, the modified oligonucleotide can consist of 12 to 30, 15 to 30, 15 to 25, 15 to 24, 16 to 24, 17 to 24, 18 to 24, 19 to 24, 20 to 24, 19 to 22, 20 to 22, 16 to 20, or 17 or 20 linked nucleosides. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 1-10. In certain embodiments, at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage, at least one nucleoside of the modified oligonucleotide comprises a modified sugar and/or at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage, the modified sugar is a bicyclic sugar or a 2′-O-methoxyethyl, and the modified nucleobase is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide has a gap segment consisting of linked 2′-deoxynucleosides; a 5′ wing segment consisting of linked nucleosides; and a 3′ wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940, wherein the modified oligonucleotide has:

• • a gap segment consisting of linked 2′-deoxynucleosides;
  • a 5′ wing segment consisting of linked nucleosides; and
  • a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863, wherein the modified oligonucleotide has:

• • a gap segment consisting of linked 2′-deoxynucleosides;
  • a 5′ wing segment consisting of linked nucleosides; and
  • a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 810 and 1404, wherein the modified oligonucleotide has:

a gap segment consisting often linked 2′-deoxynucleosides;

a 5′ wing segment consisting of three linked nucleosides; and

a 3′ wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the sequence recited in SEQ ID NO: 2864, wherein the modified oligonucleotide has:

a gap segment consisting often linked 2′-deoxynucleosides;

a 5′ wing segment consisting of one linked nucleoside; and

a 3′ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NOs: 1200 or 2863, wherein the modified oligonucleotide has:

a gap segment consisting of nine linked 2′-deoxynucleosides;

a 5′ wing segment consisting of two linked nucleosides; and

a 3′ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NO: 2865, wherein the modified oligonucleotide has:

a gap segment consisting of ten linked 2′-deoxynucleosides;

a 5′ wing segment consisting of one linked nucleoside; and

a 3′ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In any of the foregoing methods or uses, the compound can be a modified oligonucleotide, wherein the anion form of the modified oligonucleotide has the following chemical structure:

or a salt thereof.

In any of the foregoing methods or uses, the compound can be a modified oligonucleotide according to the following chemical structure:

or a salt thereof.

In any of the foregoing methods or uses, the compound can be a modified oligonucleotide according to the following chemical structure:

In any of the foregoing methods or uses, the compound can be administered parenterally. For example, in certain embodiments the compound can be administered through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.

Certain Combinations and Combination Therapies

In certain embodiments, a first agent comprising a compound described herein is co-administered with one or more secondary agents. In certain embodiments, such second agents are designed to treat the same disease, disorder, or condition as the first agent described herein. In certain embodiments, such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein. In certain embodiments, a first agent is designed to treat an undesired side effect of a second agent. In certain embodiments, second agents are co-administered with the first agent to treat an undesired effect of the first agent. In certain embodiments, such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein. In certain embodiments, second agents are co-administered with the first agent to produce a combinational effect. In certain embodiments, second agents are co-administered with the first agent to produce a synergistic effect. In certain embodiments, the co-administration of the first and second agents permits use of lower dosages than would be required to achieve a therapeutic or prophylactic effect if the agents were administered as independent therapy.

In certain embodiments, one or more compounds or compositions provided herein, such as ION 1198440, are co-administered with one or more secondary agents. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are administered at different times. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are prepared together in a single formulation. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are prepared separately. In certain embodiments, a secondary agent is selected from: CDK4/6 inhibitors including but not limited to palbociclib, ribociclib, or abemaciclib; EGFR inhibitors including but not limited to cetuximab, necitumumab, panitumumab, vandetanib, dacomitinib, neratinib, osimertinib, gefitinib, lapatinib, or erlotinib; or kinase inhibitors including but not limited to sorafenib, regorafenib, or carbozantinib.

Certain embodiments are directed to the use of a compound targeted to YAP1 as described herein, such as ION 1198440, in combination with a secondary agent. In particular embodiments such use is in a method of treating a patient suffering from cancer including, but not limited to, hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, a secondary agent is selected from: CDK4/6 inhibitors including but not limited to palbociclib, ribociclib, or abemaciclib; EGFR inhibitors including but not limited to cetuximab, necitumumab, panitumumab, vandetanib, dacomitinib, neratinib, osimertinib, gefitinib, lapatinib, or erlotinib; or kinase inhibitors including but not limited to sorafenib, regorafenib, or carbozantinib.

Certain embodiments are drawn to a combination of a compound targeted to YAP1 as described herein, such as ION 1198440, and a secondary agent, such as CDK4/6 inhibitors including but not limited to palbociclib, ribociclib, or abemaciclib; EGFR inhibitors including but not limited to cetuximab, necitumumab, panitumumab, vandetanib, dacomitinib, neratinib, osimertinib, gefitinib, lapatinib, or erlotinib; or kinase inhibitors including but not limited to sorafenib, regorafenib, or carbozantinib.

In certain embodiments the compound targeted to YAP1 as described herein, such as ION 1198440, and the secondary agent are used in combination treatment by administering the two agents simultaneously, separately or sequentially. In certain embodiments the two agents are formulated as a fixed dose combination product. In other embodiments the two agents are provided to the patient as separate units which can then either be taken simultaneously or serially (sequentially).

In certain embodiments, a compound targeted to YAP1 as described herein, such as ION 1198440, is used in combination with an immunomodulatory agent such as an anti-PD-L1 antibody (or an antigen-binding fragment thereof), an anti-PD-1 antibody (or an antigen-binding fragment thereof), an anti-CTLA-4 antibody (or an antigen-binding fragment thereof) or an OX40 agonist ((e.g., an OX40 ligand fusion protein, or an OX40 agonist antibody or antigen-binding fragment thereof).

In certain embodiments, a compound targeted to YAP1 as described herein, such as ION 1198440, is used in combination with an immune checkpoint inhibitor such as an anti-PD-L1 antibody (or an antigen-binding fragment thereof), an anti-PD-1 antibody (or an antigen-binding fragment thereof), or an anti-CTLA-4 antibody (or an antigen-binding fragment thereof).

Anti-PD-L1 antibodies are known in the art. Exemplary anti-PD-L1 antibodies include: MEDI4736 (durvalumab), MPDL3280A, BMS936559, 2.7A4, AMP-714, MDX-1105 and MPDL3280A (atezolizumab).

Anti-PD-1 antibodies are known in the art. Exemplary anti-PD-1 antibodies include: nivolumab, pembrolizumab, pidilizumab, and AMP-514

Anti-CTLA-4 antibodies are known in the art. Exemplary anti-CTLA-4 antibodies include: tremelimumab and ipilimumab, also termed MDX-010 (or BMS-734016).

OX40 agonists and antibodies are known in the art. Exemplary OX40 agonists and/or antibodies include: MEDI6383, 9B12 and MEDI0562.

In one embodiment, the combination includes the antisense oligonucleotide Ionis 1198440 or a salt thereof, and at least one immunomodulator selected from the group consisting of: MEDI4736, MPDL3280A, BMS936559, 2.7A4, AMP-714, MDX-1105, nivolumab, pembrolizumab, pidilizumab, MPDL3280A, tremelimumab, ipilimumab, MEDI0562 and MEDI0562.

In one embodiment, the combination includes the anti-PD-L1 antibody MEDI4736 (duvalumab) and ION 1198440.

In one embodiment, the combination includes ION 1198440, the anti-PD-L1 antibody MEDI4736 (durvalumab) and the anti-CTLA-4 antibody tremelimumab.

Certain Anti-PD-L1 Antibodies

Antibodies that specifically bind and inhibit PD-L1 are included in the present disclosure.

Durvalumab (MEDI4736) is an exemplary anti-PD-L1 antibody that is selective for a PD-L1 polypeptide and blocks the binding of PD-L1 to the PD-1 and CD80 receptors. Durvalumab can relieve PD-L1-mediated suppression of human T-cell activation in vitro and inhibits tumor growth in a xenograft model via a T-cell dependent mechanism.

Information regarding durvalumab (or fragments thereof) for use in the methods provided herein can be found in U.S. Pat. No. 8,779,108, the disclosure of which is incorporated herein by reference in its entirety. The fragment crystallizable (Fc) domain of durvalumab contains a triple mutation in the constant domain of the IgG1 heavy chain that reduces binding to the complement component C1q and the Fcγ receptors responsible for mediating antibody-dependent cell-mediated cytotoxicity (ADCC).

Durvalumab and antigen-binding fragments thereof for use in the methods provided herein comprises a heavy chain and a light chain or a heavy chain variable region and a light chain variable region. In certain embodiments, MEDI4736 or an antigen-binding fragment thereof for use in the methods provided herein comprises the variable heavy chain and variable light chain CDR sequences of the 2.14H9OPT antibody as disclosed in U.S. Pat. Nos. 8,779,108 and 9,493,565, which is herein incorporated by reference in its entirety.

There are numerous anti-PD-L1 antibodies in the published literature that could feature in the present disclosure, including compounds in development and/or in clinical trials such as: durvalumab (MEDI4736), MPDL3280A, BMS936559, 2.7A4, AMP-714 and MDX-1105. Patent specifications disclosing anti-PD-L1 antibodies that may be useful in the present disclosure include: U.S. Pat. Nos. 7,943,743; 8,383,796; 9,102,725; 9,273,135 (BMS/Medarex), US2006/0153841 (Dana Farber), US2011/0271358 (Dana Farber), U.S. Pat. Nos. 8,552,154 and 9,102,727 (Dana Farber), U.S. Pat. No. 8,217,149 (Genentech), including issued U.S. Pat. No. 8,217,149, US2012/0039906 (INSERM), US2016/0031990 (Amplimmune), U.S. Pat. No. 8,779,108 (MedImmune—for durvalumab/MED14726 and 2.7A4), US2014/0044738 (Amplimmune—for AMP-714) and US2010/0285039 (John's Hopkins University). Each of these disclosures is herein incorporated by reference in its entirety.

Certain Anti-CTLA-4 Antibodies

Antibodies that specifically bind CTLA-4 and inhibit CTLA-4 activity are useful for enhancing an anti-tumor immune response. Information regarding tremelimumab (or antigen-binding fragments thereof) for use in the methods provided herein can be found in U.S. Pat. No. 6,682,736 (where it is referred to as 11.2.1), the disclosure of which is incorporated herein by reference in its entirety. Tremelimumab (also known as CP-675,206, CP-675, CP-675206, and ticilimumab) is a human IgG2 monoclonal antibody that is highly selective for CTLA-4 and blocks binding of CTLA-4 to CD80 (B7.1) and CD86 (B7.2). It has been shown to result in immune activation in vitro and some patients treated with tremelimumab have shown tumor regression.

Tremelimumab for use in the methods provided herein comprises a heavy chain and a light chain or a heavy chain variable region and a light chain variable region. In a specific aspect, tremelimumab or an antigen-binding fragment thereof for use in the methods provided herein comprises a light chain variable region comprising the amino acid sequences shown herein above and a heavy chain variable region comprising the amino acid sequence shown herein above. In a specific aspect, tremelimumab or an antigen-binding fragment thereof for use in the methods provided herein comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises the Kabat-defined CDR1, CDR2, and CDR3 sequences shown herein above, and wherein the light chain variable region comprises the Kabat-defined CDR1, CDR2, and CDR3 sequences shown herein above. Those of ordinary skill in the art would easily be able to identify Chothia-defined, Abm-defined or other CDR definitions known to those of ordinary skill in the art. In a specific aspect, tremelimumab or an antigen-binding fragment thereof for use in the methods provided herein comprises the variable heavy chain and variable light chain CDR sequences of the 11.2.1 antibody as disclosed in U.S. Pat. No. 6,682,736, which is herein incorporated by reference in its entirety.

Other anti-CTLA-4 antibodies are described, for example, in US 20070243184. In one embodiment, the anti-CTLA-4 antibody is Ipilimumab, also termed MDX-010; BMS-734016.

Certain OX40 Agonists

OX40 agonists interact with the OX40 receptor on CD4+ T-cells during, or shortly after, priming by an antigen resulting in an increased response of the CD4+ T-cells to the antigen. An OX40 agonist interacting with the OX40 receptor on antigen specific CD4+ T-cells can increase T cell proliferation as compared to the response to antigen alone. The elevated response to the antigen can be maintained for a period of time substantially longer than in the absence of an OX40 agonist. Thus, stimulation via an OX40 agonist enhances the antigen specific immune response by boosting T-cell recognition of antigens, e.g., tumor cells. OX40 agonists are described, for example, in U.S. Pat. Nos. 6,312,700, 7,504,101, 7,622,444, and 7,959,925, which are incorporated herein by reference in their entireties. Methods of using such agonists in cancer treatment are described, for example, in US2015/0098942 and in US2015/0157710, each of which are incorporated herein by reference in its entirety.

OX40 agonists include, but are not limited to OX40 binding molecules, e.g., binding polypeptides, e.g., OX40 ligand (“OX40L”) or an OX40-binding fragment, variant, or derivative thereof, such as soluble extracellular ligand domains and OX40L fusion proteins, and anti-OX40 antibodies (for example, monoclonal antibodies such as humanized monoclonal antibodies), or an antigen-binding fragment, variant or derivative thereof. Examples of anti-OX40 monoclonal antibodies are described, for example, in U.S. Pat. Nos. 5,821,332 and 6,156,878, the disclosures of which are incorporated herein by reference in their entireties. In certain embodiments, the anti-OX40 monoclonal antibody is 9B12, or an antigen-binding fragment, variant, or derivative thereof, as described in Weinberg, A. D., et al. J Immunother 29, 575-585 (2006), which is incorporated herein by reference in its entirety. In another embodiment, an OX40 antibody is MEDI0562 as described in US 2016/0137740.

In certain embodiments, the antibody which specifically binds to OX40, or an antigen-binding fragment thereof binds to the same OX40 epitope as mAb 9B12. An example of a humanized OX40 antibody is described by Morris et al., Mol Immunol. May 2007; 44(12): 3112-3121. 9B12 is a murine IgG1, anti-OX40 mAb directed against the extracellular domain of human OX40 (CD134) (Weinberg, A. D., et al. J Immunother 29, 575-585 (2006)). It was selected from a panel of anti-OX40 monoclonal antibodies because of its ability to elicit an agonist response for OX40 signaling, stability, and for its high level of production by the hybridoma. For use in clinical applications, 9B12 mAb is equilibrated with phosphate buffered saline, pH 7.0, and its concentration is adjusted to 5.0 mg/ml by diafiltration.

“OX40 ligand” (“OX40L”) (also variously termed tumor necrosis factor ligand superfamily member 4, gp34, TAX transcriptionally-activated glycoprotein-1, and CD252) is found largely on antigen presenting cells (APCs), and can be induced on activated B cells, dendritic cells (DCs), Langerhans cells, plamacytoid DCs, and macrophages (Croft, M., (2010) Ann Rev Immunol 28:57-78). Other cells, including activated T cells, NK cells, mast cells, endothelial cells, and smooth muscle cells can express OX40L in response to inflammatory cytokines (Id.). OX40L specifically binds to the OX40 receptor. The human protein is described in U.S. Pat. No. 6,156,878. The mouse OX40L is described in U.S. Pat. No. 5,457,035. OX40L is expressed on the surface of cells and includes an intracellular, a transmembrane and an extracellular receptor-binding domain. A functionally active soluble form of OX40L can be produced by deleting the intracellular and transmembrane domains as described, e.g., in U.S. Pat. Nos. 5,457,035; 6,312,700; 6,156,878; 6,242,566; 6,528,055; 6,528,623; 7,098,184; and 7,125,670, the disclosures of which are incorporated herein for all purposes. A functionally active form of OX40L is a form that retains the capacity to bind specifically to OX40, that is, that possesses an OX40 “receptor binding domain.” An example is amino acids 51 to 183 of human OX40L. Methods of determining the ability of an OX40L molecule or derivative to bind specifically to OX40 are discussed below. Methods of making and using OX40L and its derivatives (such as derivatives that include an OX40 binding domain) are described in U.S. Pat. Nos. 6,156,878; 6,242,566; 6,528,055; 6,528,623; 7,098,184; and 7,125,670, which also describe proteins comprising the soluble form of OX40L linked to other peptides, such as human immunoglobulin (“Ig”) Fc regions, that can be produced to facilitate purification of OX40 ligand from cultured cells, or to enhance the stability of the molecule after in vivo administration to a mammal (see also, U.S. Pat. Nos. 5,457,035 and 7,959,925, both of which are incorporated by reference herein in their entireties).

Also included within the definition of OX40L are OX40 ligand variants which vary in amino acid sequence from naturally occurring OX40 ligand molecules but which retain the ability to specifically bind to an OX40 receptor. Such variants are described in U.S. Pat. Nos. 5,457,035; 6,156,878; 6,242,566; 6,528,055; 6,528,623; 7,098,184; and 7,125,670. In a related embodiment, a mutant of OX40L which has lost the ability to specifically bind to OX40, for example amino acids 51 to 183, in which the phenylalanine at position 180 of the receptor-binding domain of human OX40L has been replaced with alanine (F180A) is used.

OX40 agonists include a fusion protein in which one or more domains of OX40L is covalently linked to one or more additional protein domains. Exemplary OX40L fusion proteins that can be used as OX40 agonists are described in U.S. Pat. No. 6,312,700, the disclosure of which is incorporated herein by reference in its entirety. In one embodiment, an OX40 agonist includes an OX40L fusion polypeptide that self-assembles into a multimeric (e.g., trimeric or hexameric) OX40L fusion protein. Such fusion proteins are described, e.g., in U.S. Pat. No. 7,959,925, which is incorporated by reference herein in its entirety. The multimeric OX40L fusion protein exhibits increased efficacy in enhancing antigen specific immune response in a subject, particularly a human subject, due to its ability to spontaneously assemble into highly stable trimers and hexamers.

In another embodiment, an OX40 agonist capable of assembling into a multimeric form includes a fusion polypeptide comprising in an N-terminal to C-terminal direction: an immunoglobulin domain, wherein the immunoglobulin domain includes an Fc domain, a trimerization domain, wherein the trimerization domain includes a coiled coil trimerization domain, and a receptor binding domain, wherein the receptor binding domain is an OX40 receptor binding domain, e.g., an OX40L or an OX40-binding fragment, variant, or derivative thereof, where the fusion polypeptide can self-assemble into a trimeric fusion protein. In one aspect, an OX40 agonist capable of assembling into a multimeric form is capable of binding to the OX40 receptor and stimulating at least one OX40 mediated activity. In certain aspects, the OX40 agonist includes an extracellular domain of OX40 ligand.

The trimerization domain of an OX40 agonist capable of assembling into a multimeric form serves to promote self-assembly of individual OX40L fusion polypeptide molecules into a trimeric protein. Thus, an OX40L fusion polypeptide with a trimerization domain self-assembles into a trimeric OX40L fusion protein. In one aspect, the trimerization domain is an isoleucine zipper domain or other coiled coli polypeptide structure. Exemplary coiled coil trimerization domains include: TRAF2 (GENBANK® Accession No. Q12933, amino acids 299-348; Thrombospondin 1 (Accession No. P07996, amino acids 291-314; Matrilin-4 (Accession No. 095460, amino acids 594-618; CMP (matrilin-1) (Accession No. NP-002370, amino acids 463-496; HSF1 (Accession No. AAX42211, amino acids 165-191; and Cubilin (Accession No. NP-001072, amino acids 104-138. In certain specific aspects, the trimerization domain includes a TRAF2 trimerization domain, a Matrilin-4 trimerization domain, or a combination thereof.

OX40L FP is a human OX40 ligand IgG4P fusion protein that specifically binds to, and triggers signaling by, the human OX40 receptor, a member of the TNFR superfamily. OX40L FP is also disclosed in US2016/0024176, incorporated herein by reference in its entirety. OX40L FP is composed of three distinct domains: (1) human OX40 ligand extracellular receptor binding domains (RBDs) that form homotrimers and bind the OX40 receptor; (2) isoleucine zipper trimerization domains derived from TNFR-associated factor 2 that stabilize the homotrimeric structure of the OX40 ligand RBDs; and (3) human IgG4 fragment crystallizable gamma (Fcγ) domains that facilitate Fcγ receptor clustering of the fusion protein when bound to OX40 receptors, and contain a serine to proline substitution at position 228 (according to EU numbering) in the hinge regions (IgG4P) to promote stability of two sets of OX40 ligand RBD homotrimers. The IgG4P Fc domain is fused directly to an isoleucine zipper trimerization domain derived from amino acid residues 310-349 of human tumor necrosis factor 2 (TRAF2). Fused to the c-terminus of the TRAF2 domain are amino acid residues 51-183 of the extracellular receptor binding domain (RBD) of human OX40L (gene name TNFSF4). The TRAF2 domain stabilizes the homotrimeric structure of OX40L RBDs to enable OX40 binding and activation, while the IgG4P Fc domain confers serum stability, dimerization of OX40L trimers, and facilitates Fcγ receptor clustering of the hexameric fusion protein. One OX40L FP variant possesses a phenylalanine (F) to alanine (A) mutation at the amino acid corresponding to position 180 in OX40L. Another OX40L FP variant has the IgG4P Fc domain replaced with a human IgG1 Fc domain. In particular embodiments, the OX40 agonist for use in the present disclosure is one of the OX40L FP variants.

In particular embodiments, the OX40 agonist for use in the present disclosure has been modified to increase its serum half-life. For example, the serum half-life of an OX40 agonist can be increased by conjugation to a heterologous molecule such as serum albumin, an antibody Fc region, or PEG. In certain embodiments, OX40 agonists can be conjugated to other therapeutic agents or toxins to form immunoconjugates and/or fusion proteins. In certain embodiments, the OX40 agonist can be formulated so as to facilitate administration and promote stability of the active agent.

Antibody Derivatives

Antibodies for use in the present disclosure (e.g., anti-CTLA-4, anti-PD-L1, anti-PD-1, anti-OX40) may include variants of these sequences that retain the ability to specifically bind their targets. Such variants may be derived from the sequence of these antibodies by a skilled artisan using techniques well known in the art. For example, amino acid substitutions, deletions, or additions, can be made in the FRs and/or in the CDRs. While changes in the FRs are usually designed to improve stability and immunogenicity of the antibody, changes in the CDRs are typically designed to increase affinity of the antibody for its target. Variants of FRs also include naturally occurring immunoglobulin allotypes. Such affinity-increasing changes may be determined empirically by routine techniques that involve altering the CDR and testing the affinity antibody for its target. For example, conservative amino acid substitutions can be made within any one of the disclosed CDRs. Various alterations can be made according to the methods described in Antibody Engineering, 2nd ed., Oxford University Press, ed. Borrebaeck, 1995. These include but are not limited to nucleotide sequences that are altered by the substitution of different codons that encode a functionally equivalent amino acid residue within the sequence, thus producing a “silent” change. For example, the nonpolar amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine. The polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The positively charged (basic) amino acids include arginine, lysine, and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

Derivatives and analogs of antibodies of the present disclosure can be produced by various techniques well known in the art, including recombinant and synthetic methods (Maniatis (1990) Molecular Cloning, A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., and Bodansky et al. (1995) The Practice of Peptide Synthesis, 2nd ed., Spring Verlag, Berlin, Germany). Analogous shuffling or combinatorial techniques are also disclosed by Stemmer (Nature (1994) 370: 389-391), who describes the technique in relation to a β-lactamase gene but observes that the approach may be used for the generation of antibodies.

One may generate novel VH or VL regions carrying one or more sequences derived from the sequences disclosed herein using random mutagenesis of one or more selected VH and/or VL genes. One such technique, error-prone PCR, is described by Gram et al. (Proc. Nat. Acad. Sci. U.S.A. (1992) 89: 3576-3580).

Another method that may be used is to direct mutagenesis to CDRs of VH or VL genes. Such techniques are disclosed by Barbas et al. (Proc. Nat. Acad. Sci. U.S.A. (1994) 91: 3809-3813) and Schier et al. (J. Mol. Biol. (1996) 263: 551-567).

Similarly, one or more, or all three CDRs may be grafted into a repertoire of VH or VL domains, which are then screened for an antigen-binding fragment specific for CTLA-4 or PD-L1.

A portion of an immunoglobulin variable domain will comprise at least one of the CDRs substantially as set out herein and, optionally, intervening framework regions from the scFv fragments as set out herein. The portion may include at least about 50% of either or both of FR1 and FR4, the 50% being the C-terminal 50% of FR1 and the N-terminal 50% of FR4. Additional residues at the N-terminal or C-terminal end of the substantial part of the variable domain may be those not normally associated with naturally occurring variable domain regions. For example, construction of antibodies by recombinant DNA techniques may result in the introduction of N- or C-terminal residues encoded by linkers introduced to facilitate cloning or other manipulation steps. Other manipulation steps include the introduction of linkers to join variable domains to further protein sequences including immunoglobulin heavy chain constant regions, other variable domains (for example, in the production of diabodies), or proteinaceous labels as discussed in further detail below.

A skilled artisan will recognize that antibodies for use in the present disclosure may comprise antigen-binding fragments containing only a single CDR from either VL or VH domain. Either one of the single chain specific binding domains can be used to screen for complementary domains capable of forming a two-domain specific antigen-binding fragment capable of, for example, binding to CTLA-4 and PD-L1.

Antibodies for use in the present disclosure described herein can be linked to another functional molecule, e.g., another peptide or protein (albumin, another antibody, etc.). For example, the antibodies can be linked by chemical cross-linking or by recombinant methods. The antibodies may also be linked to one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Pat. Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192; or 4,179,337. The antibodies can be chemically modified by covalent conjugation to a polymer, for example, to increase their circulating half-life. Exemplary polymers and methods to attach them are also shown in U.S. Pat. Nos. 4,766,106; 4,179,337; 4,495,285, and 4,609,546.

The antibodies may also be altered to have a glycosylation pattern that differs from the native pattern. For example, one or more carbohydrate moieties can be deleted and/or one or more glycosylation sites added to the original antibody. Addition of glycosylation sites to the presently disclosed antibodies may be accomplished by altering the amino acid sequence to contain glycosylation site consensus sequences known in the art. Another means of increasing the number of carbohydrate moieties on the antibodies is by chemical or enzymatic coupling of glycosides to the amino acid residues of the antibody. Such methods are described in WO 87/05330, and in Aplin et al. (1981) CRC Crit. Rev. Biochem., 22: 259-306. Removal of any carbohydrate moieties from the antibodies may be accomplished chemically or enzymatically, for example, as described by Hakimuddin et al. (1987) Arch. Biochem. Biophys., 259: 52; and Edge et al. (1981) Anal. Biochem., 118: 131 and by Thotakura et al. (1987) Meth. Enzymol., 138: 350. The antibodies may also be tagged with a detectable, or functional, label. Detectable labels include radiolabels such as 131I or 99Tc, which may also be attached to antibodies using conventional chemistry. Detectable labels also include enzyme labels such as horseradish peroxidase or alkaline phosphatase. Detectable labels further include chemical moieties such as biotin, which may be detected via binding to a specific cognate detectable moiety, e.g., labeled avidin.

Antibodies, in which CDR sequences differ only insubstantially from those set forth herein are encompassed within the scope of this present disclosure. Typically, an amino acid is substituted by a related amino acid having similar charge, hydrophobic, or stereochemical characteristics. Such substitutions would be within the ordinary skills of an artisan. Unlike in CDRs, more substantial changes can be made in FRs without adversely affecting the binding properties of an antibody. Changes to FRs include, but are not limited to, humanizing a non-human derived or engineering certain framework residues that are important for antigen contact or for stabilizing the binding site, e.g., changing the class or subclass of the constant region, changing specific amino acid residues which might alter the effector function such as Fc receptor binding, e.g., as described in U.S. Pat. Nos. 5,624,821 and 5,648,260 and Lund et al. (1991) J. Immun. 147: 2657-2662 and Morgan et al. (1995) Immunology 86: 319-324, or changing the species from which the constant region is derived.

One of skill in the art will appreciate that the modifications described above are not all-exhaustive, and that many other modifications would be obvious to a skilled artisan in light of the teachings of the present disclosure.

Certain Compounds

In certain embodiments, compounds described herein can be antisense compounds. In certain embodiments, the antisense compound comprises or consists of an oligomeric compound. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.

In certain embodiments, a compound described herein comprises or consists of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.

In certain embodiments, a compound or antisense compound is single-stranded. Such a single-stranded compound or antisense compound comprises or consists of an oligomeric compound. In certain embodiments, such an oligomeric compound comprises or consists of an oligonucleotide and optionally a conjugate group. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of a single-stranded antisense compound or oligomeric compound comprises a self-complementary nucleobase sequence.

In certain embodiments, compounds are double-stranded. Such double-stranded compounds comprise a first modified oligonucleotide having a region complementary to a target nucleic acid and a second modified oligonucleotide having a region complementary to the first modified oligonucleotide. In certain embodiments, the modified oligonucleotide is an RNA oligonucleotide. In such embodiments, the thymine nucleobase in the modified oligonucleotide is replaced by a uracil nucleobase. In certain embodiments, compound comprises a conjugate group. In certain embodiments, one of the modified oligonucleotides is conjugated. In certain embodiments, both the modified oligonucleotides are conjugated. In certain embodiments, the first modified oligonucleotide is conjugated. In certain embodiments, the second modified oligonucleotide is conjugated. In certain embodiments, the first modified oligonucleotide consists of 12-30 linked nucleosides and the second modified oligonucleotide consists of 12-30 linked nucleosides. In certain embodiments, one of the modified oligonucleotides has a nucleobase sequence comprising at least 8 contiguous nucleobases of any of SEQ ID NOs: 23-2940.

In certain embodiments, antisense compounds are double-stranded. Such double-stranded antisense compounds comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. The first oligomeric compound of such double stranded antisense compounds typically comprises or consists of a modified oligonucleotide and optionally a conjugate group. The oligonucleotide of the second oligomeric compound of such double-stranded antisense compound may be modified or unmodified. Either or both oligomeric compounds of a double-stranded antisense compound may comprise a conjugate group. The oligomeric compounds of double-stranded antisense compounds may include non-complementary overhanging nucleosides.

Examples of single-stranded and double-stranded compounds include but are not limited to oligonucleotides, siRNAs, microRNA targeting oligonucleotides, and single-stranded RNAi compounds, such as small hairpin RNAs (shRNAs), single-stranded siRNAs (ssRNAs), and microRNA mimics.

In certain embodiments, a compound described herein has a nucleobase sequence that, when written in the 5′ to 3′ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 10 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 12 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 12 to 22 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 14 to 30 linked subunits. In certain embodiments, compound described herein comprises an oligonucleotide consisting of 14 to 20 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 15 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 15 to 20 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 16 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 16 to 20 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 17 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 17 to 20 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 18 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 18 to 21 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 18 to 20 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 20 to 30 linked subunits. In other words, such oligonucleotides consist of 12 to 30 linked subunits, 14 to 30 linked subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, 18 to 21 subunits, 20 to 30 subunits, or 12 to 22 linked subunits, respectively. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 14 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 16 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 17 linked subunits. In certain embodiments, compound described herein comprises an oligonucleotide consisting of 18 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 19 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 20 linked subunits. In other embodiments, a compound described herein comprises an oligonucleotide consisting of 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked subunits. In certain such embodiments, the compound described herein comprises an oligonucleotide consisting of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits, or a range defined by any two of the above values. In some embodiments the linked subunits are nucleotides, nucleosides, or nucleobases.

In certain embodiments, the compound may further comprise additional features or elements, such as a conjugate group, that are attached to the oligonucleotide. In certain embodiments, such compounds are antisense compounds. In certain embodiments, such compounds are oligomeric compounds. In embodiments where a conjugate group comprises a nucleoside (i.e. a nucleoside that links the conjugate group to the oligonucleotide), the nucleoside of the conjugate group is not counted in the length of the oligonucleotide.

In certain embodiments, compounds may be shortened or truncated. For example, a single subunit may be deleted from the 5′ end (5′ truncation), or alternatively from the 3′ end (3′ truncation). A shortened or truncated compound targeted to an YAP1 nucleic acid may have two subunits deleted from the 5′ end, or alternatively may have two subunits deleted from the 3′ end, of the compound. Alternatively, the deleted nucleosides may be dispersed throughout the compound.

When a single additional subunit is present in a lengthened compound, the additional subunit may be located at the 5′ or 3′ end of the compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in a compound having two subunits added to the 5′ end (5′ addition), or alternatively to the 3′ end (3′ addition), of the compound. Alternatively, the added subunits may be dispersed throughout the compound.

It is possible to increase or decrease the length of a compound, such as an oligonucleotide, and/or introduce mismatch bases without eliminating activity (Woolf et al. Proc. Natl. Acad. Sci. USA 1992, 89:7305-7309; Gautschi et al. J. Natl. Cancer Inst. March 2001, 93:463-471; Maher and Dolnick Nuc. Acid. Res. 1998, 16:3341-3358). However, seemingly small changes in oligonucleotide sequence, chemistry and motif can make large differences in one or more of the many properties required for clinical development (Seth et al. J. Med. Chem. 2009, 52, 10; Egli et al. J. Am. Chem. Soc. 2011, 133, 16642).

In certain embodiments, compounds described herein are interfering RNA compounds (RNAi), which include double-stranded RNA compounds (also referred to as short-interfering RNA or siRNA) and single-stranded RNAi compounds (or ssRNA). Such compounds work at least in part through the RISC pathway to degrade and/or sequester a target nucleic acid (thus, include microRNA/microRNA-mimic compounds). As used herein, the term siRNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term “RNAi” is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.

In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to YAP1 described herein. In certain embodiments, the compound can be double-stranded. In certain embodiments, the compound comprises a first strand comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs: 23-2940 and a second strand. In certain embodiments, the compound comprises a first strand comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940 and a second strand. In certain embodiments, the compound comprises ribonucleotides in which the first strand has uracil (U) in place of thymine (T) in any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises (i) a first strand comprising a nucleobase sequence complementary to the site on YAP1 to which any of SEQ ID NOs: 23-2940 is targeted, and (ii) a second strand. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2′ position in the sugar contains a halogen (such as fluorine group; 2′-F) or contains an alkoxy group (such as a methoxy group; 2′-OMe). In certain embodiments, the compound comprises at least one 2′-F sugar modification and at least one 2′-OMe sugar modification. In certain embodiments, the at least one 2′-F sugar modification and at least one 2′-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the dsRNA compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compound contains one or two capped strands, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000.

In certain embodiments, the first strand of the compound is an siRNA guide strand and the second strand of the compound is an siRNA passenger strand. In certain embodiments, the second strand of the compound is complementary to the first strand. In certain embodiments, each strand of the compound consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides. In certain embodiments, the first or second strand of the compound can comprise a conjugate group.

In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to YAP1 described herein. In certain embodiments, the compound is single stranded. In certain embodiments, such a compound is a single-stranded RNAi (ssRNAi) compound. In certain embodiments, the compound comprises at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises ribonucleotides in which uracil (U) is in place of thymine (T) in any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a nucleobase sequence complementary to the site on YAP1 to which any of SEQ ID NOs: 23-2940 is targeted. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2′ position in the sugar contains a halogen (such as fluorine group; 2′-F) or contains an alkoxy group (such as a methoxy group; 2′-OMe). In certain embodiments, the compound comprises at least one 2′-F sugar modification and at least one 2′-OMe sugar modification. In certain embodiments, the at least one 2′-F sugar modification and at least one 2′-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compound contains a capped strand, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000. In certain embodiments, the compound consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides. In certain embodiments, the compound can comprise a conjugate group.

In certain embodiments, compounds described herein comprise modified oligonucleotides. Certain modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or f such as for sugar anomers, or as (D) or (L) such as for amino acids etc. Included in the modified oligonucleotides provided herein are all such possible isomers, including their racemic and optically pure forms, unless specified otherwise. Likewise, all cis- and trans-isomers and tautomeric forms are also included.

The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the ¹H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: ²H or ³H in place of ¹H, ¹³C or ¹⁴C in place of ¹²C, ¹⁵N in place of ¹⁴N, ¹⁷O or ¹⁸O in place of ¹⁶O, and ³³S, ³⁴S, ³⁵S, or ³⁶S in place of ³²S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes, such as an imaging assay.

Certain Mechanisms

In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein are antisense compounds. In certain embodiments, compounds comprise oligomeric compounds. In certain embodiments, compounds described herein are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, compounds described herein selectively affect one or more target nucleic acid. Such compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in a significant undesired antisense activity.

In certain antisense activities, hybridization of a compound described herein to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain compounds described herein result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, compounds described herein are sufficiently “DNA-like” to elicit RNase H activity. Further, in certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.

In certain antisense activities, compounds described herein or a portion of the compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain compounds described herein result in cleavage of the target nucleic acid by Argonaute. Compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).

In certain embodiments, hybridization of compounds described herein to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain such embodiments, hybridization of the compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of the compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain such embodiments, hybridization of the compound to a target nucleic acid results in alteration of translation of the target nucleic acid.

Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and/or a phenotypic change in a cell or animal.

Target Nucleic Acids, Target Regions and Nucleotide Sequences

In certain embodiments, compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: an mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron.

Nucleotide sequences that encode YAP1 include, without limitation, the following: GENBANK or RefSEQ No. NM_001282101.1 (SEQ ID NO: 1); NC_000011.10 truncated from nucleotides 102107001 to 102236000 (SEQ ID NO: 2); NM 006106.4 (SEQ ID NO: 3); NM_001130145.2 (SEQ ID NO: 4); NM_001195044.1 (SEQ ID NO: 5); NM_001195045.1 (SEQ ID NO: 6); NM_001282097.1 (SEQ ID NO: 7); NM_001282098.1 (SEQ ID NO: 8); NM_001282099.1 (SEQ ID NO: 9); and NM_001282100.1 (SEQ ID NO: 10), each of which is incorporated by reference in its entirety.

Hybridization

In some embodiments, hybridization occurs between a compound disclosed herein and a YAP1 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

Hybridization can occur under varying conditions. Hybridization conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the compounds provided herein are specifically hybridizable with a YAP1 nucleic acid.

Complementarity

An oligonucleotide is said to be complementary to another nucleic acid when the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions. Nucleobase matches or complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methyl cytosine (mC) and guanine (G) unless otherwise specified. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. An oligonucleotide is fully complementary or 100% complementary when such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.

In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein are antisense compounds. In certain embodiments, compounds comprise oligomeric compounds. Non-complementary nucleobases between a compound and a YAP1 nucleic acid may be tolerated provided that the compound remains able to specifically hybridize to a target nucleic acid. Moreover, a compound may hybridize over one or more segments of a YAP1 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

In certain embodiments, the compounds provided herein, or a specified portion thereof, are, are at least, or are up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a YAP1 nucleic acid, a target region, target segment, or specified portion thereof. In certain embodiments, the compounds provided herein, or a specified portion thereof, are 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, 95% to 100%, or any number in between these ranges, complementary to a YAP1 nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of a compound with a target nucleic acid can be determined using routine methods.

For example, a compound in which 18 of 20 nucleobases of the compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, a compound which consists of 18 nucleobases having four non-complementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid. Percent complementarity of a compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

In certain embodiments, compounds described herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof. For example, a compound may be fully complementary to a YAP1 nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, “fully complementary” means each nucleobase of a compound is complementary to the corresponding nucleobase of a target nucleic acid. For example, a 20 nucleobase compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the compound. Fully complementary can also be used in reference to a specified portion of the first and/or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase compound can be “fully complementary” to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase compound is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the compound. At the same time, the entire 30 nucleobase compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary to the target sequence.

In certain embodiments, compounds described herein comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain such embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain such embodiments selectivity of the compound is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5′-end of the gap region. In certain such embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3′-end of the gap region. In certain such embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5′-end of the wing region. In certain such embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3′-end of the wing region. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide not having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5′-end of the oligonucleotide. In certain such embodiments, the mismatch is at position, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3′-end of the oligonucleotide.

The location of a non-complementary nucleobase may be at the 5′ end or 3′ end of the compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer oligonucleotide.

In certain embodiments, compounds described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a YAP1 nucleic acid, or specified portion thereof.

In certain embodiments, compounds described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a YAP1 nucleic acid, or specified portion thereof.

In certain embodiments, compounds described herein also include those which are complementary to a portion of a target nucleic acid. As used herein, “portion” refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of a compound. In certain embodiments, the compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 15 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 16 nucleobase portion of a target segment. Also contemplated are compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

Identity

The compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number, or portion thereof. In certain embodiments, compounds described herein are antisense compounds or oligomeric compounds. In certain embodiments, compounds described herein are modified oligonucleotides. As used herein, a compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the compounds described herein as well as compounds having non-identical bases relative to the compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the compound. Percent identity of an compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

In certain embodiments, compounds described herein, or portions thereof, are, or are at least, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the compounds or SEQ ID NOs, or a portion thereof, disclosed herein. In certain embodiments, compounds described herein are about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, or any percentage between such values, to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number, or portion thereof, in which the compounds comprise an oligonucleotide having one or more mismatched nucleobases. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5′-end of the oligonucleotide. In certain such embodiments, the mismatch is at position, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3′-end of the oligonucleotide.

In certain embodiments, compounds described herein comprise or consist of antisense compounds. In certain embodiments, a portion of the antisense compound is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

In certain embodiments, compounds described herein comprise or consist of oligonucleotides. In certain embodiments, a portion of the oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

Certain Modified Compounds

In certain embodiments, compounds described herein comprise or consist of oligonucleotides consisting of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA (i.e., comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage).

A. Modified Nucleosides

Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.

1. Modified Sugar Moieties

In certain embodiments, sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more acyclic substituent, including but not limited to substituents at the 2′, 4′, and/or 5′ positions. In certain embodiments one or more acyclic substituent of non-bicyclic modified sugar moieties is branched. Examples of 2′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2′-F, 2′-OCH₃ (“OMe” or “O-methyl”), and 2′-O(CH₂)₂OCH₃ (“MOE”). In certain embodiments, 2′-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF₃, OCF₃, O—C₁-C₁₀ alkoxy, O—C₁-C₁₀ substituted alkoxy, 0-C₁-C₁₀ alkyl, O—C₁-C₁₀ substituted alkyl, S-alkyl, N(R_m)-alkyl, O-alkenyl, S-alkenyl, N(R_m)-alkenyl, O-alkynyl, S-alkynyl, N(R_m)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH₂)₂SCH₃, O(CH₂)₂ON(R_m)(R_n) or OCH₂C(═O)—N(R_m)(R_n), where each R_m and R_n is, independently, H, an amino protecting group, or substituted or unsubstituted C₁-C₁₀ alkyl, and the 2′-substituent groups described in Cook et al., U.S. Pat. No. 6,531,584; Cook et al., U.S. Pat. No. 5,859,221; and Cook et al., U.S. Pat. No. 6,005,087. Certain embodiments of these 2′-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO₂), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4′-substituent groups suitable for linearly non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128. Examples of 5′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5′-methyl (R or S), 5′-vinyl, and 5′-methoxy. In certain embodiments, non-bicyclic modified sugars comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., US2010/190837 and Rajeev et al., US2013/0203836.

In certain embodiments, a 2′-substituted nucleoside or 2′-non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2′-substituent group selected from: F, NH₂, N₃, OCF₃, OCH₃, O(CH₂)₃NH₂, CH₂CH═CH₂, OCH₂CH═CH₂, OCH₂CH₂OCH₃, O(CH₂)₂SCH₃, O(CH₂)₂ON(R_m)(R_n), O(CH₂)₂O(CH₂)₂N(CH₃)₂, and N-substituted acetamide (OCH₂C(═O)—N(R_m)(R_n)), where each R_m and R_n is, independently, H, an amino protecting group, or substituted or unsubstituted C₁-C₁₀ alkyl.

In certain embodiments, a 2′-substituted nucleoside or 2′-non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2′-substituent group selected from: F, OCF₃, OCH₃, OCH₂CH₂OCH₃, O(CH₂)₂SCH₃, O(CH₂)₂ON(CH₃)₂, O(CH₂)₂O(CH₂)₂N(CH₃)₂, and OCH₂C(═O)—N(H)CH₃ (“NMA”).

In certain embodiments, a 2′-substituted nucleoside or 2′-non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2′-substituent group selected from: F, OCH₃, and OCH₂CH₂OCH₃.

Nucleosides comprising modified sugar moieties, such as non-bicyclic modified sugar moieties, are referred to by the position(s) of the substitution(s) on the sugar moiety of the nucleoside. For example, nucleosides comprising 2′-substituted or 2-modified sugar moieties are referred to as 2′-substituted nucleosides or 2-modified nucleosides.

Certain modified sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms. Examples of such 4′ to 2′ bridging sugar substituents include but are not limited to: 4′-CH₂-2′, 4′-(CH₂)₂-2′, 4′-(CH₂)₃-2′, 4′-CH₂—O-2′ (“LNA”), 4′-CH₂—S-2′, 4′-(CH₂)₂—O-2′ (“ENA”), 4′-CH(CH₃)—O-2′ (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4′-CH₂—O—CH₂-2′, 4′-CH₂—N(R)-2′, 4′-CH(CH₂OCH₃)—O-2′ (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 7,399,845, Bhat et al., U.S. Pat. No. 7,569,686, Swayze et al., U.S. Pat. No. 7,741,457, and Swayze et al., U.S. Pat. No. 8,022,193), 4′-C(CH₃)(CH₃)—O-2′ and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,283), 4′-CH₂—N(OCH₃)-2′ and analogs thereof (see, e.g., Prakash et al., U.S. Pat. No. 8,278,425), 4′-CH₂—O—N(CH₃)-2′ (see, e.g., Allerson et al., U.S. Pat. No. 7,696,345 and Allerson et al., U.S. Pat. No. 8,124,745), 4′-CH₂—C(H)(CH₃)-2′ (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4′-CH₂—C(═CH₂)-2′ and analogs thereof (see e.g., Seth et al., U.S. Pat. No. 8,278,426), 4′-C(R_aR_b)—N(R)—O-2′, 4′-C(R_aR_b)—O—N(R)-2′, 4′-CH₂—O—N(R)-2′, and 4′-CH₂—N(R)—O-2′, wherein each R, R_a, and R_b is, independently, H, a protecting group, or C₁-C₁₂ alkyl (see, e.g. Imanishi et al., U.S. Pat. No. 7,427,672).

In certain embodiments, such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from: —[C(R_a)(R_b)]_n—, —[C(R_a)(R_b)]_n—O—, —C(R_a)═C(R_b)—, —C(R_a)═N—, —C(═NR_a)—, —C(═O)—, —C(═S)—, —O—, —Si(R_a)₂—, —S(═O)_x—, and —N(R_a)—;

wherein:

x is 0, 1, or 2;

n is 1, 2, 3, or 4;

each R_a and R_b is, independently, H, a protecting group, hydroxyl, C₁-C₁₂ alkyl, substituted C₁-C₁₂ alkyl, C₂-C₁₂ alkenyl, substituted C₂-C₁₂ alkenyl, C₂-C₁₂ alkynyl, substituted C₂-C₁₂ alkynyl, C₅-C₂₀ aryl, substituted C₅-C₂₀ aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C₅-C₇ alicyclic radical, substituted C₅-C₇ alicyclic radical, halogen, OJ₁, NJ₁J₂, SJ₁, N₃, COOJ₁, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O)₂-J₁), or sulfoxyl (S(═O)-J₁); and each J₁ and J₂ is, independently, H, C₁-C₁₂ alkyl, substituted C₁-C₁₂ alkyl, C₂-C₁₂ alkenyl, substituted C₂-C₁₂ alkenyl, C₂-C₁₂ alkynyl, substituted C₂-C₁₂ alkynyl, C₅-C₂₀ aryl, substituted C₅-C₂₀ aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C₁-C₁₂ aminoalkyl, substituted C₁-C₁₂ aminoalkyl, or a protecting group.

Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wengel et al., U.S. Pat. No. 7,053,207, Imanishi et al., U.S. Pat. No. 6,268,490, Imanishi et al. U.S. Pat. No. 6,770,748, Imanishi et al., U.S. RE44,779; Wengel et al., U.S. Pat. No. 6,794,499, Wengel et al., U.S. Pat. No. 6,670,461; Wengel et al., U.S. Pat. No. 7,034,133, Wengel et al., U.S. Pat. No. 8,080,644; Wengel et al., U.S. Pat. No. 8,034,909; Wengel et al., U.S. Pat. No. 8,153,365; Wengel et al., U.S. Pat. No. 7,572,582; and Ramasamy et al., U.S. Pat. No. 6,525,191, Torsten et al., WO 2004/106356, Wengel et al., WO 1999/014226; Seth et al., WO 2007/134181; Seth et al., U.S. Pat. No. 7,547,684; Seth et al., U.S. Pat. No. 7,666,854; Seth et al., U.S. Pat. No. 8,088,746; Seth et al., U.S. Pat. No. 7,750,131; Seth et al., U.S. Pat. No. 8,030,467; Seth et al., U.S. Pat. No. 8,268,980; Seth et al., U.S. Pat. No. 8,546,556; Seth et al., U.S. Pat. No. 8,530,640; Migawa et al., U.S. Pat. No. 9,012,421; Seth et al., U.S. Pat. No. 8,501,805; Allerson et al., US2008/0039618; and Migawa et al., US2015/0191727.

In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the α-L configuration or in the β-D configuration.

α-L-methyleneoxy (4′-CH₂—O—2′) or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified.

In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars).

In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2′-position (see, e.g., Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No. 7,939,677) and/or the 5′ position.

In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see e.g., Leumann, C J. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:

(“F-HNA”, see e.g., Swayze et al., U.S. Pat. No. 8,088,904; Swayze et al., U.S. Pat. No. 8,440,803; and Swayze et al., U.S. Pat. No. 9,005,906, F-HNA can also be referred to as a F-THP or 3′-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:

wherein, independently, for each of said modified THP nucleoside:

Bx is a nucleobase moiety;

T₃ and T₄ are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T₃ and T₄ is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T₃ and T₄ is H, a hydroxyl protecting group, a linked conjugate group, or a 5′ or 3′-terminal group; q₁, q₂, q₃, q₄, q₅, q₆ and q₇ are each, independently, H, C₁-C₆ alkyl, substituted C₁-C₆ alkyl, C₂-C₆ alkenyl, substituted C₂-C₆ alkenyl, C₂-C₆ alkynyl, or substituted C₂-C₆ alkynyl; and each of R₁ and R₂ is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ₁J₂, SJ₁, N₃, OC(═X)J₁, OC(═X)NJ₁J₂, NJ₃C(═X)NJ₁J₂, and CN, wherein X is O, S or NJ₁, and each J₁, J₂, and J₃ is, independently, H or C₁-C₆ alkyl.

In certain embodiments, modified THP nucleosides are provided wherein q₁, q₂, q₃, q₄, q₅, q₆ and q₇ are each H. In certain embodiments, at least one of q₁, q₂, q₃, q₄, q₅, q₆ and q₇ is other than H. In certain embodiments, at least one of q₁, q₂, q₃, q₄, q₅, q₆ and q₇ is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R₁ and R₂ is F. In certain embodiments, R₁ is F and R₂ is H, in certain embodiments, R₁ is methoxy and R₂ is H, and in certain embodiments, R₁ is methoxyethoxy and R₂ is H.

In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following structure:

In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.”

In certain embodiments, sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013/130378.

Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.

2. Modified Nucleobases

Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds.

In certain embodiments, compounds described herein comprise modified oligonucleotides. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.

In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimi-dines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (C═C—CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press, 2008, 163-166 and 442-443.

Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manoharan et al., US2003/0158403, Manoharan et al., US2003/0175906; Dinh et al., U.S. Pat. No. 4,845,205; Spielvogel et al., U.S. Pat. No. 5,130,302; Rogers et al., U.S. Pat. No. 5,134,066; Bischofberger et al., U.S. Pat. No. 5,175,273; Urdea et al., U.S. Pat. No. 5,367,066; Benner et al., U.S. Pat. No. 5,432,272; Matteucci et al., U.S. Pat. No. 5,434,257; Gmeiner et al., U.S. Pat. No. 5,457,187; Cook et al., U.S. Pat. No. 5,459,255; Froehler et al., U.S. Pat. No. 5,484,908; Matteucci et al., U.S. Pat. No. 5,502,177; Hawkins et al., U.S. Pat. No. 5,525,711; Haralambidis et al., U.S. Pat. No. 5,552,540; Cook et al., U.S. Pat. No. 5,587,469; Froehler et al., U.S. Pat. No. 5,594,121; Switzer et al., U.S. Pat. No. 5,596,091; Cook et al., U.S. Pat. No. 5,614,617; Froehler et al., U.S. Pat. No. 5,645,985; Cook et al., U.S. Pat. No. 5,681,941; Cook et al., U.S. Pat. No. 5,811,534; Cook et al., U.S. Pat. No. 5,750,692; Cook et al., U.S. Pat. No. 5,948,903; Cook et al., U.S. Pat. No. 5,587,470; Cook et al., U.S. Pat. No. 5,457,191; Matteucci et al., U.S. Pat. No. 5,763,588; Froehler et al., U.S. Pat. No. 5,830,653; Cook et al., U.S. Pat. No. 5,808,027; Cook et al., U.S. Pat. No. 6,166,199; and Matteucci et al., U.S. Pat. No. 6,005,096.

In certain embodiments, compounds targeted to a YAP1 nucleic acid comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

3. Modified Internucleoside Linkages

The naturally occurring internucleoside linkage of RNA and DNA is a 3′ to 5′ phosphodiester linkage In certain embodiments, compounds described herein having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:

Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

In certain embodiments, compounds targeted to an YAP1 nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.

In certain embodiments, compounds described herein comprise oligonucleotides. Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.

In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P═O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P═S”), and phosphorodithioates (“HS-P═S”). Representative non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (—CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (—O—C(═O)(NH)—S—); siloxane (—O—SiH2-O—); and N,N′-dimethylhydrazine (—CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative chiral internucleoside linkages include but are not limited to alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.

Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3′-CH2-N(CH3)-O—5′), amide-3 (3′-CH2-C(═O)—N(H)-5′), amide-4 (3′-CH2-N(H)—C(═O)-5′), formacetal (3′-O—CH2-O—5′), methoxypropyl, and thioformacetal (3′-S—CH2-O—5′). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.

In certain embodiments, oligonucleotides comprise modified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleoside linkage motif. In certain embodiments, internucleoside linkages are arranged in a gapped motif. In such embodiments, the internucleoside linkages in each of two wing regions are different from the internucleoside linkages in the gap region. In certain embodiments the internucleoside linkages in the wings are phosphodiester and the internucleoside linkages in the gap are phosphorothioate. The nucleoside motif is independently selected, so such oligonucleotides having a gapped internucleoside linkage motif may or may not have a gapped nucleoside motif and if it does have a gapped nucleoside motif, the wing and gap lengths may or may not be the same.

In certain embodiments, oligonucleotides comprise a region having an alternating internucleoside linkage motif. In certain embodiments, oligonucleotides comprise a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one internucleoside linkage is phosphorothioate.

In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least block of at least one 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3′ end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3′ end of the oligonucleotide.

In certain embodiments, oligonucleotides comprise one or more methylphosponate linkages. In certain embodiments, oligonucleotides having a gapmer nucleoside motif comprise a linkage motif comprising all phosphorothioate linkages except for one or two methylphosponate linkages. In certain embodiments, one methylphosponate linkage is in the central gap of an oligonucleotide having a gapmer nucleoside motif.

In certain embodiments, it is desirable to arrange the number of phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, it is desirable to arrange the number and position of phosphorothioate internucleoside linkages and the number and position of phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, the number of phosphorothioate internucleoside linkages may be decreased and the number of phosphodiester internucleoside linkages may be increased. In certain embodiments, the number of phosphorothioate internucleoside linkages may be decreased and the number of phosphodiester internucleoside linkages may be increased while still maintaining nuclease resistance. In certain embodiments it is desirable to decrease the number of phosphorothioate internucleoside linkages while retaining nuclease resistance. In certain embodiments it is desirable to increase the number of phosphodiester internucleoside linkages while retaining nuclease resistance.

Certain Motifs

In certain embodiments, compounds described herein comprise oligonucleotides. Oligonucleotides can have a motif, e.g. a pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages. In certain embodiments, modified oligonucleotides comprise one or more modified nucleoside comprising a modified sugar. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).

a. Certain Sugar Motifs

In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.

In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which comprises two external regions or “wings” and a central or internal region or “gap.” The three regions of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3′-most nucleoside of the 5′-wing and the 5′-most nucleoside of the 3′-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5′-wing differs from the sugar motif of the 3′-wing (asymmetric gapmer).

In certain embodiments, the wings of a gapmer comprise 1-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 2-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 3-5 nucleosides. In certain embodiments, the nucleosides of a gapmer are all modified nucleosides.

In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, the gap of a gapmer comprises 7-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 8-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 10 nucleosides. In certain embodiment, each nucleoside of the gap of a gapmer is an unmodified 2′-deoxy nucleoside.

In certain embodiments, the gapmer is a deoxy gapmer. In such embodiments, the nucleosides on the gap side of each wing/gap junction are unmodified 2′-deoxy nucleosides and the nucleosides on the wing sides of each wing/gap junction are modified nucleosides. In certain such embodiments, each nucleoside of the gap is an unmodified 2′-deoxy nucleoside. In certain such embodiments, each nucleoside of each wing is a modified nucleoside.

In certain embodiments, a modified oligonucleotide has a fully modified sugar motif wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif wherein each nucleoside of the region comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified comprises the same 2′-modification.

In certain embodiments, a modified oligonucleotide can comprise a sugar motif described in Swayze et al., US2010/0197762; Freier et al., US2014/0107330; Freier et al., US2015/0184153; and Seth et al., US2015/0267195, each of which is incorporated by reference in its entirety herein.

Certain embodiments provided herein are directed to modified oligomeric compounds useful for inhibiting target nucleic acid expression, which can be useful for treating, preventing, ameliorating, or slowing progression of a disease associated with such a target nucleic acid. In certain embodiments, the modified oligomeric compounds comprise antisense oligonucleotides that are gapmers having certain sugar motifs. In certain embodiments, the gapmer sugar motifs provided herein can be combined with any nucleobase sequence and any internucleoside linkage motif to form potent antisense oligonucleotides.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: ekk-d9-kkee, wherein ‘d’ represents a 2′-deoxyribose sugar, ‘k’ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: k-d9-kekeke, wherein ‘d’ represents a 2′-deoxyribose sugar, ‘k’ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kkk-d8-kekek, wherein ‘d’ represents a 2′-deoxyribose sugar, ‘k’ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kkk-d9-keke, wherein ‘d’ represents a 2′-deoxyribose sugar, ‘k’ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kk-d9-kdkdk, wherein ‘d’ represents a 2′-deoxyribose sugar, ‘k’ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kk-d9-eeekk, wherein ‘d’ represents a 2′-deoxyribose sugar, ‘k’ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kk-d9-eeekk, wherein ‘d’ represents a 2′-deoxyribose sugar, ‘k’ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kk-d9-ekeke, wherein ‘d’ represents a 2′-deoxyribose sugar, ‘k’ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.

b. Certain Nucleobase Motifs

In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines.

In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3′-end of the oligonucleotide. In certain embodiments, the block is at the 5′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5′-end of the oligonucleotide.

In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2′-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.

c. Certain Internucleoside Linkage Motifs

In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, essentially each internucleoside linking group is a phosphate internucleoside linkage (P═O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate (P═S). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is independently selected from a phosphorothioate and phosphate internucleoside linkage. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphate linkages. In certain embodiments, the terminal internucleoside linkages are modified.

4. Certain Modified Oligonucleotides

In certain embodiments, compounds described herein comprise modified oligonucleotides. In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification, motifs, and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif. Likewise, such gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Furthermore, in certain instances, an oligonucleotide is described by an overall length or range and by lengths or length ranges of two or more regions (e.g., a regions of nucleosides having specified sugar modifications), in such circumstances it may be possible to select numbers for each range that result in an oligonucleotide having an overall length falling outside the specified range. In such circumstances, both elements must be satisfied. For example, in certain embodiments, a modified oligonucleotide consists of 15-20 linked nucleosides and has a sugar motif consisting of three regions, A, B, and C, wherein region A consists of 2-6 linked nucleosides having a specified sugar motif, region B consists of 6-10 linked nucleosides having a specified sugar motif, and region C consists of 2-6 linked nucleosides having a specified sugar motif. Such embodiments do not include modified oligonucleotides where A and C each consist of 6 linked nucleosides and B consists of 10 linked nucleosides (even though those numbers of nucleosides are permitted within the requirements for A, B, and C) because the overall length of such oligonucleotide is 22, which exceeds the upper limit of the overall length of the modified oligonucleotide (20). Herein, if a description of an oligonucleotide is silent with respect to one or more parameter, such parameter is not limited. Thus, a modified oligonucleotide described only as having a gapmer sugar motif without further description may have any length, internucleoside linkage motif, and nucleobase motif Unless otherwise indicated, all modifications are independent of nucleobase sequence.

Certain Conjugated Compounds

In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2′-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3′ and/or 5′-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3′-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5′-end of oligonucleotides.

In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of a compound has a nucleobase sequence that is complementary to a target nucleic acid. In certain embodiments, oligonucleotides are complementary to a messenger RNA (mRNA). In certain embodiments, oligonucleotides are complementary to a sense transcript.

Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

A. Certain Conjugate Groups

In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.

Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic, a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), -an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, i, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; doi: 10.1038/mtna.2014.72 and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014/179620).

1. Conjugate Moieties

Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

2. Conjugate Linkers

Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain compounds, a conjugate group is a single chemical bond (i.e. conjugate moiety is attached to an oligonucleotide via a conjugate linker through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.

In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C₁-C₁₀ alkyl, substituted or unsubstituted C₂-C₁₀ alkenyl or substituted or unsubstituted C₂-C₁₀ alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which a compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, a compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such a compound is more than 30. Alternatively, an compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such a compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.

In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate may comprise one or more cleavable moieties, typically within the conjugate linker. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.

In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, one or more linker-nucleosides are linked to one another and/or to the remainder of the compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2′-deoxy nucleoside that is attached to either the 3′ or 5′-terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2′-deoxyadenosine.

Compositions and Methods for Formulating Pharmaceutical Compositions

Compounds described herein may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

Certain embodiments provide pharmaceutical compositions comprising one or more compounds or a salt thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds comprise or consist of a modified oligonucleotide. In certain such embodiments, the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more compound. In certain embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more compound and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more compound and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

A compound described herein targeted to YAP1 nucleic acid can be utilized in pharmaceutical compositions by combining the compound with a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising a compound targeted to YAP1 nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is water. In certain embodiments, the compound comprises or consists of a modified oligonucleotide provided herein.

Pharmaceutical compositions comprising compounds provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

A prodrug can include the incorporation of additional nucleosides at one or both ends of a compound which are cleaved by endogenous nucleases within the body, to form the active compound.

In certain embodiments, the compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent.

EXAMPLES

The Examples below describe the screening process to identify lead compounds targeted to YAP1. Out of over 3,000 oligonucleotides that were screened, ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872 emerged as the top lead compounds. In particular, ION 1198440 exhibited the best combination of properties in terms of potency and tolerability out of over 3,000 oligonucleotides.

Non-Limiting Disclosure and Incorporation by Reference

Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2′-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2′-OH for the natural 2′-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) for natural uracil of RNA).

Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligonucleotide having the nucleobase sequence “ATCGATCG” encompasses any oligonucleotides having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and compounds having other modified nucleobases, such as “AT^mCGAUCG,” wherein ^mC indicates a cytosine base comprising a methyl group at the 5-position.

While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.

Example 1: Antisense Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers

Modified oligonucleotides were designed to target a Yap1 nucleic acid and were tested for their effect on Yap1 mRNA level in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured A-431 cells at a density of 5,000 cells per well were treated using free uptake with 2,000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and Yap1 mRNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS4814 (forward sequence GGGAAGTGAGCCTGTTTGGA, designated herein as SEQ ID NO.: 11; reverse sequence ACTGTTGAACAAACTAAATGCTGTGA, designated herein as SEQ ID NO.: 12; probe sequence ATGGATGCCATTCCTTTTGCCCAGTT, designated herein as SEQ ID NO.: 13) was used to measure mRNA levels. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). The modified oligonucleotides with percent control values marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides targeting the amplicon region.

The newly designed modified oligonucleotides in the Tables below were designed as 3-10-3 cEt gapmers. The gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on the 5′ direction and the 3′ direction comprising three nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a cEt sugar modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P═S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.

“Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either SEQ ID NO.: 1 (GENBANK Accession No. NM_001282101.1), or SEQ ID NO.: 2 (GENBANK Accession No. NC_000011.10 truncated from nucleotides 102107001 to 102236000). ‘N/A’ indicates that the modified oligonucleotide does not target that particular gene sequence with 10000 complementarity. ‘N.D.’ indicates that the % UTC is not defined for that particular modified oligonucleotide in that particular experiment. Activity of the modified oligonucleotide may be defined in a different experiment.

TABLE 1
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1 and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2		YAP1
Compound	Start	Stop	Start	Stop		(%	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	UTC)	ID NO
715400	559	574	4019	4034	CTCCGAGTCCCCGCGG	107	23
715403	658	673	4118	4133	GAAGGAGTCGGGCAGC	72	24
715406	664	679	4124	4139	CTTGAAGAAGGAGTCG	58	25
715409	704	719	N/A	N/A	CAGTACTGGCCTGTCG	76	26
715412	710	725	7144	7159	CTGCATCAGTACTGGC	66	27
715415	744	759	7178	7193	CGAACATGCTGTGGAG	24	28
715418	798	813	7232	7247	AGTGTCCCAGGAGAAA	126	29
715421	949	964	N/A	N/A	GTGATTTAAGAAGTAT	71	30
715424	972	987	55467	55482	TGCCATGTTGTTGTCT	58	31
715427	1081	1096	79022	79037	CCATCCATCAGGAAGA	90	32
715430	1102	1117	79043	79058	ATCCTGAGTCATGGCT	118	33
715433	1133	1148	79074	79089	TGTTCTTATGGTTTAT	36	34
715436	1178	1193	N/A	N/A	TGGCAAAACGAGGGTC	126	35
715439	1184	1199	N/A	N/A	GGTTCATGGCAAAACG	99	36
715442	1210	1225	98912	98927	CACTGGAGCACTCTGA	64	37
715445	1460	1475	116649	116664	CATCCTGCTCCAGTGT	87	38
715448	1509	1524	116698	116713	CTCAATTCCTGAGACA	97	39
715451	1516	1531	116705	116720	CATTGTTCTCAATTCC	75	40
715454	1558	1573	N/A	N/A	ATAGGTGCCACTGTTA	78	41
715457	1564	1579	120469	120484	AGAGTGATAGGTGCCA	47	42
715460	1570	1585	120475	120490	ATCTCGAGAGTGATAG	114	43
715463	1608	1623	120513	120528	CTGTAGCTGCTCATGC	73	44
715466	1751	1766	122776	122791	CAAGGTCCACATTTGT	83	45
715469	1870	1885	122895	122910	TAGCTTGGTGGCAGCC	94	46
715472	1876	1891	122901	122916	TTTATCTAGCTTGGTG	52	47
715475	1883	1898	122908	122923	AGCTTTCTTTATCTAG	103	48
715478	3560	3575	124585	124600	ACCATTATTACTCCTG	7	49
715481	3566	3581	124591	124606	TTGGAAACCATTATTA	66	50
715484	3572	3587	101152	101167	TACTCTTTGGAAACCA	123	51
			124597	124612
715487	3630	3645	124655	124670	ATTACTTCATAGCTTA	22	52
715490	3636	3651	124661	124676	CCAACTATTACTTCAT	38	53
715493	3665	3680	124690	124705	GTGCTAGCTGGTGCCA	62	54
715496	3720	3735	124745	124760	CCCTTGAAAATAAGGG	124	55
715499	3726	3741	124751	124766	TATGAACCCTTGAAAA	126	56
715502	4011	4026	125036	125051	CCAGACTTAATTCAAG	91	57
715505	4684	4699	125709	125724	ATTGGTTTATTGTAAA	84	58
715508	1397	1412	102529	102544	CTGTGCTGGGATTGAT	24	59
715511	1419	1434	N/A	N/A	TCCTGACATTTTGGAG	107	60
715514	N/A	N/A	4573	4588	GAGCGAAGGTGCGGAG	121	61
715517	N/A	N/A	5151	5166	GGCCTATGAGTCAACC	109	62
715520	N/A	N/A	5544	5559	TTCTTTCCACTCAAGT	122	63
715523	N/A	N/A	7140	7155	ATCAGTACTGGCCTAT	32	64
715526	N/A	N/A	7385	7400	ACTTACTTTAAGAAGT	112	65
715529	N/A	N/A	8646	8661	TGAAACCTGATCCTTT	148	66
715532	N/A	N/A	8820	8835	TAACAACCTGGTTTGT	91	67
715535	N/A	N/A	8906	8921	CTATTAAGCTGTTTAA	91	68
715538	N/A	N/A	10383	10398	CTTTGTAACTTAAAAG	110	69
715541	N/A	N/A	10918	10933	CTTGAAGAACTATTTC	105	70
715544	N/A	N/A	10924	10939	CAACTACTTGAAGAAC	128	71
715547	N/A	N/A	10930	10945	GTTGACCAACTACTTG	98	72
715550	N/A	N/A	10938	10953	AGGAAGTTGTTGACCA	70	73
715553	N/A	N/A	10944	10959	AGAAATAGGAAGTTGT	90	74
715556	N/A	N/A	10965	10980	AAGTTATTCAGCAGCT	63	75
715559	N/A	N/A	28556	28571	CTGCCATTTAAGAAAT	114	76
715562	N/A	N/A	37601	37616	CACACAACTCAGACAG	77	77
715565	N/A	N/A	37826	37841	GGATAAATGAATTATA	115	78
715568	N/A	N/A	37832	37847	AAGGTAGGATAAATGA	116	79
715571	N/A	N/A	105518	105533	AAAATCCTGCCAACAT	127	80
715574	N/A	N/A	79119	79134	TACCAAAACGAGGGTC	118	81
715577	N/A	N/A	80085	80100	GCATTCACAGAGTTAA	21	82
715580	N/A	N/A	80919	80934	GCCTGTCTGGAATACA	101	83
715583	N/A	N/A	80954	80969	GGGCCACAAAATAAAA	164	84
715586	N/A	N/A	80980	80995	AAAAGGTCTGGAACAG	53	85
715589	N/A	N/A	81086	81101	CCAGCAGCTAACAGCT	107	86
715592	N/A	N/A	81151	81166	TTCTTTGGCAGAGATA	89	87
715595	N/A	N/A	98883	98898	TCATGGCTGAAATGAA	104	88
715598	N/A	N/A	102395	102410	CCCAAGCTACCCAAGA	103	89
715601	N/A	N/A	102401	102416	AGAATTCCCAAGCTAC	106	90
715604	N/A	N/A	102407	102422	TAGCACAGAATTCCCA	107	91
715607	N/A	N/A	102413	102428	TCACCATAGCACAGAA	116	92
715610	N/A	N/A	102451	102466	GGCTGTGTAGGCTGAC	87	93
715613	N/A	N/A	102473	102488	ATTACTTTAAGCCACA	85	94
715616	N/A	N/A	102484	102499	GACGGATAAAAATTAC	95	95
715619	N/A	N/A	102490	102505	AAATAAGACGGATAAA	114	96
715622	N/A	N/A	102496	102511	AGTAAAAAATAAGACG	137	97
715625	N/A	N/A	102506	102521	ATTGCCTAAGAGTAAA	99	98
715628	N/A	N/A	102555	102570	GCCTACCTGACATTTT	114	99
715631	N/A	N/A	102561	102576	ATAAGAGCCTACCTGA	134	100

TABLE 2
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1 and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2		YAP1
Compound	Start	Stop	Start	Stop		(%	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	UTC)	ID NO
715401	562	577	4022	4037	GGTCTCCGAGTCCCCG	84	101
715404	660	675	4120	4135	AAGAAGGAGTCGGGCA	64	102
715407	666	681	4126	4141	GGCTTGAAGAAGGAGT	53	103
715410	706	721	N/A	N/A	ATCAGTACTGGCCTGT	61	104
715413	740	755	7174	7189	CATGCTGTGGAGTCAG	96	105
715416	746	761	7180	7195	CTCGAACATGCTGTGG	53	106
715419	929	944	7363	7378	GACCAGAAGATGTCTT	107	107
715422	968	983	55463	55478	ATGTTGTTGTCTGATC	57	108
715425	976	991	55471	55486	GTCCTGCCATGTTGTT	98	109
715428	1083	1098	79024	79039	TCCCATCCATCAGGAA	106	110
715431	1104	1119	79045	79060	CCATCCTGAGTCATGG	99	111
715434	1136	1151	79077	79092	TCTTGTTCTTATGGTT	31	112
715437	1180	1195	N/A	N/A	CATGGCAAAACGAGGG	89	113
715440	1186	1201	N/A	N/A	CTGGTTCATGGCAAAA	85	114
715443	1212	1227	98914	98929	TTCACTGGAGCACTCT	40	115
715446	1505	1520	116694	116709	ATTCCTGAGACATCCC	81	116
715449	1511	1526	116700	116715	TTCTCAATTCCTGAGA	124	117
715452	1518	1533	116707	116722	GTCATTGTTCTCAATT	71	118
715455	1560	1575	N/A	N/A	TGATAGGTGCCACTGT	65	119
715458	1566	1581	120471	120486	CGAGAGTGATAGGTGC	58	120
715461	1572	1587	120477	120492	TCATCTCGAGAGTGAT	153	121
715464	1745	1760	122770	122785	CCACATTTGTCCCAGG	89	122
715467	1769	1784	122794	122809	CATCTCCTTCCAGTGT	77	123
715470	1872	1887	122897	122912	TCTAGCTTGGTGGCAG	83	124
715473	1878	1893	122903	122918	TCTTTATCTAGCTTGG	32	125
715476	1885	1900	122910	122925	AAAGCTTTCTTTATCT	84	126
715479	3562	3577	124587	124602	AAACCATTATTACTCC	38	127
715482	3568	3583	124593	124608	CTTTGGAAACCATTAT	58	128
715485	3574	3589	124599	124614	AATACTCTTTGGAAAC	72	129
715488	3632	3647	124657	124672	CTATTACTTCATAGCT	66	130
715491	3638	3653	124663	124678	AACCAACTATTACTTC	71	131
715494	3668	3683	124693	124708	GAGGTGCTAGCTGGTG	46	132
715497	3722	3737	124747	124762	AACCCTTGAAAATAAG	155	133
715500	3966	3981	11043	11058	AAGCCTTAGAGTCAAT	30	134
			124991	125006
715503	4013	4028	125038	125053	CCCCAGACTTAATTCA	136	135
715506	4686	4701	125711	125726	AAATTGGTTTATTGTA	112	136
715509	1399	1414	102531	102546	TGCTGTGCTGGGATTG	42	137
715512	N/A	N/A	4550	4565	AGGCGCGCGCATTGTG	97	138
715515	N/A	N/A	5147	5162	TATGAGTCAACCTGCA	94	139
715518	N/A	N/A	5477	5492	TTTGGGCAAAGTTCCT	60	140
715521	N/A	N/A	5546	5561	TCTTCTTTCCACTCAA	72	141
715524	N/A	N/A	7381	7396	ACTTTAAGAAGTATCT	93	142
715527	N/A	N/A	7387	7402	TCACTTACTTTAAGAA	111	143
715530	N/A	N/A	8816	8831	AACCTGGTTTGTTTCC	61	144
715533	N/A	N/A	8822	8837	CCTAACAACCTGGTTT	97	145
715536	N/A	N/A	8908	8923	GGCTATTAAGCTGTTT	137	146
715539	N/A	N/A	10637	10652	AGATCTCACTGACCTA	102	147
715542	N/A	N/A	10920	10935	TACTTGAAGAACTATT	120	148
715545	N/A	N/A	10926	10941	ACCAACTACTTGAAGA	87	149
715548	N/A	N/A	10934	10949	AGTTGTTGACCAACTA	117	150
715551	N/A	N/A	10940	10955	ATAGGAAGTTGTTGAC	82	151
715554	N/A	N/A	10961	10976	TATTCAGCAGCTTATA	93	152
715557	N/A	N/A	10967	10982	GGAAGTTATTCAGCAG	46	153
715560	N/A	N/A	37563	37578	CCCTTTACAAAAATAG	98	154
715563	N/A	N/A	37603	37618	AGCACACAACTCAGAC	86	155
715566	N/A	N/A	37828	37843	TAGGATAAATGAATTA	94	156
715569	N/A	N/A	37834	37849	CAAAGGTAGGATAAAT	122	157
715572	N/A	N/A	78867	78882	TCAGAGAAGAAAGGTA	97	158
715575	N/A	N/A	79123	79138	CCTTTACCAAAACGAG	134	159
715578	N/A	N/A	80087	80102	TGGCATTCACAGAGTT	50	160
715581	N/A	N/A	80921	80936	AAGCCTGTCTGGAATA	106	161
715584	N/A	N/A	80976	80991	GGTCTGGAACAGATTA	96	162
715587	N/A	N/A	80982	80997	TGAAAAGGTCTGGAAC	79	163
715590	N/A	N/A	81147	81162	TTGGCAGAGATAAAAC	84	164
715593	N/A	N/A	81153	81168	ATTTCTTTGGCAGAGA	60	165
715596	N/A	N/A	98885	98900	GTTCATGGCTGAAATG	104	166
715599	N/A	N/A	102397	102412	TTCCCAAGCTACCCAA	82	167
715602	N/A	N/A	102403	102418	ACAGAATTCCCAAGCT	110	168
715605	N/A	N/A	102409	102424	CATAGCACAGAATTCC	112	169
715608	N/A	N/A	102430	102445	AATTGTATCCAGACAT	100	170
715611	N/A	N/A	102469	102484	CTTTAAGCCACATGGT	106	171
715614	N/A	N/A	102475	102490	AAATTACTTTAAGCCA	110	172
715617	N/A	N/A	102486	102501	AAGACGGATAAAAATT	98	173
715620	N/A	N/A	102492	102507	AAAAATAAGACGGATA	111	174
715623	N/A	N/A	102502	102517	CCTAAGAGTAAAAAAT	113	175
715626	N/A	N/A	102551	102566	ACCTGACATTTTGGAG	64	176
715629	N/A	N/A	102557	102572	GAGCCTACCTGACATT	112	177
715632	N/A	N/A	109609	109624	ATCCAATTATGTCCCA	109	178

TABLE 3
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1 and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2		YAP1
Compound	Start	Stop	Start	Stop		(%	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	UTC)	ID NO
715402	656	671	4116	4131	AGGAGTCGGGCAGCTT	59	179
715405	662	677	4122	4137	TGAAGAAGGAGTCGGG	60	180
715408	668	683	4128	4143	GCGGCTTGAAGAAGGA	60	181
715411	708	723	7142	7157	GCATCAGTACTGGCCT	94	182
715414	742	757	7176	7191	AACATGCTGTGGAGTC	31	183
715417	749	764	7183	7198	GAGCTCGAACATGCTG	104	184
715420	947	962	N/A	N/A	GATTTAAGAAGTATCT	107	185
715423	970	985	55465	55480	CCATGTTGTTGTCTGA	30	186
715426	1079	1094	79020	79035	ATCCATCAGGAAGAGG	80	187
715429	1100	1115	79041	79056	CCTGAGTCATGGCTTG	62	188
715432	1106	1121	79047	79062	CTCCATCCTGAGTCAT	65	189
715435	1138	1153	79079	79094	GGTCTTGTTCTTATGG	36	190
715438	1182	1197	N/A	N/A	TTCATGGCAAAACGAG	82	191
715441	1188	1203	N/A	N/A	CTCTGGTTCATGGCAA	57	192
715444	1249	1264	98951	98966	TCCCTGTGGGCTCTGG	84	193
715447	1507	1522	116696	116711	CAATTCCTGAGACATC	81	194
715450	1514	1529	116703	116718	TTGTTCTCAATTCCTG	53	195
715453	1556	1571	N/A	N/A	AGGTGCCACTGTTAAG	59	196
715456	1562	1577	120467	120482	AGTGATAGGTGCCACT	96	197
715459	1568	1583	120473	120488	CTCGAGAGTGATAGGT	93	198
715462	1574	1589	120479	120494	TCTCATCTCGAGAGTG	94	199
715465	1747	1762	122772	122787	GTCCACATTTGTCCCA	91	200
715468	1868	1883	122893	122908	GCTTGGTGGCAGCCAA	90	201
715471	1874	1889	122899	122914	TATCTAGCTTGGTGGC	36	202
715474	1881	1896	122906	122921	CTTTCTTTATCTAGCT	78	203
715477	3543	3558	124568	124583	AGACACATACTCTAGT	61	204
715480	3564	3579	124589	124604	GGAAACCATTATTACT	23	205
715483	3570	3585	124595	124610	CTCTTTGGAAACCATT	15	206
715486	3628	3643	124653	124668	TACTTCATAGCTTATA	27	207
715489	3634	3649	124659	124674	AACTATTACTTCATAG	90	208
715492	3663	3678	124688	124703	GCTAGCTGGTGCCACT	76	209
715495	3671	3686	124696	124711	ACAGAGGTGCTAGCTG	80	210
715498	3724	3739	124749	124764	TGAACCCTTGAAAATA	91	211
715501	3968	3983	64588	64603	AAAAGCCTTAGAGTCA	28	212
			124993	125008
715504	4682	4697	125707	125722	TGGTTTATTGTAAAAG	70	213
715507	1391	1406	102523	102538	TGGGATTGATATTCCG	95	214
715510	1402	1417	102534	102549	ATTTGCTGTGCTGGGA	22	215
715513	N/A	N/A	4554	4569	GCGGAGGCGCGCGCAT	125	216
715516	N/A	N/A	5149	5164	CCTATGAGTCAACCTG	77	217
715519	N/A	N/A	5540	5555	TTCCACTCAAGTTACA	96	218
715522	N/A	N/A	5548	5563	ACTCTTCTTTCCACTC	87	219
715525	N/A	N/A	7383	7398	TTACTTTAAGAAGTAT	100	220
715528	N/A	N/A	8644	8659	AAACCTGATCCTTTGA	98	221
715531	N/A	N/A	8818	8833	ACAACCTGGTTTGTTT	94	222
715534	N/A	N/A	8885	8900	TCCCCAGGTCAGCATG	112	223
715537	N/A	N/A	10155	10170	ACTTGGCACCAAAAGC	122	224
715540	N/A	N/A	10916	10931	TGAAGAACTATTTCCT	82	225
715543	N/A	N/A	10922	10937	ACTACTTGAAGAACTA	72	226
715546	N/A	N/A	10928	10943	TGACCAACTACTTGAA	59	227
715549	N/A	N/A	10936	10951	GAAGTTGTTGACCAAC	66	228
715552	N/A	N/A	10942	10957	AAATAGGAAGTTGTTG	86	229
715555	N/A	N/A	10963	10978	GTTATTCAGCAGCTTA	21	230
715558	N/A	N/A	10969	10984	CAGGAAGTTATTCAGC	37	231
715561	N/A	N/A	37599	37614	CACAACTCAGACAGGG	69	232
715564	N/A	N/A	37605	37620	CAAGCACACAACTCAG	75	233
715567	N/A	N/A	37830	37845	GGTAGGATAAATGAAT	99	234
715570	N/A	N/A	37836	37851	GCCAAAGGTAGGATAA	79	235
715573	N/A	N/A	64347	64362	TATATATGGTAGTCTA	76	236
715576	N/A	N/A	79125	79140	AACCTTTACCAAAACG	80	237
715579	N/A	N/A	80917	80932	CTGTCTGGAATACACA	100	238
715582	N/A	N/A	80924	80939	GTCAAGCCTGTCTGGA	33	239
715585	N/A	N/A	80978	80993	AAGGTCTGGAACAGAT	73	240
715588	N/A	N/A	81084	81099	AGCAGCTAACAGCTTG	96	241
715591	N/A	N/A	81149	81164	CTTTGGCAGAGATAAA	41	242
715594	N/A	N/A	81155	81170	ATATTTCTTTGGCAGA	39	243
715597	N/A	N/A	98888	98903	CTGGTTCATGGCTGAA	89	244
715600	N/A	N/A	102399	102414	AATTCCCAAGCTACCC	82	245
715603	N/A	N/A	102405	102420	GCACAGAATTCCCAAG	106	246
715606	N/A	N/A	102411	102426	ACCATAGCACAGAATT	88	247
715609	N/A	N/A	102448	102463	TGTGTAGGCTGACTTA	56	248
715612	N/A	N/A	102471	102486	TACTTTAAGCCACATG	77	249
715615	N/A	N/A	102482	102497	CGGATAAAAATTACTT	94	250
715618	N/A	N/A	102488	102503	ATAAGACGGATAAAAA	101	251
715621	N/A	N/A	102494	102509	TAAAAAATAAGACGGA	106	252
715624	N/A	N/A	102504	102519	TGCCTAAGAGTAAAAA	123	253
715627	N/A	N/A	102553	102568	CTACCTGACATTTTGG	88	254
715630	N/A	N/A	102559	102574	AAGAGCCTACCTGACA	94	255
715633	N/A	N/A	120466	120481	GTGATAGGTGCCACTA	78	256

Example 2: Antisense Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers

Modified oligonucleotides were designed to target a Yap1 nucleic acid and were tested for their effect on Yap1 mRNA level in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured A-431 cells at a density of 5,000 cells per well were treated using free uptake with 2,000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and Yap1 mRNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS4814 was used to measure mRNA levels. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). The modified oligonucleotides with percent control values marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides targeting the amplicon region.

The newly designed modified oligonucleotides in the Tables below were designed as 3-10-3 cEt gapmers. The gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on the 5′ direction and the 3′ direction comprising three nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a cEt sugar modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P═S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.

“Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Gapmers listed in the Tables below are targeted to either SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 (GENBANK Accession No. NM_006106.4), or SEQ ID NO: 4 (GENBANK Accession No. NM_001130145.2). ‘N/A’ indicates that the modified oligonucleotide does not target that particular gene sequence with 100% complementarity. ‘N.D.’ indicates that the % UTC is not defined for that particular modified oligonucleotide in that particular experiment. Activity of the modified oligonucleotide may be defined in a different experiment.

TABLE 4
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1 and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2		YAP1
Compound	Start	Stop	Start	Stop		(%	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	UTC)	ID NO
716346	1	16	3461	3476	TTTCCCTGGCGGCGGC	77	257
716349	107	122	3567	3582	ACTTTTTCCCTCCAAC	78	258
716352	184	199	3644	3659	CTGCGCCCCGGCTCCA	105	259
716355	279	294	3739	3754	GACGGCTGCGGGCCGG	96	260
716358	331	346	3791	3806	CGAGGGCTACGCCCGG	104	261
716361	405	420	3865	3880	GGTTGAGGCGGCGGCT	75	262
716364	493	508	3953	3968	CGCCGCGGGTGCCGGT	110	263
716367	631	646	4091	4106	CATGGGCACGGTCTGG	70	264
716370	716	731	7150	7165	CAGTGCCTGCATCAGT	25	265
716373	775	790	7209	7224	CAACTGCAGAGAAGCT	69	266
716376	855	870	7289	7304	CGAAGATGCTGAGCTG	35	267
716379	927	942	7361	7376	CCAGAAGATGTCTTTG	123	268
716382	993	1008	55488	55503	AGCATGGCCTTCCTGG	73	269
716385	1084	1099	79025	79040	TTCCCATCCATCAGGA	87	270
716388	1144	1159	79085	79100	AGAGGTGGTCTTGTTC	55	271
716391	1206	1221	98908	98923	GGAGCACTCTGACTGA	44	272
716394	1304	1319	99006	99021	GTTGCTGCAGTCGCAT	120	273
716397	1365	1380	99067	99082	GGCCTCACCTGCCGAA	88	274
716400	1423	1438	N/A	N/A	TAACTCCTGACATTTT	106	275
716403	1491	1506	116680	116695	CCGGGAGAAGACACTG	110	276
716406	1576	1591	120481	120496	ACTCTCATCTCGAGAG	117	277
716409	1636	1651	120541	120556	CAGGAAGTCATCTGGG	99	278
716412	1717	1732	122742	122757	GTAGTCTGGGAAACGG	41	279
716415	1794	1809	122819	122834	AGCTCCTCTCCTTCTA	90	280
716418	1910	1925	122935	122950	CCTGAGGGCTCTATAA	75	281
716421	1996	2011	123021	123036	TATTAGCCTGAAAACT	86	282
716424	2064	2079	123089	123104	GCAATGGACAAGGAAG	25	283
716427	2170	2185	123195	123210	AGCCCCCAAAATGAAC	86	284
716430*	2221	2236	123246	123261	TAACTGGGCAAAAGGA	28	285
716433*	2272	2287	123297	123312	AGCATCTGACTTCTAA	20	286
716436	2329	2344	123354	123369	ACTGGACAAAGGAAGC	59	287
716439	2387	2402	123412	123427	GTATTTAATATCAGAT	77	288
716442	2466	2481	123491	123506	GCACTAGGAGGAAAAG	63	289
716445	2559	2574	123584	123599	GTATGTGGCAATAATT	28	290
716448	2683	2698	123708	123723	CCGACAAAACCAACCA	62	291
716451	2734	2749	123759	123774	CCCAAGCTACAACTAT	67	292
716454	2803	2818	123828	123843	CGAGATTTAAATAAGG	27	293
716457	2883	2898	123908	123923	AAAGGATACATTCCAC	61	294
716460	2946	2961	123971	123986	TATTCTAAATGCATAC	86	295
716463	2998	3013	124023	124038	GACTGCCCCAACCAGA	64	296
716466	3071	3086	124096	124111	GTGGAGCACTCCCCTA	58	297
716469	3122	3137	124147	124162	GTTTGCTCCTTTCCAA	25	298
716472	3204	3219	124229	124244	GTCATGCACATTATGA	78	299
716475	3272	3287	124297	124312	CTTCCAAAACTAAGGC	63	300
716478	3330	3345	124355	124370	TATTTTAATCTAGTCG	46	301
716481	3382	3397	121835	121850	TCAGCATAGAAGTAGG	23	302
			124407	124422
716484	3433	3448	124458	124473	CACTTTTCCAGCTAAC	35	303
716487	3541	3556	42912	42927	ACACATACTCTAGTTA	64	304
			124566	124581
716490	3640	3655	124665	124680	ACAACCAACTATTACT	63	305
716493	3692	3707	124717	124732	ACATTGAAAGACCCTT	30	306
716496	3745	3760	124770	124785	GAAGAGATTTTATGCC	19	307
716499	3852	3867	124877	124892	TTTTGCCCTCCTCCAA	102	308
716502	3913	3928	124938	124953	CACAGTGATTGCATTT	11	309
716505	3996	4011	125021	125036	GATTTAATCTTTCTGC	35	310
716508	4065	4080	125090	125105	CTAGGTAGAATTTCAT	67	311
716511	4131	4146	125156	125171	GATCTTCTGCACATTA	51	312
716514	4201	4216	125226	125241	GCTGATATATAAGATA	68	313
716517	4255	4270	125280	125295	TTCACAACCCCCCCCC	53	314
716520	4312	4327	125337	125352	AGTCTTTATTAAAGAG	96	315
716523	4426	4441	125451	125466	CAAATTAAAGTTGAGG	37	316
716526	4481	4496	125506	125521	TCAAAGCACTGTGCCA	88	317
716529	4544	4559	125569	125584	CAAACTCAAAAAGGGA	61	318
716532	4615	4630	125640	125655	CAAGAAGCAGTTAAGC	70	319
716535	4737	4752	125762	125777	CCTGACTGAAAATAAC	86	320
716538	4789	4804	125814	125829	TCTGAAACTCCAAATC	77	321
716541	4840	4855	125865	125880	TAAAGGCACTACATTT	92	322
716544	4898	4913	125923	125938	TACTTAACACAGCAAC	71	323
716547	4986	5001	44309	44324	GGTATGAATTCTGAAT	44	324
			126011	126026
716550	5037	5052	126062	126077	GCACTGAATATTGCCA	77	325
716553	5088	5103	126113	126128	ATCCACCTGAGCACTC	54	326
716556	5211	5226	126236	126251	GCATTAAAGAATTCTC	39	327
716559	5294	5309	126319	126334	CCTAACATATGAGCAT	62	328
716565	N/A	N/A	5516	5531	GGGCTAACTACATTGC	129	329
716568	N/A	N/A	5640	5655	GATTTTTTCTGAGTTC	72	330
716574	N/A	N/A	11831	11846	TACACTGTATATGTTC	91	331
			11769	11784
716577	N/A	N/A	58766	58781	TCTGTCAGTTATCCTA	21	332
			58782	58797

TABLE 5
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1 and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2		YAP1
Compound	Start	Stop	Start	Stop		(%	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	UTC)	ID NO
716347	64	79	3524	3539	TGCCTTTCCCCGCCTC	85	333
716350	129	144	3589	3604	CTCGGACCTGCGGCGC	99	334
716353	216	231	3676	3691	GCATCCCCCGCCCCGG	98	335
716356	296	311	3756	3771	CGAGGTGGAGAAGCGG	112	336
716359	348	363	3808	3823	CCCCTGACCCAGGCGA	101	337
716362	433	448	3893	3908	AGGCGGCTGCCCTTGG	94	338
716365	533	548	3993	4008	TCTGATGCCCGGCGGG	83	339
716368	652	667	4112	4127	GTCGGGCAGCTTCCGG	86	340
716371	733	748	7167	7182	TGGAGTCAGGGCTCCT	115	341
716374	802	817	7236	7251	GGTCAGTGTCCCAGGA	54	342
716377	876	891	7310	7325	GGTATCTCAAAAGAAG	76	343
716380	944	959	7378	7393	TTAAGAAGTATCTCTG	54	344
716383	1049	1064	55544	55559	TCATCATATTCTGCTG	98	345
716386	1110	1125	79051	79066	ATTTCTCCATCCTGAG	60	346
716389	1161	1176	79102	79117	AGCCTTGGGTCTAGCC	93	347
716392	1266	1281	98968	98983	CTGCCACCCATGACGC	95	348
716395	1331	1346	99033	99048	GCCGCAGCCTCTCCTT	92	349
716398	1382	1397	N/A	N/A	TATTCCGCATTGCCTG	70	350
716401	1440	1455	116629	116644	AACTGGCTACGCAGGG	92	351
716404	1519	1534	116708	116723	CGTCATTGTTCTCAAT	63	352
716407	1593	1608	120498	120513	CTTAGTCCACTGTCTG	35	353
716410	1668	1683	N/A	N/A	GTATCACCTGTATCCA	52	354
716413	1753	1768	122778	122793	TCCAAGGTCCACATTT	79	355
716416	1834	1849	122859	122874	AAGGATGTCAGAACTC	45	356
716419	1962	1977	122987	123002	TTTCCGGTGCATGTGT	36	357
716422	2030	2045	123055	123070	AGTATCTTGCTGGACG	39	358
716425	2081	2096	123106	123121	GCAATACATTAACAGC	71	359
716428*	2187	2202	123212	123227	ACAGGCTCACTTCCCC	10	360
716431*	2238	2253	123263	123278	AATGATTGGTGAACAT	55	361
716434*	2289	2304	123314	123329	TAAATGCTGTGACATG	44	362
716437	2349	2364	123374	123389	CCAGTAAATCATGTTT	41	363
716440	2406	2421	123431	123446	CTCTTCAAATCAGCAT	45	364
716443	2483	2498	123508	123523	TTATGTGACTAATGAT	73	365
716446	2597	2612	123622	123637	GCACACCCACAAAATT	83	366
716449	2700	2715	123725	123740	GGTCATTTGCCTAGGT	49	367
716452	2759	2774	123784	123799	TTACCAAAACAACTAC	98	368
716455	2849	2864	123874	123889	GTTATGTTTGGGTGTG	17	369
716458	2900	2915	123925	123940	AAGCAGGGAAACCTAA	94	370
716461	2963	2978	123988	124003	ATAAACTACTAGTCAT	123	371
716464	3015	3030	124040	124055	TACTTCAAACATCTGC	62	372
716467	3088	3103	124113	124128	CCGTATGCCCAGAGGG	99	373
716470	3170	3185	124195	124210	AATCGAGACTTAAAAA	104	374
716473	3221	3236	124246	124261	CTATAAAGCTTATTTC	104	375
716476	3292	3307	124317	124332	GAACTACAAACTAGAA	91	376
716479	3348	3363	124373	124388	GAACAATCTTGAAGGC	32	377
716482	3399	3414	124424	124439	CTATCCAGGGTCAATT	83	378
716485	3461	3476	124486	124501	ACTACCAATATACATT	84	379
716488	3558	3573	38751	38766	CATTATTACTCCTGTA	67	380
			124583	124598
716491	3658	3673	124683	124698	CTGGTGCCACTTTAAT	54	381
716494	3709	3724	124734	124749	AAGGGCTTATTCTAGA	112	382
716497	3762	3777	124787	124802	AGCAGCTTTTGCCAGG	65	383
716500	3869	3884	124894	124909	AACTTCTTACTTCCAA	18	384
716503	3951	3966	124976	124991	TTATTATGAGTGATCA	33	385
716506	4031	4046	125056	125071	TCTGCAGTGGCCATTT	62	386
716509	4083	4098	125108	125123	TATACCCAATTTTGCA	70	387
716512	4150	4165	125175	125190	ACTCCTTCCAAGTAGC	99	388
716515	4218	4233	125243	125258	TAAGCTAAAGCTAATC	123	389
716518	4272	4287	125297	125312	CAAGGTCCCCCTAAAT	88	390
716521	4329	4344	125354	125369	CAGCACGGTGTAAGAC	79	391
716524	4443	4458	125468	125483	ACTGAGGTATAACTGG	35	392
716527	4502	4517	125527	125542	AGTACAGAGGGCATCG	64	393
716530	4561	4576	125586	125601	ACATCAAGGCTATGAT	83	394
716533	4666	4681	125691	125706	CAATTCAAGAATACCC	64	395
716536	4754	4769	125779	125794	AAGTAGATCTAAGAAG	94	396
716539	4806	4821	125831	125846	AATAGTGCTTTGGAAG	59	397
716542	4863	4878	125888	125903	CTTCCCTGTGTTCATT	45	398
716545	4916	4931	125941	125956	GCATGTATTTAATATG	91	399
716548	5003	5018	126028	126043	GAGTTTCAACACTGAT	31	400
716551	5054	5069	126079	126094	CGCTAGAAAAGTGTTA	76	401
716554	5105	5120	126130	126145	ATGCTTGCGAGGATAA	30	402
716557	5243	5258	126268	126283	ATTGGTACTATATATA	80	403
716560	5312	5327	126337	126352	TAACAATTTATGTAAG	107	404
716563	N/A	N/A	5445	5460	TGAAGCAAGTTCTCAA	126	405
716566	N/A	N/A	5552	5567	GGTAACTCTTCTTTCC	102	406
716569	N/A	N/A	5674	5689	CTCCTTAACCCGGGTT	115	407
716572	N/A	N/A	126465	126480	CAGTAAGAAGCCAAAA	122	408
716575	N/A	N/A	30867	30882	AAAGAACTTAGTTCCC	84	409
			31189	31204
716578	N/A	N/A	70445	70460	AACTTTCACATAAACT	102	410
			70695	70710

TABLE 6
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
716348	84	99	3544	3559	ACGGAGGCCGGACAGC	107	411
716351	166	181	3626	3641	GGTCTGGCGGCTGCGC	112	412
716354	251	266	3711	3726	TCGCTCTCAGGGCCGG	114	413
716357	314	329	3774	3789	CGCCCCGGCTCCACGG	127	414
716360	388	403	3848	3863	CTGCCCGGGATCCATG	118	415
716363	467	482	3927	3942	CGGACGGCGGGCCCTG	103	416
716366	568	583	4028	4043	CAGGTCGGTCTCCGAG	95	417
716369	670	685	4130	4145	CGGCGGCTTGAAGAAG	94	418
716372	751	766	7185	7200	ATGAGCTCGAACATGC	61	419
716375	819	834	7253	7268	GAGACTACTCCAGTGG	63	420
716378	893	908	7327	7342	GCAGAGGTACATCATC	44	421
716381	961	976	55456	55471	TGTCTGATCGATGTGA	35	422
716384	1066	1081	N/A	N/A	AGGACCTGAAGCCGAG	71	423
716387	1127	1142	79068	79083	TATGGTTTATATAGTA	33	424
716390	1189	1204	N/A	N/A	TCTCTGGTTCATGGCA	66	425
716393	1285	1300	98987	99002	TTGCTGCTGGTTGGAG	46	426
716396	1348	1363	99050	99065	CAGTTCTTGCTGTTTC	123	427
716399	1403	1418	102535	102550	AATTTGCTGTGCTGGG	40	428
716402	1474	1489	116663	116678	ATTTTGAGTCCCACCA	85	429
716405	1547	1562	116736	116751	TGTTAAGGAAAGGATC	149	430
716408	1610	1625	120515	120530	CACTGTAGCTGCTCAT	54	431
716411	1700	1715	122725	122740	TCTGCTGTGAGGGCAG	102	432
716414	1777	1792	122802	122817	GTTCATTCCATCTCCT	59	433
716417	1891	1906	122916	122931	TGTAAGAAAGCTTTCT	78	434
716420	1979	1994	24076	24091	CAACTGGCTTATGGAA	50	435
			123004	123019
716423	2047	2062	71297	71312	GCAAAATAGAGGATTA	43	436
			123072	123087
716426	2115	2130	123140	123155	TTTGATTCTTTAGAGC	45	437
716429*	2204	2219	123229	123244	TGGCATCCATCATCCA	28	438
716432*	2255	2270	123280	123295	TCTGAGTATTTAGTTA	30	439
716435*	2306	2321	123331	123346	ACAACTGTTGAACAAA	45	440
716438	2366	2381	123391	123406	ATTTTTGGCTTGTCAG	32	441
716441	2423	2438	123448	123463	GCCTTGGTTTCAGCTA	57	442
716444	2528	2543	123553	123568	AAATTGTCTCATGCCT	40	443
716447	2666	2681	123691	123706	CCAACCAACCCCCCCA	97	444
716450	2717	2732	123742	123757	AACAGATTCACTAATA	83	445
716453	2786	2801	123811	123826	GGTAAAAAAAACCAGG	87	446
716456	2866	2881	123891	123906	ACCACACTATTATAAA	96	447
716459	2926	2941	123951	123966	CGCTACCATTTTAAAA	121	448
716462	2981	2996	124006	124021	TTAAACTACCAGTGAA	86	449
716465	3036	3051	124061	124076	GCTCTTTCTAGAACAC	82	450
716468	3105	3120	124130	124145	TCATCAGATAATATCT	118	451
716471	3187	3202	124212	124227	CCTACTCACTGAATTC	48	452
716474	3238	3253	124263	124278	TAAATGAAGGTAAACC	120	453
716477	3309	3324	124334	124349	GTGTTCATTACAAATG	42	454
716480	3365	3380	124390	124405	GCAAGTCTTGTAAGTA	18	455
716483	3416	3431	15582	15597	CAAAACCTTATAGTAT	159	456
			82739	82754
			124441	124456
716486	3494	3509	124519	124534	ATCATGATTATCTCTA	68	457
716489	3606	3621	124631	124646	AGTTAATTCATGCTCG	23	458
716492	3675	3690	124700	124715	AAACACAGAGGTGCTA	72	459
716495	3728	3743	124753	124768	GTTATGAACCCTTGAA	58	460
716498	3833	3848	124858	124873	GAAGGGCCAAAATACT	92	461
716501	3891	3906	124916	124931	GCACTGAAAGTACTTA	32	462
716504	3970	3985	6107	6122	ATAAAAGCCTTAGAGT	112	463
			62583	62598
			124995	125010
716507	4048	4063	125073	125088	ACTACTCTAAAACTCC	53	464
716510	4102	4117	125127	125142	CAACATGCTATGTAAT	122	465
716513	4184	4199	125209	125224	AATCTTAATCTGTGGC	30	466
716516	4237	4252	125262	125277	AACTTTCCCACCCTCC	84	467
716519	4290	4305	125315	125330	GTTTATAAAGTTCTCT	57	468
716522	4363	4378	125388	125403	GTGACTGAAACTCTAG	47	469
716525	4460	4475	125485	125500	CACAGTACTGCTACAA	64	470
716528	4520	4535	125545	125560	TTAGGTCTCCTTCAGG	70	471
716531	4580	4595	125605	125620	GGACATAAAACAAGAG	65	472
716534	4693	4708	125718	125733	GATTATAAAATTGGTT	90	473
716537	4772	4787	125797	125812	ATGTGCTCCATCAACC	36	474
716540	4823	4838	125848	125863	GAAAAGTTATTACAAC	120	475
716543	4880	4895	125905	125920	TATTTGTAGCAAAGTC	35	476
716546	4968	4983	125993	126008	CACAATTAATTACTGT	103	477
716549	5020	5035	126045	126060	CCACTTTTGCAATGTT	44	478
716552	5071	5086	126096	126111	TTTCTCAGATGTACCA	53	479
716555	5167	5182	126192	126207	TACTTTTTCAAGATAC	99	480
716558	5277	5292	126302	126317	CTCTTACATCTAAAAC	81	481
716561	5338	5353	126363	126378	AAGGTATTACATAAGA	58	482
716564	N/A	N/A	5479	5494	CTTTTGGGCAAAGTTC	103	483
716567	N/A	N/A	5599	5614	GACTATACAACAGGCC	134	484
716570	N/A	N/A	5717	5732	AAGTGTTTAGGCAAGC	56	485
716573	N/A	N/A	126516	126531	AGTTACTACTGTAATC	116	486
716576	N/A	N/A	58764	58779	TGTCAGTTATCCTATC	52	487
			58780	58795
716579	N/A	N/A	94212	94227	ATAGAGATTTTCCCTC	84	488
			103505	103520

TABLE 7
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 3, and 4
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 3	NO: 3	NO: 4	NO: 4
Compound	Start	Stop	Start	Stop		YAP1	SEQ ID
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	NO
716562	N/A	N/A	1359	1374	GCCTGCCGAAGCAGTT	103	489
716571	1062	1077	N/A	N/A	GCTGAAGCCGAGTTCA	91	490

Example 3: Antisense Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers

Modified oligonucleotides were designed to target a Yap1 nucleic acid and were tested for their effect on Yap1 mRNA level in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured A-431 cells at a density of 5,000 cells per well were treated using free uptake with 2,000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and Yap1 mRNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS36584 (forward sequence ACGACCAATAGCTCAGATCCT, designated herein as SEQ ID NO.: 14; reverse sequence CACCTGTATCCATCTCATCCAC, designated herein as SEQ ID NO.: 15; probe sequence TGTAGCTGCTCATGCTTAGTCCACTG, designated herein as SEQ ID NO.: 16) was used to measure mRNA levels. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). The modified oligonucleotides with percent control values marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides targeting the amplicon region.

The newly designed modified oligonucleotides in the Tables below were designed as 3-10-3 cEt gapmers. The gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on the 5′ direction and the 3′ direction comprising three nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a cEt sugar modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P═S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.

“Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either SEQ ID NO.: 1 or SEQ ID NO.: 2. ‘N/A’ indicates that the modified oligonucleotide does not target that particular gene sequence with 100% complementarity. ‘N.D.’ indicates that the % UTC is not defined for that particular modified oligonucleotide in that particular experiment. Activity of the modified oligonucleotide may be defined in a different experiment.

TABLE 8
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
715483	3570	3585	124595	124610	CTCTTTGGAAACCATT	2	206
715491	3638	3653	124663	124678	AACCAACTATTACTTC	8	131
958348	556	571	4016	4031	CGAGTCCCCGCGGACG	122	491
958349	557	572	4017	4032	CCGAGTCCCCGCGGAC	81	492
958350	558	573	4018	4033	TCCGAGTCCCCGCGGA	106	493
958351	560	575	4020	4035	TCTCCGAGTCCCCGCG	67	494
958352	563	578	4023	4038	CGGTCTCCGAGTCCCC	110	495
958353	564	579	4024	4039	TCGGTCTCCGAGTCCC	43	496
958354	565	580	4025	4040	GTCGGTCTCCGAGTCC	31	497
958355	611	626	4071	4086	CGTTGGCCGTCTTGGG	51	498
958356	663	678	4123	4138	TTGAAGAAGGAGTCGG	9	499
958357	667	682	4127	4142	CGGCTTGAAGAAGGAG	12	500
958358	669	684	4129	4144	GGCGGCTTGAAGAAGG	34	501
958359	709	724	7143	7158	TGCATCAGTACTGGCC	117	502
958360	745	760	7179	7194	TCGAACATGCTGTGGA	12	503
958361	747	762	7181	7196	GCTCGAACATGCTGTG	8	504
958362	748	763	7182	7197	AGCTCGAACATGCTGT	58	505
958363	750	765	7184	7199	TGAGCTCGAACATGCT	70	506
958364	969	984	55464	55479	CATGTTGTTGTCTGAT	19	507
958365	971	986	55466	55481	GCCATGTTGTTGTCTG	34	508
958366	1607	1622	120512	120527	TGTAGCTGCTCATGCT	16*	509
958367	1871	1886	122896	122911	CTAGCTTGGTGGCAGC	105	510
958368	1873	1888	122898	122913	ATCTAGCTTGGTGGCA	11	511
958369	1875	1890	122900	122915	TTATCTAGCTTGGTGG	4	512
958370	1877	1892	122902	122917	CTTTATCTAGCTTGGT	7	513
958371	3637	3652	124662	124677	ACCAACTATTACTTCA	2	514
958372	3666	3681	124691	124706	GGTGCTAGCTGGTGCC	49	515
958373	3667	3682	124692	124707	AGGTGCTAGCTGGTGC	8	516
958374	3670	3685	124695	124710	CAGAGGTGCTAGCTGG	38	517
958375	3967	3982	11044	11059	AAAGCCTTAGAGTCAA	2	518
			124992	125007
958376	1392	1407	102524	102539	CTGGGATTGATATTCC	31	519
958377	1393	1408	102525	102540	GCTGGGATTGATATTC	9	520
958378	N/A	N/A	7141	7156	CATCAGTACTGGCCTA	25	521
958379	N/A	N/A	3336	3351	GCGCCCGCCCGCACCG	124	522
958380	N/A	N/A	3337	3352	CGCGCCCGCCCGCACC	106	523
958381	N/A	N/A	3344	3359	TCCTCTGCGCGCCCGC	146	524
958382	N/A	N/A	3345	3360	TTCCTCTGCGCGCCCG	111	525
958383	N/A	N/A	3346	3361	CTTCCTCTGCGCGCCC	96	526
958384	N/A	N/A	3347	3362	CCTTCCTCTGCGCGCC	131	527
958385	N/A	N/A	4548	4563	GCGCGCGCATTGTGCA	115	528
958386	N/A	N/A	4549	4564	GGCGCGCGCATTGTGC	111	529
958387	N/A	N/A	4551	4566	GAGGCGCGCGCATTGT	131	530
958388	N/A	N/A	4552	4567	GGAGGCGCGCGCATTG	112	531
958389	N/A	N/A	4553	4568	CGGAGGCGCGCGCATT	126	532
958390	N/A	N/A	4571	4586	GCGAAGGTGCGGAGCG	145	533
958391	N/A	N/A	4572	4587	AGCGAAGGTGCGGAGC	102	534
958392	N/A	N/A	5148	5163	CTATGAGTCAACCTGC	50	535
958393	N/A	N/A	5150	5165	GCCTATGAGTCAACCT	89	536
958394	N/A	N/A	8647	8662	TTGAAACCTGATCCTT	54	537
958395	N/A	N/A	8821	8836	CTAACAACCTGGTTTG	114	538
958396	N/A	N/A	8909	8924	AGGCTATTAAGCTGTT	131	539
958397	N/A	N/A	8910	8925	CAGGCTATTAAGCTGT	127	540
958398	N/A	N/A	8911	8926	GCAGGCTATTAAGCTG	76	541
958399	N/A	N/A	10927	10942	GACCAACTACTTGAAG	45	542
958400	N/A	N/A	10929	10944	TTGACCAACTACTTGA	26	543
958401	N/A	N/A	10964	10979	AGTTATTCAGCAGCTT	19	544
958402	N/A	N/A	29057	29072	CTCTTACACAGCCTAG	28	545
958403	N/A	N/A	36596	36611	CAGTTTATGTAGTAGT	5	546
958404	N/A	N/A	37602	37617	GCACACAACTCAGACA	52	547
958405	N/A	N/A	44925	44940	TTATGGGATGAGTGCT	24	548
958406	N/A	N/A	55773	55788	TTTCAGTTATCGGCCC	29	549
958407	N/A	N/A	63319	63334	AATACTGATCTGCAGC	35	550
958408	N/A	N/A	64348	64363	CTATATATGGTAGTCT	20	551
958409	N/A	N/A	79120	79135	TTACCAAAACGAGGGT	99	552
958410	N/A	N/A	79121	79136	TTTACCAAAACGAGGG	70	553
958411	N/A	N/A	79122	79137	CTTTACCAAAACGAGG	90	554
958412	N/A	N/A	79124	79139	ACCTTTACCAAAACGA	49	555
958413	N/A	N/A	90343	90358	CTAGTAATCTTACTGG	80	556
958414	N/A	N/A	102402	102417	CAGAATTCCCAAGCTA	73	557
958415	N/A	N/A	102449	102464	CTGTGTAGGCTGACTT	16	558
958416	N/A	N/A	102450	102465	GCTGTGTAGGCTGACT	36	559
958417	N/A	N/A	102483	102498	ACGGATAAAAATTACT	85	560
958418	N/A	N/A	102558	102573	AGAGCCTACCTGACAT	47	561
958419	N/A	N/A	102560	102575	TAAGAGCCTACCTGAC	68	562
958420	N/A	N/A	109095	109110	TTCATAATCTGACTAG	66	563
958421	N/A	N/A	112417	112432	CTCCGTGGTGATCCCA	13	564
958422	N/A	N/A	115003	115018	TTTCTTAACCAGCGGA	15	565
958423	N/A	N/A	121122	121137	GATCAACATGCTAACA	51	566

TABLE 9
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
715483	3570	3585	124595	124610	CTCTTTGGAAACCATT	1	206
958436	91	106	3551	3566	TCCCTTGACGGAGGCC	124	567
958441	281	296	3741	3756	GCGACGGCTGCGGGCC	72	568
958446	346	361	3806	3821	CCTGACCCAGGCGAGC	70	569
958451	538	553	3998	4013	CACGATCTGATGCCCG	10	570
958456	824	839	7258	7273	GGCCAGAGACTACTCC	90	571
958461	1355	1370	99057	99072	GCCGAAGCAGTTCTTG	79	572
958466	1840	1855	122865	122880	GTCATTAAGGATGTCA	9	573
958471	1943	1958	122968	122983	CTTAGATCCTTCACAG	14	574
958476	1961	1976	122986	123001	TTCCGGTGCATGTGTC	2	575
958481	1980	1995	123005	123020	GCAACTGGCTTATGGA	6	576
958486	2106	2121	123131	123146	TTAGAGCCAACTGTGA	9	577
958491	2291	2306	123316	123331	ACTAAATGCTGTGACA	4	578
958496	2515	2530	123540	123555	CCTTATAAGCTCCTAA	3	579
958501	2693	2708	123718	123733	TGCCTAGGTTCCGACA	41	580
958506	2812	2827	123837	123852	GCAGATAATCGAGATT	6	581
958511	2870	2885	123895	123910	CACTACCACACTATTA	31	582
958516	3003	3018	124028	124043	CTGCAGACTGCCCCAA	38	583
958521	3112	3127	124137	124152	TTCCAATTCATCAGAT	14	584
958526	3353	3368	124378	124393	AGTAAGAACAATCTTG	6	585
958531	3371	3386	124396	124411	GTAGGAGCAAGTCTTG	5	586
958536	3393	3408	124418	124433	AGGGTCAATTTTCAGC	3	587
958541	3404	3419	124429	124444	GTATTCTATCCAGGGT	4	588
958546	3538	3553	124563	124578	CATACTCTAGTTACAT	6	589
958551	3550	3565	124575	124590	CTCCTGTAGACACATA	5	590
958556	3639	3654	124664	124679	CAACCAACTATTACTT	10	591
958561	3673	3688	124698	124713	ACACAGAGGTGCTAGC	48	592
958566	3935	3950	124960	124975	ACCTATGAACTATTAT	18	593
958571	4105	4120	125130	125145	CAACAACATGCTATGT	43	594
958576	4173	4188	125198	125213	GTGGCTACTGGCAAAT	53	595
958581	4203	4218	125228	125243	CTGCTGATATATAAGA	26	596
958586	4331	4346	125356	125371	GGCAGCACGGTGTAAG	78	597
958591	4461	4476	125486	125501	TCACAGTACTGCTACA	38	598
958596	4610	4625	125635	125650	AGCAGTTAAGCACTTT	3	599
958601	4844	4859	125869	125884	CCTTTAAAGGCACTAC	17	600
958606	5087	5102	126112	126127	TCCACCTGAGCACTCA	31	601
958611	5284	5299	126309	126324	GAGCATGCTCTTACAT	92	602
958616	1141	1156	79082	79097	GGTGGTCTTGTTCTTA	10	603
958621	1172	1187	79113	79128	AACGAGGGTCAAGCCT	29	604
958626	N/A	N/A	5475	5490	TGGGCAAAGTTCCTAT	158	605
958631	N/A	N/A	5583	5598	TGCAAATAGGAGAGGG	122	606
958636	N/A	N/A	3328	3343	CCGCACCGCGGCCCGG	126	607
958641	N/A	N/A	7512	7527	AGCTACAGAGCTTAAC	102	608
958646	N/A	N/A	10769	10784	TATTATATGGCTAAGC	26	609
958651	N/A	N/A	12678	12693	AACTAAAGAGGACTTA	62	610
958656	N/A	N/A	17870	17885	ACGCAATCTGTGATCC	48	611
958661	N/A	N/A	21191	21206	TGCCGTTGGCCCCTCC	120	612
958666	N/A	N/A	24643	24658	GAAAAGGGCAATCATA	52	613
958671	N/A	N/A	30409	30424	CATTATATGGCACCCA	19	614
958676	N/A	N/A	31186	31201	GAACTTAGTTCCCTAT	34	615
958681	N/A	N/A	34104	34119	AATTAACACCTGAGCT	84	616
958686	N/A	N/A	36190	36205	CGCAATATAGTCTATA	4	617
958691	N/A	N/A	38179	38194	TCAGTTGGCAACAGTC	20	618
958696	N/A	N/A	40280	40295	GCATACTACACTATAA	56	619
958701	N/A	N/A	41534	41549	TTAAACTAGGCACATT	98	620
958706	N/A	N/A	45392	45407	TCGCATGGCCACTGCC	112	621
958711	N/A	N/A	48862	48877	CCAAATAAGGATCTGT	34	622
958716	N/A	N/A	54493	54508	ATGGACTGTATGCAGC	84	623
958721	N/A	N/A	56973	56988	GTAGTATAATGAGTTA	1	624
			105504	105519
958726	N/A	N/A	58765	58780	CTGTCAGTTATCCTAT	3	625
			58781	58796
958731	N/A	N/A	58768	58783	GCTCTGTCAGTTATCC	7	626
			58784	58799
			59523	59538
958736	N/A	N/A	62193	62208	GTGATATGGATTCTGT	3	627
958741	N/A	N/A	66072	66087	GTTACTGCAACTGCCC	14	628
958746	N/A	N/A	70253	70268	GTTATCCTCTATAGTC	22	629
958751	N/A	N/A	75535	75550	TCAATGCAGGATTCCA	30	630
958756	N/A	N/A	79463	79478	GTGTTGCATGACAGCC	15	631
958761	N/A	N/A	82824	82839	AGTCTCAACAACCTTC	7	632
958766	N/A	N/A	86559	86574	TAACATATGTCTACTC	23	633
958771	N/A	N/A	92071	92086	CTACAGACGAATTCCA	18	634
958776	N/A	N/A	94770	94785	GGTACTCTCCTTCAGA	94	635
958781	N/A	N/A	97391	97406	GTCATCTATGTGTCCT	6	636
958786	N/A	N/A	99922	99937	TATGTCCTACTTTCCC	10	637
958791	N/A	N/A	102044	102059	CATAAGAAAAGACGAC	123	638
958796	N/A	N/A	103309	103324	ATTATATGGTTGCTTC	3	639
958801	N/A	N/A	108999	109014	CGCTAGCACGCGCGCT	131	640
958806	N/A	N/A	112159	112174	TGCCTAGGGTTCTGTG	30	641
958811	N/A	N/A	115185	115200	CACTGAGGCACGGCCC	92	642
958816	N/A	N/A	120622	120637	GTGATAACATATCCCA	71	643

TABLE 10
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
715483	3570	3585	124595	124610	CTCTTTGGAAACCATT	2	206
958437	134	149	3594	3609	AGGCACTCGGACCTGC	84	644
958442	290	305	3750	3765	GGAGAAGCGGCGACGG	21	645
958447	404	419	3864	3879	GTTGAGGCGGCGGCTG	48	646
958452	571	586	4031	4046	CTCCAGGTCGGTCTCC	26	647
958457	857	872	7291	7306	GTCGAAGATGCTGAGC	5	648
958462	1439	1454	116628	116643	ACTGGCTACGCAGGGC	46	649
958467	1864	1879	122889	122904	GGTGGCAGCCAAAACA	32	650
958472	1945	1960	122970	122985	TCCTTAGATCCTTCAC	5	651
958477	1963	1978	122988	123003	ATTTCCGGTGCATGTG	2	652
958482	2000	2015	123025	123040	TCTGTATTAGCCTGAA	10	653
958487	2192	2207	123217	123232	TCCAAACAGGCTCACT	10	654
958492	2356	2371	123381	123396	TGTCAGACCAGTAAAT	12	655
958497	2534	2549	123559	123574	ATATGGAAATTGTCTC	1	656
958502	2722	2737	123747	123762	CTATTAACAGATTCAC	13	657
958507	2814	2829	123839	123854	GAGCAGATAATCGAGA	6	658
958512	2875	2890	123900	123915	CATTCCACTACCACAC	14	659
958517	3030	3045	124055	124070	TCTAGAACACTAAACT	88	660
958522	3156	3171	124181	124196	AATTAGTCCAAGGGAG	32	661
958527	3356	3371	124381	124396	GTAAGTAAGAACAATC	4	662
958532	3374	3389	124399	124414	GAAGTAGGAGCAAGTC	2	663
958537	3394	3409	124419	124434	CAGGGTCAATTTTCAG	3	664
			79237	79252
958542	3408	3423	124433	124448	TATAGTATTCTATCCA	4	665
			96503	96518
			102951	102966
958547	3540	3555	124565	124580	CACATACTCTAGTTAC	4	666
			56579	56594
958552	3555	3570	124580	124595	TATTACTCCTGTAGAC	16	667
958557	3641	3656	124666	124681	CACAACCAACTATTAC	10	668
958562	3691	3706	124716	124731	CATTGAAAGACCCTTA	6	669
958567	3938	3953	124963	124978	TCAACCTATGAACTAT	3	670
958572	4159	4174	125184	125199	ATTATAGGCACTCCTT	5	671
958577	4176	4191	125201	125216	TCTGTGGCTACTGGCA	4	672
958582	4206	4221	125231	125246	AATCTGCTGATATATA	21	673
958587	4364	4379	125389	125404	GGTGACTGAAACTCTA	2	674
958592	4488	4503	125513	125528	CGTAAGATCAAAGCAC	12	675
958597	4626	4641	125651	125666	CCCAATACAACCAAGA	6	676
958602	4936	4951	125961	125976	TGCCATGTTCCATATA	16	677
958607	5109	5124	126134	126149	CAACATGCTTGCGAGG	11	678
958612	5295	5310	126320	126335	ACCTAACATATGAGCA	18	679
958617	1143	1158	79084	79099	GAGGTGGTCTTGTTCT	40	680
958622	1384	1399	102516	102531	GATATTCCGCATTGCC	3	681
958627	N/A	N/A	5476	5491	TTGGGCAAAGTTCCTA	61	682
958632	N/A	N/A	5610	5625	CTCCGACAGGAGACTA	55	683
958637	N/A	N/A	4394	4409	CCGCAGAGAGAAACTC	101	684
958642	N/A	N/A	8249	8264	GACATCAATTTCAGTC	91	685
958647	N/A	N/A	10939	10954	TAGGAAGTTGTTGACC	11	686
958652	N/A	N/A	14156	14171	GCTACGACGGCTGGCC	136	687
958657	N/A	N/A	18786	18801	CAGTATAATATCCTAA	37	688
958662	N/A	N/A	21800	21815	GAACAGATAGGACTAC	51	689
958667	N/A	N/A	25870	25885	TGCCGGGCCCCTATGC	80	690
958672	N/A	N/A	30864	30879	GAACTTAGTTCCCTTC	67	691
958677	N/A	N/A	31187	31202	AGAACTTAGTTCCCTA	51	692
958682	N/A	N/A	34164	34179	CCATGAGGGACTCCCA	123	693
958687	N/A	N/A	36660	36675	ACACTATGTGTTCTGC	57	694
958692	N/A	N/A	39314	39329	GGCTAGAGGCCGGGTG	105	695
958697	N/A	N/A	40306	40321	CTAAAGATGACTACTG	39	696
958702	N/A	N/A	41672	41687	TGATGTCTTGTCCAGA	16	697
958707	N/A	N/A	46503	46518	TCAATGCTGTATCAGA	23	698
958712	N/A	N/A	49103	49118	TTATATAGGTTACAGA	52	699
958717	N/A	N/A	55730	55745	AATAATATAGCTTACG	11	700
958722	N/A	N/A	57612	57627	CATAATAGGACACAAC	59	701
958727	N/A	N/A	58767	58782	ATCTGTCAGTTATCCT	2	702
958732	N/A	N/A	59675	59690	AGCACGGTGTAGCTTT	60	703
958737	N/A	N/A	62586	62601	GGAATACAAGCCCGAG	8	704
958742	N/A	N/A	66232	66247	AGCAATATGGTATTAG	4	705
958747	N/A	N/A	72144	72159	GTAAAGAGGGTGACAT	106	706
958752	N/A	N/A	75582	75597	GAATTTTTAGTCCAGT	2	707
958757	N/A	N/A	79978	79993	GTGATCTGCACATTGT	5	708
958762	N/A	N/A	84225	84240	GATTAGAGGACTCATT	16	709
958767	N/A	N/A	86751	86766	ACGAATAAGGCATTAG	6	710
958772	N/A	N/A	92334	92349	CAACAAACATAGTTAC	61	711
958777	N/A	N/A	94786	94801	GTAACTGTTTCTAGGT	10	712
958782	N/A	N/A	97670	97685	ATGGTCTCCCAGTCAC	20	713
958787	N/A	N/A	101109	101124	TGGGCAAAGTTCCTCT	67	714
958792	N/A	N/A	102355	102370	GCCAATGGAGTCACCA	46	715
958797	N/A	N/A	105351	105366	ACGAGCACAGCACCCT	13	716
958802	N/A	N/A	110683	110698	AGATAATCATCCTCAA	25	717
958807	N/A	N/A	112517	112532	TCATTGTAGTCTGTCT	3	718
958812	N/A	N/A	115821	115836	TACTATAAGACACCAA	31	719
958817	N/A	N/A	121734	121749	TGCCAGGTAAGCCACA	30	720

TABLE 11
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
715483	3570	3585	124595	124610	CTCTTTGGAAACCATT	1	206
958438	181	196	3641	3656	CGCCCCGGCTCCACTG	61	721
958443	306	321	3766	3781	CTCCACGGGCCGAGGT	90	722
958448	437	452	3897	3912	GCGAAGGCGGCTGCCC	86	723
958453	635	650	4095	4110	GCCTCATGGGCACGGT	70	724
958458	1006	1021	55501	55516	GTTCATCTGGGACAGC	12	725
958463	1502	1517	116691	116706	CCTGAGACATCCCGGG	63	726
958468	1866	1881	122891	122906	TTGGTGGCAGCCAAAA	86	727
958473	1948	1963	122973	122988	GTCTCCTTAGATCCTT	5	728
958478	1967	1982	122992	123007	GGAAATTTCCGGTGCA	14	729
958483	2039	2054	123064	123079	GAGGATTAAAGTATCT	17	730
958488	2209	2224	123234	123249	AGGAATGGCATCCATC	41	731
958493	2435	2450	123460	123475	AAACAGTCTTCAGCCT	16	732
958498	2561	2576	74512	74527	GAGTATGTGGCAATAA	1	733
			123586	123601
958503	2740	2755	123765	123780	AACCATCCCAAGCTAC	15	734
958508	2816	2831	123841	123856	GAGAGCAGATAATCGA	7	735
958513	2927	2942	123952	123967	GCGCTACCATTTTAAA	104	736
958518	3047	3062	124072	124087	CCACAGTAATAGCTCT	1	737
958523	3174	3189	124199	124214	TTCCAATCGAGACTTA	3	738
958528	3362	3377	124387	124402	AGTCTTGTAAGTAAGA	18	739
958533	3379	3394	124404	124419	GCATAGAAGTAGGAGC	3	740
958538	3397	3412	31598	31613	ATCCAGGGTCAATTTT	10	741
			124422	124437
958543	3412	3427	124437	124452	ACCTTATAGTATTCTA	4	742
958548	3542	3557	124567	124582	GACACATACTCTAGTT	21	743
958553	3559	3574	38752	38767	CCATTATTACTCCTGT	1	744
			121706	121721
			124584	124599
958558	3643	3658	124668	124683	TTCACAACCAACTATT	9	745
958563	3759	3774	124784	124799	AGCTTTTGCCAGGAGA	3	746
958568	3947	3962	124972	124987	TATGAGTGATCAACCT	5	747
958573	4164	4179	125189	125204	GGCAAATTATAGGCAC	2	748
958578	4181	4196	125206	125221	CTTAATCTGTGGCTAC	4	749
958583	4210	4225	125235	125250	AGCTAATCTGCTGATA	89	750
958588	4373	4388	125398	125413	GTGTACTTAGGTGACT	10	751
958593	4506	4521	125531	125546	GGTCAGTACAGAGGGC	7	752
958598	4636	4651	125661	125676	CCCAATGCTACCCAAT	4	753
958603	4987	5002	44310	44325	TGGTATGAATTCTGAA	3	754
			75463	75478
			126012	126027
958608	5136	5151	126161	126176	TGATAGGCACACCCAC	11	755
958613	1062	1077	55557	55572	CCTGAAGCCGAGTTCA	15	756
958618	1149	1164	79090	79105	AGCCAAGAGGTGGTCT	36	757
958623	1386	1401	102518	102533	TTGATATTCCGCATTG	3	758
958628	N/A	N/A	5514	5529	GCTAACTACATTGCAG	81	759
958633	N/A	N/A	5656	5671	TGTCATCAGGTTAAGT	76	760
958638	N/A	N/A	4565	4580	GTGCGGAGCGCGCGGA	127	761
958643	N/A	N/A	8457	8472	TAGCAACCCACCCTGG	59	762
958648	N/A	N/A	10980	10995	GAATACTGAGTCAGGA	7	763
958653	N/A	N/A	15503	15518	TTACACACAGGCTATG	17	764
958658	N/A	N/A	18787	18802	ACAGTATAATATCCTA	6	765
958663	N/A	N/A	22200	22215	CTATTAGGGACTGAAC	32	766
958668	N/A	N/A	27649	27664	GTGATCTGTGAGAGGT	2	767
958673	N/A	N/A	30865	30880	AGAACTTAGTTCCCTT	30	768
958678	N/A	N/A	32244	32259	GGAGGAGTCACCATGG	74	769
958683	N/A	N/A	34256	34271	TATTGTGCTGCATCTC	16	770
958688	N/A	N/A	36686	36701	GGCTATGTAGCCTTCC	82	771
958693	N/A	N/A	39371	39386	GTGGTGTCTCACAGGC	99	772
958698	N/A	N/A	40400	40415	CTTATTAGCCCTCAAA	30	773
958703	N/A	N/A	43429	43444	GATAACTAAGCACTAC	49	774
958708	N/A	N/A	46790	46805	ATGTCAGATGTCAATT	19	775
958713	N/A	N/A	50391	50406	TGCTAGAGGCTGTTCC	55	776
958718	N/A	N/A	55941	55956	GAACACTATAGCTTGG	4	777
958723	N/A	N/A	58021	58036	AACCCACTAAAACCGG	63	778
958728	N/A	N/A	45026	45041	TATCTGTCAGTTATCC	10	779
			58768	58783
			58784	58799
958733	N/A	N/A	60397	60412	TAATAGACTAGACTTA	67	780
958738	N/A	N/A	63528	63543	TCTATATGTTTCCCCC	11	781
958743	N/A	N/A	66740	66755	GACTATAAAGGGTTTA	30	782
958748	N/A	N/A	72564	72579	ACATGTGACATTCCGG	83	783
958753	N/A	N/A	76248	76263	TGTATATGCCGTTCCC	4	784
958758	N/A	N/A	79985	80000	CTATTCAGTGATCTGC	2	785
958763	N/A	N/A	84603	84618	CACAATACAAGATGCA	3	786
958768	N/A	N/A	87653	87668	GTGCAAGCAGGTTCCC	17	787
958773	N/A	N/A	93005	93020	AGCTGGTAGGGCAAGA	43	788
958778	N/A	N/A	95129	95144	GCTACCTGGAGCGAAG	75	789
958783	N/A	N/A	98257	98272	TGATCTGATGCTTGCT	35	790
958788	N/A	N/A	101110	101125	CTGGGCAAAGTTCCTC	54	791
958793	N/A	N/A	102510	102525	CCGCATTGCCTAAGAG	9	792
958798	N/A	N/A	107371	107386	TGCAGTATAATATCCT	3	793
958803	N/A	N/A	110998	111013	GATAATCATCCTCAGC	24	794
958808	N/A	N/A	113126	113141	AGCGATTGGCCTCCCA	59	795
958813	N/A	N/A	116872	116887	TTACAGAGAGATTCAT	8	796
958818	N/A	N/A	121757	121772	GTTGTCAACTCTAGGG	23	797

TABLE 12
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
715483	3570	3585	124595	124610	CTCTTTGGAAACCATT	1	206
958439	182	197	3642	3657	GCGCCCCGGCTCCACT	77	798
958444	315	330	3775	3790	ACGCCCCGGCTCCACG	97	799
958449	468	483	3928	3943	CCGGACGGCGGGCCCT	84	800
958454	754	769	7188	7203	GGAATGAGCTCGAACA	3	801
958459	1061	1076	55556	55571	CTGAAGCCGAGTTCAT	28	802
958464	1600	1615	120505	120520	GCTCATGCTTAGTCCA	3*	803
958469	1904	1919	122929	122944	GGCTCTATAACCATGT	17	804
958474	1950	1965	122975	122990	GTGTCTCCTTAGATCC	3	805
958479	1969	1984	122994	123009	ATGGAAATTTCCGGTG	15	806
958484	2067	2082	123092	123107	GCAGCAATGGACAAGG	2	807
958489	2262	2277	123287	123302	TTCTAAGTCTGAGTAT	14	808
958494	2468	2483	123493	123508	TAGCACTAGGAGGAAA	28	809
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	1	810
958504	2805	2820	123830	123845	ATCGAGATTTAAATAA	63	811
958509	2851	2866	123876	123891	ATGTTATGTTTGGGTG	4	812
958514	2957	2972	123982	123997	TACTAGTCATGTATTC	20	813
958519	3061	3076	124086	124101	CCCCTAGGCACTATCC	20	814
958524	3199	3214	124224	124239	GCACATTATGAACCTA	13	815
958529	3364	3379	124389	124404	CAAGTCTTGTAAGTAA	3	816
958534	3383	3398	121836	121851	TTCAGCATAGAAGTAG	3	817
			124408	124423
958539	3400	3415	124425	124440	TCTATCCAGGGTCAAT	11	818
958544	3471	3486	124496	124511	GCTAAATTCAACTACC	8	819
958549	3546	3561	100828	100843	TGTAGACACATACTCT	8	820
			110388	110403
			124571	124586
958554	3561	3576	38754	38769	AACCATTATTACTCCT	1	821
			120229	120244
			124586	124601
958559	3645	3660	124670	124685	AATTCACAACCAACTA	17	822
958564	3841	3856	124866	124881	TCCAAATTGAAGGGCC	62	823
958569	3965	3980	124990	125005	AGCCTTAGAGTCAATT	3	824
958574	4166	4181	125191	125206	CTGGCAAATTATAGGC	13	825
958579	4183	4198	125208	125223	ATCTTAATCTGTGGCT	4	826
958584	4221	4236	125246	125261	CCCTAAGCTAAAGCTA	74	827
958589	4409	4424	125434	125449	GTAAAGGAAGATCTCC	4	828
958594	4523	4538	125548	125563	CTCTTAGGTCTCCTTC	8	829
958599	4663	4678	125688	125703	TTCAAGAATACCCAGT	5	830
958604	5055	5070	126080	126095	ACGCTAGAAAAGTGTT	94	831
958609	5221	5236	126246	126261	TGACAAGTGTGCATTA	16	832
958614	1137	1152	79078	79093	GTCTTGTTCTTATGGT	6	833
958619	1156	1171	79097	79112	TGGGTCTAGCCAAGAG	71	834
958624	1390	1405	102522	102537	GGGATTGATATTCCGC	74	835
958629	N/A	N/A	5523	5538	CCCGAGTGGGCTAACT	128	836
958634	N/A	N/A	5673	5688	TCCTTAACCCGGGTTT	61	837
958639	N/A	N/A	6783	6798	GTTATGGGTGCTTTTC	18	838
958644	N/A	N/A	8524	8539	ATGATCAAACCTTTTC	5	839
958649	N/A	N/A	12237	12252	TGCCACTGGTGAATAC	36	840
958654	N/A	N/A	16919	16934	AATGGAGTGGCCGGGC	110	841
958659	N/A	N/A	18852	18867	GTTGTATTACTCTCCA	2	842
958664	N/A	N/A	23239	23254	ACGAACTAAGGTGTAC	40	843
958669	N/A	N/A	28420	28435	GCTATCTTTGGATCCA	76	844
958674	N/A	N/A	30866	30881	AAGAACTTAGTTCCCT	25	845
			31188	31203
958679	N/A	N/A	33917	33932	GTAACTGCCACAGTTA	77	846
958684	N/A	N/A	35513	35528	GCTGAAGACGGCCCTT	70	847
958689	N/A	N/A	36864	36879	CATTAAGGAGGTTATG	87	848
958694	N/A	N/A	39375	39390	ATTGGTGGTGTCTCAC	41	849
958699	N/A	N/A	40415	40430	GACTAGAAAGATCATC	20	850
958704	N/A	N/A	43572	43587	CCCTACACTCGAGGAT	122	851
958709	N/A	N/A	46944	46959	TCAATCTATGAGACCC	57	852
958714	N/A	N/A	52275	52290	GAGCACTGCGCCCTGG	82	853
958719	N/A	N/A	56409	56424	GTACATAATGGGCTAA	49	854
958724	N/A	N/A	58762	58777	TCAGTTATCCTATCCC	2	855
958729	N/A	N/A	58763	58778	GTCAGTTATCCTATCT	4	856
			58779	58794
958734	N/A	N/A	61207	61222	ACACATAGAGCTAAGG	7	857
958739	N/A	N/A	64256	64271	AGCAATAGAGTAACCA	4	858
958744	N/A	N/A	67858	67873	GCATACTGGTGCCCCA	45	859
958749	N/A	N/A	74623	74638	CCACAAGGGCAGTACG	51	860
958754	N/A	N/A	77489	77504	CCTTAGGAAGGCTCCC	31	861
958759	N/A	N/A	81664	81679	GCCTATCGCCCCAAGC	61	862
958764	N/A	N/A	85543	85558	TGGGTCTCTTGATTTC	34	863
958769	N/A	N/A	89667	89682	CATTGCCACGATCTAA	36	864
958774	N/A	N/A	94013	94028	TGCTAGATATCGCCAA	33	865
958779	N/A	N/A	95898	95913	TCGAATATAGAGGCCT	80	866
958784	N/A	N/A	99202	99217	GGCTGGATAGAATGCT	79	867
958789	N/A	N/A	101277	101292	TACTATATAATACCCT	17	868
958794	N/A	N/A	102512	102527	TTCCGCATTGCCTAAG	14	869
958799	N/A	N/A	107814	107829	ATTACTCAATCATGGT	2	870
958804	N/A	N/A	110999	111014	AGATAATCATCCTCAG	17	871
958809	N/A	N/A	113144	113159	TCTTAACACCTGAGCT	66	872
958814	N/A	N/A	117837	117852	GGCTATGCCTCTCTTA	214	873
958819	N/A	N/A	122502	122517	TGCTTCAACATTGTTC	9	874

TABLE 13
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
715483	3570	3585	124595	124610	CTCTTTGGAAACCATT	1	206
958440	183	198	3643	3658	TGCGCCCCGGCTCCAC	54	875
958445	327	342	3787	3802	GGCTACGCCCGGACGC	63	876
958450	496	511	3956	3971	GGTCGCCGCGGGTGCC	59	877
958455	757	772	7191	7206	AGAGGAATGAGCTCGA	43	878
958460	1294	1309	98996	99011	TCGCATCTGTTGCTGC	52	879
958465	1726	1741	122751	122766	GGCTTCAAGGTAGTCT	84	880
958470	1941	1956	8781	8796	TAGATCCTTCACAGAT	18	881
			45134	45149
			122966	122981
958475	1959	1974	122984	122999	CCGGTGCATGTGTCTC	37	882
958480	1978	1993	24075	24090	AACTGGCTTATGGAAA	24	883
			123003	123018
958485	2089	2104	56507	56522	AGAGGTCAGCAATACA	3	884
			122015	122030
			123114	123129
958490	2281	2296	123306	123321	GTGACATGAAGCATCT	5	885
958495	2488	2503	123513	123528	GGTCATTATGTGACTA	56	886
958500	2570	2585	123595	123610	TCTATATTAGAGTATG	5	887
958505	2809	2824	123834	123849	GATAATCGAGATTTAA	6	888
958510	2867	2882	123892	123907	TACCACACTATTATAA	43	889
958515	2993	3008	124018	124033	CCCCAACCAGATTTAA	28	890
958520	3091	3106	124116	124131	CTACCGTATGCCCAGA	27	891
958525	3235	3250	124260	124275	ATGAAGGTAAACCACT	3	892
958530	3367	3382	124392	124407	GAGCAAGTCTTGTAAG	20	893
958535	3392	3407	124417	124432	GGGTCAATTTTCAGCA	10	894
958540	3402	3417	124427	124442	ATTCTATCCAGGGTCA	8	895
958545	3535	3550	5536	5551	ACTCTAGTTACATCAT	3	896
			124560	124575
958550	3548	3563	124573	124588	CCTGTAGACACATACT	4	897
958555	3619	3634	124644	124659	GCTTATATTGAAGAGT	4	898
958560	3656	3671	124681	124696	GGTGCCACTTTAATTC	22	899
958565	3895	3910	124920	124935	TTGAGCACTGAAAGTA	4	900
958570	4092	4107	125117	125132	TGTAATTCATATACCC	5	901
958575	4171	4186	125196	125211	GGCTACTGGCAAATTA	9	902
958580	4186	4201	125211	125226	ATAATCTTAATCTGTG	4	903
958585	4278	4293	125303	125318	CTCTATCAAGGTCCCC	5	904
958590	4439	4454	125464	125479	AGGTATAACTGGGCAA	2	905
958595	4563	4578	125588	125603	CCACATCAAGGCTATG	8	906
958600	4752	4767	125777	125792	GTAGATCTAAGAAGCC	8	907
958605	5068	5083	126093	126108	CTCAGATGTACCAACG	7	908
958610	5250	5265	126275	126290	AGGTAACATTGGTACT	34	909
958615	1139	1154	79080	79095	TGGTCTTGTTCTTATG	3	910
958620	1162	1177	79103	79118	AAGCCTTGGGTCTAGC	57	911
958625	1394	1409	102526	102541	TGCTGGGATTGATATT	6	912
958630	N/A	N/A	5554	5569	GCGGTAACTCTTCTTT	52	913
958635	N/A	N/A	5713	5728	GTTTAGGCAAGCAGCT	43	914
958640	N/A	N/A	7413	7428	TAGATAACTGTCTCCC	13	915
958645	N/A	N/A	9559	9574	GCCCATAGTTGACAGG	54	916
958650	N/A	N/A	12498	12513	TCAATTGAGTCTGCTA	3	917
958655	N/A	N/A	17868	17883	GCAATCTGTGATCCCA	12	918
958660	N/A	N/A	19378	19393	CCCACTGGGTTTGTCC	106	919
958665	N/A	N/A	23878	23893	CTGCATACCCTCCAGC	84	920
958670	N/A	N/A	28665	28680	GGTCTTGGTGATTGGC	20	921
958675	N/A	N/A	31177	31192	TCCCTATCAGCTGGGC	112	922
958680	N/A	N/A	34103	34118	ATTAACACCTGAGCTG	50	923
958685	N/A	N/A	35577	35592	AGCTATGGAAAGTGTC	24	924
958690	N/A	N/A	37103	37118	TGGACTCTTGATCACA	26	925
958695	N/A	N/A	39759	39774	TCAATTCTCCACCAGA	45	926
958700	N/A	N/A	41085	41100	CTAATATAGACTACTC	55	927
958705	N/A	N/A	45162	45177	GGCCATCAATAAAGAC	112	928
958710	N/A	N/A	47735	47750	AGGGAACCCTTGGCTA	77	929
958715	N/A	N/A	53767	53782	GTAATAGGAGGTAAGA	48	930
958720	N/A	N/A	56594	56609	GTCTACTAGAGCTGCC	12	931
958725	N/A	N/A	58763	58778	GTCAGTTATCCTATCC	1	932
958730	N/A	N/A	58783	58798	CTCTGTCAGTTATCCT	4	933
958735	N/A	N/A	61265	61280	AGCAATCTTGTGGATC	7	934
958740	N/A	N/A	65047	65062	CGGCACCAAACACCCA	57	935
958745	N/A	N/A	69906	69921	TCCCAGCCGCATGGCT	78	936
958750	N/A	N/A	75333	75348	TGTAAGAGGAGACCAC	28	937
958755	N/A	N/A	78709	78724	TAACATAAGACACGGA	12	938
958760	N/A	N/A	82249	82264	AGTAATAGATCTACAA	76	939
958765	N/A	N/A	86532	86547	GTACAGGAGAGATTGC	37	940
958770	N/A	N/A	90915	90930	ACAGAGCGGTGCACCC	64	941
958775	N/A	N/A	94061	94076	GTCTATACGGGAGATT	29	942
958780	N/A	N/A	96542	96557	TCAACTACTTTTCAGC	24	943
958785	N/A	N/A	99371	99386	GCAATCCACAATTCCA	2	944
958790	N/A	N/A	102039	102054	GAAAAGACGACACAGT	68	945
958795	N/A	N/A	102514	102529	TATTCCGCATTGCCTA	8	946
958800	N/A	N/A	108359	108374	TCGATAATATATGGCA	22	947
958805	N/A	N/A	111001	111016	CAAGATAATCATCCTC	6	948
958810	N/A	N/A	114182	114197	TTATATACGGGAAAAT	47	949
958815	N/A	N/A	120003	120018	GGGCGAGGAGACAGGT	16	950
958820	N/A	N/A	126468	126483	GACCAGTAAGAAGCCA	49	951

Example 4: Antisense Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers

Modified oligonucleotides were designed to target a Yap1 nucleic acid and were tested for their effect on Yap1 mRNA level in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured A-431 cells at a density of 5,000 cells per well were treated using free uptake with 2,000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and Yap1 mRNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS4814 was used to measure mRNA levels. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). The modified oligonucleotides with percent control values marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides targeting the amplicon region.

The newly designed modified oligonucleotides in the Tables below were designed as 3-10-3 cEt gapmers. The gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on the 5′ direction and the 3′ direction comprising three nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a cEt sugar modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P═S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.

“Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either SEQ ID NO. 1, SEQ ID NO.: 2, SEQ ID NO.: 3 (GENBANK Accession No. NM_006106.4), or SEQ ID NO. 4 (GENBANK Accession No. NM_001130145.2). ‘N/A’ indicates that the modified oligonucleotide does not target that particular gene sequence with 10000 complementarity. ‘N.D.’ indicates that the % UTC is not defined for that particular modified oligonucleotide in that particular experiment. Activity of the modified oligonucleotide may be defined in a different experiment.

TABLE 14
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	2	810
1074112	97	112	3557	3572	TCCAACTCCCTTGACG	83	952
1074144	285	300	3745	3760	AGCGGCGACGGCTGCG	92	953
1074176	364	379	3824	3839	CTCCCCCGACGCGCAC	84	954
1074208	541	556	4001	4016	GTGCACGATCTGATGC	96	955
1074240	896	911	7330	7345	CTGGCAGAGGTACATC	29	956
1074272	1118	1133	79059	79074	TATAGTAAATTTCTCC	16	957
1074304	1357	1372	99059	99074	CTGCCGAAGCAGTTCT	109	958
1074336	1451	1466	116640	116655	CCAGTGTTGGTAACTG	97	959
1074368	1672	1687	N/A	N/A	GATAGTATCACCTGTA	8	960
1074400	1928	1943	122953	122968	GATTTAGAATTCAGTC	42	961
1074432	2243	2258	123268	123283	GTTAAAATGATTGGTG	3*	962
1074464	2564	2579	123589	123604	TTAGAGTATGTGGCAA	2	963
1074496	2743	2758	123768	123783	AATAACCATCCCAAGC	69	964
1074528	2996	3011	124021	124036	CTGCCCCAACCAGATT	25	965
1074560	3172	3187	124197	124212	CCAATCGAGACTTAAA	3	966
1074592	3368	3383	124393	124408	GGAGCAAGTCTTGTAA	23	967
1074624	3706	3721	124731	124746	GGCTTATTCTAGAAAC	65	968
1074656	4008	4023	125033	125048	GACTTAATTCAAGATT	31	969
1074688	4224	4239	125249	125264	TCCCCCTAAGCTAAAG	83	970
1074720	4403	4418	125428	125443	GAAGATCTCCATATTC	58	971
1074752	4592	4607	125617	125632	CATTAGGAACAAGGAC	10	972
1074784	4758	4773	125783	125798	CCATAAGTAGATCTAA	25	973
1074816	5032	5047	126057	126072	GAATATTGCCACCCAC	15	974
1074848	5140	5155	126165	126180	GTTATGATAGGCACAC	11	975
1074912	N/A	N/A	5525	5540	ATCCCGAGTGGGCTAA	85	976
1074944	N/A	N/A	5623	5638	AAAACCCTTTGGTCTC	89	977
1074976	N/A	N/A	126479	126494	TTCTATTGGAAGACCA	35	978
1075008	N/A	N/A	5286	5301	TAATCGAACATTGTGT	61	979
1075040	N/A	N/A	7618	7633	TTATAAAGAGGCTCAG	10	980
1075072	N/A	N/A	9650	9665	TCCGGGTAAATATCTC	37	981
1075104	N/A	N/A	11109	11124	ATTATAAGGTCCTACA	67	982
1075136	N/A	N/A	13294	13309	CTAGAATATTAAAGGG	87	983
1075168	N/A	N/A	16596	16611	CATCAAAATTTCACGA	49	984
1075200	N/A	N/A	21836	21851	CATATTAACTAGATGA	120	985
1075232	N/A	N/A	24676	24691	ATTTATCAGCCATTGT	13	986
1075264	N/A	N/A	27401	27416	GAATAATATGCAGAAC	53	987
1075296	N/A	N/A	30827	30842	ATTATAAGCTGTGTTG	18	988
1075328	N/A	N/A	32291	32306	CTCGCAAAGCCTCTTC	21	989
1075360	N/A	N/A	34021	34036	AGGCAACAACATCTAA	50	990
1075392	N/A	N/A	36045	36060	GACGGGTGAACCTGTT	95	991
1075424	N/A	N/A	38749	38764	TTATTAATCCTGTCCA	18	992
1075456	N/A	N/A	40812	40827	TTACGAAATGTTTAGT	61	993
1075488	N/A	N/A	42808	42823	CAGAATAAGGGAGATC	56	994
1075520	N/A	N/A	45363	45378	CCCCAACAACTGCTAA	77	995
1075552	N/A	N/A	47526	47541	GATTATAACATGCTGT	74	996
1075584	N/A	N/A	49326	49341	AATAATTGACCTAGCA	57	997
1075616	N/A	N/A	51128	51143	GTAAAACCGATTTTTC	46	998
1075648	N/A	N/A	52713	52728	TCAATAAAGTGGGACT	67	999
1075680	N/A	N/A	55168	55183	ATTATTACCCCTTCTA	73	1000
1075712	N/A	N/A	57557	57572	GACGCGAAATACTTAC	7	1001
1075744	N/A	N/A	59642	59657	TTCGGGTTAGCAGACT	6	1002
1075776	N/A	N/A	62195	62210	ATGTGATATGGATTCT	10	1003
1075808	N/A	N/A	64255	64270	GCAATAGAGTAACCAG	3	1004
1075840	N/A	N/A	67174	67189	CCTAAAATAGGAATGC	89	1005
1075872	N/A	N/A	70920	70935	CAATTATGACAAACAG	21	1006
1075904	N/A	N/A	73288	73303	GTATAGGATCTACTAA	51	1007
1075936	N/A	N/A	76577	76592	CTTATATTCTCTCCGA	49	1008
1075968	N/A	N/A	80319	80334	TATTTAAGCCAAACCG	5	1009
1076000	N/A	N/A	82082	82097	CCTAATATGACTCCTT	4	1010
1076032	N/A	N/A	84424	84439	TATAATTTCCCTGATC	105	1011
1076064	N/A	N/A	86676	86691	TATGAACAATGTACTC	5	1012
1076096	N/A	N/A	90315	90330	AATAATAAACGATTCT	71	1013
1076128	N/A	N/A	92094	92109	TCTAAACCTAAAGACT	118	1014
1076160	N/A	N/A	93143	93158	TTATACTAGTACGGCA	20	1015
1076192	N/A	N/A	95979	95994	CTACAACCTGGACTTT	34	1016
1076224	N/A	N/A	97726	97741	TATAAACCTTGCTACA	67	1017
1076256	N/A	N/A	100250	100265	TTATTTAGGCCCCATA	4	1018
1076288	N/A	N/A	103352	103367	CTTATTTAGCATAGTG	3	1019
1076320	N/A	N/A	105383	105398	CATTAACCTCACCCAT	52	1020
1076352	N/A	N/A	109308	109323	GATAACCCTGAAACAA	37	1021
1076384	N/A	N/A	111269	111284	TATAAGGGACTTGCTG	25	1022
1076416	N/A	N/A	113834	113849	ACCGAAATGATACTGA	8	1023
1076448	N/A	N/A	117100	117115	CTTATAATGCAATCCT	2	1024
1076480	N/A	N/A	119636	119651	GTAAATATCCATTACC	72	1025
1076512	N/A	N/A	122045	122060	CATAAACCATTAAGTG	65	1026
1076544	N/A	N/A	71389	71404	GACCAACCTCCCCTTG	89	1027

TABLE 15
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	1	810
1074113	98	113	3558	3573	CTCCAACTCCCTTGAC	61	1028
1074145	286	301	3746	3761	AAGCGGCGACGGCTGC	73	1029
1074177	365	380	3825	3840	CCTCCCCCGACGCGCA	69	1030
1074209	640	655	4100	4115	CCGGAGCCTCATGGGC	72	1031
1074241	921	936	7355	7370	GATGTCTTTGCCATCT	72	1032
1074273	1129	1144	79070	79085	CTTATGGTTTATATAG	34	1033
1074305	1360	1375	99062	99077	CACCTGCCGAAGCAGT	64	1034
1074337	1469	1484	116658	116673	GAGTCCCACCATCCTG	10	1035
1074369	1673	1688	N/A	N/A	TGATAGTATCACCTGT	19	1036
1074401	1960	1975	122985	123000	TCCGGTGCATGTGTCT	18	1037
1074433	2258	2273	123283	123298	AAGTCTGAGTATTTAG	5*	1038
1074465	2572	2587	123597	123612	AATCTATATTAGAGTA	44	1039
1074497	2744	2759	123769	123784	CAATAACCATCCCAAG	26	1040
1074529	3001	3016	124026	124041	GCAGACTGCCCCAACC	50	1041
1074561	3176	3191	124201	124216	AATTCCAATCGAGACT	10	1042
1074593	3369	3384	124394	124409	AGGAGCAAGTCTTGTA	6	1043
1074625	3711	3726	124736	124751	ATAAGGGCTTATTCTA	42	1044
1074657	4016	4031	125041	125056	TCCCCCCAGACTTAAT	59	1045
1074689	4225	4240	125250	125265	CTCCCCCTAAGCTAAA	70	1046
1074721	4404	4419	125429	125444	GGAAGATCTCCATATT	43	1047
1074753	4594	4609	125619	125634	TACATTAGGAACAAGG	4	1048
1074785	4759	4774	125784	125799	ACCATAAGTAGATCTA	10	1049
1074817	5034	5049	126059	126074	CTGAATATTGCCACCC	8	1050
1074849	5141	5156	126166	126181	TGTTATGATAGGCACA	18	1051
1074913	N/A	N/A	5526	5541	CATCCCGAGTGGGCTA	99	1052
1074945	N/A	N/A	5624	5639	CAAAACCCTTTGGTCT	74	1053
1074977	N/A	N/A	126483	126498	CTTGTTCTATTGGAAG	94	1054
1075009	N/A	N/A	5287	5302	ATAATCGAACATTGTG	43	1055
1075041	N/A	N/A	7620	7635	GATTATAAAGAGGCTC	5	1056
1075073	N/A	N/A	9719	9734	CATAAAAGTTCCCCAG	51	1057
1075105	N/A	N/A	11110	11125	AATTATAAGGTCCTAC	42	1058
1075137	N/A	N/A	13320	13335	GATTAAATACTGACCA	3	1059
1075169	N/A	N/A	16611	16626	AAAACGGAGTAATGCC	39	1060
1075201	N/A	N/A	21864	21879	CTTTAAAGCCCTAATT	114	1061
1075233	N/A	N/A	24679	24694	GTAATTTATCAGCCAT	2	1062
1075265	N/A	N/A	27404	27419	TCTGAATAATATGCAG	44	1063
1075297	N/A	N/A	30831	30846	GTTAATTATAAGCTGT	10	1064
1075329	N/A	N/A	32457	32472	AGGGAAAACTTTGCAC	26	1065
1075361	N/A	N/A	34085	34100	TCTTAAGGGAATGTAT	69	1066
1075393	N/A	N/A	36169	36184	CTTAACCTATGCCAAA	37	1067
1075425	N/A	N/A	38750	38765	ATTATTAATCCTGTCC	26	1068
1075457	N/A	N/A	40828	40843	AGTAATATGTACATGG	5	1069
1075489	N/A	N/A	42854	42869	GAGCAACAACTATGAG	51	1070
1075521	N/A	N/A	45427	45442	AAATCGAGGCGAATCT	65	1071
1075553	N/A	N/A	47527	47542	TGATTATAACATGCTG	77	1072
1075585	N/A	N/A	49327	49342	AAATAATTGACCTAGC	52	1073
1075617	N/A	N/A	51372	51387	TAAGAACGACATATGC	27	1074
1075649	N/A	N/A	52715	52730	CTTCAATAAAGTGGGA	56	1075
1075681	N/A	N/A	55170	55185	TAATTATTACCCCTTC	37	1076
1075713	N/A	N/A	57571	57586	AATCAACCTTGTTAGA	58	1077
1075745	N/A	N/A	59682	59697	CTTCAAAAGCACGGTG	58	1078
1075777	N/A	N/A	62196	62211	TATGTGATATGGATTC	12	1079
1075809	N/A	N/A	64257	64272	TAGCAATAGAGTAACC	13	1080
1075841	N/A	N/A	67205	67220	ATTTAGGTACTCAGTA	27	1081
1075873	N/A	N/A	70936	70951	CTTGAATACTACACCA	16	1082
1075905	N/A	N/A	73332	73347	CCTGAACACAGGAGTA	43	1083
1075937	N/A	N/A	76578	76593	ACTTATATTCTCTCCG	36	1084
1075969	N/A	N/A	80320	80335	GTATTTAAGCCAAACC	11	1085
1076001	N/A	N/A	82122	82137	ACTCAAGGAACCATTT	24	1086
1076033	N/A	N/A	84540	84555	CATTAGTAGGTATTTC	8	1087
1076065	N/A	N/A	86761	86776	CTTTAGTAACACGAAT	36	1088
1076097	N/A	N/A	90316	90331	CAATAATAAACGATTC	70	1089
1076129	N/A	N/A	92131	92146	CATAAACCTTAGTCCT	26	1090
1076161	N/A	N/A	93145	93160	TCTTATACTAGTACGG	14	1091
1076193	N/A	N/A	96059	96074	TTAATACACAGGTTCC	29	1092
1076225	N/A	N/A	97727	97742	ATATAAACCTTGCTAC	66	1093
1076257	N/A	N/A	100265	100280	CTAAGAAACTCATAGT	54	1094
1076289	N/A	N/A	103430	103445	AACGGACAACTTAACA	21	1095
1076321	N/A	N/A	105417	105432	CAATATCACTTGGGCC	63	1096
1076353	N/A	N/A	109381	109396	ATTAAACATTCGGATT	30	1097
1076385	N/A	N/A	111270	111285	ATATAAGGGACTTGCT	32	1098
1076417	N/A	N/A	113840	113855	CTTTACACCGAAATGA	42	1099
1076449	N/A	N/A	117101	117116	CCTTATAATGCAATCC	2	1100
1076481	N/A	N/A	119672	119687	CTAAGTAAGGTTTCCC	1	1101
1076513	N/A	N/A	122094	122109	CATTAACACTCCTCAG	36	1102
1076545	N/A	N/A	76624	76639	AACCAACCTTCCCTAC	68	1103

TABLE 16
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	2	810
1074114	109	124	3569	3584	GAACTTTTTCCCTCCA	30	1104
1074146	287	302	3747	3762	GAAGCGGCGACGGCTG	91	1105
1074178	366	381	3826	3841	GCCTCCCCCGACGCGC	95	1106
1074210	641	656	4101	4116	TCCGGAGCCTCATGGG	113	1107
1074242	925	940	7359	7374	AGAAGATGTCTTTGCC	56	1108
1074274	1132	1147	79073	79088	GTTCTTATGGTTTATA	4	1109
1074306	1363	1378	99065	99080	CCTCACCTGCCGAAGC	107	1110
1074338	1476	1491	116665	116680	GGATTTTGAGTCCCAC	77	1111
1074370	1674	1689	N/A	N/A	TTGATAGTATCACCTG	8	1112
1074402	1971	1986	122996	123011	TTATGGAAATTTCCGG	25	1113
1074434	2264	2279	123289	123304	ACTTCTAAGTCTGAGT	51*	1114
1074466	2651	2666	123676	123691	ACCGACCCTGCCAAAA	32	1115
1074498	2745	2760	123770	123785	ACAATAACCATCCCAA	17	1116
1074530	3021	3036	124046	124061	CTAAACTACTTCAAAC	88	1117
1074562	3177	3192	124202	124217	GAATTCCAATCGAGAC	30	1118
1074594	3370	3385	124395	124410	TAGGAGCAAGTCTTGT	6	1119
1074626	3730	3745	124755	124770	CTGTTATGAACCCTTG	5	1120
1074658	4023	4038	125048	125063	GGCCATTTCCCCCCAG	89	1121
1074690	4226	4241	125251	125266	CCTCCCCCTAAGCTAA	81	1122
1074722	4405	4420	125430	125445	AGGAAGATCTCCATAT	57	1123
1074754	4598	4613	125623	125638	CTTTTACATTAGGAAC	11	1124
1074786	4760	4775	125785	125800	AACCATAAGTAGATCT	28	1125
1074818	5035	5050	126060	126075	ACTGAATATTGCCACC	12	1126
1074850	5142	5157	126167	126182	TTGTTATGATAGGCAC	5	1127
1074914	N/A	N/A	5529	5544	TTACATCCCGAGTGGG	97	1128
1074946	N/A	N/A	5625	5640	CCAAAACCCTTTGGTC	109	1129
1074978	N/A	N/A	126492	126507	TTGCCAGTTCTTGTTC	38	1130
1075010	N/A	N/A	5288	5303	AATAATCGAACATTGT	88	1131
1075042	N/A	N/A	7676	7691	TTAAAAGGTTTGGCAC	17	1132
1075074	N/A	N/A	9744	9759	TATAGTAAGACTAATC	105	1133
1075106	N/A	N/A	11112	11127	CAAATTATAAGGTCCT	10	1134
1075138	N/A	N/A	13444	13459	AATAATAGATACTGCC	4	1135
1075170	N/A	N/A	17299	17314	ACTAAAATCCCCAAGG	94	1136
1075202	N/A	N/A	21884	21899	AATTATATAAGGCTGT	26	1137
1075234	N/A	N/A	24701	24716	GTAAATACTCTAGTTC	22	1138
1075266	N/A	N/A	27425	27440	TATTAGGACAAAGTAC	57	1139
1075298	N/A	N/A	30895	30910	ATCTCGGAAATTTAAA	128	1140
1075330	N/A	N/A	32458	32473	GAGGGAAAACTTTGCA	63	1141
1075362	N/A	N/A	34134	34149	CAGGAAAAATCTAGGT	50	1142
1075394	N/A	N/A	36170	36185	TCTTAACCTATGCCAA	27	1143
1075426	N/A	N/A	38752	38767	GTATTATTAATCCTGT	49	1144
1075458	N/A	N/A	40971	40986	CCACAATATACTCCAA	7	1145
1075490	N/A	N/A	42884	42899	CATATACGCAATTAGT	27	1146
1075522	N/A	N/A	45428	45443	CAAATCGAGGCGAATC	82	1147
1075554	N/A	N/A	47574	47589	TTGCAATAGTCACCCA	56	1148
1075586	N/A	N/A	49373	49388	TATTAGCACCTGGGTA	64	1149
1075618	N/A	N/A	51375	51390	TTTTAAGAACGACATA	69	1150
1075650	N/A	N/A	52783	52798	ATATTACAATCCCAGC	48	1151
1075682	N/A	N/A	55172	55187	GATAATTATTACCCCT	35	1152
1075714	N/A	N/A	57577	57592	AATTACAATCAACCTT	42	1153
1075746	N/A	N/A	59700	59715	GATTAACCCAGTAGAG	28	1154
1075778	N/A	N/A	62239	62254	CATTTATACCAGGCAC	3	1155
1075810	N/A	N/A	64258	64273	GTAGCAATAGAGTAAC	7	1156
1075842	N/A	N/A	67207	67222	GTATTTAGGTACTCAG	2	1157
1075874	N/A	N/A	71096	71111	CTTAACAACCCTACGA	113	1158
1075906	N/A	N/A	73792	73807	CCTCAATACAGATGAA	39	1159
1075938	N/A	N/A	76754	76769	GAATATATGGGTTTCA	55	1160
1075970	N/A	N/A	80333	80348	GCTTAAAAGGACAGTA	34	1161
1076002	N/A	N/A	82141	82156	ATTTAATGGCTTGCAT	21	1162
1076034	N/A	N/A	84970	84985	AATTAGAAACTTGGCC	74	1163
1076066	N/A	N/A	87168	87183	CATATAAGATGTTTGC	8	1164
1076098	N/A	N/A	90319	90334	TTACAATAATAAACGA	94	1165
1076130	N/A	N/A	92149	92164	CTGGAATAGTGGGTGC	34	1166
1076162	N/A	N/A	93320	93335	ATTTACTTGGCAACTC	9	1167
1076194	N/A	N/A	96060	96075	TTTAATACACAGGTTC	22	1168
1076226	N/A	N/A	97728	97743	CATATAAACCTTGCTA	36	1169
1076258	N/A	N/A	100563	100578	CTTTAGGTGCCTCCTT	10	1170
1076290	N/A	N/A	103434	103449	CTCCAACGGACAACTT	28	1171
1076322	N/A	N/A	106041	106056	ATTTACAAGTGAGCAC	21	1172
1076354	N/A	N/A	109382	109397	GATTAAACATTCGGAT	13	1173
1076386	N/A	N/A	111389	111404	AGTTATAACAGTGTAA	7	1174
1076418	N/A	N/A	113873	113888	TATAATAACCCATTGT	63	1175
1076450	N/A	N/A	117136	117151	CTTGAATAGCTATGTG	13	1176
1076482	N/A	N/A	119679	119694	CTTTAGACTAAGTAAG	107	1177
1076514	N/A	N/A	122224	122239	CCTTAGGAGATGCACC	18	1178
1076546	N/A	N/A	79333	79348	CCCCAACCTGAGGAGC	94	1179

TABLE 17
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	3	810
1074115	110	125	3570	3585	AGAACTTTTTCCCTCC	33	1180
1074147	288	303	3748	3763	AGAAGCGGCGACGGCT	23	1181
1074179	383	398	3843	3858	CGGGATCCATGGCTTC	49	1182
1074211	643	658	4103	4118	CTTCCGGAGCCTCATG	67	1183
1074243	932	947	7366	7381	TCTGACCAGAAGATGT	60	1184
1074275	1146	1161	79087	79102	CAAGAGGTGGTCTTGT	73	1185
1074307	1367	1382	99069	99084	GTGGCCTCACCTGCCG	105	1186
1074339	1479	1494	116668	116683	ACTGGATTTTGAGTCC	31	1187
1074371	1675	1690	122700	122715	GTTGATAGTATCACCT	31	1188
1074403	1973	1988	122998	123013	GCTTATGGAAATTTCC	9	1189
1074435	2265	2280	123290	123305	GACTTCTAAGTCTGAG	19*	1190
1074467	2652	2667	123677	123692	CACCGACCCTGCCAAA	31	1191
1074499	2746	2761	123771	123786	TACAATAACCATCCCA	10	1192
1074531	3023	3038	124048	124063	CACTAAACTACTTCAA	73	1193
1074563	3178	3193	124203	124218	TGAATTCCAATCGAGA	4	1194
1074595	3376	3391	124401	124416	TAGAAGTAGGAGCAAG	4	1195
1074627	3731	3746	124756	124771	CCTGTTATGAACCCTT	3	1196
1074659	4042	4057	125067	125082	CTAAAACTCCATCTGC	12	1197
1074691	4227	4242	125252	125267	CCCTCCCCCTAAGCTA	76	1198
1074723	4410	4425	125435	125450	GGTAAAGGAAGATCTC	6	1199
1074755	4600	4615	125625	125640	CACTTTTACATTAGGA	3	1200
1074787	4761	4776	125786	125801	CAACCATAAGTAGATC	13	1201
1074819	5039	5054	126064	126079	AAGCACTGAATATTGC	33	1202
1074851	5143	5158	126168	126183	ATTGTTATGATAGGCA	6	1203
1074915	N/A	N/A	5531	5546	AGTTACATCCCGAGTG	65	1204
1074947	N/A	N/A	5626	5641	TCCAAAACCCTTTGGT	99	1205
1074979	N/A	N/A	126493	126508	ATTGCCAGTTCTTGTT	32	1206
1075011	N/A	N/A	5292	5307	GCACAATAATCGAACA	44	1207
1075043	N/A	N/A	7834	7849	CCCCAAAAGCCCTACT	73	1208
1075075	N/A	N/A	9942	9957	AATTTTATAAGCCCAC	9	1209
1075107	N/A	N/A	11251	11266	TAAAAACATTGTGGCC	114	1210
1075139	N/A	N/A	13448	13463	CCCAAATAATAGATAC	65	1211
1075171	N/A	N/A	17320	17335	CCCCAATATAAAGAAC	88	1212
1075203	N/A	N/A	21885	21900	TAATTATATAAGGCTG	68	1213
1075235	N/A	N/A	24702	24717	AGTAAATACTCTAGTT	38	1214
1075267	N/A	N/A	27547	27562	CTATTTAGAATAAGTG	83	1215
1075299	N/A	N/A	31204	31219	GATAACCAATGCACCA	21	1216
1075331	N/A	N/A	32471	32486	GATAAACACTGCAGAG	33	1217
1075363	N/A	N/A	34223	34238	ACACAATATCAAGTCC	25	1218
1075395	N/A	N/A	36225	36240	ATGAATAAGTATGCCA	4	1219
1075427	N/A	N/A	38797	38812	TATAAGGCATCTTGGA	60	1220
1075459	N/A	N/A	41050	41065	AACCAAGGATAGTCAT	37	1221
1075491	N/A	N/A	43058	43073	GACGGAAGTTGCAAGG	93	1222
1075523	N/A	N/A	45517	45532	AATTAAGGGCCCACAA	78	1223
1075555	N/A	N/A	47585	47600	GCCAAAAATTCTTGCA	92	1224
1075587	N/A	N/A	49375	49390	CTTATTAGCACCTGGG	50	1225
1075619	N/A	N/A	51414	51429	CTTAGATACTACTTTG	54	1226
1075651	N/A	N/A	52784	52799	TATATTACAATCCCAG	57	1227
1075683	N/A	N/A	55227	55242	CTGAAAAAGTTATGCC	56	1228
1075715	N/A	N/A	57578	57593	GAATTACAATCAACCT	12	1229
1075747	N/A	N/A	59709	59724	ATTTAGCATGATTAAC	43	1230
1075779	N/A	N/A	62290	62305	GTATTACAAACTGATT	28	1231
1075811	N/A	N/A	64261	64276	ATTGTAGCAATAGAGT	10	1232
1075843	N/A	N/A	67232	67247	CATGAAATGATGGAAC	47	1233
1075875	N/A	N/A	71097	71112	ACTTAACAACCCTACG	72	1234
1075907	N/A	N/A	73846	73861	AATTACTACTGGCCAT	55	1235
1075939	N/A	N/A	76757	76772	CTTGAATATATGGGTT	6	1236
1075971	N/A	N/A	80380	80395	TATTAACATACCTCAT	28	1237
1076003	N/A	N/A	82142	82157	AATTTAATGGCTTGCA	8	1238
1076035	N/A	N/A	84972	84987	GTAATTAGAAACTTGG	9	1239
1076067	N/A	N/A	87169	87184	GCATATAAGATGTTTG	4	1240
1076099	N/A	N/A	90414	90429	CCTCAAAACTTGGATT	41	1241
1076131	N/A	N/A	92180	92195	TATTATGAGGACTGAT	23	1242
1076163	N/A	N/A	93798	93813	GATATAAGTTACCAAT	16	1243
1076195	N/A	N/A	96248	96263	AATAACATGGTTCTGT	20	1244
1076227	N/A	N/A	97800	97815	ACTTATAAGGCCAGCA	16	1245
1076259	N/A	N/A	100700	100715	ATTTAACTCCTGAAGT	61	1246
1076291	N/A	N/A	103541	103556	GATTAATGGTGGCATT	4	1247
1076323	N/A	N/A	106043	106058	CAATTTACAAGTGAGC	5	1248
1076355	N/A	N/A	109562	109577	CTACAAAAGAGCTATG	92	1249
1076387	N/A	N/A	111398	111413	TGACAACACAGTTATA	13	1250
1076419	N/A	N/A	113874	113889	ATATAATAACCCATTG	47	1251
1076451	N/A	N/A	117183	117198	CCTTAAGAACATGAGG	77	1252
1076483	N/A	N/A	119774	119789	ACGGGAAATCATATAG	5	1253
1076515	N/A	N/A	122246	122261	CTGCAAGAATACTTTA	30	1254
1076547	N/A	N/A	97024	97039	GACCAACCTCCCTCAG	89	1255

TABLE 18
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	1	810
1074116	111	126	3571	3586	GAGAACTTTTTCCCTC	112	1256
1074148	292	307	3752	3767	GTGGAGAAGCGGCGAC	66	1257
1074180	384	399	3844	3859	CCGGGATCCATGGCTT	86	1258
1074212	644	659	4104	4119	GCTTCCGGAGCCTCAT	53	1259
1074244	933	948	7367	7382	CTCTGACCAGAAGATG	95	1260
1074276	1147	1162	79088	79103	CCAAGAGGTGGTCTTG	87	1261
1074308	1376	1391	N/A	N/A	GCATTGCCTGTGGCCT	132	1262
1074340	1493	1508	116682	116697	TCCCGGGAGAAGACAC	120	1263
1074372	1680	1695	122705	122720	CTTTGGTTGATAGTAT	10	1264
1074404	1974	1989	122999	123014	GGCTTATGGAAATTTC	16	1265
1074436	2277	2292	123302	123317	CATGAAGCATCTGACT	31*	1266
1074468	2653	2668	123678	123693	CCACCGACCCTGCCAA	34	1267
1074500	2747	2762	123772	123787	CTACAATAACCATCCC	10	1268
1074532	3026	3041	124051	124066	GAACACTAAACTACTT	59	1269
1074564	3179	3194	124204	124219	CTGAATTCCAATCGAG	4	1270
1074596	3401	3416	124426	124441	TTCTATCCAGGGTCAA	12	1271
1074628	3732	3747	124757	124772	GCCTGTTATGAACCCT	5	1272
1074660	4057	4072	125082	125097	AATTTCATTACTACTC	48	1273
1074692	4245	4260	125270	125285	CCCCCCCAAACTTTCC	101	1274
1074724	4411	4426	125436	125451	GGGTAAAGGAAGATCT	22	1275
1074756	4601	4616	125626	125641	GCACTTTTACATTAGG	3	1276
1074788	4762	4777	125787	125802	TCAACCATAAGTAGAT	25	1277
1074820	5046	5061	126071	126086	AAGTGTTAAGCACTGA	85	1278
1074852	5144	5159	126169	126184	AATTGTTATGATAGGC	4	1279
1074916	N/A	N/A	5532	5547	AAGTTACATCCCGAGT	75	1280
1074948	N/A	N/A	5630	5645	GAGTTCCAAAACCCTT	61	1281
1074980	N/A	N/A	126494	126509	TATTGCCAGTTCTTGT	26	1282
1075012	N/A	N/A	5349	5364	CTATTGGAATGTTAAC	119	1283
1075044	N/A	N/A	7844	7859	AATTAGACTCCCCCAA	58	1284
1075076	N/A	N/A	10048	10063	CATAACATCATGGAAG	25	1285
1075108	N/A	N/A	11252	11267	CTAAAAACATTGTGGC	67	1286
1075140	N/A	N/A	13661	13676	CTTTAGGTTAAGCAAT	86	1287
1075172	N/A	N/A	17404	17419	CTTTACATGAACTGAT	14	1288
1075204	N/A	N/A	22115	22130	GTTAAACACATCTCAG	43	1289
1075236	N/A	N/A	24827	24842	TATAATACCACAAAGT	81	1290
1075268	N/A	N/A	27596	27611	TATTAACCTGGAGAGT	47	1291
1075300	N/A	N/A	31414	31429	CGTGAAAAGAAAGGCC	98	1292
1075332	N/A	N/A	32520	32535	AGCGGGTTTAGAATGC	66	1293
1075364	N/A	N/A	34293	34308	CGAAAATAGTTCTCAA	59	1294
1075396	N/A	N/A	36570	36585	ATTATCGCACATACAT	89	1295
1075428	N/A	N/A	38799	38814	TATATAAGGCATCTTG	53	1296
1075460	N/A	N/A	41053	41068	AATAACCAAGGATAGT	30	1297
1075492	N/A	N/A	43309	43324	GCTAAAATGATACTTC	29	1298
1075524	N/A	N/A	45518	45533	TAATTAAGGGCCCACA	71	1299
1075556	N/A	N/A	47618	47633	TGGCAAAAGAGTGGTG	68	1300
1075588	N/A	N/A	49376	49391	ACTTATTAGCACCTGG	27	1301
1075620	N/A	N/A	51476	51491	GATGAAGAATCTATAG	88	1302
1075652	N/A	N/A	52785	52800	GTATATTACAATCCCA	40	1303
1075684	N/A	N/A	55228	55243	TCTGAAAAAGTTATGC	78	1304
1075716	N/A	N/A	57654	57669	GCCGAAATACTCTCAT	19	1305
1075748	N/A	N/A	59723	59738	GTAAATCAAGTTGCAT	7	1306
1075780	N/A	N/A	62440	62455	TATAATAATCCAGAAC	98	1307
1075812	N/A	N/A	64470	64485	CATTAAGATTTTAACC	103	1308
1075844	N/A	N/A	67247	67262	TATTAAATAAGAGCTC	84	1309
1075876	N/A	N/A	71176	71191	GTATTTATGATGATTC	6	1310
1075908	N/A	N/A	74518	74533	AATAAGGAGTAGGTGG	50	1311
1075940	N/A	N/A	77113	77128	ACTCAACAACCCCAAG	54	1312
1075972	N/A	N/A	80426	80441	TCACAAGGGCTAATTC	22	1313
1076004	N/A	N/A	82143	82158	TAATTTAATGGCTTGC	2	1314
1076036	N/A	N/A	84973	84988	CGTAATTAGAAACTTG	19	1315
1076068	N/A	N/A	87383	87398	CTAAAATGACCTTAGC	73	1316
1076100	N/A	N/A	90552	90567	AATAAGGGACTACTTT	65	1317
1076132	N/A	N/A	92207	92222	CATCAATACTGACATC	28	1318
1076164	N/A	N/A	93799	93814	TGATATAAGTTACCAA	50	1319
1076196	N/A	N/A	96347	96362	TATCAAGGGAATTATT	113	1320
1076228	N/A	N/A	98039	98054	ATTAACCTCAGTGAGC	69	1321
1076260	N/A	N/A	100704	100719	CTTAATTTAACTCCTG	3	1322
1076292	N/A	N/A	103572	103587	TATTATTGAGTTATCC	27	1323
1076324	N/A	N/A	106059	106074	GCTCAAAAGGTCTCTC	13	1324
1076356	N/A	N/A	109576	109591	CATAATTGGACTGTCT	99	1325
1076388	N/A	N/A	111483	111498	GAAATATTCGAGAAGA	6	1326
1076420	N/A	N/A	113876	113891	CCATATAATAACCCAT	26	1327
1076452	N/A	N/A	117193	117208	GGACTATAGCCCTTAA	16	1328
1076484	N/A	N/A	119777	119792	GAAACGGGAAATCATA	10	1329
1076516	N/A	N/A	122314	122329	CATAAACATGAGTGGT	8	1330
1076548	N/A	N/A	116744	116759	CACCAACCTGTTAAGG	106	1331

TABLE 19
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	2	810
1074117	117	132	3577	3592	GCGCCTGAGAACTTTT	87	1332
1074149	298	313	3758	3773	GCCGAGGTGGAGAAGC	58	1333
1074181	385	400	3845	3860	CCCGGGATCCATGGCT	107	1334
1074213	654	669	4114	4129	GAGTCGGGCAGCTTCC	55	1335
1074245	941	956	7375	7390	AGAAGTATCTCTGACC	5	1336
1074277	1153	1168	79094	79109	GTCTAGCCAAGAGGTG	18	1337
1074309	1378	1393	N/A	N/A	CCGCATTGCCTGTGGC	80	1338
1074341	1494	1509	116683	116698	ATCCCGGGAGAAGACA	106	1339
1074373	1681	1696	122706	122721	GCTTTGGTTGATAGTA	26	1340
1074405	1991	2006	123016	123031	GCCTGAAAACTGCAAC	27	1341
1074437	2278	2293	123303	123318	ACATGAAGCATCTGAC	4*	1342
1074469	2654	2669	123679	123694	CCCACCGACCCTGCCA	77	1343
1074501	2748	2763	123773	123788	ACTACAATAACCATCC	9	1344
1074533	3028	3043	124053	124068	TAGAACACTAAACTAC	80	1345
1074565	3180	3195	124205	124220	ACTGAATTCCAATCGA	5	1346
1074597	3405	3420	124430	124445	AGTATTCTATCCAGGG	5	1347
1074629	3742	3757	124767	124782	GAGATTTTATGCCTGT	3	1348
1074661	4058	4073	125083	125098	GAATTTCATTACTACT	36	1349
1074693	4246	4261	125271	125286	CCCCCCCCAAACTTTC	92	1350
1074725	4437	4452	125462	125477	GTATAACTGGGCAAAT	17	1351
1074757	4607	4622	125632	125647	AGTTAAGCACTTTTAC	21	1352
1074789	4763	4778	125788	125803	ATCAACCATAAGTAGA	17	1353
1074821	5049	5064	126074	126089	GAAAAGTGTTAAGCAC	18	1354
1074853	5145	5160	126170	126185	CAATTGTTATGATAGG	15	1355
1074917	N/A	N/A	5533	5548	CAAGTTACATCCCGAG	80	1356
1074949	N/A	N/A	5642	5657	GTGATTTTTTCTGAGT	31	1357
1074981	N/A	N/A	126495	126510	TTATTGCCAGTTCTTG	9	1358
1075013	N/A	N/A	5768	5783	CATAAACCCACTTCGA	102	1359
1075045	N/A	N/A	7845	7860	AAATTAGACTCCCCCA	18	1360
1075077	N/A	N/A	10057	10072	TATACGGTCCATAACA	35	1361
1075109	N/A	N/A	11253	11268	ACTAAAAACATTGTGG	71	1362
1075141	N/A	N/A	13863	13878	TATACGAGAAGTTGAA	54	1363
1075173	N/A	N/A	17464	17479	CTTTAGGGCAACTGTA	22	1364
1075205	N/A	N/A	22160	22175	ATTAAATGAGCACCAC	29	1365
1075237	N/A	N/A	25230	25245	GCTGAAAATGCTAACT	105	1366
1075269	N/A	N/A	27597	27612	TTATTAACCTGGAGAG	13	1367
1075301	N/A	N/A	31460	31475	CAGCAACACCTAAGGA	92	1368
1075333	N/A	N/A	32529	32544	AGTTAACAAAGCGGGT	14	1369
1075365	N/A	N/A	34295	34310	CACGAAAATAGTTCTC	11	1370
1075397	N/A	N/A	36571	36586	CATTATCGCACATACA	79	1371
1075429	N/A	N/A	38974	38989	CTTTACTATCTGGGTC	23	1372
1075461	N/A	N/A	41056	41071	CTAAATAACCAAGGAT	64	1373
1075493	N/A	N/A	43320	43335	AGACAAGGGATGCTAA	67	1374
1075525	N/A	N/A	45519	45534	TTAATTAAGGGCCCAC	130	1375
1075557	N/A	N/A	47655	47670	TATTAAGGTGGCTTAC	57	1376
1075589	N/A	N/A	49390	49405	AATTAGCAGGGCAGAC	84	1377
1075621	N/A	N/A	51645	51660	GATTAACATTGATACT	61	1378
1075653	N/A	N/A	53476	53491	CATAAACTCTGCTGTC	58	1379
1075685	N/A	N/A	55369	55384	CATAATCAAAGGGTGC	60	1380
1075717	N/A	N/A	57665	57680	CATAAATTTCAGCCGA	10	1381
1075749	N/A	N/A	59800	59815	AATTATGAATGATGGG	4	1382
1075781	N/A	N/A	62475	62490	CATATATTGTGACTTC	2	1383
1075813	N/A	N/A	64652	64667	ACTAATATGCAACTCT	4	1384
1075845	N/A	N/A	67654	67669	GTGGAAAAGTATGATC	19	1385
1075877	N/A	N/A	71248	71263	CTGGAAAAGTACATTC	28	1386
1075909	N/A	N/A	74519	74534	AAATAAGGAGTAGGTG	93	1387
1075941	N/A	N/A	77150	77165	AGTCAATAGCAATCAC	11	1388
1075973	N/A	N/A	80581	80596	CCGCAACACCATTCTT	8	1389
1076005	N/A	N/A	82193	82208	GTACAAAATCTCCAGG	69	1390
1076037	N/A	N/A	84987	85002	CTTAAATTCTCTTACG	21	1391
1076069	N/A	N/A	87384	87399	TCTAAAATGACCTTAG	118	1392
1076101	N/A	N/A	90553	90568	AAATAAGGGACTACTT	71	1393
1076133	N/A	N/A	92254	92269	CATACTAATTTGGTAA	60	1394
1076165	N/A	N/A	93923	93938	CCCCAAGGACTTGCCA	79	1395
1076197	N/A	N/A	96350	96365	TATTATCAAGGGAATT	94	1396
1076229	N/A	N/A	98040	98055	AATTAACCTCAGTGAG	91	1397
1076261	N/A	N/A	100852	100867	CCCCAACAAGTTCCTG	39	1398
1076293	N/A	N/A	103575	103590	GCTTATTATTGAGTTA	3	1399
1076325	N/A	N/A	106620	106635	CTAATAATGGAAGAGT	16	1400
1076357	N/A	N/A	109680	109695	TCCAAAAACTTCTTAG	22	1401
1076389	N/A	N/A	111486	111501	ATCGAAATATTCGAGA	76	1402
1076421	N/A	N/A	113900	113915	AATTATGACCTCCATG	65	1403
1076453	N/A	N/A	117330	117345	GTAATATTGCAATCTG	1	1404
1076485	N/A	N/A	119781	119796	AAACGAAACGGGAAAT	55	1405
1076517	N/A	N/A	122329	122344	CATAATAAGACTAAAC	102	1406
1076549	N/A	N/A	117537	117552	GTGCAAAATACCTTTG	8	1407

TABLE 20
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	1	810
1074118	131	146	3591	3606	CACTCGGACCTGCGGC	66	1408
1074150	299	314	3759	3774	GGCCGAGGTGGAGAAG	85	1409
1074182	386	401	3846	3861	GCCCGGGATCCATGGC	82	1410
1074214	672	687	4132	4147	TCCGGCGGCTTGAAGA	89	1411
1074246	942	957	7376	7391	AAGAAGTATCTCTGAC	11	1412
1074278	1158	1173	79099	79114	CTTGGGTCTAGCCAAG	31	1413
1074310	1379	1394	N/A	N/A	TCCGCATTGCCTGTGG	100	1414
1074342	1495	1510	116684	116699	CATCCCGGGAGAAGAC	56	1415
1074374	1682	1697	122707	122722	TGCTTTGGTTGATAGT	13	1416
1074406	2032	2047	123057	123072	AAAGTATCTTGCTGGA	16	1417
1074438	2279	2294	123304	123319	GACATGAAGCATCTGA	1*	1418
1074470	2657	2672	123682	123697	CCCCCCACCGACCCTG	69	1419
1074502	2749	2764	123774	123789	AACTACAATAACCATC	31	1420
1074534	3041	3056	124066	124081	TAATAGCTCTTTCTAG	88	1421
1074566	3181	3196	124206	124221	CACTGAATTCCAATCG	3	1422
1074598	3410	3425	124435	124450	CTTATAGTATTCTATC	46	1423
1074630	3743	3758	124768	124783	AGAGATTTTATGCCTG	5	1424
1074662	4062	4077	125087	125102	GGTAGAATTTCATTAC	30	1425
1074694	4247	4262	125272	125287	CCCCCCCCCAAACTTT	79	1426
1074726	4438	4453	125463	125478	GGTATAACTGGGCAAA	2	1427
1074758	4608	4623	125633	125648	CAGTTAAGCACTTTTA	4	1428
1074790	4764	4779	125789	125804	CATCAACCATAAGTAG	28	1429
1074822	5051	5066	126076	126091	TAGAAAAGTGTTAAGC	25	1430
1074854	5146	5161	126171	126186	ACAATTGTTATGATAG	23	1431
1074918	N/A	N/A	5534	5549	TCAAGTTACATCCCGA	60	1432
1074950	N/A	N/A	5652	5667	ATCAGGTTAAGTGATT	120	1433
1074982	N/A	N/A	126500	126515	ACCTTTTATTGCCAGT	13	1434
1075014	N/A	N/A	6038	6053	GGAGAAATAAAAGTCG	46	1435
1075046	N/A	N/A	7846	7861	AAAATTAGACTCCCCC	12	1436
1075078	N/A	N/A	10061	10076	CAACTATACGGTCCAT	3	1437
1075110	N/A	N/A	11254	11269	GACTAAAAACATTGTG	120	1438
1075142	N/A	N/A	13865	13880	GATATACGAGAAGTTG	16	1439
1075174	N/A	N/A	17491	17506	CCTGAAAAGACAGTCC	74	1440
1075206	N/A	N/A	22161	22176	TATTAAATGAGCACCA	36	1441
1075238	N/A	N/A	25596	25611	CTTAAACAGGTGCCAA	24	1442
1075270	N/A	N/A	27599	27614	CTTTATTAACCTGGAG	18	1443
1075302	N/A	N/A	31497	31512	CCTTAAAGCTTCCACC	75	1444
1075334	N/A	N/A	32542	32557	TTAATAATCTACCAGT	60	1445
1075366	N/A	N/A	34296	34311	ACACGAAAATAGTTCT	27	1446
1075398	N/A	N/A	36612	36627	TATATATGGCCCTTTA	49	1447
1075430	N/A	N/A	39017	39032	CTTAACTAACTTGACC	96	1448
1075462	N/A	N/A	41259	41274	GTTTATAGACAAGTCA	15	1449
1075494	N/A	N/A	43450	43465	TCTCAACAATTTGCTA	47	1450
1075526	N/A	N/A	45520	45535	TTTAATTAAGGGCCCA	110	1451
1075558	N/A	N/A	47656	47671	ATATTAAGGTGGCTTA	51	1452
1075590	N/A	N/A	49396	49411	CATCAAAATTAGCAGG	50	1453
1075622	N/A	N/A	51771	51786	TCTTATACCTATCTTC	56	1454
1075654	N/A	N/A	53501	53516	TATTAAGACGAATCCA	76	1455
1075686	N/A	N/A	55578	55593	GTAATTACAGTGTCTC	10	1456
1075718	N/A	N/A	57703	57718	CCACTAAAACCAAGTT	48	1457
1075750	N/A	N/A	59801	59816	CAATTATGAATGATGG	10	1458
1075782	N/A	N/A	62506	62521	TATTAGGTTTCCCGTT	10	1459
1075814	N/A	N/A	64821	64836	TATAAAGCAGGGCATT	47	1460
1075846	N/A	N/A	67670	67685	GATTAAGAGCCTATCT	96	1461
1075878	N/A	N/A	71286	71301	GATTATCAAGTAGTTT	35	1462
1075910	N/A	N/A	74520	74535	GAAATAAGGAGTAGGT	93	1463
1075942	N/A	N/A	77172	77187	TGACTATACATGGTGA	46	1464
1075974	N/A	N/A	80589	80604	AAAAAATTCCGCAACA	39	1465
1076006	N/A	N/A	82219	82234	TTTAAACCTGAGACTC	41	1466
1076038	N/A	N/A	85047	85062	AGGCAAGAATTGGGTA	11	1467
1076070	N/A	N/A	87434	87449	ATTAGTAATGCACAGG	6	1468
1076102	N/A	N/A	90613	90628	CTTAACAAATCAGCCC	32	1469
1076134	N/A	N/A	92267	92282	GATTAGAGTTGGGCAT	10	1470
1076166	N/A	N/A	93997	94012	ATTTACACCACCGCCC	77	1471
1076198	N/A	N/A	96351	96366	CTATTATCAAGGGAAT	81	1472
1076230	N/A	N/A	98041	98056	GAATTAACCTCAGTGA	50	1473
1076262	N/A	N/A	101120	101135	AGACAATAGTCTGGGC	41	1474
1076294	N/A	N/A	103629	103644	TATATTAGTGCCCCCT	6	1475
1076326	N/A	N/A	106621	106636	GCTAATAATGGAAGAG	4	1476
1076358	N/A	N/A	109745	109760	GTTTAACAAACTTGTA	43	1477
1076390	N/A	N/A	111487	111502	GATCGAAATATTCGAG	54	1478
1076422	N/A	N/A	113901	113916	GAATTATGACCTCCAT	13	1479
1076454	N/A	N/A	117469	117484	TAAACTAATCCCATAT	35	1480
1076486	N/A	N/A	119782	119797	GAAACGAAACGGGAAA	5	1481
1076518	N/A	N/A	122341	122356	GATAAGCACCACCATA	25	1482
1076550	N/A	N/A	120573	120588	TACCAACCTGTATCCA	61	1483

TABLE 21
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	1	810
1074119	132	147	3592	3607	GCACTCGGACCTGCGG	71	1484
1074151	300	315	3760	3775	GGGCCGAGGTGGAGAA	81	1485
1074183	407	422	3867	3882	CCGGTTGAGGCGGCGG	90	1486
1074215	674	689	4134	4149	GCTCCGGCGGCTTGAA	77	1487
1074247	955	970	N/A	N/A	ATCGATGTGATTTAAG	43	1488
1074279	1165	1180	79106	79121	GTCAAGCCTTGGGTCT	13	1489
1074311	1380	1395	N/A	N/A	TTCCGCATTGCCTGTG	24	1490
1074343	1498	1513	116687	116702	AGACATCCCGGGAGAA	18	1491
1074375	1688	1703	122713	122728	GCAGGGTGCTTTGGTT	33	1492
1074407	2033	2048	123058	123073	TAAAGTATCTTGCTGG	6	1493
1074439	2283	2298	123308	123323	CTGTGACATGAAGCAT	2*	1494
1074471	2658	2673	123683	123698	CCCCCCCACCGACCCT	69	1495
1074503	2750	2765	123775	123790	CAACTACAATAACCAT	29	1496
1074535	3042	3057	124067	124082	GTAATAGCTCTTTCTA	5	1497
1074567	3189	3204	124214	124229	AACCTACTCACTGAAT	38	1498
1074599	3423	3438	124448	124463	GCTAACTCAAAACCTT	12	1499
1074631	3765	3780	124790	124805	CATAGCAGCTTTTGCC	9	1500
1074663	4069	4084	125094	125109	CATTCTAGGTAGAATT	79	1501
1074695	4266	4281	125291	125306	CCCCCTAAATCTTCAC	49	1502
1074727	4440	4455	125465	125480	GAGGTATAACTGGGCA	9	1503
1074759	4619	4634	125644	125659	CAACCAAGAAGCAGTT	43	1504
1074791	4767	4782	125792	125807	CTCCATCAACCATAAG	20	1505
1074823	5080	5095	126105	126120	GAGCACTCATTTCTCA	77	1506
1074855	5213	5228	126238	126253	GTGCATTAAAGAATTC	29	1507
1074887	N/A	N/A	5450	5465	TAGCCTGAAGCAAGTT	57	1508
1074919	N/A	N/A	5535	5550	CTCAAGTTACATCCCG	48	1509
1074951	N/A	N/A	5653	5668	CATCAGGTTAAGTGAT	85	1510
1074983	N/A	N/A	126501	126516	CACCTTTTATTGCCAG	11	1511
1075015	N/A	N/A	6067	6082	CAGAATAAGTATGATT	55	1512
1075047	N/A	N/A	7847	7862	TAAAATTAGACTCCCC	7	1513
1075079	N/A	N/A	10149	10164	CACCAAAAGCTTAGTT	40	1514
1075111	N/A	N/A	11385	11400	TAGGAATATGGGTAGT	5	1515
1075143	N/A	N/A	13883	13898	CCTTATTAGTCAGTTC	2	1516
1075175	N/A	N/A	17507	17522	ACTGAAAGATTCCATG	99	1517
1075207	N/A	N/A	22162	22177	CTATTAAATGAGCACC	4	1518
1075239	N/A	N/A	25597	25612	TCTTAAACAGGTGCCA	27	1519
1075271	N/A	N/A	27652	27667	GATGTGATCTGTGAGA	11	1520
1075303	N/A	N/A	31554	31569	TAAACTAATCTACAAC	100	1521
1075335	N/A	N/A	32543	32558	CTTAATAATCTACCAG	30	1522
1075367	N/A	N/A	34502	34517	CATTACTTAGGGCTTA	12	1523
1075399	N/A	N/A	36614	36629	CATATATATGGCCCTT	15	1524
1075431	N/A	N/A	39045	39060	TAACTAAACTGATTCC	74	1525
1075463	N/A	N/A	41370	41385	CTTAATCCAAAGCTTC	34	1526
1075495	N/A	N/A	43489	43504	CTTAATTGGTAACTGA	19	1527
1075527	N/A	N/A	45521	45536	ATTTAATTAAGGGCCC	82	1528
1075559	N/A	N/A	47657	47672	GATATTAAGGTGGCTT	24	1529
1075591	N/A	N/A	49541	49556	GTAATAATCACCTTAC	76	1530
1075623	N/A	N/A	51815	51830	CATAATCAAAATGGGC	48	1531
1075655	N/A	N/A	53502	53517	CTATTAAGACGAATCC	38	1532
1075687	N/A	N/A	55642	55657	TAAACGAGTAATGACT	23	1533
1075719	N/A	N/A	58015	58030	CTAAAACCGGCTGGAC	76	1534
1075751	N/A	N/A	59839	59854	GAGGAACAAGATCTCA	72	1535
1075783	N/A	N/A	62684	62699	CTTAATTTACCTGAAC	36	1536
1075815	N/A	N/A	64822	64837	GTATAAAGCAGGGCAT	36	1537
1075847	N/A	N/A	67823	67838	CTTTATAGCAGATGCC	14	1538
1075879	N/A	N/A	71353	71368	GAATAAAGAAGTCACC	77	1539
1075911	N/A	N/A	74637	74652	TGACAAAACAGGCACC	41	1540
1075943	N/A	N/A	77361	77376	GTATATCAAACCTTTT	15	1541
1075975	N/A	N/A	80592	80607	GGAAAAAAATTCCGCA	84	1542
1076007	N/A	N/A	82293	82308	CATTAGGCCTTTTACT	27	1543
1076039	N/A	N/A	85200	85215	GATTAGAGCTGTATTC	29	1544
1076071	N/A	N/A	87435	87450	TATTAGTAATGCACAG	14	1545
1076103	N/A	N/A	90614	90629	GCTTAACAAATCAGCC	79	1546
1076135	N/A	N/A	92319	92334	CATAATTGACAGGTAT	14	1547
1076167	N/A	N/A	93999	94014	AAATTTACACCACCGC	33	1548
1076199	N/A	N/A	96382	96397	TATCAAAAGTCCATCC	37	1549
1076231	N/A	N/A	98106	98121	TTAGAAATGGACTGGG	16	1550
1076263	N/A	N/A	101298	101313	AATAACCAAGTGAGTT	21	1551
1076295	N/A	N/A	103630	103645	GTATATTAGTGCCCCC	2	1552
1076327	N/A	N/A	106694	106709	GATAAGCAAGGTTCTC	7	1553
1076359	N/A	N/A	109776	109791	ATTTATCCTAGTTACC	29	1554
1076391	N/A	N/A	111530	111545	CAAATATAGTTAGCCT	22	1555
1076423	N/A	N/A	114068	114083	CCTGAACCTTCTGGAT	93	1556
1076455	N/A	N/A	117635	117650	ACTAAATACTTTTAGC	86	1557
1076487	N/A	N/A	119786	119801	GTACGAAACGAAACGG	21	1558
1076519	N/A	N/A	122375	122390	ACACAACACGACAGCA	31	1559
1076551	N/A	N/A	5268	5283	GTGGAATAGCAGCCAT	67	1560

TABLE 22
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	1	810
1074120	137	152	3597	3612	GCGAGGCACTCGGACC	50	1561
1074152	301	316	3761	3776	CGGGCCGAGGTGGAGA	77	1562
1074184	408	423	3868	3883	GCCGGTTGAGGCGGCG	100	1563
1074216	681	696	4141	4156	GATTTGGGCTCCGGCG	58	1564
1074248	956	971	N/A	N/A	GATCGATGTGATTTAA	29	1565
1074280	1166	1181	79107	79122	GGTCAAGCCTTGGGTC	43	1566
1074312	1383	1398	102515	102530	ATATTCCGCATTGCCT	18	1567
1074344	1500	1515	116689	116704	TGAGACATCCCGGGAG	99	1568
1074376	1706	1721	122731	122746	AACGGTTCTGCTGTGA	44	1569
1074408	2036	2051	123061	123076	GATTAAAGTATCTTGC	23	1570
1074440	2284	2299	123309	123324	GCTGTGACATGAAGCA	38*	1571
1074472	2660	2675	123685	123700	AACCCCCCCACCGACC	107	1572
1074504	2804	2819	123829	123844	TCGAGATTTAAATAAG	76	1573
1074536	3043	3058	124068	124083	AGTAATAGCTCTTTCT	6	1574
1074568	3190	3205	124215	124230	GAACCTACTCACTGAA	12	1575
1074600	3425	3440	124450	124465	CAGCTAACTCAAAACC	29	1576
1074632	3766	3781	124791	124806	TCATAGCAGCTTTTGC	12	1577
1074664	4070	4085	125095	125110	GCATTCTAGGTAGAAT	49	1578
1074696	4268	4283	125293	125308	GTCCCCCTAAATCTTC	38	1579
1074728	4441	4456	125466	125481	TGAGGTATAACTGGGC	3	1580
1074760	4620	4635	125645	125660	ACAACCAAGAAGCAGT	11	1581
1074792	4776	4791	125801	125816	ATCAATGTGCTCCATC	4	1582
1074824	5083	5098	126108	126123	CCTGAGCACTCATTTC	53	1583
1074856	5223	5238	126248	126263	TTTGACAAGTGTGCAT	15	1584
1074888	N/A	N/A	5453	5468	GTTTAGCCTGAAGCAA	58	1585
1074920	N/A	N/A	5536	5551	ACTCAAGTTACATCCC	68	1586
1074952	N/A	N/A	5661	5676	GTTTTTGTCATCAGGT	42	1587
1074984	N/A	N/A	126503	126518	ATCACCTTTTATTGCC	31	1588
1075016	N/A	N/A	6068	6083	TCAGAATAAGTATGAT	100	1589
1075048	N/A	N/A	7848	7863	GTAAAATTAGACTCCC	4	1590
1075080	N/A	N/A	10219	10234	ATTACAAAGACAGCCC	18	1591
1075112	N/A	N/A	11388	11403	ATATAGGAATATGGGT	6	1592
1075144	N/A	N/A	14659	14674	ACCCTATATCCTATAT	82	1593
1075176	N/A	N/A	17544	17559	AATTACCCGGGAACTA	70	1594
1075208	N/A	N/A	22191	22206	ACTGAACACAGGCTAC	24	1595
1075240	N/A	N/A	25749	25764	TAAACGGTTTATATTC	16	1596
1075272	N/A	N/A	28023	28038	AATTAGCCAGCATGCA	110	1597
1075304	N/A	N/A	31613	31628	CACGGGTACCAGAAAA	50	1598
1075336	N/A	N/A	32544	32559	GCTTAATAATCTACCA	32	1599
1075368	N/A	N/A	34751	34766	GAGAATAAGCAATCAG	24	1600
1075400	N/A	N/A	36641	36656	TAGCAATAGTCAGGTA	11	1601
1075432	N/A	N/A	39046	39061	CTAACTAAACTGATTC	121	1602
1075464	N/A	N/A	41448	41463	CCACTAAACCACCTAA	77	1603
1075496	N/A	N/A	43503	43518	TTATATAATGCAGGCT	22	1604
1075528	N/A	N/A	45616	45631	ATCGAAGGGCAAACTC	42	1605
1075560	N/A	N/A	47723	47738	GCTAAATAAAGGTTAC	86	1606
1075592	N/A	N/A	49542	49557	CGTAATAATCACCTTA	55	1607
1075624	N/A	N/A	51848	51863	ATCTATAACCCTTATT	91	1608
1075656	N/A	N/A	53591	53606	AAAACGGTTTTTCTAA	103	1609
1075688	N/A	N/A	55673	55688	GACAATAAACATCACC	12	1610
1075720	N/A	N/A	58458	58473	CTTTACTACATATAGC	47	1611
1075752	N/A	N/A	60020	60035	CATAATTATACTGATC	19	1612
1075784	N/A	N/A	62703	62718	ATTTTATAGGGCCATT	3	1613
1075816	N/A	N/A	64824	64839	TAGTATAAAGCAGGGC	7	1614
1075848	N/A	N/A	67963	67978	GATTACAATGGGCAGT	9	1615
1075880	N/A	N/A	71412	71427	ATTAACTACACCACGA	30	1616
1075912	N/A	N/A	74743	74758	AGTTATACACAACCAC	13	1617
1075944	N/A	N/A	77599	77614	TATTAGGAACAGATCA	25	1618
1075976	N/A	N/A	80964	80979	ATTAAAAGTCGGGCCA	92	1619
1076008	N/A	N/A	82386	82401	AGCGAAAATAACATTA	33	1620
1076040	N/A	N/A	85319	85334	CTTAAAGAAGCACTAG	105	1621
1076072	N/A	N/A	87726	87741	CACAAAAACTGGTCTG	18	1622
1076104	N/A	N/A	90640	90655	ACGAAATAGTAACTGT	24	1623
1076136	N/A	N/A	92372	92387	CAACAACCTCATGTAA	60	1624
1076168	N/A	N/A	94000	94015	CAAATTTACACCACCG	23	1625
1076200	N/A	N/A	96417	96432	GATTACACTATCAAAA	67	1626
1076232	N/A	N/A	98125	98140	GTAATACACCATTTGG	15	1627
1076264	N/A	N/A	101302	101317	ACCCAATAACCAAGTG	40	1628
1076296	N/A	N/A	103670	103685	TATAAAGACCCAATGC	68	1629
1076328	N/A	N/A	107005	107020	ACTGAACCGCTGCCTC	33	1630
1076360	N/A	N/A	109778	109793	CTATTTATCCTAGTTA	59	1631
1076392	N/A	N/A	111564	111579	TATTAATCAAATAGGG	64	1632
1076424	N/A	N/A	114085	114100	ACTTAACCTGACAGCT	76	1633
1076456	N/A	N/A	117763	117778	CTTTAAAGTGTATGTC	2	1634
1076488	N/A	N/A	119867	119882	GCCAATAAGATAAGAA	19	1635
1076520	N/A	N/A	122407	122422	AATTATATGCAGCAGC	21	1636
1076552	N/A	N/A	11807	11822	ATGTATAAATACCAGG	7	1637

TABLE 23
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2		YAP1
Compound	Start	Stop	Start	Stop		(%	SEQ
Number	Site	Site	Site	Site	Sequence (5' to 3')	UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	2	810
1074121	138	153	3598	3613	TGCGAGGCACTCGGAC	87	1638
1074153	303	318	3763	3778	CACGGGCCGAGGTGGA	78	1639
1074185	409	424	3869	3884	GGCCGGTTGAGGCGGC	91	1640
1074217	682	697	4142	4157	GGATTTGGGCTCCGGC	74	1641
1074249	957	972	N/A	N/A	TGATCGATGTGATTTA	23	1642
1074281	1169	1184	79110	79125	GAGGGTCAAGCCTTGG	91	1643
1074313	1385	1400	102517	102532	TGATATTCCGCATTGC	5	1644
1074345	1533	1548	116722	116737	TCTGAGCTATTGGTCG	8	1645
1074377	1707	1722	122732	122747	AAACGGTTCTGCTGTG	52	1646
1074409	2037	2052	123062	123077	GGATTAAAGTATCTTG	6	1647
1074441	2294	2309	123319	123334	CAAACTAAATGCTGTG	5*	1648
1074473	2661	2676	123686	123701	CAACCCCCCCACCGAC	82	1649
1074505	2806	2821	123831	123846	AATCGAGATTTAAATA	83	1650
1074537	3044	3059	124069	124084	CAGTAATAGCTCTTTC	3	1651
1074569	3191	3206	124216	124231	TGAACCTACTCACTGA	8	1652
1074601	3426	3441	124451	124466	CCAGCTAACTCAAAAC	24	1653
1074633	3774	3789	124799	124814	GAGGCTTTTCATAGCA	78	1654
1074665	4072	4087	125097	125112	TTGCATTCTAGGTAGA	17	1655
1074697	4274	4289	125299	125314	ATCAAGGTCCCCCTAA	44	1656
1074729	4445	4460	125470	125485	ACACTGAGGTATAACT	9	1657
1074761	4628	4643	125653	125668	TACCCAATACAACCAA	15	1658
1074793	4777	4792	125802	125817	AATCAATGTGCTCCAT	9	1659
1074825	5084	5099	126109	126124	ACCTGAGCACTCATTT	36	1660
1074857	5245	5260	126270	126285	ACATTGGTACTATATA	25	1661
1074889	N/A	N/A	5454	5469	AGTTTAGCCTGAAGCA	42	1662
1074921	N/A	N/A	5537	5552	CACTCAAGTTACATCC	65	1663
1074953	N/A	N/A	5663	5678	GGGTTTTTGTCATCAG	32	1664
1074985	N/A	N/A	126504	126519	AATCACCTTTTATTGC	49	1665
1075017	N/A	N/A	6099	6114	CTTAAAGTGATACACC	19	1666
1075049	N/A	N/A	7912	7927	GAAATATTGGTAAGTC	10	1667
1075081	N/A	N/A	10220	10235	GATTACAAAGACAGCC	7	1668
1075113	N/A	N/A	11804	11819	TATAAATACCAGGTAC	67	1669
1075145	N/A	N/A	15306	15321	TCCCAAAAGGAGTAGC	58	1670
1075177	N/A	N/A	17546	17561	GAAATTACCCGGGAAC	27	1671
1075209	N/A	N/A	22213	22228	CATCAACAATGGTCTA	11	1672
1075241	N/A	N/A	25786	25801	GATAATTACTAACTGA	31	1673
1075273	N/A	N/A	28145	28160	AAATTATGGTCAGGCT	18	1674
1075305	N/A	N/A	31621	31636	AAACGAAACACGGGTA	66	1675
1075337	N/A	N/A	32561	32576	GCTTATATCCTGTAAC	48	1676
1075369	N/A	N/A	34752	34767	GGAGAATAAGCAATCA	31	1677
1075401	N/A	N/A	36720	36735	CGATTAAAACACTGGT	3	1678
1075433	N/A	N/A	39050	39065	TTAACTAACTAAACTG	124	1679
1075465	N/A	N/A	41471	41486	GATTTATTGAACTGAG	7	1680
1075497	N/A	N/A	43504	43519	ATTATATAATGCAGGC	14	1681
1075529	N/A	N/A	45618	45633	AAATCGAAGGGCAAAC	84	1682
1075561	N/A	N/A	47742	47757	GTAAGTAAGGGAACCC	32	1683
1075593	N/A	N/A	49605	49620	CATTAGAGTATGAACT	99	1684
1075625	N/A	N/A	51849	51864	AATCTATAACCCTTAT	49	1685
1075657	N/A	N/A	53594	53609	TAAAAAACGGTTTTTC	84	1686
1075689	N/A	N/A	55744	55759	CAACTATACAAGGCAA	4	1687
1075721	N/A	N/A	58637	58652	TTAAATACCTTCTAGC	67	1688
1075753	N/A	N/A	60167	60182	CTAGAACCTTTTCCAG	65	1689
1075785	N/A	N/A	62704	62719	CATTTTATAGGGCCAT	2	1690
1075817	N/A	N/A	65591	65606	CCTAAAGAAGTCTTGG	100	1691
1075849	N/A	N/A	67996	68011	CTAGAACACGCTGATG	55	1692
1075881	N/A	N/A	71413	71428	GATTAACTACACCACG	23	1693
1075913	N/A	N/A	75193	75208	CCCCTATACTTTTTGA	46	1694
1075945	N/A	N/A	77600	77615	GTATTAGGAACAGATC	11	1695
1075977	N/A	N/A	80965	80980	GATTAAAAGTCGGGCC	73	1696
1076009	N/A	N/A	82387	82402	TAGCGAAAATAACATT	69	1697
1076041	N/A	N/A	85661	85676	GTTAAAGAGTGGAAAT	47	1698
1076073	N/A	N/A	88094	88109	CTTTAAGGTCTAGTTA	47	1699
1076105	N/A	N/A	90641	90656	TACGAAATAGTAACTG	13	1700
1076137	N/A	N/A	92375	92390	CACCAACAACCTCATG	45	1701
1076169	N/A	N/A	94082	94097	CTACTATATCTTTGGG	10	1702
1076201	N/A	N/A	96469	96484	CTAAAAAGACAGGGCC	99	1703
1076233	N/A	N/A	98280	98295	CCAATAAAGCAAGTAG	13	1704
1076265	N/A	N/A	101306	101321	TATTACCCAATAACCA	9	1705
1076297	N/A	N/A	103671	103686	TTATAAAGACCCAATG	52	1706
1076329	N/A	N/A	107153	107168	AATTATACTGGCTACT	14	1707
1076361	N/A	N/A	109944	109959	TGGGAAAAGCTACCAC	87	1708
1076393	N/A	N/A	111591	111606	CTTTACTTACTGGTGG	4	1709
1076425	N/A	N/A	114175	114190	CGGGAAAATTCTGGAG	32	1710
1076457	N/A	N/A	117800	117815	GAACTATAATCTTATA	74	1711
1076489	N/A	N/A	119885	119900	CAAAATAGGTGAGTCA	2	1712
1076521	N/A	N/A	122446	122461	ACTAAAGGAGTCATGA	67	1713
1076553	N/A	N/A	37304	37319	TGGGAATAATTTGGCC	69	1714

TABLE 24
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	2	810
1074122	139	154	3599	3614	CTGCGAGGCACTCGGA	73	1715
1074154	304	319	3764	3779	CCACGGGCCGAGGTGG	100	1716
1074186	410	425	3870	3885	GGGCCGGTTGAGGCGG	74	1717
1074218	726	741	7160	7175	AGGGCTCCTGCAGTGC	70	1718
1074250	958	973	N/A	N/A	CTGATCGATGTGATTT	6	1719
1074282	1170	1185	79111	79126	CGAGGGTCAAGCCTTG	83	1720
1074314	1387	1402	102519	102534	ATTGATATTCCGCATT	12	1721
1074346	1534	1549	116723	116738	ATCTGAGCTATTGGTC	10	1722
1074378	1708	1723	122733	122748	GAAACGGTTCTGCTGT	31	1723
1074410	2041	2056	123066	123081	TAGAGGATTAAAGTAT	32	1724
1074442	2351	2366	123376	123391	GACCAGTAAATCATGT	21	1725
1074474	2662	2677	123687	123702	CCAACCCCCCCACCGA	71	1726
1074506	2807	2822	123832	123847	TAATCGAGATTTAAAT	107	1727
1074538	3049	3064	124074	124089	ATCCACAGTAATAGCT	31	1728
1074570	3192	3207	124217	124232	ATGAACCTACTCACTG	12	1729
1074602	3427	3442	124452	124467	TCCAGCTAACTCAAAA	24	1730
1074634	3777	3792	124802	124817	GCTGAGGCTTTTCATA	55	1731
1074666	4085	4100	125110	125125	CATATACCCAATTTTG	16	1732
1074698	4275	4290	125300	125315	TATCAAGGTCCCCCTA	78	1733
1074730	4463	4478	125488	125503	TATCACAGTACTGCTA	46	1734
1074762	4630	4645	125655	125670	GCTACCCAATACAACC	6	1735
1074794	4779	4794	125804	125819	CAAATCAATGTGCTCC	5	1736
1074826	5090	5105	126115	126130	AAATCCACCTGAGCAC	51	1737
1074858	5246	5261	126271	126286	AACATTGGTACTATAT	23	1738
1074890	N/A	N/A	5456	5471	GAAGTTTAGCCTGAAG	58	1739
1074922	N/A	N/A	5542	5557	CTTTCCACTCAAGTTA	87	1740
1074954	N/A	N/A	5665	5680	CCGGGTTTTTGTCATC	91	1741
1074986	N/A	N/A	126511	126526	CTACTGTAATCACCTT	78	1742
1075018	N/A	N/A	6100	6115	CCTTAAAGTGATACAC	29	1743
1075050	N/A	N/A	8047	8062	ACCCAACGGTCATGTT	94	1744
1075082	N/A	N/A	10252	10267	CTTTAGATACAAGAGG	80	1745
1075114	N/A	N/A	11805	11820	GTATAAATACCAGGTA	26	1746
1075146	N/A	N/A	15570	15585	GTATTAAGGGATTTTC	8	1747
1075178	N/A	N/A	17552	17567	CTGGAAGAAATTACCC	47	1748
1075210	N/A	N/A	22314	22329	GTATTTTAACCTAAAC	100	1749
1075242	N/A	N/A	25790	25805	CAGGGATAATTACTAA	7	1750
1075274	N/A	N/A	28203	28218	AATAATCCAGCCTAGG	86	1751
1075306	N/A	N/A	31622	31637	TAAACGAAACACGGGT	30	1752
1075338	N/A	N/A	32572	32587	CCCAAAAACTAGCTTA	56	1753
1075370	N/A	N/A	34931	34946	CTTACGAATCACATAT	32	1754
1075402	N/A	N/A	36792	36807	GAGCAACACAAGCATA	45	1755
1075434	N/A	N/A	39406	39421	GTAAAAGAGGTGCATC	96	1756
1075466	N/A	N/A	41511	41526	TCCAAAAACCATCAGT	28	1757
1075498	N/A	N/A	43505	43520	CATTATATAATGCAGG	9	1758
1075530	N/A	N/A	45619	45634	GAAATCGAAGGGCAAA	30	1759
1075562	N/A	N/A	47824	47839	GTATTTATGGCAACAT	15	1760
1075594	N/A	N/A	49676	49691	TGAGAATATTCCTCCC	64	1761
1075626	N/A	N/A	51926	51941	CATTAGCCAAAGCTCA	34	1762
1075658	N/A	N/A	53595	53610	GTAAAAAACGGTTTTT	103	1763
1075690	N/A	N/A	55750	55765	CGTTAACAACTATACA	33	1764
1075722	N/A	N/A	58638	58653	GTTAAATACCTTCTAG	88	1765
1075754	N/A	N/A	60230	60245	CTTAAATGGCACAGTT	20	1766
1075786	N/A	N/A	62749	62764	CTATATTGATTCCAGA	19	1767
1075818	N/A	N/A	65659	65674	CATAACTTAGAACCAT	35	1768
1075850	N/A	N/A	68030	68045	CTATAGGTACTTAGAA	N.D.	1769
1075882	N/A	N/A	71422	71437	GAAAATCCTGATTAAC	73	1770
1075914	N/A	N/A	75298	75313	ATTTAGGATGCCTTTA	14	1771
1075946	N/A	N/A	77683	77698	GCTGAATAAGTAACTT	20	1772
1075978	N/A	N/A	80966	80981	AGATTAAAAGTCGGGC	11	1773
1076010	N/A	N/A	82396	82411	TATAAACAATAGCGAA	44	1774
1076042	N/A	N/A	85704	85719	CTTAAGCAAGAGTCCA	35	1775
1076074	N/A	N/A	88162	88177	CTAATTAGCTTTCAGC	92	1776
1076106	N/A	N/A	90642	90657	CTACGAAATAGTAACT	77	1777
1076138	N/A	N/A	92409	92424	AGCCAACAATTTTTGG	113	1778
1076170	N/A	N/A	94131	94146	AGTAAAGAGTACTGTA	16	1779
1076202	N/A	N/A	96470	96485	TCTAAAAAGACAGGGC	32	1780
1076234	N/A	N/A	98304	98319	CCTTAATATATCCACA	24	1781
1076266	N/A	N/A	101308	101323	ATTATTACCCAATAAC	72	1782
1076298	N/A	N/A	103672	103687	GTTATAAAGACCCAAT	10	1783
1076330	N/A	N/A	107154	107169	GAATTATACTGGCTAC	3	1784
1076362	N/A	N/A	110095	110110	CCACTAAATAAAGCAG	16	1785
1076394	N/A	N/A	111629	111644	CCTAAATTAGACTTGA	20	1786
1076426	N/A	N/A	114176	114191	ACGGGAAAATTCTGGA	9	1787
1076458	N/A	N/A	117825	117840	CTTAATTAGCCTCAGT	6	1788
1076490	N/A	N/A	119886	119901	CCAAAATAGGTGAGTC	2	1789
1076522	N/A	N/A	122448	122463	GCACTAAAGGAGTCAT	35	1790
1076554	N/A	N/A	38773	38788	TGGGAATAGTGAATTT	30	1791

TABLE 25
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	1	810
1074123	140	155	3600	3615	GCTGCGAGGCACTCGG	72	1792
1074155	311	326	3771	3786	CCCGGCTCCACGGGCC	87	1793
1074187	439	454	3899	3914	CTGCGAAGGCGGCTGC	47	1794
1074219	730	745	7164	7179	AGTCAGGGCTCCTGCA	30	1795
1074251	959	974	N/A	N/A	TCTGATCGATGTGATT	7	1796
1074283	1174	1189	79115	79130	AAAACGAGGGTCAAGC	12	1797
1074315	1388	1403	102520	102535	GATTGATATTCCGCAT	3	1798
1074347	1546	1561	116735	116750	GTTAAGGAAAGGATCT	34	1799
1074379	1711	1726	122736	122751	TGGGAAACGGTTCTGC	20	1800
1074411	2095	2110	123120	123135	TGTGAAAGAGGTCAGC	3	1801
1074443	2354	2369	123379	123394	TCAGACCAGTAAATCA	7	1802
1074475	2663	2678	123688	123703	ACCAACCCCCCCACCG	72	1803
1074507	2808	2823	123833	123848	ATAATCGAGATTTAAA	74	1804
1074539	3051	3066	124076	124091	CTATCCACAGTAATAG	62	1805
1074571	3193	3208	124218	124233	TATGAACCTACTCACT	37	1806
1074603	3428	3443	124453	124468	TTCCAGCTAACTCAAA	17	1807
1074635	3783	3798	124808	124823	TCCCAAGCTGAGGCTT	31	1808
1074667	4107	4122	125132	125147	CCCAACAACATGCTAT	15	1809
1074699	4276	4291	125301	125316	CTATCAAGGTCCCCCT	27	1810
1074731	4467	4482	125492	125507	CAGGTATCACAGTACT	19	1811
1074763	4631	4646	125656	125671	TGCTACCCAATACAAC	25	1812
1074795	4780	4795	125805	125820	CCAAATCAATGTGCTC	4	1813
1074827	5092	5107	126117	126132	TAAAATCCACCTGAGC	39	1814
1074859	5248	5263	126273	126288	GTAACATTGGTACTAT	16	1815
1074891	N/A	N/A	5457	5472	TGAAGTTTAGCCTGAA	31	1816
1074923	N/A	N/A	5556	5571	GGGCGGTAACTCTTCT	73	1817
1074955	N/A	N/A	5666	5681	CCCGGGTTTTTGTCAT	93	1818
1074987	N/A	N/A	4228	4243	GCCGCGGCTCCCGAGC	94	1819
1075019	N/A	N/A	6185	6200	CATTAGAGTTTGATTA	64	1820
1075051	N/A	N/A	8055	8070	AATAAACAACCCAACG	56	1821
1075083	N/A	N/A	10265	10280	CAACAACACTCCTCTT	54	1822
1075115	N/A	N/A	11890	11905	GTATAGCCTTATTCTT	6	1823
1075147	N/A	N/A	15583	15598	TATAAACCTTACAGTA	57	1824
1075179	N/A	N/A	18169	18184	AATTAGCCGGTCCCAG	107	1825
1075211	N/A	N/A	22668	22683	AATAAAGGGTCCTAAC	91	1826
1075243	N/A	N/A	26237	26252	CTTAGTAAGAATTGTC	4	1827
1075275	N/A	N/A	28517	28532	CTAGAAAGGCCATGTA	76	1828
1075307	N/A	N/A	31624	31639	ATTAAACGAAACACGG	28	1829
1075339	N/A	N/A	32573	32588	ACCCAAAAACTAGCTT	70	1830
1075371	N/A	N/A	34942	34957	CTGCAAAAGTTCTTAC	90	1831
1075403	N/A	N/A	36942	36957	CTTAATCAGGTACTAT	18	1832
1075435	N/A	N/A	39516	39531	CTTAAACGATAAAGTA	93	1833
1075467	N/A	N/A	41522	41537	CATTAATGCCATCCAA	60	1834
1075499	N/A	N/A	43601	43616	GCTAAAAAATGAGTAG	99	1835
1075531	N/A	N/A	45685	45700	CTTAATAGTTTAACCT	66	1836
1075563	N/A	N/A	47947	47962	CCATATAACCAGTTTT	12	1837
1075595	N/A	N/A	49869	49884	TATAATACATCTCCCC	50	1838
1075627	N/A	N/A	51985	52000	ATAAGATAGTCGGTTC	19	1839
1075659	N/A	N/A	53597	53612	AAGTAAAAAACGGTTT	125	1840
1075691	N/A	N/A	55841	55856	CGTCAAAATTAACAGA	46	1841
1075723	N/A	N/A	58758	58773	TTATCCTATCCCTGGT	32	1842
1075755	N/A	N/A	60231	60246	ACTTAAATGGCACAGT	73	1843
1075787	N/A	N/A	62761	62776	CTTAAGGATTGGCTAT	28	1844
1075819	N/A	N/A	65672	65687	GTATATCCGTTCTCAT	2	1845
1075851	N/A	N/A	68466	68481	GCCGAATATGGGAAAA	70	1846
1075883	N/A	N/A	71454	71469	ACTAAAACCATTTGCC	20	1847
1075915	N/A	N/A	75299	75314	AATTTAGGATGCCTTT	16	1848
1075947	N/A	N/A	78266	78281	CTTTATAGGAATAGAG	95	1849
1075979	N/A	N/A	81132	81147	CATAATCCACTATGCA	18	1850
1076011	N/A	N/A	82397	82412	ATATAAACAATAGCGA	61	1851
1076043	N/A	N/A	85727	85742	CAAAAAGGCTATTGAG	36	1852
1076075	N/A	N/A	88209	88224	ACACAAGGGTTGCTAA	38	1853
1076107	N/A	N/A	90801	90816	CATTACCAACTTCTTC	23	1854
1076139	N/A	N/A	92416	92431	CGAAAAAAGCCAACAA	18	1855
1076171	N/A	N/A	94134	94149	ATTAGTAAAGAGTACT	30	1856
1076203	N/A	N/A	96576	96591	GTTAATACATGGCCAA	29	1857
1076235	N/A	N/A	98318	98333	TCAAAATAATCAGCCC	34	1858
1076267	N/A	N/A	101345	101360	ATTTAAGGTGCATAAG	13	1859
1076299	N/A	N/A	103673	103688	CGTTATAAAGACCCAA	3	1860
1076331	N/A	N/A	107265	107280	CATTATTCAGTAGTTG	71	1861
1076363	N/A	N/A	110104	110119	CATAAAAGTCCACTAA	72	1862
1076395	N/A	N/A	111649	111664	GTAACTAACCTAAGGA	34	1863
1076427	N/A	N/A	114212	114227	CAAATTTACTGATCTC	3	1864
1076459	N/A	N/A	117903	117918	CTTCAACAAGACAGGT	4	1865
1076491	N/A	N/A	119888	119903	AGCCAAAATAGGTGAG	12	1866
1076523	N/A	N/A	122559	122574	ATTTATATCAGGTCAA	5	1867
1076555	N/A	N/A	74684	74699	TGGGAATAGTACACAG	19	1868

TABLE 26
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	1	810
1074124	141	156	3601	3616	GGCTGCGAGGCACTCG	94	1869
1074156	329	344	3789	3804	AGGGCTACGCCCGGAC	96	1870
1074188	440	455	3900	3915	GCTGCGAAGGCGGCTG	113	1871
1074220	752	767	7186	7201	AATGAGCTCGAACATG	22	1872
1074252	997	1012	55492	55507	GGACAGCATGGCCTTC	50	1873
1074284	1175	1190	79116	79131	CAAAACGAGGGTCAAG	21	1874
1074316	1389	1404	102521	102536	GGATTGATATTCCGCA	33	1875
1074348	1578	1593	120483	120498	GTACTCTCATCTCGAG	100	1876
1074380	1714	1729	122739	122754	GTCTGGGAAACGGTTC	11	1877
1074412	2096	2111	123121	123136	CTGTGAAAGAGGTCAG	55	1878
1074444	2368	2383	123393	123408	ACATTTTTGGCTTGTC	3	1879
1074476	2685	2700	123710	123725	TTCCGACAAAACCAAC	18	1880
1074508	2818	2833	123843	123858	GAGAGAGCAGATAATC	7	1881
1074540	3052	3067	124077	124092	ACTATCCACAGTAATA	26	1882
1074572	3194	3209	124219	124234	TTATGAACCTACTCAC	17	1883
1074604	3446	3461	124471	124486	TTATTAATCTGATCAC	12	1884
1074636	3791	3806	124816	124831	ATCTATCTTCCCAAGC	56	1885
1074668	4108	4123	125133	125148	TCCCAACAACATGCTA	20	1886
1074700	4320	4335	125345	125360	GTAAGACAAGTCTTTA	26	1887
1074732	4468	4483	125493	125508	CCAGGTATCACAGTAC	30	1888
1074764	4632	4647	125657	125672	ATGCTACCCAATACAA	18	1889
1074796	4782	4797	125807	125822	CTCCAAATCAATGTGC	22	1890
1074828	5093	5108	126118	126133	ATAAAATCCACCTGAG	58	1891
1074860	5252	5267	126277	126292	AAAGGTAACATTGGTA	9	1892
1074892	N/A	N/A	5458	5473	CTGAAGTTTAGCCTGA	42	1893
1074924	N/A	N/A	5585	5600	CCTGCAAATAGGAGAG	87	1894
1074956	N/A	N/A	5667	5682	ACCCGGGTTTTTGTCA	104	1895
1074988	N/A	N/A	4324	4339	ACCGCGGCGGAGTGGA	94	1896
1075020	N/A	N/A	6193	6208	TTAATTAGCATTAGAG	30	1897
1075052	N/A	N/A	8204	8219	ATATATACTTGATCCA	3	1898
1075084	N/A	N/A	10268	10283	TGACAACAACACTCCT	9	1899
1075116	N/A	N/A	11969	11984	CTTAACATTTAATGGC	15	1900
1075148	N/A	N/A	16000	16015	CGGAAAAAACACCTAG	66	1901
1075180	N/A	N/A	18759	18774	TATTACTACAACCATA	56	1902
1075212	N/A	N/A	22669	22684	CAATAAAGGGTCCTAA	76	1903
1075244	N/A	N/A	26292	26307	ACCCAAAAATTCTGTG	76	1904
1075276	N/A	N/A	28647	28662	GACCAATACAATGGGA	78	1905
1075308	N/A	N/A	31625	31640	AATTAAACGAAACACG	97	1906
1075340	N/A	N/A	32580	32595	CCCGAACACCCAAAAA	103	1907
1075372	N/A	N/A	34997	35012	ATATATAGACTTGAGA	27	1908
1075404	N/A	N/A	37268	37283	ATATAACCTGAACTAA	102	1909
1075436	N/A	N/A	39517	39532	CCTTAAACGATAAAGT	89	1910
1075468	N/A	N/A	41570	41585	CACCAATACTGAGTAT	91	1911
1075500	N/A	N/A	43668	43683	TAAATTAAGCCAACAC	26	1912
1075532	N/A	N/A	45686	45701	ACTTAATAGTTTAACC	121	1913
1075564	N/A	N/A	48028	48043	ATATAACAGGCCACCA	81	1914
1075596	N/A	N/A	49870	49885	ATATAATACATCTCCC	91	1915
1075628	N/A	N/A	52040	52055	CCGCAAAATATTAATT	118	1916
1075660	N/A	N/A	53599	53614	CAAAGTAAAAAACGGT	72	1917
1075692	N/A	N/A	55999	56014	TAAGAACACCATAGCA	11	1918
1075724	N/A	N/A	58769	58784	CTATCTGTCAGTTATC	44	1919
1075756	N/A	N/A	60243	60258	ATTTACCCTGCCACTT	49	1920
1075788	N/A	N/A	62762	62777	TCTTAAGGATTGGCTA	15	1921
1075820	N/A	N/A	65896	65911	TCTGAACGGGCTGTTG	27	1922
1075852	N/A	N/A	68471	68486	GATAAGCCGAATATGG	58	1923
1075884	N/A	N/A	71468	71483	ATTAGTAATGACTAAC	116	1924
1075916	N/A	N/A	75300	75315	CAATTTAGGATGCCTT	6	1925
1075948	N/A	N/A	78306	78321	GGACTAAAGAATACAG	31	1926
1075980	N/A	N/A	81219	81234	CAATATCCTACACCAT	43	1927
1076012	N/A	N/A	82398	82413	AATATAAACAATAGCG	34	1928
1076044	N/A	N/A	85729	85744	ATCAAAAAGGCTATTG	73	1929
1076076	N/A	N/A	88372	88387	TATCAATACTTTAGTC	57	1930
1076108	N/A	N/A	90863	90878	AAACAAAACCGGCTTT	116	1931
1076140	N/A	N/A	92417	92432	ACGAAAAAAGCCAACA	28	1932
1076172	N/A	N/A	94135	94150	TATTAGTAAAGAGTAC	98	1933
1076204	N/A	N/A	96620	96635	GATAATGAATCCTTGT	11	1934
1076236	N/A	N/A	98440	98455	GGAGAACCTTATTTAT	51	1935
1076268	N/A	N/A	101514	101529	GTACAATAATGCTTCC	10	1936
1076300	N/A	N/A	103687	103702	AAAAAATGGCTTCACG	22	1937
1076332	N/A	N/A	107285	107300	TATAAGGAATGGCAAC	107	1938
1076364	N/A	N/A	110105	110120	CCATAAAAGTCCACTA	30	1939
1076396	N/A	N/A	111672	111687	CTATATTTGAGCCATG	2	1940
1076428	N/A	N/A	114406	114421	ATTAAAAAGAAGCACG	53	1941
1076460	N/A	N/A	117914	117929	TAATATAGCCCCTTCA	7	1942
1076492	N/A	N/A	120180	120195	AAAAGATACCCCCAGT	47	1943
1076524	N/A	N/A	122560	122575	AATTTATATCAGGTCA	6	1944
1076556	N/A	N/A	116991	117006	GTATAGGCAGAAGCAA	9	1945

TABLE 27
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	2	810
1074125	160	175	3620	3635	GCGGCTGCGCCTCGGG	94	1946
1074157	333	348	3793	3808	AGCGAGGGCTACGCCC	103	1947
1074189	441	456	3901	3916	GGCTGCGAAGGCGGCT	96	1948
1074221	753	768	7187	7202	GAATGAGCTCGAACAT	6	1949
1074253	1001	1016	55496	55511	TCTGGGACAGCATGGC	11	1950
1074285	1176	1191	N/A	N/A	GCAAAACGAGGGTCAA	17	1951
1074317	1406	1421	102538	102553	GAGAATTTGCTGTGCT	12	1952
1074349	1580	1595	120485	120500	CTGTACTCTCATCTCG	30	1953
1074381	1715	1730	122740	122755	AGTCTGGGAAACGGTT	16	1954
1074413	2097	2112	123122	123137	ACTGTGAAAGAGGTCA	4	1955
1074445	2471	2486	123496	123511	TGATAGCACTAGGAGG	6	1956
1074477	2686	2701	123711	123726	GTTCCGACAAAACCAA	10	1957
1074509	2850	2865	123875	123890	TGTTATGTTTGGGTGT	5	1958
1074541	3053	3068	124078	124093	CACTATCCACAGTAAT	23	1959
1074573	3195	3210	124220	124235	ATTATGAACCTACTCA	14	1960
1074605	3464	3479	124489	124504	TCAACTACCAATATAC	20	1961
1074637	3792	3807	124817	124832	AATCTATCTTCCCAAG	36	1962
1074669	4109	4124	125134	125149	ATCCCAACAACATGCT	13	1963
1074701	4322	4337	125347	125362	GTGTAAGACAAGTCTT	17	1964
1074733	4469	4484	125494	125509	GCCAGGTATCACAGTA	47	1965
1074765	4634	4649	125659	125674	CAATGCTACCCAATAC	34	1966
1074797	4783	4798	125808	125823	ACTCCAAATCAATGTG	31	1967
1074829	5095	5110	126120	126135	GGATAAAATCCACCTG	92	1968
1074861	5279	5294	126304	126319	TGCTCTTACATCTAAA	23	1969
1074893	N/A	N/A	5459	5474	GCTGAAGTTTAGCCTG	78	1970
1074925	N/A	N/A	5586	5601	GCCTGCAAATAGGAGA	94	1971
1074957	N/A	N/A	5668	5683	AACCCGGGTTTTTGTC	102	1972
1074989	N/A	N/A	4423	4438	GAGGGAAAGCACGCCC	105	1973
1075021	N/A	N/A	6245	6260	TTACAACCTAGATTTG	68	1974
1075053	N/A	N/A	8205	8220	AATATATACTTGATCC	4	1975
1075085	N/A	N/A	10318	10333	TGCGGAAACAAGTGTA	11	1976
1075117	N/A	N/A	12081	12096	CCTCAATAGCAAGACA	48	1977
1075149	N/A	N/A	16001	16016	GCGGAAAAAACACCTA	50	1978
1075181	N/A	N/A	18762	18777	TTATATTACTACAACC	15	1979
1075213	N/A	N/A	22670	22685	ACAATAAAGGGTCCTA	33	1980
1075245	N/A	N/A	26692	26707	CCTAATATGCTATTGT	34	1981
1075277	N/A	N/A	28762	28777	TTATAAGAACTGTGGC	13	1982
1075309	N/A	N/A	31626	31641	TAATTAAACGAAACAC	110	1983
1075341	N/A	N/A	32592	32607	GCTGAACAATCTCCCG	31	1984
1075373	N/A	N/A	34998	35013	TATATATAGACTTGAG	13	1985
1075405	N/A	N/A	37270	37285	CTATATAACCTGAACT	84	1986
1075437	N/A	N/A	39572	39587	TATTAGTACGAGCTAC	85	1987
1075469	N/A	N/A	41723	41738	TGATATAATGACCAAG	25	1988
1075501	N/A	N/A	43670	43685	CATAAATTAAGCCAAC	67	1989
1075533	N/A	N/A	45730	45745	GATTACTCAGCTATGT	65	1990
1075565	N/A	N/A	48029	48044	TATATAACAGGCCACC	52	1991
1075597	N/A	N/A	49954	49969	ATTAACATTTGCCCGC	47	1992
1075629	N/A	N/A	52041	52056	GCCGCAAAATATTAAT	100	1993
1075661	N/A	N/A	53794	53809	GAATAGGATACAAGCA	74	1994
1075693	N/A	N/A	56014	56029	CATTAAAAGTTGGGTT	36	1995
1075725	N/A	N/A	58772	58787	ATCCTATCTGTCAGTT	18	1996
1075757	N/A	N/A	60324	60339	CTTAATACATTATTCC	2	1997
1075789	N/A	N/A	62993	63008	AATTACAAGCTAATGC	79	1998
1075821	N/A	N/A	66155	66170	CTTAACTTCCCACTCG	22	1999
1075853	N/A	N/A	68653	68668	GAGCGATAAGCTGTAT	72	2000
1075885	N/A	N/A	71469	71484	CATTAGTAATGACTAA	112	2001
1075917	N/A	N/A	75472	75487	AGCAAAAAGTGATATG	55	2002
1075949	N/A	N/A	78635	78650	TAGGAACACCAAGGTT	48	2003
1075981	N/A	N/A	81222	81237	AAGCAATATCCTACAC	40	2004
1076013	N/A	N/A	82644	82659	GTTTAATACCTCTGAC	76	2005
1076045	N/A	N/A	85776	85791	GTGCAATAAATAGTTC	11	2006
1076077	N/A	N/A	88420	88435	GGATTAAAGTTTTCAC	5	2007
1076109	N/A	N/A	91026	91041	CTTAAATGACCAATTC	23	2008
1076141	N/A	N/A	92418	92433	TACGAAAAAAGCCAAC	29	2009
1076173	N/A	N/A	94244	94259	CAATATATCCTGAGAT	91	2010
1076205	N/A	N/A	96783	96798	TAGTATAATTCATGAC	51	2011
1076237	N/A	N/A	98456	98471	ACTAAAGGACAAAGGT	109	2012
1076269	N/A	N/A	101560	101575	GACGAAAAATATTCTT	28	2013
1076301	N/A	N/A	104195	104210	GTATAAGACCTTGGGA	34	2014
1076333	N/A	N/A	107286	107301	CTATAAGGAATGGCAA	97	2015
1076365	N/A	N/A	110141	110156	TAAGAAGGGCCAATGG	15	2016
1076397	N/A	N/A	111675	111690	AACCTATATTTGAGCC	4	2017
1076429	N/A	N/A	114456	114471	CATTACAAGCATAGGC	26	2018
1076461	N/A	N/A	117917	117932	GATTAATATAGCCCCT	3	2019
1076493	N/A	N/A	120197	120212	TGACAATAAGGGACAA	34	2020
1076525	N/A	N/A	122561	122576	GAATTTATATCAGGTC	3	2021
1076557	N/A	N/A	55411	55426	AACAAATACCAGGTTC	111	2022

TABLE 28
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	2	810
1074126	163	178	3623	3638	CTGGCGGCTGCGCCTC	111	2023
1074158	334	349	3794	3809	GAGCGAGGGCTACGCC	72	2024
1074190	463	478	3923	3938	CGGCGGGCCCTGCCCC	114	2025
1074222	755	770	7189	7204	AGGAATGAGCTCGAAC	5	2026
1074254	1002	1017	55497	55512	ATCTGGGACAGCATGG	13	2027
1074286	1193	1208	98895	98910	TGATTCTCTGGTTCAT	32	2028
1074318	1407	1422	102539	102554	GGAGAATTTGCTGTGC	4	2029
1074350	1591	1606	120496	120511	TAGTCCACTGTCTGTA	14	2030
1074382	1719	1734	122744	122759	AGGTAGTCTGGGAAAC	8	2031
1074414	2098	2113	123123	123138	AACTGTGAAAGAGGTC	6	2032
1074446	2472	2487	123497	123512	ATGATAGCACTAGGAG	3	2033
1074478	2691	2706	123716	123731	CCTAGGTTCCGACAAA	69	2034
1074510	2878	2893	123903	123918	ATACATTCCACTACCA	10	2035
1074542	3056	3071	124081	124096	AGGCACTATCCACAGT	21	2036
1074574	3196	3211	124221	124236	CATTATGAACCTACTC	17	2037
1074606	3500	3515	124525	124540	GGTATAATCATGATTA	4	2038
1074638	3816	3831	124841	124856	AGATTTTGTAATTGGG	2	2039
1074670	4141	4156	125166	125181	AAGTAGCTTTGATCTT	49	2040
1074702	4323	4338	125348	125363	GGTGTAAGACAAGTCT	16	2041
1074734	4470	4485	125495	125510	TGCCAGGTATCACAGT	51	2042
1074766	4638	4653	125663	125678	ATCCCAATGCTACCCA	8	2043
1074798	4800	4815	125825	125840	GCTTTGGAAGATCTGA	4	2044
1074830	5097	5112	126122	126137	GAGGATAAAATCCACC	89	2045
1074862	5287	5302	126312	126327	TATGAGCATGCTCTTA	56	2046
1074894	N/A	N/A	5460	5475	TGCTGAAGTTTAGCCT	79	2047
1074926	N/A	N/A	5592	5607	CAACAGGCCTGCAAAT	111	2048
1074958	N/A	N/A	5669	5684	TAACCCGGGTTTTTGT	107	2049
1074990	N/A	N/A	4687	4702	GCCGCAAAGGAAAGGG	108	2050
1075022	N/A	N/A	6247	6262	ATTTACAACCTAGATT	91	2051
1075054	N/A	N/A	8206	8221	CAATATATACTTGATC	48	2052
1075086	N/A	N/A	10392	10407	AGTTATAGACTTTGTA	25	2053
1075118	N/A	N/A	12281	12296	CTATTTACTCTGTCAC	4	2054
1075150	N/A	N/A	16002	16017	AGCGGAAAAAACACCT	35	2055
1075182	N/A	N/A	18766	18781	GATATTATATTACTAC	61	2056
1075214	N/A	N/A	22671	22686	AACAATAAAGGGTCCT	45	2057
1075246	N/A	N/A	26760	26775	GATAACTAGTAACCGT	6	2058
1075278	N/A	N/A	28866	28881	TATACTAACATTCACG	48	2059
1075310	N/A	N/A	31627	31642	GTAATTAAACGAAACA	84	2060
1075342	N/A	N/A	32636	32651	ACTAAAAGGGAGTAGG	87	2061
1075374	N/A	N/A	35122	35137	GAAAATACTCCTCCTA	27	2062
1075406	N/A	N/A	37271	37286	ACTATATAACCTGAAC	99	2063
1075438	N/A	N/A	39657	39672	CATATTAGAGTTGAGG	22	2064
1075470	N/A	N/A	41860	41875	GCCAATAAGTTATCAA	50	2065
1075502	N/A	N/A	44236	44251	CTTAACATGATTCTAG	61	2066
1075534	N/A	N/A	45787	45802	ACCCAAGGACAGCACA	53	2067
1075566	N/A	N/A	48030	48045	ATATATAACAGGCCAC	50	2068
1075598	N/A	N/A	49955	49970	AATTAACATTTGCCCG	62	2069
1075630	N/A	N/A	52052	52067	TATAACCAAATGCCGC	60	2070
1075662	N/A	N/A	53888	53903	AAGGGATACAAGTGTT	78	2071
1075694	N/A	N/A	56015	56030	ACATTAAAAGTTGGGT	11	2072
1075726	N/A	N/A	58776	58791	AGTTATCCTATCTGTC	14	2073
1075758	N/A	N/A	60403	60418	GTAATTTAATAGACTA	73	2074
1075790	N/A	N/A	63026	63041	TCAGAAGAACTCCCAT	14	2075
1075822	N/A	N/A	66205	66220	CTTAGTAATTGCCCAT	35	2076
1075854	N/A	N/A	68837	68852	CTTATAATAGAGCTAA	52	2077
1075886	N/A	N/A	71526	71541	CATAACACTGAAGGTG	60	2078
1075918	N/A	N/A	75510	75525	CTTAAACTAACTGTTG	82	2079
1075950	N/A	N/A	78649	78664	TGACAATACCTTCCTA	30	2080
1075982	N/A	N/A	81227	81242	CATGAAAGCAATATCC	23	2081
1076014	N/A	N/A	82658	82673	AATCAACCTATGAGGT	98	2082
1076046	N/A	N/A	85784	85799	CTTAAATGGTGCAATA	28	2083
1076078	N/A	N/A	89187	89202	CTTTAGCCTCTATACC	23	2084
1076110	N/A	N/A	91091	91106	CTTTACCTAAATGTTG	53	2085
1076142	N/A	N/A	92419	92434	ATACGAAAAAAGCCAA	38	2086
1076174	N/A	N/A	94299	94314	GATATATGGTAGCATA	3	2087
1076206	N/A	N/A	96835	96850	CAATAAACTTACCCTT	55	2088
1076238	N/A	N/A	98513	98528	GATGAATAGCTAAGAA	30	2089
1076270	N/A	N/A	101571	101586	TAACAATAGTAGACGA	28	2090
1076302	N/A	N/A	104337	104352	AATAAGCCTCACCTTT	74	2091
1076334	N/A	N/A	107288	107303	ACCTATAAGGAATGGC	108	2092
1076366	N/A	N/A	110167	110182	ATTTACATGAGAGGAG	4	2093
1076398	N/A	N/A	111707	111722	CTTGAAGGGCTATGGA	62	2094
1076430	N/A	N/A	114752	114767	CGTTATAAGATGTGCT	4	2095
1076462	N/A	N/A	117971	117986	TCAGAAGGATATGCAG	6	2096
1076494	N/A	N/A	120254	120269	CTAATTGAAGCTGGCA	3	2097
1076526	N/A	N/A	102684	102699	GTAGAAAGATGGCTCA	3	2098
1076558	N/A	N/A	82852	82867	GCCAAATATTTAACTC	30	2099

TABLE 29
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	2	810
1074127	171	186	3631	3646	CCACTGGTCTGGCGGC	57	2100
1074159	335	350	3795	3810	CGAGCGAGGGCTACGC	77	2101
1074191	464	479	3924	3939	ACGGCGGGCCCTGCCC	80	2102
1074223	786	801	7220	7235	GAAACAGCTCCCAACT	48	2103
1074255	1004	1019	55499	55514	TCATCTGGGACAGCAT	16	2104
1074287	1195	1210	98897	98912	ACTGATTCTCTGGTTC	11	2105
1074319	1425	1440	N/A	N/A	GCTAACTCCTGACATT	47	2106
1074351	1596	1611	120501	120516	ATGCTTAGTCCACTGT	7	2107
1074383	1722	1737	122747	122762	TCAAGGTAGTCTGGGA	40	2108
1074415	2101	2116	123126	123141	GCCAACTGTGAAAGAG	10	2109
1074447	2473	2488	123498	123513	AATGATAGCACTAGGA	4	2110
1074479	2697	2712	123722	123737	CATTTGCCTAGGTTCC	2	2111
1074511	2879	2894	123904	123919	GATACATTCCACTACC	9	2112
1074543	3059	3074	124084	124099	CCTAGGCACTATCCAC	57	2113
1074575	3197	3212	124222	124237	ACATTATGAACCTACT	14	2114
1074607	3502	3517	124527	124542	AAGGTATAATCATGAT	4	2115
1074639	3817	3832	124842	124857	TAGATTTTGTAATTGG	3	2116
1074671	4142	4157	125167	125182	CAAGTAGCTTTGATCT	8	2117
1074703	4324	4339	125349	125364	CGGTGTAAGACAAGTC	16	2118
1074735	4483	4498	125508	125523	GATCAAAGCACTGTGC	117	2119
1074767	4640	4655	125665	125680	TTATCCCAATGCTACC	12	2120
1074799	4801	4816	125826	125841	TGCTTTGGAAGATCTG	8	2121
1074831	5098	5113	126123	126138	CGAGGATAAAATCCAC	35	2122
1074863	5288	5303	126313	126328	ATATGAGCATGCTCTT	41	2123
1074895	N/A	N/A	5465	5480	TCCTATGCTGAAGTTT	60	2124
1074927	N/A	N/A	5594	5609	TACAACAGGCCTGCAA	74	2125
1074959	N/A	N/A	5670	5685	TTAACCCGGGTTTTTG	128	2126
1074991	N/A	N/A	4727	4742	AATTATTTGACTCCCC	60	2127
1075023	N/A	N/A	6249	6264	GTATTTACAACCTAGA	18	2128
1075055	N/A	N/A	8271	8286	CTATTAAGTGAGCTTT	4	2129
1075087	N/A	N/A	10400	10415	TCTCAATAAGTTATAG	39	2130
1075119	N/A	N/A	12305	12320	AGGGAATATGTTAATC	8	2131
1075151	N/A	N/A	16014	16029	TTTAAAAGTACCAGCG	60	2132
1075183	N/A	N/A	18905	18920	ATTACTAAGACAGTGG	15	2133
1075215	N/A	N/A	22672	22687	AAACAATAAAGGGTCC	44	2134
1075247	N/A	N/A	26764	26779	CTAAGATAACTAGTAA	101	2135
1075279	N/A	N/A	28867	28882	CTATACTAACATTCAC	52	2136
1075311	N/A	N/A	31628	31643	AGTAATTAAACGAAAC	100	2137
1075343	N/A	N/A	32637	32652	AACTAAAAGGGAGTAG	89	2138
1075375	N/A	N/A	35237	35252	CTAAATATCAACTCCC	35	2139
1075407	N/A	N/A	37273	37288	GAACTATATAACCTGA	32	2140
1075439	N/A	N/A	39815	39830	AATTAGAGATATGGAC	77	2141
1075471	N/A	N/A	41861	41876	AGCCAATAAGTTATCA	55	2142
1075503	N/A	N/A	44248	44263	GCTGAAAAAGGGCTTA	66	2143
1075535	N/A	N/A	45791	45806	AATTACCCAAGGACAG	53	2144
1075567	N/A	N/A	48031	48046	GATATATAACAGGCCA	65	2145
1075599	N/A	N/A	49979	49994	ACCCTATAGCTTTAGG	90	2146
1075631	N/A	N/A	52055	52070	CCCTATAACCAAATGC	104	2147
1075663	N/A	N/A	53926	53941	CTAAATAGGTGGTTAT	80	2148
1075695	N/A	N/A	56025	56040	GAATAACACCACATTA	30	2149
1075727	N/A	N/A	58798	58813	TTATCGGAGGCTTCGC	31	2150
1075759	N/A	N/A	60742	60757	CCTTATAAATTATGAC	44	2151
1075791	N/A	N/A	63059	63074	CTTTATCAGCCATCAC	10	2152
1075823	N/A	N/A	66222	66237	TATTAGAGGTTCCAGG	30	2153
1075855	N/A	N/A	68937	68952	GATTTTTAGGCAGACG	7	2154
1075887	N/A	N/A	71602	71617	TATTACTTGATTGACA	10	2155
1075919	N/A	N/A	75511	75526	TCTTAAACTAACTGTT	78	2156
1075951	N/A	N/A	78699	78714	CACGGAAGAGCTTGCA	34	2157
1075983	N/A	N/A	81249	81264	ATCGAAAAGCAAACTC	5	2158
1076015	N/A	N/A	82981	82996	ATTTAGTTGGTTGTTA	8	2159
1076047	N/A	N/A	85785	85800	ACTTAAATGGTGCAAT	34	2160
1076079	N/A	N/A	89467	89482	AAGCAATATATGGCCT	37	2161
1076111	N/A	N/A	91203	91218	AATTAGTTAGGATATC	67	2162
1076143	N/A	N/A	92420	92435	GATACGAAAAAAGCCA	8	2163
1076175	N/A	N/A	94392	94407	CAATAGGTAACAGGTA	15	2164
1076207	N/A	N/A	96838	96853	AGTCAATAAACTTACC	58	2165
1076239	N/A	N/A	98583	98598	GTTTAAAAAAAACGGG	75	2166
1076271	N/A	N/A	101685	101700	CGGCAACAACAAAATG	18	2167
1076303	N/A	N/A	104339	104354	CTAATAAGCCTCACCT	34	2168
1076335	N/A	N/A	107289	107304	CACCTATAAGGAATGG	80	2169
1076367	N/A	N/A	110169	110184	CTATTTACATGAGAGG	3	2170
1076399	N/A	N/A	111771	111786	GATAACTTAGAGATGT	4	2171
1076431	N/A	N/A	114853	114868	CACCAATAGAACATAT	31	2172
1076463	N/A	N/A	118082	118097	GATTAGTAACACTGAT	38	2173
1076495	N/A	N/A	120353	120368	GATTAGTGAAAATTCC	30	2174
1076527	N/A	N/A	117218	117233	GCACAACCTTACATTT	6	2175
1076559	N/A	N/A	111532	111547	AACAAATATAGTTAGC	74	2176

TABLE 30
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	1	810
1074128	173	188	3633	3648	CTCCACTGGTCTGGCG	76	2177
1074160	336	351	3796	3811	GCGAGCGAGGGCTACG	86	2178
1074192	465	480	3925	3940	GACGGCGGGCCCTGCC	108	2179
1074224	821	836	7255	7270	CAGAGACTACTCCAGT	16	2180
1074256	1033	1048	55528	55543	CACTGGTGGACTGGTG	64	2181
1074288	1196	1211	98898	98913	GACTGATTCTCTGGTT	48	2182
1074320	1426	1441	N/A	N/A	GGCTAACTCCTGACAT	80	2183
1074352	1597	1612	120502	120517	CATGCTTAGTCCACTG	69	2184
1074384	1723	1738	122748	122763	TTCAAGGTAGTCTGGG	35	2185
1074416	2108	2123	123133	123148	CTTTAGAGCCAACTGT	9	2186
1074448	2474	2489	123499	123514	TAATGATAGCACTAGG	3	2187
1074480	2698	2713	123723	123738	TCATTTGCCTAGGTTC	3	2188
1074512	2880	2895	123905	123920	GGATACATTCCACTAC	64	2189
1074544	3063	3078	124088	124103	CTCCCCTAGGCACTAT	34	2190
1074576	3201	3216	124226	124241	ATGCACATTATGAACC	7	2191
1074608	3529	3544	124554	124569	GTTACATCATCTCTTC	5	2192
1074640	3828	3843	124853	124868	GCCAAAATACTTAGAT	26	2193
1074672	4143	4158	125168	125183	CCAAGTAGCTTTGATC	6	2194
1074704	4326	4341	125351	125366	CACGGTGTAAGACAAG	16	2195
1074736	4504	4519	125529	125544	TCAGTACAGAGGGCAT	4	2196
1074768	4641	4656	125666	125681	CTTATCCCAATGCTAC	11	2197
1074800	4808	4823	125833	125848	CAAATAGTGCTTTGGA	6	2198
1074832	5099	5114	126124	126139	GCGAGGATAAAATCCA	17	2199
1074864	5289	5304	126314	126329	CATATGAGCATGCTCT	47	2200
1074896	N/A	N/A	5472	5487	GCAAAGTTCCTATGCT	99	2201
1074928	N/A	N/A	5595	5610	ATACAACAGGCCTGCA	83	2202
1074960	N/A	N/A	5671	5686	CTTAACCCGGGTTTTT	81	2203
1074992	N/A	N/A	4728	4743	CAATTATTTGACTCCC	63	2204
1075024	N/A	N/A	6368	6383	ACTGAACAAGTATCTT	32	2205
1075056	N/A	N/A	8297	8312	CTTTATTATCTCAACC	21	2206
1075088	N/A	N/A	10433	10448	ATTTATAGTCAGGTTC	2	2207
1075120	N/A	N/A	12519	12534	AATTAGCCTACCACCT	42	2208
1075152	N/A	N/A	16101	16116	TATAATGGGAGGATTA	99	2209
1075184	N/A	N/A	18998	19013	CAAGAACACTGGTATT	67	2210
1075216	N/A	N/A	23247	23262	TATTTTACACGAACTA	55	2211
1075248	N/A	N/A	26930	26945	GTACAAAAAGCGGTCG	64	2212
1075280	N/A	N/A	28870	28885	GAACTATACTAACATT	57	2213
1075312	N/A	N/A	31662	31677	TTAATTGAACTCAGGG	37	2214
1075344	N/A	N/A	32638	32653	TAACTAAAAGGGAGTA	91	2215
1075376	N/A	N/A	35238	35253	CCTAAATATCAACTCC	72	2216
1075408	N/A	N/A	37387	37402	CTAAAATGGCATAAGG	23	2217
1075440	N/A	N/A	39843	39858	AAATTATTAGTTGTCG	28	2218
1075472	N/A	N/A	41890	41905	GATTATAGTTAAACAG	92	2219
1075504	N/A	N/A	44291	44306	CTTAAATGAGAGAACC	71	2220
1075536	N/A	N/A	45793	45808	TTAATTACCCAAGGAC	55	2221
1075568	N/A	N/A	48108	48123	TTATTTAAGTTGGGAG	23	2222
1075600	N/A	N/A	49991	50006	CACTATAATCTGACCC	68	2223
1075632	N/A	N/A	52056	52071	TCCCTATAACCAAATG	95	2224
1075664	N/A	N/A	53927	53942	GCTAAATAGGTGGTTA	87	2225
1075696	N/A	N/A	56066	56081	TTACAAAAGTTACTGC	28	2226
1075728	N/A	N/A	58800	58815	CTTTATCGGAGGCTTC	15	2227
1075760	N/A	N/A	61106	61121	GAGAAAAACTACGGAT	39	2228
1075792	N/A	N/A	63072	63087	GATTAGAAAGTGCCTT	6	2229
1075824	N/A	N/A	66223	66238	GTATTAGAGGTTCCAG	3	2230
1075856	N/A	N/A	68965	68980	CCTAATCAAGTTCTGC	40	2231
1075888	N/A	N/A	71648	71663	ACTTAAACTTGAGGGA	22	2232
1075920	N/A	N/A	75749	75764	AAAGAAAGCTGCGCAC	108	2233
1075952	N/A	N/A	78848	78863	CTATATACCTGCTTCT	41	2234
1075984	N/A	N/A	81250	81265	TATCGAAAAGCAAACT	44	2235
1076016	N/A	N/A	83002	83017	TAATAGGATGGATTCT	8	2236
1076048	N/A	N/A	85859	85874	GATTAAAGGCTGGAAG	32	2237
1076080	N/A	N/A	89574	89589	CATTAGCAGTTCACTA	55	2238
1076112	N/A	N/A	91226	91241	ATTCAAAACCACGGAA	98	2239
1076144	N/A	N/A	92435	92450	TTTTATAGGGCAATGG	7	2240
1076176	N/A	N/A	94395	94410	CTCCAATAGGTAACAG	43	2241
1076208	N/A	N/A	97037	97052	GAGGAATATTACAGAC	15	2242
1076240	N/A	N/A	98611	98626	ATTAAAAGCAAGGTGC	56	2243
1076272	N/A	N/A	101702	101717	TTAGAACAACTACTAC	53	2244
1076304	N/A	N/A	104340	104355	ACTAATAAGCCTCACC	30	2245
1076336	N/A	N/A	107295	107310	CATTACCACCTATAAG	31	2246
1076368	N/A	N/A	110251	110266	CATTTTATGTAAGGCC	15	2247
1076400	N/A	N/A	111869	111884	GTTAAAAGCCGTGAAA	10	2248
1076432	N/A	N/A	114880	114895	CATTAGTATTCACTGT	18	2249
1076464	N/A	N/A	118102	118117	CATATACAATTCTGCC	2	2250
1076496	N/A	N/A	120437	120452	GTTAAAGACCAACACA	81	2251
1076528	N/A	N/A	16102	16117	TTATAATGGGAGGATT	86	2252
1076560	N/A	N/A	113259	113274	TCCAAATATGGCATAC	10	2253

TABLE 31
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	1	810
1074129	178	193	3638	3653	CCCGGCTCCACTGGTC	77	2254
1074161	337	352	3797	3812	GGCGAGCGAGGGCTAC	98	2255
1074193	471	486	3931	3946	GGTCCGGACGGCGGGC	74	2256
1074225	822	837	7256	7271	CCAGAGACTACTCCAG	11	2257
1074257	1034	1049	55529	55544	GCACTGGTGGACTGGT	29	2258
1074289	1197	1212	98899	98914	TGACTGATTCTCTGGT	13	2259
1074321	1427	1442	N/A	N/A	GGGCTAACTCCTGACA	73	2260
1074353	1612	1627	120517	120532	GACACTGTAGCTGCTC	17	2261
1074385	1724	1739	122749	122764	CTTCAAGGTAGTCTGG	17	2262
1074417	2109	2124	123134	123149	TCTTTAGAGCCAACTG	2	2263
1074449	2475	2490	123500	123515	CTAATGATAGCACTAG	36	2264
1074481	2705	2720	123730	123745	AATATGGTCATTTGCC	14	2265
1074513	2881	2896	123906	123921	AGGATACATTCCACTA	47	2266
1074545	3064	3079	124089	124104	ACTCCCCTAGGCACTA	18	2267
1074577	3211	3226	124236	124251	TATTTCTGTCATGCAC	3	2268
1074609	3532	3547	124557	124572	CTAGTTACATCATCTC	8	2269
1074641	3829	3844	124854	124869	GGCCAAAATACTTAGA	107	2270
1074673	4154	4169	125179	125194	AGGCACTCCTTCCAAG	43	2271
1074705	4327	4342	125352	125367	GCACGGTGTAAGACAA	20	2272
1074737	4510	4525	125535	125550	TTCAGGTCAGTACAGA	7	2273
1074769	4642	4657	125667	125682	TCTTATCCCAATGCTA	12	2274
1074801	4809	4824	125834	125849	ACAAATAGTGCTTTGG	8	2275
1074833	5100	5115	126125	126140	TGCGAGGATAAAATCC	17	2276
1074865	5290	5305	126315	126330	ACATATGAGCATGCTC	46	2277
1074897	N/A	N/A	5473	5488	GGCAAAGTTCCTATGC	76	2278
1074929	N/A	N/A	5596	5611	TATACAACAGGCCTGC	79	2279
1074961	N/A	N/A	5676	5691	TCCTCCTTAACCCGGG	93	2280
1074993	N/A	N/A	4755	4770	TCTAATCAACACTGGA	65	2281
1075025	N/A	N/A	6468	6483	ACTTAAGAACTCACAC	58	2282
1075057	N/A	N/A	8351	8366	CCTTAGGAGTAGACTG	14	2283
1075089	N/A	N/A	10434	10449	CATTTATAGTCAGGTT	2	2284
1075121	N/A	N/A	12521	12536	AAAATTAGCCTACCAC	40	2285
1075153	N/A	N/A	16103	16118	ATTATAATGGGAGGAT	38	2286
1075185	N/A	N/A	19001	19016	GCCCAAGAACACTGGT	78	2287
1075217	N/A	N/A	23248	23263	TTATTTTACACGAACT	71	2288
1075249	N/A	N/A	27029	27044	ATTACGATTAGATCAG	5	2289
1075281	N/A	N/A	29105	29120	CAGCAAAAGTACCATG	36	2290
1075313	N/A	N/A	31663	31678	CTTAATTGAACTCAGG	28	2291
1075345	N/A	N/A	32639	32654	GTAACTAAAAGGGAGT	29	2292
1075377	N/A	N/A	35267	35282	CTAGAAAGGTTGGCCC	108	2293
1075409	N/A	N/A	37405	37420	CTTTAAATAGCAGAGG	22	2294
1075441	N/A	N/A	40002	40017	GAATTAAAGCAGTGCC	24	2295
1075473	N/A	N/A	41930	41945	AGTTATAACTGTACTA	89	2296
1075505	N/A	N/A	44322	44337	GCTAAATTACAGAGGT	18	2297
1075537	N/A	N/A	45795	45810	CTTTAATTACCCAAGG	82	2298
1075569	N/A	N/A	48125	48140	GTAGAAAGGCATTAGA	45	2299
1075601	N/A	N/A	49992	50007	ACACTATAATCTGACC	50	2300
1075633	N/A	N/A	52118	52133	CTATATTGGCTCCTAG	82	2301
1075665	N/A	N/A	53953	53968	ATTTAGTTGTGCACAG	87	2302
1075697	N/A	N/A	56110	56125	AATAATCCATGCTTGC	16	2303
1075729	N/A	N/A	58853	58868	TATTTAAAAATAGCGC	88	2304
1075761	N/A	N/A	61107	61122	GGAGAAAAACTACGGA	13	2305
1075793	N/A	N/A	63128	63143	CATTAGTTGCCCTGAC	31	2306
1075825	N/A	N/A	66353	66368	CCCCTAAAGAAGATTT	44	2307
1075857	N/A	N/A	68976	68991	CTTAAACAATCCCTAA	69	2308
1075889	N/A	N/A	72204	72219	ATTAAAAGTAGGCCCT	71	2309
1075921	N/A	N/A	75750	75765	GAAAGAAAGCTGCGCA	93	2310
1075953	N/A	N/A	78851	78866	AACCTATATACCTGCT	36	2311
1075985	N/A	N/A	81251	81266	ATATCGAAAAGCAAAC	82	2312
1076017	N/A	N/A	83003	83018	CTAATAGGATGGATTC	5	2313
1076049	N/A	N/A	85860	85875	AGATTAAAGGCTGGAA	4	2314
1076081	N/A	N/A	89730	89745	GATAATTCACCCTTGT	15	2315
1076113	N/A	N/A	91298	91313	TGACAATAGCCAATGC	16	2316
1076145	N/A	N/A	92457	92472	CCTTATAGGTTATAGT	41	2317
1076177	N/A	N/A	94422	94437	CTTTATTTCCCACCCG	37	2318
1076209	N/A	N/A	97241	97256	CATTAGCACACCTTTT	12	2319
1076241	N/A	N/A	98642	98657	CAATAAGGAACAGTTT	42	2320
1076273	N/A	N/A	101849	101864	AAACAAAATGGCGAAT	84	2321
1076305	N/A	N/A	104341	104356	TACTAATAAGCCTCAC	37	2322
1076337	N/A	N/A	107326	107341	ATTAAACCAGGGACTG	25	2323
1076369	N/A	N/A	110591	110606	TATTCGGTATTTTCTA	2	2324
1076401	N/A	N/A	112117	112132	TCTAAAGACTCTCATT	31	2325
1076433	N/A	N/A	114928	114943	ATTAACTTTCGCTAAA	69	2326
1076465	N/A	N/A	118550	118565	GCTTAAGGAATATACA	5	2327
1076497	N/A	N/A	120579	120594	AAAGAATACCAACCTG	72	2328
1076529	N/A	N/A	40252	40267	CTATAATGAGGATTAC	108	2329
1076561	N/A	N/A	11318	11333	GTATACCAAGCTACTC	22	2330

TABLE 32
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	2	810
1074130	214	229	3674	3689	ATCCCCCGCCCCGGCG	119	2331
1074162	338	353	3798	3813	AGGCGAGCGAGGGCTA	101	2332
1074194	474	489	3934	3949	CCGGGTCCGGACGGCG	57	2333
1074226	859	874	7293	7308	CTGTCGAAGATGCTGA	10	2334
1074258	1044	1059	55539	55554	ATATTCTGCTGCACTG	36	2335
1074290	1198	1213	98900	98915	CTGACTGATTCTCTGG	5	2336
1074322	1428	1443	N/A	N/A	AGGGCTAACTCCTGAC	94	2337
1074354	1613	1628	120518	120533	GGACACTGTAGCTGCT	24	2338
1074386	1733	1748	122758	122773	CAGGAATGGCTTCAAG	39	2339
1074418	2110	2125	123135	123150	TTCTTTAGAGCCAACT	4	2340
1074450	2476	2491	123501	123516	ACTAATGATAGCACTA	5	2341
1074482	2706	2721	123731	123746	TAATATGGTCATTTGC	12	2342
1074514	2882	2897	123907	123922	AAGGATACATTCCACT	25	2343
1074546	3065	3080	124090	124105	CACTCCCCTAGGCACT	33	2344
1074578	3214	3229	124239	124254	GCTTATTTCTGTCATG	8	2345
1074610	3533	3548	124558	124573	TCTAGTTACATCATCT	5	2346
1074642	3830	3845	124855	124870	GGGCCAAAATACTTAG	78	2347
1074674	4157	4172	125182	125197	TATAGGCACTCCTTCC	22	2348
1074706	4336	4351	125361	125376	TTAATGGCAGCACGGT	48	2349
1074738	4511	4526	125536	125551	CTTCAGGTCAGTACAG	12	2350
1074770	4643	4658	125668	125683	ATCTTATCCCAATGCT	15	2351
1074802	4836	4851	125861	125876	GGCACTACATTTAGAA	37	2352
1074834	5101	5116	126126	126141	TTGCGAGGATAAAATC	14	2353
1074866	5291	5306	126316	126331	AACATATGAGCATGCT	30	2354
1074898	N/A	N/A	5481	5496	AACTTTTGGGCAAAGT	101	2355
1074930	N/A	N/A	5597	5612	CTATACAACAGGCCTG	84	2356
1074962	N/A	N/A	5709	5724	AGGCAAGCAGCTAAAT	78	2357
1074994	N/A	N/A	4784	4799	AAACTAAATGGACCGG	94	2358
1075026	N/A	N/A	6556	6571	CTTAAAAGCCATCTAC	55	2359
1075058	N/A	N/A	8466	8481	ATTACAAAGTAGCAAC	66	2360
1075090	N/A	N/A	10590	10605	GCTTATAATCTTTCAG	9	2361
1075122	N/A	N/A	12522	12537	GAAAATTAGCCTACCA	16	2362
1075154	N/A	N/A	16104	16119	CATTATAATGGGAGGA	13	2363
1075186	N/A	N/A	19097	19112	AAATCGATTATTCAGA	73	2364
1075218	N/A	N/A	23347	23362	CTTAACACTGGTAAGA	97	2365
1075250	N/A	N/A	27030	27045	AATTACGATTAGATCA	55	2366
1075282	N/A	N/A	29645	29660	GAAAAATGAGCCCGGT	103	2367
1075314	N/A	N/A	31708	31723	AATAAAGTCTAATCCA	54	2368
1075346	N/A	N/A	32705	32720	GTAAGTAAAACTGCTG	16	2369
1075378	N/A	N/A	35289	35304	AAAACTAATCATCGAT	83	2370
1075410	N/A	N/A	37572	37587	GATTAACAGCCCTTTA	36	2371
1075442	N/A	N/A	40105	40120	TATTAGTTCTACGATT	71	2372
1075474	N/A	N/A	41975	41990	TTTAATAGGCTCTATC	68	2373
1075506	N/A	N/A	44427	44442	CATAAAGGTGACAGCC	66	2374
1075538	N/A	N/A	46165	46180	GAATTGGAACACCTCA	66	2375
1075570	N/A	N/A	48306	48321	GATACTAAGCACAGAG	16	2376
1075602	N/A	N/A	50018	50033	TATTATAAGTCTACAA	114	2377
1075634	N/A	N/A	52121	52136	AGACTATATTGGCTCC	65	2378
1075666	N/A	N/A	53955	53970	AAATTTAGTTGTGCAC	106	2379
1075698	N/A	N/A	56114	56129	GTTTAATAATCCATGC	10	2380
1075730	N/A	N/A	58854	58869	GTATTTAAAAATAGCG	92	2381
1075762	N/A	N/A	61391	61406	GATAAATGGGTTGATT	20	2382
1075794	N/A	N/A	63266	63281	CATAATGAATGTGGGT	38	2383
1075826	N/A	N/A	66375	66390	TAGGGAAAACCATAGC	23	2384
1075858	N/A	N/A	68977	68992	CCTTAAACAATCCCTA	23	2385
1075890	N/A	N/A	72205	72220	GATTAAAAGTAGGCCC	92	2386
1075922	N/A	N/A	75778	75793	GCCCAAAATAGGATAC	60	2387
1075954	N/A	N/A	78881	78896	ATTTAAGGCTGTGTTC	50	2388
1075986	N/A	N/A	81253	81268	GAATATCGAAAAGCAA	26	2389
1076018	N/A	N/A	83004	83019	ACTAATAGGATGGATT	15	2390
1076050	N/A	N/A	85864	85879	CTTTAGATTAAAGGCT	45	2391
1076082	N/A	N/A	89791	89806	TCTCAATACACTATAT	38	2392
1076114	N/A	N/A	91589	91604	ATTAGTAAGCTGAGGA	3	2393
1076146	N/A	N/A	92471	92486	GCTAAAACTTTCATCC	23	2394
1076178	N/A	N/A	94474	94489	CCTGAAATACAGGTGT	100	2395
1076210	N/A	N/A	97442	97457	ATTTATATGCTCCCTC	20	2396
1076242	N/A	N/A	98645	98660	ATGCAATAAGGAACAG	33	2397
1076274	N/A	N/A	102073	102088	TGAGAATAGAGCAGGT	9	2398
1076306	N/A	N/A	104347	104362	CTTTACTACTAATAAG	99	2399
1076338	N/A	N/A	107327	107342	CATTAAACCAGGGACT	33	2400
1076370	N/A	N/A	110594	110609	GATTATTCGGTATTTT	2	2401
1076402	N/A	N/A	112324	112339	CGTAATTATTTTTGCT	38	2402
1076434	N/A	N/A	115047	115062	CTTTAGGTTTATGCCT	25	2403
1076466	N/A	N/A	118557	118572	ATTTAGAGCTTAAGGA	5	2404
1076498	N/A	N/A	120644	120659	TTACAATACCTTATGA	70	2405
1076530	N/A	N/A	64823	64838	AGTATAAAGCAGGGCA	5	2406
1076562	N/A	N/A	12922	12937	TATTACAGAGGGTAGC	17	2407

TABLE 33
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	4	810
1074131	222	237	3682	3697	GGCCCCGCATCCCCCG	72	2408
1074163	339	354	3799	3814	CAGGCGAGCGAGGGCT	118	2409
1074195	475	490	3935	3950	CCCGGGTCCGGACGGC	79	2410
1074227	860	875	7294	7309	ACTGTCGAAGATGCTG	10	2411
1074259	1046	1061	55541	55556	TCATATTCTGCTGCAC	38	2412
1074291	1202	1217	98904	98919	CACTCTGACTGATTCT	11	2413
1074323	1429	1444	N/A	N/A	CAGGGCTAACTCCTGA	116	2414
1074355	1615	1630	120520	120535	AGGGACACTGTAGCTG	55	2415
1074387	1734	1749	122759	122774	CCAGGAATGGCTTCAA	32	2416
1074419	2111	2126	123136	123151	ATTCTTTAGAGCCAAC	4	2417
1074451	2477	2492	123502	123517	GACTAATGATAGCACT	6	2418
1074483	2709	2724	123734	123749	CACTAATATGGTCATT	15	2419
1074515	2908	2923	123933	123948	TAACTGGAAAGCAGGG	9	2420
1074547	3068	3083	124093	124108	GAGCACTCCCCTAGGC	71	2421
1074579	3224	3239	124249	124264	CCACTATAAAGCTTAT	6	2422
1074611	3621	3636	124646	124661	TAGCTTATATTGAAGA	19	2423
1074643	3835	3850	124860	124875	TTGAAGGGCCAAAATA	68	2424
1074675	4161	4176	125186	125201	AAATTATAGGCACTCC	6	2425
1074707	4337	4352	125362	125377	TTTAATGGCAGCACGG	36	2426
1074739	4525	4540	125550	125565	GACTCTTAGGTCTCCT	24	2427
1074771	4644	4659	125669	125684	AATCTTATCCCAATGC	18	2428
1074803	4837	4852	125862	125877	AGGCACTACATTTAGA	32	2429
1074835	5102	5117	126127	126142	CTTGCGAGGATAAAAT	30	2430
1074867	5292	5307	126317	126332	TAACATATGAGCATGC	40	2431
1074899	N/A	N/A	5482	5497	TAACTTTTGGGCAAAG	52	2432
1074931	N/A	N/A	5601	5616	GAGACTATACAACAGG	35	2433
1074963	N/A	N/A	5710	5725	TAGGCAAGCAGCTAAA	76	2434
1074995	N/A	N/A	4785	4800	AAAACTAAATGGACCG	50	2435
1075027	N/A	N/A	6578	6593	AAATTTGAACTGCCCA	28	2436
1075059	N/A	N/A	8749	8764	ATTTACTTTGGATGTC	11	2437
1075091	N/A	N/A	10609	10624	AAACAACGAATGATTG	65	2438
1075123	N/A	N/A	12563	12578	CTTTAGGAAAGGGTAT	21	2439
1075155	N/A	N/A	16105	16120	TCATTATAATGGGAGG	5	2440
1075187	N/A	N/A	19108	19123	GCCCAAGGAGGAAATC	77	2441
1075219	N/A	N/A	23348	23363	CCTTAACACTGGTAAG	117	2442
1075251	N/A	N/A	27031	27046	TAATTACGATTAGATC	79	2443
1075283	N/A	N/A	29653	29668	CGAATATAGAAAAATG	90	2444
1075315	N/A	N/A	31772	31787	CATAACTTGATGACTC	27	2445
1075347	N/A	N/A	32821	32836	CATAGGTAGGCAACAA	20	2446
1075379	N/A	N/A	35306	35321	TACCAAAACTACAACC	75	2447
1075411	N/A	N/A	37768	37783	CAAAAAGGGTAAGGCA	39	2448
1075443	N/A	N/A	40138	40153	GATTAACAGAGCTAGA	29	2449
1075475	N/A	N/A	42037	42052	TAGCAACACATGAAGA	64	2450
1075507	N/A	N/A	44455	44470	GTACAACCTAGTGATA	82	2451
1075539	N/A	N/A	46198	46213	CTTAAGGGATGGAACA	79	2452
1075571	N/A	N/A	48312	48327	CAAATAGATACTAAGC	54	2453
1075603	N/A	N/A	50064	50079	TATGAACAAGTATGAG	35	2454
1075635	N/A	N/A	52207	52222	AATAAACACCTCGCCA	97	2455
1075667	N/A	N/A	53956	53971	CAAATTTAGTTGTGCA	109	2456
1075699	N/A	N/A	56158	56173	GATTTATACTCAGGTT	4	2457
1075731	N/A	N/A	58878	58893	CCCCAATATTATCTAC	40	2458
1075763	N/A	N/A	61435	61450	ATTTAGGCTTTGGGTT	16	2459
1075795	N/A	N/A	63289	63304	GTAATTATATACCCAC	66	2460
1075827	N/A	N/A	66457	66472	ATACTATACCTAAGGA	60	2461
1075859	N/A	N/A	69260	69275	ACTTATCACTCTGCCC	20	2462
1075891	N/A	N/A	72206	72221	AGATTAAAAGTAGGCC	89	2463
1075923	N/A	N/A	75823	75838	TTTAATACTCTCTGGG	42	2464
1075955	N/A	N/A	79005	79020	GACCTATAATACAGAA	85	2465
1075987	N/A	N/A	81256	81271	GAAGAATATCGAAAAG	13	2466
1076019	N/A	N/A	83005	83020	CACTAATAGGATGGAT	12	2467
1076051	N/A	N/A	85945	85960	CTTAACTATTCAGCCC	21	2468
1076083	N/A	N/A	89966	89981	CGCTATAAAGTGGCAT	46	2469
1076115	N/A	N/A	91590	91605	CATTAGTAAGCTGAGG	7	2470
1076147	N/A	N/A	92516	92531	ATTAACTCACGAAGAC	25	2471
1076179	N/A	N/A	94487	94502	AATTAGCCAACCACCT	38	2472
1076211	N/A	N/A	97443	97458	AATTTATATGCTCCCT	22	2473
1076243	N/A	N/A	98790	98805	ATATTCGATGTAACTT	41	2474
1076275	N/A	N/A	102220	102235	GTATTAGATAAAGCAG	10	2475
1076307	N/A	N/A	104378	104393	GTAATTACCTCTAATC	38	2476
1076339	N/A	N/A	107352	107367	CAGCAATACTGTGGGC	13	2477
1076371	N/A	N/A	110712	110727	TAAGAACGAACCTCCA	49	2478
1076403	N/A	N/A	112457	112472	ATTTAAGACCTGGTGA	26	2479
1076435	N/A	N/A	115328	115343	CGTAAACATCATCTCT	12	2480
1076467	N/A	N/A	118559	118574	GTATTTAGAGCTTAAG	5	2481
1076499	N/A	N/A	121073	121088	GCTAATATATCCAATT	37	2482
1076531	N/A	N/A	66739	66754	ACTATAAAGGGTTTAG	66	2483
1076563	N/A	N/A	31631	31646	CAAAGTAATTAAACGA	91	2484

TABLE 34
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	1	810
1074132	223	238	3683	3698	CGGCCCCGCATCCCCC	96	2485
1074164	340	355	3800	3815	CCAGGCGAGCGAGGGC	135	2486
1074196	476	491	3936	3951	GCCCGGGTCCGGACGG	99	2487
1074228	861	876	7295	7310	GACTGTCGAAGATGCT	17	2488
1074260	1051	1066	55546	55561	GTTCATCATATTCTGC	48	2489
1074292	1216	1231	98918	98933	CTGTTTCACTGGAGCA	10	2490
1074324	1430	1445	N/A	N/A	GCAGGGCTAACTCCTG	116	2491
1074356	1616	1631	120521	120536	GAGGGACACTGTAGCT	43	2492
1074388	1805	1820	122830	122845	GACTTGGCATCAGCTC	16	2493
1074420	2112	2127	123137	123152	GATTCTTTAGAGCCAA	2	2494
1074452	2478	2493	123503	123518	TGACTAATGATAGCAC	3	2495
1074484	2710	2725	123735	123750	TCACTAATATGGTCAT	3	2496
1074516	2909	2924	123934	123949	TTAACTGGAAAGCAGG	22	2497
1074548	3093	3108	124118	124133	ATCTACCGTATGCCCA	4	2498
1074580	3225	3240	124250	124265	ACCACTATAAAGCTTA	5	2499
1074612	3622	3637	124647	124662	ATAGCTTATATTGAAG	12	2500
1074644	3836	3851	124861	124876	ATTGAAGGGCCAAAAT	93	2501
1074676	4162	4177	125187	125202	CAAATTATAGGCACTC	4	2502
1074708	4338	4353	125363	125378	CTTTAATGGCAGCACG	55	2503
1074740	4526	4541	125551	125566	GGACTCTTAGGTCTCC	75	2504
1074772	4650	4665	125675	125690	AGTTAAAATCTTATCC	80	2505
1074804	4874	4889	125899	125914	TAGCAAAGTCACTTCC	15	2506
1074836	5111	5126	126136	126151	AACAACATGCTTGCGA	27	2507
1074868	5297	5312	126322	126337	GTACCTAACATATGAG	74	2508
1074900	N/A	N/A	5484	5499	ATTAACTTTTGGGCAA	40	2509
1074932	N/A	N/A	5602	5617	GGAGACTATACAACAG	88	2510
1074964	N/A	N/A	5711	5726	TTAGGCAAGCAGCTAA	112	2511
1074996	N/A	N/A	4843	4858	AATAAATGCTTACGGG	60	2512
1075028	N/A	N/A	6670	6685	AAAAATCAAGCCCTCG	103	2513
1075060	N/A	N/A	8896	8911	GTTTAACAATCTCCCC	70	2514
1075092	N/A	N/A	10612	10627	TTAAAACAACGAATGA	63	2515
1075124	N/A	N/A	12652	12667	GTAAAAACCTGGGTTT	58	2516
1075156	N/A	N/A	16175	16190	ATTATATGACTCTGCT	22	2517
1075188	N/A	N/A	19193	19208	AGTCAACCTGTAATTA	14	2518
1075220	N/A	N/A	23362	23377	AATTTTAACTGTGACC	24	2519
1075252	N/A	N/A	27032	27047	TTAATTACGATTAGAT	90	2520
1075284	N/A	N/A	29658	29673	CTTTTCGAATATAGAA	76	2521
1075316	N/A	N/A	31797	31812	GTATATAGATACCCAC	25	2522
1075348	N/A	N/A	32855	32870	TCACAAAACCCTACAC	96	2523
1075380	N/A	N/A	35609	35624	ACTAAAACTGACTGTC	94	2524
1075412	N/A	N/A	37770	37785	TCCAAAAAGGGTAAGG	48	2525
1075444	N/A	N/A	40268	40283	ATAAATCCTCATGTGG	112	2526
1075476	N/A	N/A	42291	42306	TCTTATCCTACAGCTT	75	2527
1075508	N/A	N/A	44490	44505	GAAAAAGGTTTAGGGT	84	2528
1075540	N/A	N/A	46199	46214	GCTTAAGGGATGGAAC	78	2529
1075572	N/A	N/A	48372	48387	CAATTTAACTGTTACA	84	2530
1075604	N/A	N/A	50104	50119	ATAATTAAGCTATCAC	81	2531
1075636	N/A	N/A	52208	52223	CAATAAACACCTCGCC	91	2532
1075668	N/A	N/A	54032	54047	AATTATTGGTGACACT	80	2533
1075700	N/A	N/A	56179	56194	GCCAAATAAGAGGTAG	22	2534
1075732	N/A	N/A	58998	59013	AATAACCTCGAGTGCT	36	2535
1075764	N/A	N/A	61668	61683	CTTCAAGGAAGGTGCT	103	2536
1075796	N/A	N/A	63290	63305	AGTAATTATATACCCA	64	2537
1075828	N/A	N/A	66513	66528	TTAGAATAGTTCTACC	59	2538
1075860	N/A	N/A	69290	69305	AACTATAAGCTATGTG	73	2539
1075892	N/A	N/A	72236	72251	CACCAATACCAAAGTC	54	2540
1075924	N/A	N/A	75824	75839	ATTTAATACTCTCTGG	21	2541
1075956	N/A	N/A	79218	79233	TATAAAGCAATGCGAT	27	2542
1075988	N/A	N/A	81357	81372	AATTAAGCTTCTCTAG	90	2543
1076020	N/A	N/A	83011	83026	CCCCAACACTAATAGG	60	2544
1076052	N/A	N/A	86023	86038	GCAATAAAGCTGAACT	23	2545
1076084	N/A	N/A	89980	89995	CATCAATAGAGAGTCG	7	2546
1076116	N/A	N/A	91600	91615	GAAAATAGCCCATTAG	25	2547
1076148	N/A	N/A	92517	92532	TATTAACTCACGAAGA	52	2548
1076180	N/A	N/A	94489	94504	ATAATTAGCCAACCAC	42	2549
1076212	N/A	N/A	97445	97460	CAAATTTATATGCTCC	15	2550
1076244	N/A	N/A	98799	98814	CAATTTGGGATATTCG	14	2551
1076276	N/A	N/A	102282	102297	CTTTAGGAGTCAGAAC	59	2552
1076308	N/A	N/A	104379	104394	AGTAATTACCTCTAAT	32	2553
1076340	N/A	N/A	107364	107379	TAATATCCTCATCAGC	8	2554
1076372	N/A	N/A	110715	110730	CAATAAGAACGAACCT	76	2555
1076404	N/A	N/A	112458	112473	TATTTAAGACCTGGTG	13	2556
1076436	N/A	N/A	115413	115428	CATTACTACTCTGTCC	39	2557
1076468	N/A	N/A	118602	118617	CATTACTACTAAGAGT	91	2558
1076500	N/A	N/A	121129	121144	CAATTAAGATCAACAT	99	2559
1076532	N/A	N/A	68936	68951	ATTTTTAGGCAGACGC	12	2560
1076564	N/A	N/A	39617	39632	TAAAGTAATGCTACAG	77	2561

TABLE 35
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	2	810
1074133	224	239	3684	3699	GCGGCCCCGCATCCCC	101	2562
1074165	341	356	3801	3816	CCCAGGCGAGCGAGGG	90	2563
1074197	477	492	3937	3952	TGCCCGGGTCCGGACG	91	2564
1074229	864	879	7298	7313	GAAGACTGTCGAAGAT	5	2565
1074261	1055	1070	55550	55565	CCGAGTTCATCATATT	19	2566
1074293	1217	1232	98919	98934	GCTGTTTCACTGGAGC	54	2567
1074325	1431	1446	116620	116635	CGCAGGGCTAACTCCT	42	2568
1074357	1617	1632	120522	120537	CGAGGGACACTGTAGC	12	2569
1074389	1808	1823	122833	122848	GCAGACTTGGCATCAG	14	2570
1074421	2113	2128	123138	123153	TGATTCTTTAGAGCCA	3	2571
1074453	2479	2494	123504	123519	GTGACTAATGATAGCA	4	2572
1074485	2711	2726	123736	123751	TTCACTAATATGGTCA	4	2573
1074517	2939	2954	123964	123979	AATGCATACAAAGCGC	55	2574
1074549	3094	3109	124119	124134	TATCTACCGTATGCCC	6	2575
1074581	3226	3241	124251	124266	AACCACTATAAAGCTT	18	2576
1074613	3623	3638	124648	124663	CATAGCTTATATTGAA	7	2577
1074645	3837	3852	124862	124877	AATTGAAGGGCCAAAA	81	2578
1074677	4169	4184	125194	125209	CTACTGGCAAATTATA	22	2579
1074709	4352	4367	125377	125392	TCTAGAACAGCTGCCT	71	2580
1074741	4528	4543	125553	125568	AAGGACTCTTAGGTCT	78	2581
1074773	4651	4666	125676	125691	CAGTTAAAATCTTATC	94	2582
1074805	4875	4890	125900	125915	GTAGCAAAGTCACTTC	9	2583
1074837	5112	5127	126137	126152	TAACAACATGCTTGCG	11	2584
1074869	5298	5313	126323	126338	AGTACCTAACATATGA	31	2585
1074901	N/A	N/A	5485	5500	TATTAACTTTTGGGCA	61	2586
1074933	N/A	N/A	5603	5618	AGGAGACTATACAACA	72	2587
1074965	N/A	N/A	5715	5730	GTGTTTAGGCAAGCAG	20	2588
1074997	N/A	N/A	4854	4869	GCCGCGAGGAAAATAA	119	2589
1075029	N/A	N/A	7004	7019	ATATTCGACACTGGAG	33	2590
1075061	N/A	N/A	8954	8969	CCTTATACTTTTAGCC	5	2591
1075093	N/A	N/A	10664	10679	CAAAGTAAGGTATGAG	3	2592
1075125	N/A	N/A	12777	12792	CTTAAGGTACAAGGCA	84	2593
1075157	N/A	N/A	16192	16207	CCAGAAAATCATAGTA	19	2594
1075189	N/A	N/A	19238	19253	GCTAATAGTCACTGTT	11	2595
1075221	N/A	N/A	23384	23399	CATTATCCGGGAGAGC	10	2596
1075253	N/A	N/A	27033	27048	GTTAATTACGATTAGA	20	2597
1075285	N/A	N/A	29702	29717	TATACATAGTCAATTC	60	2598
1075317	N/A	N/A	31832	31847	GTATTCGCCTCCTGCA	27	2599
1075349	N/A	N/A	33000	33015	ATTAAAGCTCATTGAT	81	2600
1075381	N/A	N/A	35767	35782	TATTACCCTACTCATA	89	2601
1075413	N/A	N/A	37807	37822	CATAACTACATCGACA	34	2602
1075445	N/A	N/A	40269	40284	TATAAATCCTCATGTG	84	2603
1075477	N/A	N/A	42405	42420	CTTTATCTCACTAGCT	86	2604
1075509	N/A	N/A	44622	44637	CATAATCCCTGACTTG	81	2605
1075541	N/A	N/A	46250	46265	GCTCAAAACTGACATA	47	2606
1075573	N/A	N/A	48504	48519	AAGGAACCTTCTGTGT	72	2607
1075605	N/A	N/A	50176	50191	CGTAAACATTTTGCCT	38	2608
1075637	N/A	N/A	52219	52234	CCACAACCTGTCAATA	100	2609
1075669	N/A	N/A	54033	54048	AAATTATTGGTGACAC	70	2610
1075701	N/A	N/A	56296	56311	AATTACTAGAGGCTTC	3	2611
1075733	N/A	N/A	58999	59014	CAATAACCTCGAGTGC	28	2612
1075765	N/A	N/A	61721	61736	CTTAAGGCAGCTCTAT	58	2613
1075797	N/A	N/A	63378	63393	GATAATCATGATACTC	3	2614
1075829	N/A	N/A	66603	66618	ACTCAATAGATCATTG	41	2615
1075861	N/A	N/A	69291	69306	TAACTATAAGCTATGT	78	2616
1075893	N/A	N/A	72284	72299	CGTGAAAAAGATGTGG	7	2617
1075925	N/A	N/A	75907	75922	AACCTATATTATTTGC	28	2618
1075957	N/A	N/A	79219	79234	CTATAAAGCAATGCGA	28	2619
1075989	N/A	N/A	81362	81377	GCTAAAATTAAGCTTC	78	2620
1076021	N/A	N/A	83058	83073	CATTAATAAAGTTACC	95	2621
1076053	N/A	N/A	86047	86062	TACCAACAAGGCATCA	55	2622
1076085	N/A	N/A	90079	90094	ACTAATAGGCCATCTG	7	2623
1076117	N/A	N/A	91603	91618	CTAGAAAATAGCCCAT	15	2624
1076149	N/A	N/A	92518	92533	TTATTAACTCACGAAG	24	2625
1076181	N/A	N/A	94490	94505	TATAATTAGCCAACCA	26	2626
1076213	N/A	N/A	97518	97533	TCTCAAGGAATTGCCT	27	2627
1076245	N/A	N/A	98849	98864	CCTAAAAAACTAGTGA	101	2628
1076277	N/A	N/A	102574	102589	GCTAAAACATCAGATA	24	2629
1076309	N/A	N/A	104525	104540	GATAACTTTCCACAAT	9	2630
1076341	N/A	N/A	107422	107437	ATTAACTACAACTGTG	18	2631
1076373	N/A	N/A	111082	111097	AACGGATATACAATAA	10	2632
1076405	N/A	N/A	112459	112474	TTATTTAAGACCTGGT	12	2633
1076437	N/A	N/A	115843	115858	GAAGAATAGCATCTGA	19	2634
1076469	N/A	N/A	118627	118642	GTAAAAGGGAACTAAG	69	2635
1076501	N/A	N/A	121268	121283	CATAACACTTAAGGTG	97	2636
1076533	N/A	N/A	75580	75595	ATTTTTAGTCCAGTGG	9	2637
1076565	N/A	N/A	55334	55349	CATTAAGTCACAGCAT	74	2638

TABLE 36
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	1	810
1074134	225	240	3685	3700	CGCGGCCCCGCATCCC	79	2639
1074166	342	357	3802	3817	ACCCAGGCGAGCGAGG	72	2640
1074198	478	493	3938	3953	TTGCCCGGGTCCGGAC	112	2641
1074230	866	881	7300	7315	AAGAAGACTGTCGAAG	4	2642
1074262	1056	1071	55551	55566	GCCGAGTTCATCATAT	48	2643
1074294	1275	1290	98977	98992	TTGGAGTTGCTGCCAC	80	2644
1074326	1432	1447	116621	116636	ACGCAGGGCTAACTCC	36	2645
1074358	1618	1633	120523	120538	TCGAGGGACACTGTAG	17	2646
1074390	1810	1825	122835	122850	CTGCAGACTTGGCATC	64	2647
1074422	2189	2204	123214	123229	AAACAGGCTCACTTCC	9*	2648
1074454	2480	2495	123505	123520	TGTGACTAATGATAGC	1	2649
1074486	2712	2727	123737	123752	ATTCACTAATATGGTC	4	2650
1074518	2940	2955	123965	123980	AAATGCATACAAAGCG	13	2651
1074550	3095	3110	124120	124135	ATATCTACCGTATGCC	23	2652
1074582	3228	3243	124253	124268	TAAACCACTATAAAGC	18	2653
1074614	3624	3639	124649	124664	TCATAGCTTATATTGA	49	2654
1074646	3838	3853	124863	124878	AAATTGAAGGGCCAAA	39	2655
1074678	4179	4194	125204	125219	TAATCTGTGGCTACTG	7	2656
1074710	4353	4368	125378	125393	CTCTAGAACAGCTGCC	42	2657
1074742	4529	4544	125554	125569	AAAGGACTCTTAGGTC	25	2658
1074774	4661	4676	125686	125701	CAAGAATACCCAGTTA	16	2659
1074806	4877	4892	125902	125917	TTGTAGCAAAGTCACT	8	2660
1074838	5113	5128	126138	126153	ATAACAACATGCTTGC	9	2661
1074870	5301	5316	126326	126341	GTAAGTACCTAACATA	20	2662
1074902	N/A	N/A	5486	5501	CTATTAACTTTTGGGC	54	2663
1074934	N/A	N/A	5604	5619	CAGGAGACTATACAAC	74	2664
1074966	N/A	N/A	5721	5736	ATTGAAGTGTTTAGGC	9	2665
1074998	N/A	N/A	4998	5013	CACGCGACCTACTAAG	61	2666
1075030	N/A	N/A	7007	7022	TTAATATTCGACACTG	37	2667
1075062	N/A	N/A	8960	8975	CTTTAACCTTATACTT	58	2668
1075094	N/A	N/A	10705	10720	GATAAATGTAACTAGC	10	2669
1075126	N/A	N/A	12890	12905	CTTAAATCTTAGCAAC	20	2670
1075158	N/A	N/A	16240	16255	CGGCAAAAACAAAATC	76	2671
1075190	N/A	N/A	19295	19310	TATCAAGGATTCAGTA	45	2672
1075222	N/A	N/A	23766	23781	GTATTTGGACAACTCT	3	2673
1075254	N/A	N/A	27099	27114	TCCCAAAAGTCATCGC	28	2674
1075286	N/A	N/A	29807	29822	ATTACGGACAGAAGTG	48	2675
1075318	N/A	N/A	31850	31865	ATCCTAAAGCCACTGC	72	2676
1075350	N/A	N/A	33001	33016	GATTAAAGCTCATTGA	62	2677
1075382	N/A	N/A	35769	35784	ATTATTACCCTACTCA	33	2678
1075414	N/A	N/A	37990	38005	CATACTAATCCCTCTT	41	2679
1075446	N/A	N/A	40270	40285	CTATAAATCCTCATGT	87	2680
1075478	N/A	N/A	42416	42431	CATTTTGAACCCTTTA	20	2681
1075510	N/A	N/A	44630	44645	GAATAACACATAATCC	83	2682
1075542	N/A	N/A	46607	46622	TGAGAAAGGTTCCTGA	66	2683
1075574	N/A	N/A	48508	48523	AGTCAAGGAACCTTCT	47	2684
1075606	N/A	N/A	50368	50383	GCTAAACCTACACGCT	82	2685
1075638	N/A	N/A	52324	52339	ATTAACCAGAAGCCTG	79	2686
1075670	N/A	N/A	54501	54516	TATATATGATGGACTG	39	2687
1075702	N/A	N/A	56442	56457	GAGGAAGGGCACCTTT	81	2688
1075734	N/A	N/A	59002	59017	AGGCAATAACCTCGAG	26	2689
1075766	N/A	N/A	61741	61756	GGAGAACACAAGAGGC	5	2690
1075798	N/A	N/A	63396	63411	ATTTAGATAGTTACTG	21	2691
1075830	N/A	N/A	66610	66625	GATGAACACTCAATAG	12	2692
1075862	N/A	N/A	70001	70016	CTAATAACTTGTCTAC	67	2693
1075894	N/A	N/A	72305	72320	CTCGAAAGCTGGGCCC	100	2694
1075926	N/A	N/A	75911	75926	GTAGAACCTATATTAT	25	2695
1075958	N/A	N/A	79351	79366	CATTATGACATTCCCC	12	2696
1075990	N/A	N/A	81490	81505	CGTTATTATGCAGCAA	1	2697
1076022	N/A	N/A	83093	83108	TAATTAGATGCTGACA	2	2698
1076054	N/A	N/A	86104	86119	CATTAGACTTTCTGTC	21	2699
1076086	N/A	N/A	90080	90095	AACTAATAGGCCATCT	31	2700
1076118	N/A	N/A	91688	91703	CGTAAATTGAGGCCCA	45	2701
1076150	N/A	N/A	92520	92535	ATTTATTAACTCACGA	11	2702
1076182	N/A	N/A	94491	94506	CTATAATTAGCCAACC	15	2703
1076214	N/A	N/A	97543	97558	ATCCTATACATTAAGA	67	2704
1076246	N/A	N/A	98850	98865	TCCTAAAAAACTAGTG	75	2705
1076278	N/A	N/A	102644	102659	AATAAGGACAGGACCC	29	2706
1076310	N/A	N/A	104554	104569	ACCCTATACTTGAATT	36	2707
1076342	N/A	N/A	107423	107438	CATTAACTACAACTGT	33	2708
1076374	N/A	N/A	111084	111099	ATAACGGATATACAAT	15	2709
1076406	N/A	N/A	112460	112475	ATTATTTAAGACCTGG	4	2710
1076438	N/A	N/A	115846	115861	TAGGAAGAATAGCATC	13	2711
1076470	N/A	N/A	118843	118858	GATAAAGAGGTTAACA	34	2712
1076502	N/A	N/A	121320	121335	CAAAGTAAGTGAGCCC	17	2713
1076534	N/A	N/A	79220	79235	ACTATAAAGCAATGCG	4	2714
1076566	N/A	N/A	55576	55591	AATTACAGTGTCTCAC	63	2715

TABLE 37
Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop		YAP1	SEQ
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	2	810
1074135	226	241	3686	3701	CCGCGGCCCCGCATCC	91	2716
1074167	353	368	3813	3828	CGCACCCCCTGACCCA	58	2717
1074199	483	498	3943	3958	GCCGGTTGCCCGGGTC	101	2718
1074231	867	882	7301	7316	AAAGAAGACTGTCGAA	8	2719
1074263	1057	1072	55552	55567	AGCCGAGTTCATCATA	34	2720
1074295	1278	1293	98980	98995	TGGTTGGAGTTGCTGC	15	2721
1074327	1433	1448	116622	116637	TACGCAGGGCTAACTC	39	2722
1074359	1619	1634	120524	120539	TTCGAGGGACACTGTA	18	2723
1074391	1828	1843	122853	122868	GTCAGAACTCAAAGCT	14	2724
1074423	2190	2205	123215	123230	CAAACAGGCTCACTTC	4*	2725
1074455	2485	2500	123510	123525	CATTATGTGACTAATG	67	2726
1074487	2714	2729	123739	123754	AGATTCACTAATATGG	7	2727
1074519	2959	2974	123984	123999	ACTACTAGTCATGTAT	45	2728
1074551	3096	3111	124121	124136	AATATCTACCGTATGC	58	2729
1074583	3229	3244	124254	124269	GTAAACCACTATAAAG	30	2730
1074615	3625	3640	124650	124665	TTCATAGCTTATATTG	8	2731
1074647	3839	3854	124864	124879	CAAATTGAAGGGCCAA	27	2732
1074679	4182	4197	125207	125222	TCTTAATCTGTGGCTA	5	2733
1074711	4354	4369	125379	125394	ACTCTAGAACAGCTGC	28	2734
1074743	4530	4545	125555	125570	GAAAGGACTCTTAGGT	16	2735
1074775	4681	4696	125706	125721	GGTTTATTGTAAAAGC	3	2736
1074807	4927	4942	125952	125967	CCATATAGAAGGCATG	75	2737
1074839	5114	5129	126139	126154	TATAACAACATGCTTG	33	2738
1074871	5302	5317	126327	126342	TGTAAGTACCTAACAT	70	2739
1074903	N/A	N/A	5487	5502	CCTATTAACTTTTGGG	87	2740
1074935	N/A	N/A	5605	5620	ACAGGAGACTATACAA	80	2741
1074967	N/A	N/A	5726	5741	GACAAATTGAAGTGTT	116	2742
1074999	N/A	N/A	5004	5019	AACCAACACGCGACCT	77	2743
1075031	N/A	N/A	7009	7024	ATTTAATATTCGACAC	52	2744
1075063	N/A	N/A	9104	9119	TACGGAAGGCCAACTG	16	2745
1075095	N/A	N/A	10722	10737	CTTGAAAACAAGCCAC	63	2746
1075127	N/A	N/A	12934	12949	GCTAAATTATGCTATT	79	2747
1075159	N/A	N/A	16250	16265	CAAAAAATCACGGCAA	63	2748
1075191	N/A	N/A	19412	19427	ACGGGAAAGAAAGGCC	83	2749
1075223	N/A	N/A	23854	23869	GTTAAAAGTGAACCCA	19	2750
1075255	N/A	N/A	27113	27128	AAATATCCGTGTCCTC	16	2751
1075287	N/A	N/A	29808	29823	TATTACGGACAGAAGT	58	2752
1075319	N/A	N/A	31860	31875	TATAACAATCATCCTA	59	2753
1075351	N/A	N/A	33002	33017	AGATTAAAGCTCATTG	38	2754
1075383	N/A	N/A	35770	35785	AATTATTACCCTACTC	45	2755
1075415	N/A	N/A	38069	38084	CATTAAATGACAGCCT	52	2756
1075447	N/A	N/A	40272	40287	CACTATAAATCCTCAT	96	2757
1075479	N/A	N/A	42463	42478	GACAATAAATCTGCCT	77	2758
1075511	N/A	N/A	44708	44723	CAATATTATCTGAGCT	106	2759
1075543	N/A	N/A	46674	46689	ATATATTAGGAGTTTC	22	2760
1075575	N/A	N/A	48710	48725	TTACAACACAAGTCTA	55	2761
1075607	N/A	N/A	50539	50554	AAAACGGTGTGAAGAA	45	2762
1075639	N/A	N/A	52325	52340	AATTAACCAGAAGCCT	101	2763
1075671	N/A	N/A	54503	54518	GATATATATGATGGAC	37	2764
1075703	N/A	N/A	56609	56624	GGAGAAAGCCATCAAG	10	2765
1075735	N/A	N/A	59100	59115	GAATCGATGTGTTGCG	17	2766
1075767	N/A	N/A	61758	61773	TATTACACAGGCAGGC	12	2767
1075799	N/A	N/A	63412	63427	CCTCAACACATTTGAG	85	2768
1075831	N/A	N/A	66680	66695	TATTAGCCTTCTAACC	59	2769
1075863	N/A	N/A	70002	70017	CCTAATAACTTGTCTA	71	2770
1075895	N/A	N/A	72306	72321	ACTCGAAAGCTGGGCC	38	2771
1075927	N/A	N/A	75923	75938	GCTTAAAATCATGTAG	32	2772
1075959	N/A	N/A	79446	79461	GATTATTATTGCAGCT	15	2773
1075991	N/A	N/A	81533	81548	ATATAGGACCACGACT	62	2774
1076023	N/A	N/A	83094	83109	ATAATTAGATGCTGAC	4	2775
1076055	N/A	N/A	86186	86201	AATTACTAACAATCTC	45	2776
1076087	N/A	N/A	90082	90097	CAAACTAATAGGCCAT	10	2777
1076119	N/A	N/A	91742	91757	GTTAAATATGAATTGG	7	2778
1076151	N/A	N/A	92521	92536	TATTTATTAACTCACG	14	2779
1076183	N/A	N/A	94494	94509	CTTCTATAATTAGCCA	7	2780
1076215	N/A	N/A	97620	97635	TTATAACAGACTGGCT	47	2781
1076247	N/A	N/A	99297	99312	GACCAAAACAGCTCTT	11	2782
1076279	N/A	N/A	102645	102660	CAATAAGGACAGGACC	71	2783
1076311	N/A	N/A	104558	104573	TATAACCCTATACTTG	56	2784
1076343	N/A	N/A	107707	107722	AGACTAAATCTTCCCT	8	2785
1076375	N/A	N/A	111085	111100	TATAACGGATATACAA	22	2786
1076407	N/A	N/A	112462	112477	GTATTATTTAAGACCT	22	2787
1076439	N/A	N/A	115906	115921	CTTATATGGTTTTGTG	4	2788
1076471	N/A	N/A	118862	118877	CATTAGACTAGGCTTT	5	2789
1076503	N/A	N/A	121702	121717	AATTACCCCTGTGAGG	77	2790
1076535	N/A	N/A	83322	83337	ATTTTTAGCTCGCAAT	28	2791
1076567	N/A	N/A	59365	59380	GATTACAGTGACATTC	10	2792

TABLE 38
Inhibition of Yap1 mRNA by
3-10-3 cEt gapmers targeting SEQ ID NO.: 3
	SEQ ID	SEQ ID
	NO: 3	NO: 3
Compound	Start	Stop		YAP1	SEQ
Number	Site	Site	Sequence (5′ to 3′)	(% UTC)	ID NO
1074880	1246	1261	CTCCTGCCGAAGCAGT	101	2793
1074881	1250	1265	CTAACTCCTGCCGAAG	76	2794
1074882	1251	1266	GCTAACTCCTGCCGAA	73	2795
1074883	1252	1267	GGCTAACTCCTGCCGA	107	2796
1074884	1253	1268	GGGCTAACTCCTGCCG	110	2797
1074885	1254	1269	AGGGCTAACTCCTGCC	115	2798
1074886	1255	1270	CAGGGCTAACTCCTGC	104	2799

Example 5: Antisense Inhibition of Human Yap1 in SNU-449 Cells by Modified Oligonucleotides

Modified oligonucleotides with additional chemistry modifications were designed to target a Yap1 nucleic acid and were tested for their effect on Yap1 mRNA level in SNU-449 cells. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured SNU-449 cells at a density of 10,000 cells per well were treated using free uptake with 2,000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and Yap1 mRNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS36584 was used to measure mRNA levels. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). The modified oligonucleotides with percent control values marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides targeting the amplicon region.

Several different chemistry modifications were tested, which are specified in the Chemistry Notation column of the tables below, wherein the notation “d” refers to a 2′-deoxyribose sugar, the notation “s” refers to a phosphorothioate (P═S) internucleoside linkage, the notation “k” refers to a cEt modified sugar, the notation “y” refers to a 2′-O-methyl ribose sugar, the notation “e” refers to a MOE modified sugar, and the notation “^mC” refers to a 5-methylcytosine.

“Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either SEQ ID NO.: 1 or SEQ ID NO.: 2. ‘N/A’ indicates that the modified oligonucleotide does not target that particular gene sequence with 10000 complementarity. ‘N.D.’ indicates that the % UTC is not defined for that particular modified oligonucleotide in that particular experiment. Activity of the modified oligonucleotide may be defined in a different experiment.

TABLE 39
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop			YAP1	SEQ ID
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	CHEMISTRY NOTATION	(% UTC)	NO
715487	3630	3645	124655	124670	ATTACTTCATAGCTTA	AksTksTksAdsmCdsTdsTdsmCdsAds	12	52
						TdsAdsGdsmCdsTksTksAk
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTksAdsGdsAdsGdsTdsAdsTds	8	810
						GdsTdsGdsGksmCksAk
1074461	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAksAdsTdsTdsGdsTdsmCds	7	2800
						TdsmCdsAdsTdsGksmCksmCk
1095379	4443	4458	125468	125483	ACTGAGGTATAACTGG	AksmCdsTdsGdsAdsGdsGdsTdsAds	52	392
						TdsAdsAksmCesTksGesGk
1095397	4441	4456	125466	125481	TGAGGTATAACTGGGC	TksGdsAdsGdsGdsTdsAdsTdsAds	53	1580
						AdsmCdsTksGesGksGesmCk
1095398	4442	4457	125467	125482	CTGAGGTATAACTGGG	mCksTdsGdsAdsGdsGdsTdsAdsTds	38	2801
						AdsAdsmCksTesGksGesGk
1095399	4444	4459	125469	125484	CACTGAGGTATAACTG	mCksAdsmCdsTdsGdsAdsGdsGdsTds	46	2802
						AdsTdsAksAesmCksTesGk
1198370	2524	2539	123549	123564	TGTCTCATGCCTTATA	TksGdsTdsmCdsTdsmCdsAdsTdsGds	20	2803
						mCdsmCdsTksTesAksTesAk
1198371	2526	2541	123551	123566	ATTGTCTCATGCCTTA	AksTdsTdsGdsTdsmCdsTdsmCdsAds	15	2804
						TdsGdsmCksmCesTksTesAk
1198372	2527	2542	123552	123567	AATTGTCTCATGCCTT	AksAdsTdsTdsGdsTdsmcdsTdsmcds	21	2805
						AdsTdsGksmCesmCksTesTk
1198373	2528	2543	123553	123568	AAATTGTCTCATGCCT	AksAdsTdsTdsGdsTdsmcdsTdsmcds	40	443
						AdsTksGesmCksmCesTk
1198374	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAdsAdsAdsTdsTdsGdsTdsmcds	24	2800
						TdsmCdsAksTesGksmCesmCk
1198375	2530	2545	123555	123570	GGAAATTGTCTCATGC	GksGdsAdsAdsAdsTdsTdsGdsTdsmcds	22	2806
						TdsmCksAesTksGesmCk
1198376	2531	2546	123556	123571	TGGAAATTGTCTCATG	TksGdsGdsAdsAdsAdsTdsTdsGdsTds	36	2807
						mCdsTksmCesAksTesGk
1198377	2532	2547	123557	123572	ATGGAAATTGTCTCAT	AksTdsGdsGdsAdsAdsAdsTdsTds	30	2808
						GdsTdsmCksTesmCksAesTk
1198378	2534	2549	123559	123574	ATATGGAAATTGTCTC	AksTdsAdsTdsGdsGdsAdsAdsAds	39	656
						TdsTdsGksTesmCksTesmCk
1198379	2560	2575	123585	123600	AGTATGTGGCAATAAT	AksGdsTdsAdsTdsGdsTdsGdsGds	45	2809
						mCdsAdsAksTesAksAesTk
1198380	2562	2577	123587	123602	AGAGTATGTGGCAATA	AksGdsAdsGdsTdsAdsTdsGdsTds	18	2810
						GdsGdsmCksAesAksTesAk
1198381	2563	2578	123588	123603	TAGAGTATGTGGCAAT	TksAdsGdsAdsGdsTdsAdsTdsGdsTds	19	2811
						GdsGksmCesAksAesTk
1198382	2564	2579	123589	123604	TTAGAGTATGTGGCAA	TksTdsAdsGdsAdsGdsTdsAdsTdsGds	19	963
						TdsGksGesmCksAesAk
1198383	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTdsTdsAdsGdsAdsGdsTdsAdsTds	31	810
						GdsTksGesGksmCesAk
1198384	2566	2581	123591	123606	TATTAGAGTATGTGGC	TksAdsTdsTdsAdsGdsAdsGdsTdsAds	6	2812
						TdsGksTesGksGesmCk
1198385	2567	2582	123592	123607	ATATTAGAGTATGTGG	AksTdsAdsTdsTdsAdsGdsAdsGdsTds	30	2813
						AdsTksGesTksGesGk
1198386	2568	2583	123593	123608	TATATTAGAGTATGTG	TksAdsTdsAdsTdsTdsAdsGdsAdsGds	77	2814
						TdsAksTesGksTesGk
1198387	2570	2585	123595	123610	TCTATATTAGAGTATG	TksmCdsTdsAdsTdsTdsTdsAds	84	887
						GdsAdsGksTesAksTesGk
1198388	4436	4451	125461	125476	TATAACTGGGCAAATT	TksAdsTdsAdsAdsmCdsTdsGdsGds	90	2815
						GdsmCdsAksAesAksTesTk
1198389	4438	4453	125463	125478	GGTATAACTGGGCAAA	GksGdsTdsAdsTdsAdsAdsmCdsTds	28	1427
						GdsGdsGksmCesAksAesAk
1198390	4439	4454	125464	125479	AGGTATAACTGGGCAA	AksGdsGdsTdsAdsTdsAdsAdsmCds	37	905
						TdsGdsGksGesmCksAesAk
1198391	4440	4455	125465	125480	GAGGTATAACTGGGCA	GksAdsGdsGdsTdsAdsTdsAdsAds	29	1503
						mCdsTdsGksGesGksmCesAk
1198392	4446	4461	125471	125486	AACACTGAGGTATAAC	AksAdsmCdsAdsmCdsTdsGdsAdsGds	48	2816
						GdsTdsAksTesAksAesmCk
1198393	4595	4610	125620	125635	TTACATTAGGAACAAG	TksTdsAdsmCdsAdsTdsTdsAdsGds	58	2817
						GdsAdsAksmCesAksAesGk
1198394	4597	4612	125622	125637	TTTTACATTAGGAACA	TksTdsTdsTdsAdsmCdsAdsTdsTdsAds	63	2818
						GdsGdsGksAesAksmCesAk
1198395	4598	4613	125623	125638	CTTTTACATTAGGAAC	mCksTdsTdsTdsTdsAdsmCdsAdsTds	35	1124
						TdsAdsGksGesAksAesmCk
1198396	4599	4614	125624	125639	ACTTTTACATTAGGAA	AksmCdsTdsTdsTdsTdsAdsmCdsAdsAds	25	2819
						TdsTdsAksGesGksAesAk
1198397	4600	4615	125625	125640	CACTTTTACATTAGGA	mCksAdsmCdsTdsTdsTdsTdsAdsmCds	17	1200
						AdsTdsTksAesGksGesAk
1198398	4601	4616	125626	125641	GCACTTTTACATTAGG	GksmCdsAdsmCdsTdsTdsTdsTdsAds	18	1276
						mCdsAdsTksTesAksGesGk
1198399	4602	4617	125627	125642	AGCACTTTTACATTAG	AksGdsmCdsAdsmCdsTdsTdsTdsTds	35	2820
						AdsmCdsAksTesTksAesGk
1198400	4603	4618	125628	125643	AAGCACTTTTACATTA	AksAdsGdsmCdsAdsmCdsTdsTdsTds	62	2821
						TdsAdsmCksAesTksTesAk
1198401	4605	4620	125630	125645	TTAAGCACTTTTACAT	TksTdsAdsAdsGdsmCdsAdsmCdsTds	63	2822
						TdsTdsTksAesmCksAesTk
1198402	4795	4810	125820	125835	GGAAGATCTGAAACTC	GksGdsAdsAdsGdsAdsTdsmCdsTds	32	2823
						GdsAdsAksAesmCksTesmCk
1198403	4797	4812	125822	125837	TTGGAAGATCTGAAAC	TksTdsGdsGdsAdsAdsGdsAdsTds	54	2824
						mCdsTdsGksAesAksAesmCk
1198404	4798	4813	125823	125838	TTTGGAAGATCTGAAA	TksTdsTdsGdsGdsAdsAdsGdsAdsTds	55	2825
						mCdsTksGesAksAesAk
1198405	4799	4814	125824	125839	CTTTGGAAGATCTGAA	mCksTdsTdsTdsGdsGdsAdsAdsGdsAds	36	2826
						AdsTdsmCksTesGksAesAk
1198406	4800	4815	125825	125840	GCTTTGGAAGATCTGA	GksmCdsTdsTdsTdsGdsGdsAdsAds	17	2044
						GdsAdsTksmCesTksGesAk
1198407	4801	4816	125826	125841	TGCTTTGGAAGATCTG	TksGdsmCdsTdsTdsTdsGdsGdsAds	23	2121
						AdsGdsAksTesmCksTesGk
1198408	4802	4817	125827	125842	GTGCTTTGGAAGATCT	GksTdsGdsmCdsTdsTdsTdsGdsGds	41	2827
						AdsAdsGksAesTksmCesTk
1198409	4803	4818	125828	125843	AGTGCTTTGGAAGATC	AksGdsTdsGdsmCdsTdsTdsTdsGds	19	2828
						GdsAdsAksGesAksTesmCk
1198410	4805	4820	125830	125845	ATAGTGCTTTGGAAGA	AksTdsAdsGdsTdsGdsmCdsTdsTdsTds	48	2829
						GdsGksAesAksGesAk
1198411	N/A	N/A	94729	94744	AGGATGCATGGTTTTT	AksGdsGdsAdsTdsGdsmCdsAdsTds	33	2830
						GdsGdsTksTesTksTesTk
1198412	N/A	N/A	94731	94746	TTAGGATGCATGGTTT	TksTdsAdsGdsGdsAdsTdsGdsmCds	17	2831
						AdsTdsGksGesTksTesTk
1198413	N/A	N/A	94732	94747	TTTAGGATGCATGGTT	TksTdsTdsAdsGdsGdsAdsTdsGdsmCds	29	2832
						mCdsAdsTksGesGksTesTk
1198414	N/A	N/A	94733	94748	ATTTAGGATGCATGGT	AksTdsTdsTdsAdsGdsGdsAdsGds	20	2833
						mCdsAksTesGksGesTk
1198415	N/A	N/A	94734	94749	GATTTAGGATGCATGG	GksAdsTdsTdsTdsAdsGdsGdsAdsTds	29	2834
						GdsmCksAesTksGesGk
1198416	N/A	N/A	94735	94750	AGATTTAGGATGCATG	AksGdsAdsTdsTdsTdsAdsGdsGdsAds	29	2835
						TdsGksmCesAksTesGk
1198417	N/A	N/A	94736	94751	CAGATTTAGGATGCAT	mCksAdsGdsAdsTdsTdsTdsAdsGds	40	2836
						GdsAdsTksGesmCksAesTk
1198418	N/A	N/A	94737	94752	TCAGATTTAGGATGCA	TksmCdsAdsGdsAdsTdsTdsTdsAds	67	2837
						GdsGdsAdsTesGksmCesAk
1198419	N/A	N/A	94739	94754	ATTCAGATTTAGGATG	AksTdsTdsmCdsAdsGdsAdsTdsTdsTds	78	2838
						AdsAdsGksGesAksTesGk
1198420	N/A	N/A	115903	115918	ATATGGTTTTGTGTGT	AksTdsAdsTdsGdsGdsTdsTdsTdsTds	41	2839
						GdsTksGesTksGesTk
1198421	N/A	N/A	115905	115920	TTATATGGTTTTGTGT	TksTdsAdsTdsAdsTdsGdsGdsTdsTds	36	2840
						TdsTksGesTksGesTk
1198422	N/A	N/A	115906	115921	CTTATATGGTTTTGTG	mCksTdsTdsAdsTdsAdsTdsGdsGds	18	2788
						TdsTdsTksTesGksTesGk
1198423	N/A	N/A	115907	115922	TCTTATATGGTTTTGT	TksmCdsTdsTdsAdsTdsAdsTdsGds	10	2841
						GdsTdsTksTesTksGesTk
1198424	N/A	N/A	115908	115923	CTCTTATATGGTTTTG	mCksTdsmCdsTdsTdsAdsTdsAdsTds	15	2842
						GdsGdsTksTesTksTesGk
1198429	N/A	N/A	117325	117340	ATTGCAATCTGTCTGA	AksTdsTdsGdsmCdsAdsAdsTdsmCds	48	2843
						TdsGdsTksmCesTksGesAk
1198430	N/A	N/A	117327	117342	ATATTGCAATCTGTCT	AksTdsAdsTdsTdsGdsmCdsAdsAds	49	2844
						TdsmCdsTksGesTksmCesTk
1198431	N/A	N/A	117328	117343	AATATTGCAATCTGTC	AksAdsTdsAdsTdsTdsGdsmCdsAds	35	2845
						AdsTdsmCksTesGksTesmCk
1198432	N/A	N/A	117329	117344	TAATATTGCAATCTGT	TksAdsAdsTdsAdsTdsTdsGdsmCds	70	2846
						AdsAdsTksmCesTksGesTk
1198433	N/A	N/A	117330	117345	GTAATATTGCAATCTG	GksTdsAdsAdsTdsAdsTdsTdsGds	36	1404
						mCdsAdsAksTesmCksTesGk
1198434	N/A	N/A	117331	117346	TGTAATATTGCAATCT	TksGdsTdsAdsAdsTdsAdsTdsTdsGds	78	2847
						mCdsAksAesTksmCesTk
1198435	N/A	N/A	117332	117347	ATGTAATATTGCAATC	AksTdsGdsTdsAdsAdsTdsAdsTdsTds	57	2848
						GdsmCksAesAksTesmCk
1198436	N/A	N/A	117333	117348	TATGTAATATTGCAAT	TksAdsTdsGdsTdsAdsAdsTdsAdsTds	69	2849
						TdsGksmCesAksAesTk
1198437	N/A	N/A	117335	117350	TTTATGTAATATTGCA	TksTdsTdsAdsTdsGdsTdsAdsAdsTds	63	2850
						AdsTksTesGksmCesAk
1198447	N/A	N/A	119667	119682	TAAGGTTTCCCAGATT	TksAdsAdsGdsGdsTdsTdsTdsmCds	63	2851
						mCdsAksGesAksTesTk
1198448	N/A	N/A	119669	119684	AGTAAGGTTTCCCAGA	AksGdsTdsAdsAdsGdsGdsTdsTdsTds	36	2852
						mCdsmCksmCesAksGesAk
1198449	N/A	N/A	119670	119685	AAGTAAGGTTTCCCAG	AksAdsGdsTdsAdsAdsGdsGdsTds	37	2853
						TdsTdsmCksmCesmCksAesGk
1198450	N/A	N/A	119671	119686	TAAGTAAGGTTTCCCA	TksAdsAdsGdsTdsAdsAdsGdsGds	42	2854
						TdsTdsTksmCesmCksmCesAk
1198451	N/A	N/A	119672	119687	CTAAGTAAGGTTTCCC	mCksTdsAdsAdsGdsTdsAdsAdsGds	48	1101
						GdsTdsTksTesmCksmCesmCk
1198452	N/A	N/A	119673	119688	ACTAAGTAAGGTTTCC	AksmCdsTdsAdsAdsGdsTdsAdsAds	38	2855
						GdsGdsTksTesTksmCesmCk
1198453	N/A	N/A	119674	119689	GACTAAGTAAGGTTTC	GksAdsmCdsTdsAdsAdsGdsTdsAds	48	2856
						AdsGdsGksTesTksTesmCk
1198454	N/A	N/A	119675	119690	AGACTAAGTAAGGTTT	AksGdsAdsmCdsTdsAdsAdsGdsTds	39	2857
						AdsAdsGksGesTksTesTk
1198455	N/A	N/A	119677	119692	TTAGACTAAGTAAGGT	TksTdsAdsGdsAdsmCdsTdsAdsAds	42	2858
						GdsTdsAksAesGksGesTk

TABLE 40
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop			YAP1	SEQ ID
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	CHEMISTRY NOTATION	(% UTC)	NO
715487	3630	3645	124655	124670	ATTACTTCATAGCTTA	AksTksTksAdsmCdsTdsTdsmCdsAds	28	52
						TdsAdsGdsmCdsTksTksAk
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTksAdsGdsAdsGdsTdsAdsTds	15	810
						GdsTdsGdsGksmCksAk
1074461	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAksAdsTdsTdsGdsTdsmCds	9	2800
						TdsmCdsAdsTdsGksmCksmCk
1198425	N/A	N/A	115909	115924	ACTCTTATATGGTTTT	AksmCdsTdsmCdsTdsTdsAdsTdsAds	35	2859
						TdsGdsGksTesTksTesTk
1198426	N/A	N/A	115910	115925	AACTCTTATATGGTTT	AksAdsmCdsTdsmCdsTdsTdsAdsTds	111	2860
						AdsTdsGksGesTksTesTk
1198427	N/A	N/A	115911	115926	CAACTCTTATATGGTT	mCksAdsAdsmCdsTdsmCdsTdsTdsAds	62	2861
						TdsAdsTksGesGksTesTk
1198428	N/A	N/A	115913	115928	GACAACTCTTATATGG	GksAdsmCdsAdsAdsmCdsTdsmCdsTds	62	2862
						TdsAdsTksAesTksGesGk
1198438	N/A	N/A	117755	117770	TGTATGTCAGAAGAGT	TksGdsTdsAdsTdsGdsTdsmCdsAds	7	2863
						GdsAdsAksGesAksGesTk
1198439	N/A	N/A	117757	117772	AGTGTATGTCAGAAGA	AksGdsTdsGdsTdsAdsTdsGdsTdsmCds	6	2864
						AdsGksAesAksGesAk
1198440	N/A	N/A	117758	117773	AAGTGTATGTCAGAAG	AksAdsGdsTdsGdsTdsAdsTdsGdsTds	5	2865
						mCdsAksGesAksAesGk
1198441	N/A	N/A	117759	117774	AAAGTGTATGTCAGAA	AksAdsAdsGdsTdsGdsTdsAdsTdsGds	19	2866
						TdsmCksAesGksAesAk
1198442	N/A	N/A	117760	117775	TAAAGTGTATGTCAGA	TksAdsAdsAdsGdsTdsGdsTdsAdsTds	44	2867
						GdsTksmCesAksGesAk
1198443	N/A	N/A	117761	117776	TTAAAGTGTATGTCAG	TksTdsAdsAdsAdsGdsTdsGdsTdsAds	39	2868
						TdsGksTesmCksAesGk
1198444	N/A	N/A	117762	117777	TTTAAAGTGTATGTCA	TksTdsTdsAdsAdsAdsGdsTdsGdsTds	70	2869
						AdsTksGesTksmCesAk
1198445	N/A	N/A	117763	117778	CTTTAAAGTGTATGTC	mCksTdsTdsTdsAdsAdsAdsGdsTds	61	1634
						GdsTdsAksTesGksTesmCk
1198446	N/A	N/A	117765	117780	AACTTTAAAGTGTATG	AksAdsmCdsTdsTdsTdsAdsAdsAds	83	2870
						GdsTdsGksTesAksTesGk
1198714	2524	2539	123549	123564	TGTCTCATGCCTTATA	TksGesTksmCdsTdsmCdsAdsTdsGds	20	2803
						mCdsmCdsTdsTesAesTksAk
1198715	2526	2541	123551	123566	ATTGTCTCATGCCTTA	AksTesTksGdsTdsmCdsTdsmCdsAds	33	2804
						TdsGdsmCdsmCesTesTksAk
1198716	2527	2542	123552	123567	AATTGTCTCATGCCTT	AksAesTksTdsGdsTdsmCdsTdsmCds	27	2805
						AdsTdsGdsmCesmCesTksTk
1198717	2528	2543	123553	123568	AAATTGTCTCATGCCT	AksAesAksTdsTdsGdsTdsmCdsTds	41	443
						mCdsAdsTdsGesmCesmCksTk
1198718	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAesAksAdsTdsTdsGdsTdsmCdsTds	9	2800
						mCdsAdsTesGesmCksmCk
1198719	2530	2545	123555	123570	GGAAATTGTCTCATGC	GksGesAksAdsAdsTdsTdsGdsTdsmCds	14	2806
						TdsmCdsAesTesGksmCk
1198720	2531	2546	123556	123571	TGGAAATTGTCTCATG	TksGesGksAdsAdsAdsTdsTdsGdsTds	21	2807
						mCdsTdsmCesAesTksGk
1198721	2532	2547	123557	123572	ATGGAAATTGTCTCAT	AksTesGksGdsAdsAdsAdsTdsTdsGds	48	2808
						TdsmCdsTesmCesAksTk
1198722	2534	2549	123559	123574	ATATGGAAATTGTCTC	AksTesAksTdsGdsGdsAdsAdsAdsTds	48	656
						TdsGdsTesmCesTksmCk
1198723	2560	2575	123585	123600	AGTATGTGGCAATAAT	AksGesTksAdsTdsGdsTdsGdsGds	57	2809
						mCdsAdsAdsTesAesAksTk
1198724	2562	2577	123587	123602	AGAGTATGTGGCAATA	AksGesAksGdsTdsAdsTdsGdsTdsGds	16	2810
						GdsmCdsAesAesTksAk
1198725	2563	2578	123588	123603	TAGAGTATGTGGCAAT	TksAesGksAdsGdsTdsAdsTdsGdsTds	23	2811
						GdsGdsmCesAesAksTk
1198726	2564	2579	123589	123604	TTAGAGTATGTGGCAA	TksTesAksGdsAdsGdsTdsAdsTdsGds	28	963
						TdsGdsGesmCesAksAk
1198727	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTesTksAdsGdsAdsGdsTdsAdsTds	19	810
						GdsTdsGesGesmCksAk
1198728	2566	2581	123591	123606	TATTAGAGTATGTGGC	TksAesTksTdsAdsGdsAdsGdsTdsAds	17	2812
						TdsGdsTesGesGksmCk
1198729	2567	2582	123592	123607	ATATTAGAGTATGTGG	AksTesAksTdsTdsAdsGdsAdsGdsTds	21	2813
						AdsTdsGesTesGksGk
1198730	2568	2583	123593	123608	TATATTAGAGTATGTG	TksAesTksAdsTdsTdsAdsGdsAdsGds	57	2814
						TdsAdsTesGesTksGk
1198731	2570	2585	123595	123610	TCTATATTAGAGTATG	TksmCesTksAdsTdsAdsTdsTdsAdsGds	59	887
						AdsGdsTesAesTksGk
1198732	4436	4451	125461	125476	TATAACTGGGCAAATT	TksAesTksAdsAdsmCmsTdsGdsGds	86	2815
						GdsmCdsAdsAesAesTksTk
1198741	4595	4610	125620	125635	TTACATTAGGAACAAG	TksTesAksmCdsAdsTdsTdsAdsGds	60	2817
						GdsAdsAdsmCesAesAksGk
1198742	4597	4612	125622	125637	TTTTACATTAGGAACA	TksTesTksTdsAdsmCdsAdsTdsTdsAds	143	2818
						GdsGdsAesAesmCksAk
1198743	4598	4613	125623	125638	CTTTTACATTAGGAAC	mCksTesTksTdsTdsAdsmCdsAdsTds	86	1124
						TdsAdsGdsGesAesAksmCk
1198744	4599	4614	125624	125639	ACTTTTACATTAGGAA	AksmCesTksTdsTdsTdsAdsmCdsAds	66	2819
						TdsTdsAdsGesGesAksAk
1198745	4600	4615	125625	125640	CACTTTTACATTAGGA	mCksAesmCksTdsTdsTdsTdsAdsmCds	57	1200
						AdsTdsTdsAesGesGksAk
1198746	4601	4616	125626	125641	GCACTTTTACATTAGG	GksmCesAksmCdsTdsTdsTdsTdsAds	7	1276
						mCdsAdsTdsTesAesGksGk
1198747	4602	4617	125627	125642	AGCACTTTTACATTAG	AksGesmCksAdsmCdsTdsTdsTdsTds	38	2820
						AdsmCdsAdsTesTesAksGk
1198748	4603	4618	125628	125643	AAGCACTTTTACATTA	AksAesGksmCdsAdsmCdsTdsTdsTds	81	2821
						TdsAdsmCdsAesTesTksAk
1198749	4605	4620	125630	125645	TTAAGCACTTTTACAT	TksTesAksAdsGdsmCdsAdsmCdsTds	73	2822
						TdsTdsTdsAesmCesAksTk
1198750	4795	4810	125820	125835	GGAAGATCTGAAACTC	GksGesAksAdsGdsAdsTdsmCdsTds	32	2823
						GdsAdsAdsAesmCesTksmCk
1198751	4797	4812	125822	125837	TTGGAAGATCTGAAAC	TksTesGksGdsAdsAdsGdsAdsTdsmCds	76	2824
						TdsGdsAesAesAksmCk
1198752	4798	4813	125823	125838	TTTGGAAGATCTGAAA	TksTesTksGdsGdsAdsAdsGdsAdsTds	111	2825
						mCdsTdsGesAesAksAk
1198753	4799	4814	125824	125839	CTTTGGAAGATCTGAA	mCksTesTksTdsGdsGdsAdsAdsGds	58	2826
						GdsTdsmCdsTesGesAksAk
1198754	4800	4815	125825	125840	GCTTTGGAAGATCTGA	GksmCesTksTdsTdsGdsGdsAdsAds	23	2044
						GdsAdsTdsmCesTesGksAk
1198755	4801	4816	125826	125841	TGCTTTGGAAGATCTG	TksGesmCksTdsTdsGdsGdsAds	32	2121
						AdsGdsAdsTesmCesTksGk
1198756	4802	4817	125827	125842	GTGCTTTGGAAGATCT	GksTesGksmCdsTdsTdsTdsGdsGds	50	2827
						AdsAdsGdsAesTesmCksTk
1198757	4803	4818	125828	125843	AGTGCTTTGGAAGATC	AksGesTksGdsmCdsTdsTdsTdsGds	40	2828
						GdsAdsAdsGesAesTksmCk
1198758	4805	4820	125830	125845	ATAGTGCTTTGGAAGA	AksTesAksGdsTdsGdsmCdsTdsTds	47	2829
						TdsGdsGdsAesAesGksAk
1198759	N/A	N/A	94729	94744	AGGATGCATGGTTTTT	AksGesGksAdsTdsGdsmCdsAdsTds	27	2830
						GdsGdsTdsTesTesTksTk
1198760	N/A	N/A	94731	94746	TTAGGATGCATGGTTT	TksTesAksGdsGdsAdsTdsGdsmCds	91	2831
						AdsTdsGdsGesTesTksTk
1198761	N/A	N/A	94732	94747	TTTAGGATGCATGGTT	TksTesTksAdsGdsGdsAdsTdsGdsmCds	42	2832
						AdsTdsGesGesTksTk
1198762	N/A	N/A	94733	94748	ATTTAGGATGCATGGT	AksTesTksTdsAdsGdsGdsAdsTdsGds	30	2833
						mCdsAdsTesGesGksTk
1198763	N/A	N/A	94734	94749	GATTTAGGATGCATGG	GksAesTksTdsTdsAdsGdsGdsAdsTds	26	2834
						GdsmCdsAesTesGksGk
1198764	N/A	N/A	94735	94750	AGATTTAGGATGCATG	AksGesAksTdsTdsTdsAdsGdsGdsAds	28	2835
						TdsGdsmCesAesTksGk
1198765	N/A	N/A	94736	94751	CAGATTTAGGATGCAT	mCksAesGksAdsTdsTdsTdsAdsGds	23	2836
						GdsAdsTdsGesmCesAksTk
1198766	N/A	N/A	94737	94752	TCAGATTTAGGATGCA	TksmCesAksGdsAdsTdsTdsTdsAds	19	2837
						GdsGdsAdsTesGesmCksAk
1198767	N/A	N/A	94739	94754	ATTCAGATTTAGGATG	AksTksmC TesdsAdsGdsAdsTdsTds	65	2838
						TdsAdsGdsGesAesTksGk
1198777	N/A	N/A	117325	117340	ATTGCAATCTGTCTGA	AksTesTksGdsmCdsAdsAdsTdsmCds	84	2843
						TdsGdsTdsmCesTesGksAk
1198778	N/A	N/A	117327	117342	ATATTGCAATCTGTCT	AksTesAksTdsTdsGdsmCdsAdsAds	55	2844
						TdsmCdsTdsGesTesmCksTk
1198779	N/A	N/A	117328	117343	AATATTGCAATCTGTC	AksAesTksAdsTdsTdsGdsmCdsAds	49	2845
						AdsTdsmCdsTesGesTksmCk
1198780	N/A	N/A	117329	117344	TAATATTGCAATCTGT	TksAesAksTdsAdsTdsTdsGdsmCds	80	2846
						AdsAdsTdsmCesTesGksTk
1198781	N/A	N/A	117330	117345	GTAATATTGCAATCTG	GksTesAksAdsTdsAdsTdsTdsGdsmCds	25	1404
						AdsAdsTesmCesTksGk
1198782	N/A	N/A	117331	117346	TGTAATATTGCAATCT	TksGesTksAdsAdsTdsAdsTdsTdsGds	61	2847
						mCdsAdsAesTesmCksTk
1198783	N/A	N/A	117332	117347	ATGTAATATTGCAATC	AksTesGksTdsAdsAdsTdsAdsTdsTds	78	2848
						GdsmCdsAesAesTksmCk
1198784	N/A	N/A	117333	117348	TATGTAATATTGCAAT	TksAesTksGdsTdsAdsAdsTdsAdsTds	94	2849
						TdsGdsmCesAesAksTk
1198785	N/A	N/A	117335	117350	TTTATGTAATATTGCA	TksTesTksAdsTdsGdsTdsAdsAdsTds	86	2850
						AdsTdsTesGesmCksAk
1198795	N/A	N/A	119667	119682	TAAGGTTTCCCAGATT	TksAesAksGdsGdsTdsTdsTdsmCds	43	2851
						mCdsmCdsAdsGesAesTksTk
1198796	N/A	N/A	119669	119684	AGTAAGGTTTCCCAGA	AksGesTksAdsAdsGdsGdsTdsTdsTds	32	2852
						mCdsmCdsmCesAesGksAk
1198797	N/A	N/A	119670	119685	AAGTAAGGTTTCCCAG	AksAesGksTdsAdsAdsGdsGdsTdsTds	31	2853
						TdsmCdsmCesmCesAksGk
1198798	N/A	N/A	119671	119686	TAAGTAAGGTTTCCCA	TksAesAksGdsTdsAdsAdsGdsGdsTds	38	2854
						TdsTdsmCesmCesmCksAk
1198799	N/A	N/A	119672	119687	CTAAGTAAGGTTTCCC	mCksTesAksAdsGdsTdsAdsAdsGds	18	1101
						GdsTdsTdsTesmCesmCksmCk
1198800	N/A	N/A	119673	119688	ACTAAGTAAGGTTTCC	AksmCesTksAdsAdsGdsTdsAdsAds	47	2855
						GdsGdsTdsTesTesmCksmCk
1198801	N/A	N/A	119674	119689	GACTAAGTAAGGTTTC	GksAesmCksTdsAdsAdsGdsTdsAds	47	2856
						AdsGdsGdsTesTesTksmCk
1198802	N/A	N/A	119675	119690	AGACTAAGTAAGGTTT	AksGesAksmCdsTdsAdsAdsGdsTds	83	2857
						AdsAdsGdsGesTesTksTk
1198803	N/A	N/A	119677	119692	TTAGACTAAGTAAGGT	TksTesAksGdsAdsmCdsTdsAdsAdsGds	62	2858
						TdsAdsAesGesGksTk

TABLE 41
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop			YAP1	SEQ ID
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	CHEMISTRY NOTATION	(% UTC)	NO
715487	3630	3645	124655	124670	ATTACTTCATAGCTTA	AksTksTksAdsmCdsTdsTdsmCdsAds	28	52
						TdsAdsGdsmCdsTksTksAk
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTksAdsGdsAdsGdsTdsAdsTds	14	810
						GdsTdsGdsGksmCksAk
1074461	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAksAdsTdsTdsGdsTdsmCdsTds	12	2800
						mCdsAdsTdsGksmCksmCk
1198628	2524	2539	123549	123564	TGTCTCATGCCTTATA	TksGksTdsmCdsTdsmCdsAdsTdsGds	27	2803
						mCdsmCdsTdsTksAesTksAe
1198629	2526	2541	123551	123566	ATTGTCTCATGCCTTA	AksTksTdsGdsTdsmCdsTdsmCdsAds	22	2804
						TdsGdsmCdsmCksTesTksAe
1198630	2527	2542	123552	123567	AATTGTCTCATGCCTT	AksAksTdsTdsGdsTdsmCdsTdsmCds	37	2805
						AdsTdsGdsmCksmCesTksTe
1198631	2528	2543	123553	123568	AAATTGTCTCATGCCT	AksAksAdsTdsTdsGdsTdsmCdsTds	53	443
						mCdsAdsTdsGksmCesmCksTe
1198632	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAdsAdsTdsTdsGdsTdsmCds	21	2800
						TdsmCdsAdsTksGesmCksmCe
1198633	2530	2545	123555	123570	GGAAATTGTCTCATGC	GksGksAdsAdsAdsTdsTdsGdsTds	46	2806
						mCdsTdsmCdsAksTesGksmCe
1198634	2531	2546	123556	123571	TGGAAATTGTCTCATG	TksGksGdsAdsAdsAdsTdsTdsGdsTds	34	2807
						mCdsTdsmCksAesTksGe
1198635	2532	2547	123557	123572	ATGGAAATTGTCTCAT	AksTksGdsGdsAdsAdsAdsTdsTdsGds	57	2808
						TdsmCdsTksmCesAksTe
1198636	2534	2549	123559	123574	ATATGGAAATTGTCTC	AksTksAdsTdsGdsGdsAdsAdsAdsTds	41	656
						TdsGdsTksmCesTksmCe
1198637	2560	2575	123585	123600	AGTATGTGGCAATAAT	AksGksTdsAdsTdsGdsTdsGdsGds	64	2809
						mCdsAdsAdsTksAesAksTe
1198638	2562	2577	123587	123602	AGAGTATGTGGCAATA	AksGksAdsGdsTdsAdsTdsGdsTdsGds	18	2810
						GdsmCdsAksAesTksAe
1198639	2563	2578	123588	123603	TAGAGTATGTGGCAAT	TksAksGdsAdsGdsTdsAdsTdsGdsTds	32	2811
						GdsGdsmCksAesAksTe
1198640	2564	2579	123589	123604	TTAGAGTATGTGGCAA	TksTksAdsGdsAdsGdsTdsAdsTdsGds	26	963
						TdsGdsGksmCesAksAe
1198641	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTdsAdsGdsAdsGdsTdsAdsTds	15	810
						GdsTdsGksGesmCksAe
1198642	2566	2581	123591	123606	TATTAGAGTATGTGGC	TksAksTdsTdsAdsGdsAdsGdsTdsAds	19	2812
						TdsGdsTksGesGksmCe
1198643	2567	2582	123592	123607	ATATTAGAGTATGTGG	AksTksAdsTdsTdsAdsGdsAdsGdsTds	25	2813
						AdsTdsGksTesGksGe
1198644	2568	2583	123593	123608	TATATTAGAGTATGTG	TksAksTdsAdsTdsTdsAdsGdsAdsGds	73	2814
						TdsAdsTksGesTksGe
1198645	2570	2585	123595	123610	TCTATATTAGAGTATG	TksmCksTdsAdsTdsAdsTdsTdsAdsGds	73	887
						AdsGdsTksAesTksGe
1198651	4595	4610	125620	125635	TTACATTAGGAACAAG	TksTksAdsmCdsAdsTdsTdsAdsGdsGds	94	2817
						AdsAdsmCksAesAksGe
1198652	4597	4612	125622	125637	TTTTACATTAGGAACA	TksTksTdsTdsAdsmCdsAddsTdsTds	68	2818
						AdsGdsGdsAksAesmCksAe
1198653	4598	4613	125623	125638	CTTTTACATTAGGAAC	mCksTksTdsTdsTdsAdsmCdsAdsTds	64	1124
						TdsAdsGdsGksAesAksmCe
1198654	4599	4614	125624	125639	ACTTTTACATTAGGAA	AksmCksTdsTdsTdsTdsAdsmCdsAds	91	2819
						TdsTdsAdsGksGesAksAe
1198655	4600	4615	125625	125640	CACTTTTACATTAGGA	mCksAksmCdsTdsTdsTdsTdsAdsmCds	30	1200
						AdsTdsTdsAksGesGksAe
1198656	4601	4616	125626	125641	GCACTTTTACATTAGG	GksmCksAdsmCdsTdsTdsTdsTdsAds	11	1276
						mCdsAdsTdsTksAesGksGe
1198657	4602	4617	125627	125642	AGCACTTTTACATTAG	AksGksmCdsAdsmCdsTdsTdsTdsTds	95	2820
						AdsmCdsAdsTksTesAksGe
1198658	4603	4618	125628	125643	AAGCACTTTTACATTA	AksAksGdsmCdsAdsmCdsTdsTdsTds	62	2821
						TdsAdsmCdsAksTesTksAe
1198659	4605	4620	125630	125645	TTAAGCACTTTTACAT	TksTksAdsAdsGdsmCdsAdsmCdsTds	58	2822
						TdsTdsTdsAksmCesAksTe
1198660	4795	4810	125820	125835	GGAAGATCTGAAACTC	GksGksAdsAdsGdsAdsTdsmCdsTds	66	2823
						GdsAdsAdsAksmCesTksmCe
1198661	4797	4812	125822	125837	TTGGAAGATCTGAAAC	TksTksGdsGdsAdsAdsGdsAdsTds	111	2824
						mCdsTdsGdsAksAesAksmCe
1198662	4798	4813	125823	125838	TTTGGAAGATCTGAAA	TksTksTdsGdsGdsAdsAdsGdsAdsTds	83	2825
						mCdsTdsGksAesAksAe
1198663	4799	4814	125824	125839	CTTTGGAAGATCTGAA	mCksTksTdsTdsGdsGdsAdsAdsGds	76	2826
						AdsTdsmCdsTksGesAksAe
1198664	4800	4815	125825	125840	GCTTTGGAAGATCTGA	GksmCksTdsTdsTdsGdsGdsAdsAds	18	2044
						GdsAdsTdsmCksTesGksAe
1198665	4801	4816	125826	125841	TGCTTTGGAAGATCTG	TksGksmCdsTdsTdsTdsGdsGdsAdsAds	38	2121
						GdsAdsTksmCesTksGe
1198666	4802	4817	125827	125842	GTGCTTTGGAAGATCT	GksTksGdsmCdsTdsTdsTdsGdsGdsAds	44	2827
						AdsGdsAksTesmCksTe
1198667	4803	4818	125828	125843	AGTGCTTTGGAAGATC	AksGksTdsGdsmCdsTdsTdsTdsGdsGds	40	2828
						AdsAdsGksAesTksmCe
1198668	4805	4820	125830	125845	ATAGTGCTTTGGAAGA	AksTksAdsGdsTdsGdsmCdsTdsTdsTds	72	2829
						GdsGdsAksAesGksAe
1198669	N/A	N/A	94729	94744	AGGATGCATGGTTTTT	AksGksGdsAdsTdsGdsmCdsAdsTds	61	2830
						GdsGdsTdsTksTesTksTe
1198670	N/A	N/A	94731	94746	TTAGGATGCATGGTTT	TksTksAdsGdsGdsAdsTdsGdsmCds	55	2831
						AdsTdsGdsGksTesTksTe
1198671	N/A	N/A	94732	94747	TTTAGGATGCATGGTT	TksTksTdsAdsGdsGdsAdsTdsGdsmCds	26	2832
						AdsTdsGksGesTksTe
1198672	N/A	N/A	94733	94748	ATTTAGGATGCATGGT	AksTksTdsTdsAdsGdsGdsAdsTdsGds	41	2833
						mCdsAdsTksGesGksTe
1198673	N/A	N/A	94734	94749	GATTTAGGATGCATGG	GksAksTdsTdsTdsAdsGdsGdsAdsTds	10	2834
						GdsmCdsAksTesGksGe
1198674	N/A	N/A	94735	94750	AGATTTAGGATGCATG	AksGksAdsTdsTdsTdsAdsGdsGdsAds	21	2835
						TdsGdsmCksAesTksGe
1198675	N/A	N/A	94736	94751	CAGATTTAGGATGCAT	mCksAksGdsAdsTdsTdsTdsAdsGds	35	2836
						GdsAdsTdsGksmCesAksTe
1198676	N/A	N/A	94737	94752	TCAGATTTAGGATGCA	TksmCksAdsGdsAdsTdsTdsTdsAdsGds	52	2837
						GdsAdsTksGesmCksAe
1198677	N/A	N/A	94739	94754	ATTCAGATTTAGGATG	AksTksTdsmCdsAdsGdsAdsTdsTdsTds	87	2838
						AdsGdsGksAesTksGe
1198687	N/A	N/A	117325	117340	ATTGCAATCTGTCTGA	AksTksTdsGdsmCdsAdsAdsTdsmCds	55	2843
						TdsGdsTdsmCksTesGksAe
1198688	N/A	N/A	117327	117342	ATATTGCAATCTGTCT	AksTksAdsTdsTdsGdsmCdsAdsAds	48	2844
						TdsmCdsTdsGksTesmCksTe
1198689	N/A	N/A	117328	117343	AATATTGCAATCTGTC	AksAksTdsAdsTdsTdsGdsmCdsAds	91	2845
						AdsTdsmCdsTksGesTksmCe
1198690	N/A	N/A	117329	117344	TAATATTGCAATCTGT	TksAksAdsTdsAdsTdsTdsGdsmCdsAds	64	2846
						AdsTdsmCksTesGksTe
1198691	N/A	N/A	117330	117345	GTAATATTGCAATCTG	GksTksAdsAdsTdsAdsTdsTdsGdsmCds	38	1404
						AdsAdsTksmCesTksGe
1198692	N/A	N/A	117331	117346	TGTAATATTGCAATCT	TksGksTdsAdsAdsTdsAdsTdsTdsGds	120	2847
						mCdsAdsAksTesmCksTe
1198733	4438	4453	125463	125478	GGTATAACTGGGCAAA	GksGesTksAdsTdsAdsAdsmCdsTds	47	1427
						GdsGdsGdsmCesAesAksAk
1198734	4439	4454	125464	125479	AGGTATAACTGGGCAA	AksGesGksTdsAdsTdsAdsAdsmCds	29	905
						TdsGdsGdsGesmCesAksAk
1198735	4440	4455	125465	125480	GAGGTATAACTGGGCA	GksAesGksGdsTdsAdsTdsAdsAds	34	1503
						mCdsTdsGdsGesGesmCksAk
1198736	4441	4456	125466	125481	TGAGGTATAACTGGGC	TksGesAksGdsGdsTdsAdsTdsAdsAds	20	1580
						mCdsTdsGesGesGksmCk
1198737	4442	4457	125467	125482	CTGAGGTATAACTGGG	mCksTesGksAdsGdsGdsTdsAdsTds	24	2801
						AdsAdsmCdsTesGesGksGk
1198738	4443	4458	125468	125483	ACTGAGGTATAACTGG	AksmCesTksGdsAdsGdsGdsTdsAds	38	392
						TdsAdsAdsmCesTesGksGk
1198739	4444	4459	125469	125484	CACTGAGGTATAACTG	mCksAesmCksTdsGdsAdsGdsGdsTds	94	2802
						AdsTdsAdsAesmCesTksGk
1198740	4446	4461	125471	125486	AACACTGAGGTATAAC	AksAesmCksAdsmCdsTdsGdsAdsGds	39	2816
						GdsTdsAdsTesAesAksmCk
1198768	N/A	N/A	115903	115918	ATATGGTTTTGTGTGT	AksTesAksTdsGdsGdsTdsTdsTdsTds	61	2839
						GdsTdsGesTesGksTk
1198769	N/A	N/A	115905	115920	TTATATGGTTTTGTGT	TksTesAksTdsAdsTdsGdsGdsTdsTds	77	2840
						TdsTdsGesTesGksTk
1198770	N/A	N/A	115906	115921	CTTATATGGTTTTGTG	mCksTesTksAdsTdsAdsTdsGdsGds	40	2788
						TdsTdsTdsTesGesTksGk
1198771	N/A	N/A	115907	115922	TCTTATATGGTTTTGT	TksmCesTksTdsAdsTdsAdsTdsGds	85	2841
						GdsTdsTdsTesTesGksTk
1198772	N/A	N/A	115908	115923	CTCTTATATGGTTTTG	mCksTesmCksTdsTdsAdsTdsAdsTds	41	2842
						GdsGdsTdsTesTesTksGk
1198773	N/A	N/A	115909	115924	ACTCTTATATGGTTTT	AksmCesTksmCdsTdsTdsAdsTdsAds	58	2859
						TdsGdsGdsTesTesTksTk
1198774	N/A	N/A	115910	115925	AACTCTTATATGGTTT	AksAesmCdsTdsmCdsTdsTdsAdsTds	106	2860
						AdsTdsGdsGesTesTksTk
1198775	N/A	N/A	115911	115926	CAACTCTTATATGGTT	mCksAesAksmCdsTdsmCdsTdsTds	113	2861
						AdsTdsAdsTdsGesGesTksTk
1198776	N/A	N/A	115913	115928	GACAACTCTTATATGG	GksAesmCksAdsAdsmCdsTdsmCds	57	2862
						TdsTdsAdsTdsAesTesGksGk
1198786	N/A	N/A	117755	117770	TGTATGTCAGAAGAGT	TksGesTksAdsTdsGdsTdsmCdsAds	16	2863
						AdsAdsGesAesGksTk
1198787	N/A	N/A	117757	117772	AGTGTATGTCAGAAGA	AksGesTksGdsTdsAdsTdsGdsTdsmCds	9	2864
						AdsGdsAesAesGksAk
1198788	N/A	N/A	117758	117773	AAGTGTATGTCAGAAG	AksAesGksTdsGdsTdsAdsTdsGdsTds	17	2865
						mCdsAdsGesAesAksGk
1198789	N/A	N/A	117759	117774	AAAGTGTATGTCAGAA	AksAesAksGdsTdsGdsTdsAdsTdsGds	22	2866
						TdsmCdsAesGesAksAk
1198790	N/A	N/A	117760	117775	TAAAGTGTATGTCAGA	TksAesAksGdsTdsGdsTdsAdsTdsGds	27	2867
						GdsTdsmCesAesGksAk
1198791	N/A	N/A	117761	117776	TTAAAGTGTATGTCAG	TksTesAksAdsAdsGdsTdsGdsTdsAds	39	2868
						TdsGdsTesmCesAksGk
1198792	N/A	N/A	117762	117777	TTTAAAGTGTATGTCA	TksTesTksAdsAdsAdsGdsTksGdsTds	48	2869
						AdsTdsGesTesmCksAk
1198793	N/A	N/A	117763	117778	CTTTAAAGTGTATGTC	mCksTesTksTdsAdsAdsGdsTdsGdsAds	34	1634
						GdsTdsAdsTesGesTksmCk
1198794	N/A	N/A	117765	117780	AACTTTAAAGTGTATG	AksAesmcksTdsTdsAdsAdsAdsGds	74	2870
						TdsGdsTesAesTksGk

TABLE 42
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop			YAP1	SEQ ID
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	CHEMISTRY NOTATION	(% UTC)	NO
715487	3630	3645	124655	124670	ATTACTTCATAGCTTA	AksTksTksAdsmCdsTdsTdsmCdsAds	29	52
						TdsAdsGdsmCdsTksTksAk
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTksAdsGdsAdsGdsTdsAdsTds	15	810
						GdsTdsGdsGksmCksAk
1074461	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAksAdsTdsTdsGdsTdsmCdsTds	11	2800
						mCdsAdsTdsGksmCksmCk
1095463	4443	4458	125468	125483	ACTGAGGTATAACTGG	AksmCksTdsGdsAdsGdsGdsTdsAds	37	392
						TdsAdsAdsmCksTesGksGe
1095481	4441	4456	125466	125481	TGAGGTATAACTGGGC	TksGksAdsGdsGdsTdsAdsTdsAdsAds	21	1580
						mCdsTdsGksGesGksmCe
1095482	4442	4457	125467	125482	CTGAGGTATAACTGGG	mCksTksGdsAdsGdsGdsTdsAdsTds	72	2801
						AdsAdsmCdsTksGesGksGe
1095483	4444	4459	125469	125484	CACTGAGGTATAACTG	mCksAksmCdsTdsGdsAdsGdsGdsTds	101	2802
						AdsTdsAdsAksmCesTksGe
1198198	2524	2539	123549	123564	TGTCTCATGCCTTATA	TksGksTdsmCdsTdsmCdsAdsTdsGds	29	2803
						mCdsmCdsTesTesAesTksAk
1198199	2526	2541	123551	123566	ATTGTCTCATGCCTTA	AksTksTdsGdsTdsmCdsTdsmCdsAds	38	2804
						TdsGdsmCesmCesTesTksAk
1198200	2527	2542	123552	123567	AATTGTCTCATGCCTT	AksAksTdsTdsGdsTdsmCdsTdsmCds	49	2805
						AdsTdsGesmCesmCesTksTk
1198201	2528	2543	123553	123568	AAATTGTCTCATGCCT	AksAksAdsTdsGdsTdsmCdsTds	34	443
						mCdsAdsTesGesmCesmCksTk
1198202	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAdsAdsTdsTdsGdsTdsmCds	14	2800
						TdsmCdsAesTesGesmCksmCk
1198203	2530	2545	123555	123570	GGAAATTGTCTCATGC	GksGksAdsAdsAdsTdsTdsGdsTds	19	2806
						mCdsTdsmCesAesTesGksmCk
1198204	2531	2546	123556	123571	TGGAAATTGTCTCATG	TksGksGdsAdsAdsAdsTdsTdsGdsTds	31	2807
						mCdsTesmCesAesTksGk
1198205	2532	2547	123557	123572	ATGGAAATTGTCTCAT	AksTksGdsGdsAdsAdsAdsTdsTdsGds	64	2808
						TdsmCesTesmCesAksTk
1198206	2534	2549	123559	123574	ATATGGAAATTGTCTC	AksTksAdsTdsGdsGdsAdsAdsAdsTds	43	656
						TdsGesTesmCesTksmCk
1198207	2560	2575	123585	123600	AGTATGTGGCAATAAT	AksGksTdsAdsTdsGdsTdsGdsGds	91	2809
						mCdsAdsAesTesAesAksTk
1198208	2562	2577	123587	123602	AGAGTATGTGGCAATA	AksGksAdsGdsTdsAdsTdsGdsTdsGds	25	2810
						GdsmCesAesAesTksAk
1198209	2563	2578	123588	123603	TAGAGTATGTGGCAAT	TksAksGdsAdsGdsTdsAdsTdsGdsTds	45	2811
						GdsGesmCesAesAksTk
1198210	2564	2579	123589	123604	TTAGAGTATGTGGCAA	TksTksAdsGdsAdsGdsTdsAdsTdsGds	28	963
						TdsGesGesmCesAksAk
1198211	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTdsAdsGdsAdsGdsTdsAdsTds	19	810
						GdsTesGesGesmCksAk
1198212	2566	2581	123591	123606	TATTAGAGTATGTGGC	TksAksTdsTdsAdsGdsAdsGdsTdsAds	17	2812
						TdsGesTesGesGksmCk
1198213	2567	2582	123592	123607	ATATTAGAGTATGTGG	AksTksAdsTdsTdsAdsGdsAdsGdsTds	16	2813
						AdsTesGesTesGksGk
1198214	2568	2583	123593	123608	TATATTAGAGTATGTG	TksAksTdsAdsTdsTdsAdsGdsAdsGds	91	2814
						TdsAesTesGesTksGk
1198215	2570	2585	123595	123610	TCTATATTAGAGTATG	TksmCksTdsAdsTdsAdsTdsTdsAdsGds	120	887
						AdsGesTesAesTksGk
1198221	4595	4610	125620	125635	TTACATTAGGAACAAG	TksTksAdsmCdsAdsTdsTdsAdsGds	95	2817
						GdsAdsAesmCesAesAksGk
1198222	4597	4612	125622	125637	TTTTACATTAGGAACA	TksTksTdsTdsAdsmCdsAdsTdsTds	87	2818
						AdsGdsGesAesAesmCksAk
1198223	4598	4613	125623	125638	CTTTTACATTAGGAAC	mCksTksTdsTdsTdsAdsmCdsAdsTds	94	1124
						TdsAdsGesGesAesAksmCk
1198224	4599	4614	125624	125639	ACTTTTACATTAGGAA	AksmCksTdsTdsTdsTdsAdsmCdsAds	74	2819
						TdsTdsAesGesGesAksAk
1198225	4600	4615	125625	125640	CACTTTTACATTAGGA	mCksAksmCdsTdsTdsTdsTdsAdsmCds	67	1200
						AdsTdsTesAesGesGksAk
1198226	4601	4616	125626	125641	GCACTTTTACATTAGG	GksmCksAdsmCdsTdsTdsTdsTdsAds	23	1276
						mCdsAdsTesTesAesGksGk
1198227	4602	4617	125627	125642	AGCACTTTTACATTAG	AksGksmCdsAdsmCdsTdsTdsTdsTds	104	2820
						AdsmCdsAesTesTesAksGk
1198228	4603	4618	125628	125643	AAGCACTTTTACATTA	AksAksGdsmCdsAdsmCdsTdsTdsTdsTds	54	2821
						TdsAdsmCesAesTesTksAk
1198229	4605	4620	125630	125645	TTAAGCACTTTTACAT	TksTksAdsAdsGdsmCdsAdsmCdsTds	80	2822
						TdsTdsTesAesmCesAksTk
1198230	4795	4810	125820	125835	GGAAGATCTGAAACTCG	GksGksAdsAdsGdsAdsTdsmCdsTds	81	2823
						GdsAdsAesAesmCesTksk
1198231	4797	4812	125822	125837	TTGGAAGATCTGAAAC	TksTksGdsGdsAdsAdsGdsAdsTds	73	2824
						mCdsTdsGesAesAesAksmCk
1198232	4798	4813	125823	125838	TTTGGAAGATCTGAAA	TksTksTdsGdsGdsAdsAdsGdsAds	92	2825
						TdsmCdsTesGesAesAksAk
1198233	4799	4814	125824	125839	CTTTGGAAGATCTGAA	mCksTksTdsTdsGdsGdsAdsAdsGds	49	2826
						AdsTdsmCesTesGesAksAk
1198234	4800	4815	125825	125840	GCTTTGGAAGATCTGA	GksmCksTdsTdsTdsGdsGdsAdsAds	45	2044
						GdsAdsTesmCesTesGksAk
1198235	4801	4816	125826	125841	TGCTTTGGAAGATCTG	TksGksmCdsTdsTdsTdsGdsGdsAdsAds	49	2121
						GdsAesTesmCesTksGk
1198236	4802	4817	125827	125842	GTGCTTTGGAAGATCT	GksTksGdsmCdsTdsTdsTdsGdsGds	24	2827
						AdsAdsGesAesTesmCksTk
1198237	4803	4818	125828	125843	AGTGCTTTGGAAGATC	AksGksTksGdsmCdsTdsTdsTdsGds	51	2828
						GdsAdsAesGesAesTksmCk
1198238	4805	4820	125830	125845	ATAGTGCTTTGGAAGA	AksTksAdsGdsTdsAdsmCdsTdsTds	88	2829
						TdsGdsGesAesAesGksAk
1198239	N/A	N/A	94729	94744	AGGATGCATGGTTTTT	AksGksGdsAdsTdsGdsmCdsAdsTds	39	2830
						GdsGdsTesTesTesTksTk
1198240	N/A	N/A	94731	94746	TTAGGATGCATGGTTT	TksTksAdsGdsGdsAdsTdsGdsmCds	43	2831
						AdsTdsGesGesTesTksTk
1198646	4436	4451	125461	125476	TATAACTGGGCAAATT	TksAksTdsAdsAdsmCdsTdsGdsGds	80	2815
						GdsmCdsAdsAksAesTksTe
1198647	4438	4453	125463	125478	GGTATAACTGGGCAAA	GksGksTdsAdsTdsAdsAdsmCdsTds	47	1427
						GdsGdsGdsmCksAesAksAe
1198648	4439	4454	125464	125479	AGGTATAACTGGGCAA	AksGksGdsTdsAdsTdsAdsAdsmCds	43	905
						TdsGdsGdsGksmCesAksAe
1198649	4440	4455	125465	125480	GAGGTATAACTGGGCA	GksAksGdsGdsTdsAdsTdsAdsAds	27	1503
						mCdsTdsGdsGksGesmCksAe
1198650	4446	4461	125471	125486	AACACTGAGGTATAAC	AksAkmCdsAdsmCdsTdsGdsAdsGds	88	2816
						GdsTdsAdsTksAesAksmCe
1198678	N/A	N/A	115903	115918	ATATGGTTTTGTGTGT	AksTksAdsTdsGdsGdsTdsTdsTdsTds	58	2839
						GdsTdsGksTesGksTe
1198679	N/A	N/A	115905	115920	TTATATGGTTTTGTGT	TksTksAdsTdsAdsTdsGdsGdsTdsTds	54	2840
						TdsTdsGksTesGksTe
1198680	N/A	N/A	115906	115921	CTTATATGGTTTTGTG	mCksTksTdsAdsTdsAdsTdsGdsGds	28	2788
						TdsTdsTdsTksGesTksGe
1198681	N/A	N/A	115907	115922	TCTTATATGGTTTTGT	TksmCksTdsTdsAdsTdsAdsTdsGds	54	2841
						GdsTdsTdsTksTesGksTe
1198682	N/A	N/A	115908	115923	CT CTTATATGGTTTTG	mCksTksmCdsTdsTdsAdsTdsAdsTds	25	2842
						GdsGdsTdsTksTesTksGe
1198683	N/A	N/A	115909	115924	ACTCTTATATGGTTTT	AksmCksTdsmCdsTdsTdsAdsTdsAds	27	2859
						TdsGdsGdsTksTesTksTe
1198684	N/A	N/A	115910	115925	AACTCTTATATGGTTT	AksAksmCdsTdsmCdsTdsTdsAdsTds	75	2860
						AdsTdsGdsGksTesTksTe
1198685	N/A	N/A	115911	115926	CAACTCTTATATGGTT	mCksAksAdsmCdsTdsmCdsTdsTds	70	2861
						AdsTdsAdsTdsGksGesTksTe
1198686	N/A	N/A	115913	115928	GACAACTCTTATATGG	GksAksmCdsAdsAdsmCdsTdsmCds	78	2862
						TdsTdsAdsTdsAksTesGksGe
1198693	N/A	N/A	117332	117347	AT GTAATATTGCAATC	AksTksGdsTdsAdsAdsTdsAdsTdsTds	92	2848
						GdsmCdsAksAesTksmCe
1198694	N/A	N/A	117333	117348	TATGTAATATTGCAAT	TksAksTdsGdsTdsAdsAdsTdsAdsTds	110	2849
						TdsGdsmCksAesAksTe
1198695	N/A	N/A	117335	117350	TTTATGTAATATTGCA	TksTksTdsAdsTdsGdsTdsAdsAdsTds	75	2850
						AdsTdsTksGesmCksAe
1198696	N/A	N/A	117755	117770	TGTATGTCAGAAGAGT	TksGksTdsAdsTdsGdsTdsmCdsAds	12	2863
						GdsAdsAdsGksAesGksTe
1198697	N/A	N/A	117757	117772	AGTGTATGTCAGAAGA	AksGksTdsGdsTdsAdsTdsGdsTdsmCds	12	2864
						AdsGdsAksAesGksAe
1198698	N/A	N/A	117758	117773	AAGTGTATGTCAGAAG	AksAksGdsTdsGdsTdsAdsTdsGdsTds	12	2865
						mCdsAdsGksAesAksGe
1198699	N/A	N/A	117759	117774	AAAGTGTATGTCAGAA	AksAksAdsGdsTdsGdsTdsAdsTdsGds	30	2866
						TdsmCdsAksGesAksAe
1198700	N/A	N/A	117760	117775	TAAAGTGTATGTCAGA	TksAksAdsAdsGdsTdsGdsTdsAdsTds	26	2867
						GdsTdsmCksAesGksAe
1198701	N/A	N/A	117761	117776	TTAAAGTGTATGTCAG	TksTksAdsAdsAdsGdsTdsGdsTdsAds	46	2868
						TdsGdsTksmCesAksGes
1198702	N/A	N/A	117762	117777	TTTAAAGTGTATGTCA	TksTksTdsAdsAdsAdsGdsTdsGdsTds	74	2869
						AdsTdsGksTesmCksAe
1198703	N/A	N/A	117763	117778	CTTTAAAGTGTATGTC	mCksTksTdsTdsAdsAdsAdsGdsTds	42	1634
						GdsTdsAdsTksGesTksmCe
1198704	N/A	N/A	117765	117780	AACTTTAAAGTGTATG	AksAksmCdsTdsTdsTdsAdsAdsAds	72	2870
						GdsTdsGdsTksAesTksGe
1198705	N/A	N/A	119667	119682	TAAGGTTTCCCAGATT	TksAksAdsGdsGdsTdsTdsTdsmCds	70	2851
						mCdsmCdsAdsGksAesTksTe
1198706	N/A	N/A	119669	119684	AGTAAGGTTTCCCAGA	AksGksTdsAdsAdsGdsGdsTdsTdsTds	39	2852
						mCdsmCdsmCksAesGksAe
1198707	N/A	N/A	119670	119685	AAGTAAGGTTTCCCAG	AksAksGdsTdsAdsAdsGdsGdsTdsTds	31	2853
						TdsmCdsmCksmCesAksGe
1198708	N/A	N/A	119671	119686	TAAGTAAGGTTTCCCA	TksAksAdsGdsTdsAdsAdsGdsGdsTds	34	2854
						TdsTdsmCksmCesmCksAe
1198709	N/A	N/A	119672	119687	CTAAGTAAGGTTTCCC	mCksTksAdsAdsGdsTdsAdsAdsGds	29	1101
						GdsTdsTdsTksmCesmCksmCe
1198710	N/A	N/A	119673	119688	ACTAAGTAAGGTTTCC	AksmCksTdsAdsAdsGdsTdsAdsAds	51	2855
						GdsGdsTdsTksTesmCksmCe
1198711	N/A	N/A	119674	119689	GACTAAGTAAGGTTTC	GksAksmCdsTdsAdsAdsGdsTdsAds	60	2856
						AdsGdsGdsTksTesTksmCe
1198712	N/A	N/A	119675	119690	AGACTAAGTAAGGTTT	AksGksAdsmCdsTdsAdsAdsGdsTds	110	2857
						AdsAdsGdsGksTesTksTe
1198713	N/A	N/A	119677	119692	TTAGACTAAGTAAGGT	TksTksAdsGdsAdsmCdsTdsAdsAds	62	2858
						GdsTdsAdsAksGesGksTe

TABLE 43
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop			YAP1	SEQ ID
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	CHEMISTRY NOTATION	(% UTC)	NO
715487	3630	3645	124655	124670	ATTACTTCATAGCTTA	AksTksTksAdsmCdsTdsTdsmCdsAds	25	52
						TdsAdsGdsmCdsTksTksAk
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTksAdsGdsAdsGdsTdsAds	14	810
						TdsGdsTdsGdsGksmCksAk
1074461	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAksAdsTdsTdsGdsTdsmCds	11	2800
						TdsmCdsAdsTdsGksmCksmCk
1095575	4443	4458	125468	125483	ACTGAGGTATAACTGG	AksmCksTdsGdsAdsGdsGdsTdsAds	55	392
						TdsAdsAesmCesTesGksGk
1095593	4441	4456	125466	125481	TGAGGTATAACTGGGC	TksGksAdsGdsGdsTdsAdsTdsAdsAds	16	1580
						mCdsTesGesGesGksmCk
1095594	4442	4457	125467	125482	CTGAGGTATAACTGGG	mCksTksGdsAdsGdsGdsTdsAdsTds	27	2801
						AdsAdsmCesTesGesGksGk
1095595	4444	4459	125469	125484	CACTGAGGTATAACTG	mCksAksmCdsTdsGdsAdsGdsGdsTds	63	2802
						AdsTdsAesAesmCesTksGk
1198216	4436	4451	125461	125476	TATAACTGGGCAAATT	TksAksTdsAdsAdsmCdsTdsGdsGds	89	2815
						GdsmCdsAesAesAesTksTk
1198217	4438	4453	125463	125478	GGTATAACTGGGCAAA	GksGksTdsAdsTdsAdsAdsmCdsTds	57	1427
						GdsGdsGesmCesAesAksAk
1198218	4439	4454	125464	125479	AGGTATAACTGGGCAA	AksGksGdsTdsAdsTdsAdsAdsmCds	40	905
						TdsGdsGesGesmCesAksAk
1198219	4440	4455	125465	125480	GAGGTATAACTGGGCA	GksAksGdsGdsTdsAdsTdsAdsAds	22	1503
						mCdsTdsGesGesGesmCksAk
1198220	4446	4461	125471	125486	AACACTGAGGTATAAC	AksAksmCdsAdsmCdsTdsGdsAdsGds	89	2816
						GdsTdsAesTesAesAksmCk
1198241	N/A	N/A	94732	94747	TTTAGGATGCATGGTT	TksTksTdsAdsGdsGdsAdsTdsGds	32	2832
						mCdsAdsTesGesGesTksTk
1198242	N/A	N/A	94733	94748	ATTTAGGATGCATGGT	AksTksTdsTdsAdsGdsGdsAdsTds	47	2833
						GdsmCdsAesTesGesGksTk
1198243	N/A	N/A	94734	94749	GATTTAGGATGCATGG	GksAksTdsTdsTdsAdsGdsGdsAdsTds	8	2834
						GdsmCesAesTesGksGk
1198244	N/A	N/A	94735	94750	AGATTTAGGATGCATG	AksGksAdsTdsTdsTdsAdsGdsGdsAds	24	2835
						TdsGesmCesAesTksGk
1198245	N/A	N/A	94736	94751	CAGATTTAGGATGCAT	mCksAksGdsAdsTdsTdsTdsAdsGds	46	2836
						GdsAdsTesGesmCesAksTk
1198246	N/A	N/A	94737	94752	TCAGATTTAGGATGCA	TksmCksAdsGdsAdsTdsTdsTdsAds	30	2837
						GdsGdsAesTesGesmCksAk
1198247	N/A	N/A	94739	94754	ATTCAGATTTAGGATG	AksTksTdsmCdsAdsGdsAdsTdsTds	99	2838
						TdsAdsGesGesAesTksGk
1198248	N/A	N/A	115903	115918	ATATGGTTTTGTGTGT	AksTksAdsTdsGdsGdsTdsTdsTdsTds	64	2839
						GdsTesGesTesGksTk
1198249	N/A	N/A	115905	115920	TTATATGGTTTTGTGT	TksTksAdsTdsAdsTdsGdsGdsTdsTds	42	2840
						TdsTesGesTesGksTk
1198250	N/A	N/A	115906	115921	CTTATATGGTTTTGTG	mCksTksTdsAdsTdsAdsTdsGdsGds	50	2788
						TdsTdsTesTesGesTksGk
1198251	N/A	N/A	115907	115922	TCTTATATGGTTTTGT	TksmCksTdsTdsAdsTdsAdsTdsGds	83	2841
						GdsTdsTesTesTesGksTk
1198252	N/A	N/A	115908	115923	CTCTTATATGGTTTTG	mCksTksmCdsTdsTdsAdsTdsAdsTds	26	2842
						GdsGdsTesTesTesTksGk
1198253	N/A	N/A	115909	115924	ACTCTTATATGGTTTT	AksmCksTdsmCdsTdsTdsAdsTdsAds	50	2859
						TdsGdsGesTesTesTksTk
1198254	N/A	N/A	115910	115925	AACTCTTATATGGTTT	AksAksmCdsTdsmCdsTdsTdsAdsTds	95	2860
						AdsTdsGesGesTesTksTk
1198255	N/A	N/A	115911	115926	CAACTCTTATATGGTT	mCksAksAdsmCdsTdsmCdsTdsTds	84	2861
						AdsTdsAdsTesGesGesTksTk
1198256	N/A	N/A	115913	115928	GACAACTCTTATATGG	GksAksmCdsAdsAdsmCdsTdsmCdsT	78	2862
						dsTdsAdsTesAesTesGksGk
1198257	N/A	N/A	117325	117340	ATTGCAATCTGTCTGA	AksTksTdsGdsmCdsAdsAdsTdsmCds	85	2843
						TdsGdsTesmCesTesGksAk
1198258	N/A	N/A	117327	117342	ATATTGCAATCTGTCT	AksTksAdsTdsTdsGdsmCdsAdsAds	52	2844
						TdsmCdsTesGesTesmCksTk
1198259	N/A	N/A	117328	117343	AATATTGCAATCTGTC	AksAksTdsAdsTdsTdsGdsmCdsAds	51	2845
						AdsTdsmCesTesGesTksmCk
1198260	N/A	N/A	117329	117344	TAATATTGCAATCTGT	TksAksAdsTdsAdsTdsTdsGdsmCds	106	2846
						AdsAdsTesmCesTesGksTk
1198261	N/A	N/A	117330	117345	GTAATATTGCAATCTG	GksTksAdsAdsTdsAdsTdsTdsGds	54	1404
						mCdsAdsAesTesmCesTksGk
1198262	N/A	N/A	117331	117346	TGTAATATTGCAATCT	TksGksTdsAdsAdsTdsAdsTdsTds	114	2847
						GdsmCdsAesAesTesmCksTk
1198263	N/A	N/A	117332	117347	ATGTAATATTGCAATC	AksTksGdsTdsAdsAdsTdsAdsTdsTds	114	2848
						GdsmCesAesAesTksmCk
1198264	N/A	N/A	117333	117348	TATGTAATATTGCAAT	TksAksTdsGdsTdsAdsAdsTdsAdsTds	73	2849
						TdsGesmCesAesAksTk
1198265	N/A	N/A	117335	117350	TTTATGTAATATTGCA	TksTksTdsAdsTdsGdsTdsAdsAdsTds	111	2850
						AdsTesTesGesmCksAk
1198266	N/A	N/A	117755	117770	TGTATGTCAGAAGAGT	TksGksTdsAdsTdsGdsTdsmCdsAds	25	2863
						GdsAdsAesGesAesGksTk
1198267	N/A	N/A	117757	117772	AGTGTATGTCAGAAGA	AksGksTdsGdsTdsAdsTdsGdsTds	7	2864
						mCdsAdsGesAesAesGksAk
1198268	N/A	N/A	117758	117773	AAGTGTATGTCAGAAG	AksAksGdsTdsGdsTdsAdsTdsGdsTds	11	2865
						mCdsAesGesAesAksGk
1198269	N/A	N/A	117759	117774	AAAGTGTATGTCAGAA	AksAksAdsGdsTdsGdsTdsAdsTdsGds	58	2866
						TdsmCesAesGesAksAk
1198270	N/A	N/A	117760	117775	TAAAGTGTATGTCAGA	TksAksAdsAdsGdsTdsGdsTdsAdsTds	52	2867
						GdsTesmCesAesGksAk
1198271	N/A	N/A	117761	117776	TTAAAGTGTATGTCAG	TksTksAdsAdsAdsGdsTdsGdsTdsAds	44	2868
						TdsGesTesmCesAksGk
1198272	N/A	N/A	117762	117777	TTTAAAGTGTATGTCA	TksTksTdsAdsAdsAdsGdsTdsGdsTds	37	2869
						AdsTesGesTesmCksAk
1198273	N/A	N/A	117763	117778	CTTTAAAGTGTATGTC	mCksTksTdsTdsAdsAdsAdsGdsTds	52	1634
						GdsTdsAesTesGesTksmCk
1198274	N/A	N/A	117765	117780	AACTTTAAAGTGTATG	AksAksmCdsTdsTdsTdsAdsAdsAds	69	2870
						GdsTdsGesTesAesTksGk
1198275	N/A	N/A	119667	119682	TAAGGTTTCCCAGATT	TksAksAdsGdsGdsTdsTdsTdsmCds	52	2851
						mCdsmCdsAesGesAesTksTk
1198276	N/A	N/A	119669	119684	AGTAAGGTTTCCCAGA	AksGksTdsAdsAdsGdsGdsTdsTdsTds	52	2852
						mCdsmCesmCesAesGksAk
1198277	N/A	N/A	119670	119685	AAGTAAGGTTTCCCAG	AksAksGdsTdsAdsAdsGdsGdsTdsTds	32	2853
						TdsmCesmCesmCesAksGk
1198278	N/A	N/A	119671	119686	TAAGTAAGGTTTCCCA	TksAksAdsGdsTdsAdsAdsGdsGdsTds	43	2854
						TdsTesmCesmCesmCksAk
1198279	N/A	N/A	119672	119687	CTAAGTAAGGTTTCCC	mCksTksAdsAdsGdsTdsAdsAdsGds	43	1101
						GdsTdsTesTesmCesmCksmCk
1198280	N/A	N/A	119673	119688	ACTAAGTAAGGTTTCC	AksmCksTdsAdsAdsGdsTdsAdsAds	40	2855
						GdsGdsTesTesTesmCksmCk
1198281	N/A	N/A	119674	119689	GACTAAGTAAGGTTTC	GksAksmCdsTdsAdsAdsGdsTdsAds	71	2856
						AdsGdsGesTesTesTksmCk
1198282	N/A	N/A	119675	119690	AGACTAAGTAAGGTTT	AksGksAdsmCdsTdsAdsAdsGdsTds	58	2857
						AdsAdsGesGesTesTksTk
1198283	N/A	N/A	119677	119692	TTAGACTAAGTAAGGT	TksTksAdsGdsAdsmCdsTdsAdsAds	99	2858
						GdsTdsAesAesGesGksTk
1198456	2524	2539	123549	123564	TGTCTCATGCCTTATA	TksGksTdsmCdsTdsmCdsAdsTdsGds	21	2803
						mCdsmCdsTesTksAesTksAe
1198457	2526	2541	123551	123566	ATTGTCTCATGCCTTA	AksTksTdsGdsTdsmCdsTdsmCdsAds	18	2804
						TdsGdsmCesmCksTesTksAe
1198458	2527	2542	123552	123567	AATTGTCTCATGCCTT	AksAksTdsTdsGdsTdsmCdsTdsmCds	30	2805
						AdsTdsGesmCksmCesTksTe
1198459	2528	2543	123553	123568	AAATTGTCTCATGCCT	AksAksAdsTdsTdsGdsTdsmCdsTds	28	443
						mCdsAdsTesGksmCesmCksTe
1198460	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAdsAdsTdsTdsGdsTdsmCds	17	2800
						TdsmCdsAesTksGesmCksmCe
1198461	2530	2545	123555	123570	GGAAATTGTCTCATGC	GksGksAdsAdsAdsTdsTdsGdsTds	24	2806
						mCdsTdsmCesAksTesGksmCe
1198462	2531	2546	123556	123571	TGGAAATTGTCTCATG	TksGksGdsAdsAdsAdsTdsTdsGdsTds	27	2807
						mCdsTesmCksAesTksGe
1198463	2532	2547	123557	123572	ATGGAAATTGTCTCAT	AksTksGdsGdsAdsAdsAdsTdsTdsGds	59	2808
						TdsmCesTksmCesAksTe
1198464	2534	2549	123559	123574	ATATGGAAATTGTCTC	AksTksAdsTdsGdsGdsAdsAdsAdsTds	41	656
						TdsGesTksmCesTksmCe
1198465	2560	2575	123585	123600	AGTATGTGGCAATAAT	AksGksTdsAdsTdsGdsTdsGdsGds	68	2809
						mCdsAdsAesTksAesAksTe
1198466	2562	2577	123587	123602	AGAGTATGTGGCAATA	AksGksAdsGdsTdsAdsTdsGdsTdsGds	12	2810
						GdsmCesAksAesTksAe
1198467	2563	2578	123588	123603	TAGAGTATGTGGCAAT	TksAksGdsAdsGdsTdsAdsTdsGdsTds	27	2811
						GdsGesmCksAesAksTe
1198468	2564	2579	123589	123604	TTAGAGTATGTGGCAA	TksTksAdsGdsAdsGdsTdsAdsTdsGds	22	963
						TdsGesGksmCesAksAe
1198469	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTdsAdsGdsAdsGdsTdsAdsTds	23	810
						GdsTesGksGesmCksAe
1198470	2566	2581	123591	123606	TATTAGAGTATGTGGC	TksAksTdsTdsAdsGdsAdsGdsTdsAds	17	2812
						TdsGesTksGesGksmCe
1198471	2567	2582	123592	123607	ATATTAGAGTATGTGG	AksTksAdsTdsTdsAdsGdsAdsGdsTds	21	2813
						AdsTesGksTesGksGe
1198472	2568	2583	123593	123608	TATATTAGAGTATGTG	TksAksTdsAdsTdsTdsAdsGdsAdsGds	60	2814
						TdsAesTksGesTksGe
1198473	2570	2585	123595	123610	TCTATATTAGAGTATG	TksmCksTdsAdsTdsAdsTdsTdsAds	66	887
						GdsAdsGesTksAesTksGe
1198479	4595	4610	125620	125635	TTACATTAGGAACAAG	TksTksAdsmCdsAdsTdsTdsAdsGds	65	2817
						GdsAdsAesmCksAesAksGe
1198480	4597	4612	125622	125637	TTTTACATTAGGAACA	TksTksTdsTdsAdsmCdsAdsTdsTds	75	2818
						AdsGdsGesAksAesmCksAe
1198481	4598	4613	125623	125638	CTTTTACATTAGGAAC	mCksTksTdsTdsTdsAdsmCdsAdsTds	72	1124
						TdsAdsGesGksAesAksmCe
1198482	4599	4614	125624	125639	ACTTTTACATTAGGAA	AksmCksTdsTdsTdsTdsAdsmCdsAds	63	2819
						TdsTdsAesGksGesAksAe
1198483	4600	4615	125625	125640	CACTTTTACATTAGGA	mCksAksmCdsTdsTdsTdsTdsAdsmCds	31	1200
						AdsTdsTesAksGesGksAe
1198484	4601	4616	125626	125641	GCACTTTTACATTAGG	GksmCksAdsmCdsTdsTdsTdsTdsAds	18	1276
						mCdsAdsTesTksAesGksGe
1198485	4602	4617	125627	125642	AGCACTTTTACATTAG	AksGksmCdsAdsmCdsTdsTdsTdsTds	64	2820
						AdsmCdsAesTksTesAksGe

TABLE 44
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop			YAP1	SEQ ID
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	CHEMISTRY NOTATION	(% UTC)	NO
715487	3630	3645	124655	124670	ATTACTTCATAGCTTA	AksTksTksAdsmCdsTdsTdsmCds	18	52
						AdsTdsAdsGdsmCdsTksTksAk
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTksAdsGdsAdsGdsTdsAds	9	810
						TdsGdsTdsGdsGksmCksAk
1074461	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAksAdsTdsTdsGdsTdsmCds	7	2800
						TdsmCdsAdsTdsGksmCksmCk
1095603	4443	4458	125468	125483	ACTGAGGTATAACTGG	AksmCksTdsGdsAdsGdsGdsTds	29	2872
						AdsTdsAdsAesmCksTesGksGe
1095621	4441	4456	125466	125481	TGAGGTATAACTGGGC	TksGksAdsGdsGdsTdsAdsTdsAds	22	1580
						AdsmCdsTesGksGesGksmCe
1095622	4442	4457	125467	125482	CTGAGGTATAACTGGG	mCksTksGdsAdsGdsGdsTdsAds	44	2801
						TdsAdsAdsmCesTksGesGksGe
1095623	4444	4459	125469	125484	CACTGAGGTATAACTG	mCksAksmCdsTdsGdsAdsGdsGds	57	2802
						TdsAdsTdsAesAksmCesTksGe
1198474	4436	4451	125461	125476	TATAACTGGGCAAATT	TksAksTdsAdsAdsmCdsTdsGds	68	2815
						GdsGdsmCdsAesAksAesTksTe
1198475	4438	4453	125463	125478	GGTATAACTGGGCAAA	GksGksTdsAdsTdsAdsAdsmCds	25	1427
						TdsGdsGdsGesmCksAesAksAe
1198476	4439	4454	125464	125479	AGGTATAACTGGGCAA	AksGksGdsTdsAdsTdsAdsAds	31	905
						mCdsTdsGdsGesGksmCesAksAe
1198477	4440	4455	125465	125480	GAGGTATAACTGGGCA	GksAksGdsGdsTdsAdsTdsAds	47	1503
						AdsmCdsTdsGesGksGesmCksAe
1198478	4446	4461	125471	125486	AACACTGAGGTATAAC	AksAksmCdsAdsmCdsTdsGdsAds	60	2816
						GdsGdsTdsAesTksAesAksmCe
1198486	4603	4618	125628	125643	AAGCACTTTTACATTA	AksAksGdsmCdsAdsmCdsTdsTds	39	2821
						TdsTdsAdsmCesAksTesTksAe
1198487	4605	4620	125630	125645	TTAAGCACTTTTACAT	TksTksAdsAdsGdsmCdsAdsmCds	62	2822
						TdsTdsTdsTesAksmCesAksTe
1198488	4795	4810	125820	125835	GGAAGATCTGAAACTC	GksGksAdsAdsGdsAdsTdsmCds	66	2823
						TdsGdsAdsAesAksmCesTksmCe
1198489	4797	4812	125822	125837	TTGGAAGATCTGAAAC	TksTksGdsGdsAdsAdsGdsAdsTds	50	2824
						mCdsTdsGesAksAesAksmCe
1198490	4798	4813	125823	125838	TTTGGAAGATCTGAAA	TksTksTdsGdsGdsAdsAdsGdsAds	53	2825
						TdsmCdsTesGksAesAksAe
1198491	4799	4814	125824	125839	CTTTGGAAGATCTGAA	mCksTksTdsTdsGdsGdsAdsAds	22	2826
						GdsAdsTdsmCesTksGesAksAe
1198492	4800	4815	125825	125840	GCTTTGGAAGATCTGA	GksmCksTdsTdsTdsGdsGdsAds	15	2044
						AdsGdsAdsTesmCksTesGksAe
1198493	4801	4816	125826	125841	TGCTTTGGAAGATCTG	TksGksmCdsTdsTdsTdsGdsGds	28	2121
						AdsAdsGdsAesTksmCesTksGe
1198494	4802	4817	125827	125842	GTGCTTTGGAAGATCT	GksTksGdsmCdsTdsTdsTdsGds	15	2827
						GdsAdsAdsGesAksTesmCksTe
1198495	4803	4818	125828	125843	AGTGCTTTGGAAGATC	AksGksTdsGdsmCdsTdsTdsTds	22	2828
						GdsGdsAdsAesGksAesTksmCe
1198496	4805	4820	125830	125845	ATAGTGCTTTGGAAGA	AksTksAdsGdsTdsGdsmCdsTds	46	2891
						TdsTdsGdsGesAksAesGksAe
1198497	N/A	N/A	94729	94744	AGGATGCATGGTTTTT	AksGksGdsAdsTdsGdsmCdsAds	22	2830
						TdsGdsGdsTesTksTesTksTe
1198498	N/A	N/A	94731	94746	TTAGGATGCATGGTTT	TksTksAdsGdsGdsAdsTdsGdsmCds	39	2831
						AdsTdsGesGksTesTksTe
1198499	N/A	N/A	94732	94747	TTTAGGATGCATGGTT	TksTksTdsAdsGdsGdsAdsTdsGds	13	2832
						mCdsAdsTesGksGesTksTe
1198500	N/A	N/A	94733	94748	ATTTAGGATGCATGGT	AksTksTdsTdsAdsGdsGdsAdsTds	17	2833
						GdsmCdsAesTksGesGksTe
1198501	N/A	N/A	94734	94749	GATTTAGGATGCATGG	GksAksTdsTdsTdsAdsGdsGdsAds	5	2834
						TdsGdsmCesAksTesGksGe
1198502	N/A	N/A	94735	94750	AGATTTAGGATGCATG	AksGksAdsTdsTdsTdsAdsGdsGds	16	2835
						AdsTdsGesmCksAesTksGe
1198503	N/A	N/A	94736	94751	CAGATTTAGGATGCAT	mCksAksGdsAdsTdsTdsTdsAds	31	2836
						GdsGdsAdsTesGksmCesAksTe
1198504	N/A	N/A	94737	94752	TCAGATTTAGGATGCA	TksmCksAdsGdsAdsTdsTdsTds	15	2837
						AdsGdsGdsAesTksGesmCksAe
1198505	N/A	N/A	94739	94754	ATTCAGATTTAGGATG	AksTksTdsmCdsAdsGdsAdsTds	73	2838
						TdsTdsAdsGesGksAesTksGe
1198506	N/A	N/A	115903	115918	ATATGGTTTTGTGTGT	AksTksAdsTdsGdsGdsTdsTdsTds	47	2839
						TdsGdsTesGksTesGksTe
1198507	N/A	N/A	115905	115920	TTATATGGTTTTGTGT	TksTksAdsTdsAdsTdsGdsGdsTds	17	2840
						TdsTdsTesGksTesGksTe
1198508	N/A	N/A	115906	115921	CTTATATGGTTTTGTG	mCksTksTdsAdsTdsAdsTdsGds	22	2788
						GdsTdsTdsTesTksGesTksGe
1198509	N/A	N/A	115907	115922	TCTTATATGGTTTTGT	TksmCksTdsTdsAdsTdsAdsTds	20	2841
						GdsGdsTdsTesTksTesGksTe
1198510	N/A	N/A	115908	115923	CTCTTATATGGTTTTG	mCksTksmCdsTdsTdsAdsTdsAds	8	2842
						TdsGdsGdsTesTksTesTksGe
1198511	N/A	N/A	115909	115924	ACTCTTATATGGTTTT	AksmCksTdsmCdsTdsTdsAdsTds	53	2859
						AdsTdsGdsGesTksTesTksTe
1198512	N/A	N/A	115910	115925	AACTCTTATATGGTTT	AksAksmCdsTdsmCdsTdsTdsAds	62	2860
						TdsAdsTdsGesGksTesTksTe
1198513	N/A	N/A	115911	115926	CAACTCTTATATGGTT	mCksAksAdsmCdsTdsmCdsTdsTds	63	2861
						AdsTdsAdsTesGksGesTksTe
1198514	N/A	N/A	115913	115928	GACAACTCTTATATGG	GksAksmCdsAdsAdsmCdsTdsmCds	53	2862
						TdsTdsAdsTesAksTesGksGe
1198515	N/A	N/A	117325	117340	ATTGCAATCTGTCTGA	AksTksTdsGdsmCdsAdsAdsTds	44	2843
						mCdsTdsGdsTesmCksTesGksAe
1198516	N/A	N/A	117327	117342	ATATTGCAATCTGTCT	AksTksAdsTdsTdsGdsmCdsAds	50	2844
						AdsTdsmCdsTesGksTesmCksTe
1198517	N/A	N/A	117328	117343	AATATTGCAATCTGTC	AksAksTdsAdsTdsTdsGdsmCds	36	2845
						AdsAdsTdsmCesTksGesTksmCe
1198518	N/A	N/A	117329	117344	TAATATTGCAATCTGT	TksAksAdsTdsAdsTdsTdsGdsmCds	71	2846
						AdsAdsTesmCksTesGksTe
1198519	N/A	N/A	117330	117345	GTAATATTGCAATCTG	GksTksAdsAdsTdsAdsTdsTdsGds	20	1404
						mCdsAdsAesTksmCesTksGe
1198520	N/A	N/A	117331	117346	TGTAATATTGCAATCT	TksGksTdsAdsAdsTdsAdsTdsTds	51	2847
						GdsmCdsAesAksTesmCksTe
1198521	N/A	N/A	117332	117347	ATGTAATATTGCAATC	AksTksGdsTdsAdsAdsTdsAdsTds	44	2848
						TdsGdsmCesAksAesTksmCe
1198522	N/A	N/A	117333	117348	TATGTAATATTGCAAT	TksAksTdsGdsTdsAdsAdsTdsAds	37	2849
						TdsTdsGesmCksAesAksTe
1198523	N/A	N/A	117335	117350	TTTATGTAATATTGCA	TksTksTdsAdsTdsGdsTdsAdsAds	93	2850
						TdsAdsTesTksGesmCksAe
1198524	N/A	N/A	117755	117770	TGTATGTCAGAAGAGT	TksGksTdsAdsTdsGdsTdsmCds	3	2863
						AdsGdsAdsAesGksAesGksTe
1198525	N/A	N/A	117757	117772	AGTGTATGTCAGAAGA	AksGksTdsGdsTdsAdsTdsGdsTds	2	2864
						mCdsAdsGesAksAesGksAe
1198526	N/A	N/A	117758	117773	AAGTGTATGTCAGAAG	AksAksGdsTdsGdsTdsAdsTdsGds	2	2865
						TdsmCdsAesGksAesAksGe
1198527	N/A	N/A	117759	117774	AAAGTGTATGTCAGAA	AksAksAdsGdsTdsGdsTdsAdsTds	5	2866
						GdsTdsmCesAksGesAksAe
1198528	N/A	N/A	117760	117775	TAAAGTGTATGTCAGA	TksAksAdsAdsGdsTdsGdsTdsAds	14	2867
						TdsGdsTesmCksAesGksAe
1198529	N/A	N/A	117761	117776	TTAAAGTGTATGTCAG	TksTksAdsAdsAdsGdsTdsGdsTds	17	2868
						AdsTdsGesTksmCesAksGe
1198530	N/A	N/A	117762	117777	TTTAAAGTGTATGTCA	TksTksTdsAdsAdsAdsGdsTdsGds	29	2869
						TdsAdsTesGksTesmCksAe
1198531	N/A	N/A	117763	117778	CTTTAAAGTGTATGTC	mCksTksTdsTdsAdsAdsAdsGds	21	1634
						TdsGdsTdsAesTksGesTksmCe
1198532	N/A	N/A	117765	117780	AACTTTAAAGTGTATG	AksAksmCdsTdsTdsTdsAdsAds	36	2870
						AdsGdsTdsGesTksAesTksGe
1198533	N/A	N/A	119667	119682	TAAGGTTTCCCAGATT	TksAksAdsGdsGdsTdsTdsTds	35	2851
						mCdsmCdsmCdsAesGksAesTksTe
1198534	N/A	N/A	119669	119684	AGTAAGGTTTCCCAGA	AksGksTdsAdsAdsGdsGdsTdsTds	30	2852
						TdsmCdsmCesmCksAesGksAe
1198535	N/A	N/A	119670	119685	AAGTAAGGTTTCCCAG	AksAksGdsTdsAdsAdsGdsGds	35	2853
						TdsTdsTdsmCesmCksmCesAksGe
1198536	N/A	N/A	119671	119686	TAAGTAAGGTTTCCCA	TksAksAdsGdsTdsAdsAdsGds	20	2854
						GdsTdsTdsTesmCksmCesmCksAe
1198537	N/A	N/A	119672	119687	CTAAGTAAGGTTTCCC	mCksTksAdsAdsGdsTdsAdsAds	24	1101
						GdsGdsTdsTesTksmCesmCksmCe
1198538	N/A	N/A	119673	119688	ACTAAGTAAGGTTTCC	AksmCksTdsAdsAdsGdsTdsAds	29	2855
						AdsGdsGdsTesTksTesmCksmCe
1198539	N/A	N/A	119674	119689	GACTAAGTAAGGTTTC	GksAksmCdsTdsAdsAdsGdsTds	54	2856
						AdsAdsGdsGesTksTesTksmCe
1198540	N/A	N/A	119675	119690	AGACTAAGTAAGGTTT	AksGksAdsmCdsTdsAdsAdsGds	51	2857
						TdsAdsAdsGesGksTesTksTe
1198541	N/A	N/A	119677	119692	TTAGACTAAGTAAGGT	TksTksAdsGdsAdsmCdsTdsAds	34	2858
						AdsGdsTdsAesAksGesGksTe
1198890	2524	2539	123549	123564	TGTCTCATGCCTTATA	TksGksTdsmCdsTdsmCdsAdsTds	19	2803
						GdsmCdsmCdsTksTdsAksTdsAk
1198891	2526	2541	123551	123566	ATTGTCTCATGCCTTA	AksTksTdsGdsTdsmCdsTdsmCds	18	2804
						AdsTdsGdsmCksmCdsTksTdsAk
1198892	2527	2542	123552	123567	AATTGTCTCATGCCTT	AksAksTdsTdsGdsTdsmCdsTds	24	2805
						mCdsAdsTdsGksmCdsmCksTdsTk
1198899	2560	2575	123585	123600	AGTATGTGGCAATAAT	AksGksTdsAdsTdsGdsTdsGdsGds	75	2809
						mCdsAdsAksTdsAksAdsTk
1198900	2562	2577	123587	123602	AGAGTATGTGGCAATA	AksGksAdsGdsTdsAdsTdsGdsTds	11	2810
						GdsGdsmCksAdsAksTdsAk
1198901	2563	2578	123588	123603	TAGAGTATGTGGCAAT	TksAksGdsAdsGdsTdsAdsTdsGds	28	2811
						TdsGdsGksmCdsAksAdsTk
1198902	2564	2579	123589	123604	TTAGAGTATGTGGCAA	TksTksAdsGdsAdsGdsTdsAdsTds	13	963
						GdsTdsGksGdsmCksAdsAk
1198903	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTdsAdsGdsAdsGdsTdsAds	24	810
						TdsGdsTksGdsGksmCdsAk
1198904	2566	2581	123591	123606	TATTAGAGTATGTGGC	TksAksTdsTdsAdsGdsAdsGdsTds	12	2812
						AdsTdsGksTdsGksGdsmCk
1198905	2567	2582	123592	123607	ATATTAGAGTATGTGG	AksTksAdsTdsTdsAdsGdsAdsGds	5	2813
						TdsAdsTksGdsTksGdsGk
1198906	2568	2583	123593	123608	TATATTAGAGTATGTG	TksAksTdsAdsTdsTdsAdsGdsAds	56	2814
						GdsTdsAksTdsGksTdsGk
1198907	2570	2585	123595	123610	TCTATATTAGAGTATG	TksmCksTdsAdsTdsAdsTdsTds	74	887
						AdsGdsAdsGksTdsAksTdsGk

TABLE 45
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
	SEQ ID	SEQ ID	SEQ ID	SEQ ID
	NO: 1	NO: 1	NO: 2	NO: 2
Compound	Start	Stop	Start	Stop			YAP1	SEQ ID
Number	Site	Site	Site	Site	Sequence (5′ to 3′)	CHEMISTRY NOTATION	(% UTC)	NO
715487	3630	3645	124655	124670	ATTACTTCATAGCTTA	AksTksTksAdsmCdsTdsTdsmCdsAds	28	52
						TdsAdsGdsmCdsTksTksAk
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTksAdsGdsAdsGdsTdsAdsTds	15	810
						GdsTdsGdsGksmCksAk
91074461	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAksAdsTdsTdsGdsTdsmCds	9	2800
						TdsmCdsAdsTdsGksmCksAk
1095491	4443	4458	125468	125483	ACTGAGGTATAACTGG	AksmCksTdsGdsAdsGdsGdsTdsAds	65	392
						TdsAdsAksmCdsTksGdsGk
1095509	4441	4456	125466	125481	TGAGGTATAACTGGGC	TksGksAdsGdsGdsTdsAdsTdsAdsAds	29	1580
						mCdsTksGdsGksGdsmCk
1095510	4442	4457	125467	125482	CTGAGGTATAACTGGG	mCksTksGdsAdsGdsGdsTdsAdsTds	35	2801
						AdsAdsmCksTdsGksGdsGk
1095511	4444	4459	125469	125484	CACTGAGGTATAACTG	mCksAksmCdsTdsGdsAdsGdsGdsTds	46	2802
						AdsTdsAksAdsmCksTdsGk
1198893	2528	2543	123553	123568	AAATTGTCTCATGCCT	AksAksAdsTdsTdsGdsTdsmCdsTds	58	443
						mCdsAdsTksGdsmCksmCdsTk
1198894	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAdsAdsTdsTdsGdsTdsmCds	57	2800
						TdsmCdsAksTdsGksmCksmCk
1198895	2530	2545	123555	123570	GGAAATTGTCTCATGC	GksGksAdsAdsAdsTdsTdsGdsTds	22	2806
						mCdsTdsmCksAdsTksGdsmCk
1198896	2531	2546	123556	123571	TGGAAATTGTCTCATG	TksGksGdsAdsAdsAdsTdsTdsGdsTds	59	2807
						mCdsTksmCdsAksTdsGk
1198897	2532	2547	123557	123572	ATGGAAATTGTCTCAT	AksTksGdsGdsAdsAdsAdsTdsTds	61	2808
						GdsTdsmCksTdsmCksAdsTk
1198898	2534	2549	123559	123574	ATATGGAAATTGTCTC	AksTksAdsTdsGdsGdsAdsAdsAds	53	656
						TdsTdsGksTdsmCksTdsmCk
1198908	4436	4451	125461	125476	TATAACTGGGCAAATT	TksAksTdsAdsAdsmCdsTdsGdsGds	124	2815
						GdsmCdsAksAdsAksTdsTk
1198909	4438	4453	125463	125478	GGTATAACTGGGCAAA	GksGksTdsAdsTdsAdsAdsmCdsTds	56	1427
						GdsGdsGksmCdsAksAdsAk
1198910	4439	4454	125464	125479	AGGTATAACTGGGCAA	AksGksGdsTdsAdsTdsAdsAdsmCds	40	905
						TdsGdsGksGdsmCksAdsAk
1198911	4440	4455	125465	125480	GAGGTATAACTGGGCA	GksAksGdsGdsTdsAdsTdsAdsAds	26	1503
						mCdsTdsGksGdsGksmCdsAk
1198912	4446	4461	125471	125486	AACACTGAGGTATAAC	AksAksmCdsAdsmCdsTdsGdsAdsGds	78	2816
						GdsTdsAksTdsAksAdsmCk
1198913	4595	4610	125620	125635	TTACATTAGGAACAAG	TksTksAdsmCdsAdsTdsTdsAdsGds	86	2817
						GdsAdsAksmCdsAksAdsGk
1198914	4597	4612	125622	125637	TTTTACATTAGGAACA	TksTksTdsTdsAdsmCdsAdsTdsTds	68	2818
						AdsGdsGksAdsAksmCdsAk
1198915	4598	4613	125623	125638	CTTTTACATTAGGAAC	mCksTksTdsTdsTdsAdsmCdsAdsTds	37	1124
						TdsAdsGksGdsAksAdsmCk
1198916	4599	4614	125624	125639	ACTTTTACATTAGGAA	AksmCksTdsTdsTdsTdsAdsmCdsAds	59	2819
						TdsTdsAksGdsGksAdsAk
1198917	4600	4615	125625	125640	CACTTTTACATTAGGA	mCksAksmCdsTdsTdsTdsTdsAdsmCds	21	1200
						AdsTdsTksAdsGksGdsAk
1198918	4601	4616	125626	125641	GCACTTTTACATTAGG	GksmCksAdsmCdsTdsTdsTdsTdsAds	27	1276
						mCdsAdsTksTdsAksGdsGk
1198919	4602	4617	125627	125642	AGCACTTTTACATTAG	AksGksmCdsAdsmCdsTdsTdsTdsTds	60	2820
						AdsmCdsAksTdsTksAdsGk
1198920	4603	4618	125628	125643	AAGCACTTTTACATTA	AksAksGdsmCdsAdsmCdsTdsTdsTds	54	2821
						TdsAdsmCksAdsTksTdsAk
1198921	4605	4620	125630	125645	TTAAGCACTTTTACAT	TksTksAdsAdsGdsmCdsAdsmCdsTds	89	2822
						TdsTdsTksAdsmCksAdsTk
1198922	4795	4810	125820	125835	GGAAGATCTGAAACTC	GksGksAdsAdsGdsAdsTdsmCdsTds	59	2823
						GdsAdsAksAdsmCksTdsmCk
1198923	4797	4812	125822	125837	TTGGAAGATCTGAAAC	TksTksGdsGdsAdsAdsGdsAdsTds	73	2824
						mCdsTdsGksAdsAksAdsmCk
1198924	4798	4813	125823	125838	TTTGGAAGATCTGAAA	TksTksTdsGdsGdsAdsAdsGdsAdsTds	75	2825
						mCdsTksGdsAksAdsAk
1198925	4799	4814	125824	125839	CTTTGGAAGATCTGAA	mCksTksTdsTdsGdsGdsAdsAdsGds	52	2826
						AdsTdsmCksTdsGksAdsAk
1198926	4800	4815	125825	125840	GCTTTGGAAGATCTGA	GksmCksTdsTdsTdsGdsGdsAdsAds	45	2044
						GdsAdsTksmCdsTksGdsAk
1198927	4801	4816	125826	125841	TGCTTTGGAAGATCTG	TksGksmCdsTdsTdsTdsGdsGdsAds	50	2121
						AdsGdsAksTdsmCksTdsGk
1198928	4802	4817	125827	125842	GTGCTTTGGAAGATCT	GksTksGdsmCdsTdsTdsTdsGdsGds	28	2827
						AdsAdsGksAdsTksmCdsTk
1198929	4803	4818	125828	125843	AGTGCTTTGGAAGATC	AksGksTdsGdsmCdsTdsTdsTdsGds	43	2828
						GdsAdsAksGdsAksTdsmCk
1198930	4805	4820	125830	125845	ATAGTGCTTTGGAAGA	AksTksAdsGdsTdsGdsmCdsTdsTdsTds	68	2829
						GdsGksAdsAksGdsAk
1198931	N/A	N/A	94729	94744	AGGATGCATGGTTTTT	AksGksGdsAdsTdsGdsmCdsAdsTds	47	2830
						GdsGdsTksTdsTksTdsTk
1198932	N/A	N/A	94731	94746	TTAGGATGCATGGTTT	TksTksAdsGdsGdsAdsTdsGdsmCds	35	2831
						AdsTdsGksGdsTksTdsTk
1198933	N/A	N/A	94732	94747	TTTAGGATGCATGGTT	TksTksTdsAdsGdsGdsAdsTdsGds	69	2832
						mCdsAdsTksGdsGksTdsTk
1198934	N/A	N/A	94733	94748	ATTTAGGATGCATGGT	AksTksTdsTdsAdsGdsGdsAdsTdsGds	56	2833
						mCdsAksTdsGksGdsTk
1198935	N/A	N/A	94734	94749	GATTTAGGATGCATGG	GksAksTdsTdsTdsAdsGdsGdsAdsTds	18	2834
						GdsmCksAdsTksGdsGk
1198936	N/A	N/A	94735	94750	AGATTTAGGATGCATG	AksGksAdsTdsTdsTdsAdsGdsGdsAds	38	2835
						TdsGksmCdsAksTdsGk
1198937	N/A	N/A	94736	94751	CAGATTTAGGATGCAT	mCksAksGdsAdsTdsTdsTdsAdsGds	48	2836
						GdsAdsTksGdsmCksAdsTk
1198938	N/A	N/A	94737	94752	TCAGATTTAGGATGCA	TksmCksAdsGdsAdsTdsTdsTdsAds	59	2837
						GdsGdsAksTdsGksmCdsAk
1198939	N/A	N/A	94739	94754	ATTCAGATTTAGGATG	AksTksTdsmCdsAdsGdsAdsTdsTds	102	2838
						TdsAdsGksGdsAksTdsGk
1198940	N/A	N/A	115903	115918	ATATGGTTTTGTGTGT	AksTksAdsTdsGdsGdsTdsTdsTdsTds	51	2881
						GdsTksGdsTksGdsTk
1198941	N/A	N/A	115905	115920	TTATATGGTTTTGTGT	TksTksAdsTdsAdsTdsGdsGdsTdsTds	35	2840
						TdsTksGdsTksGdsTk
1198942	N/A	N/A	115906	115921	CTTATATGGTTTTGTG	mCksTksTdsAdsTdsAdsTdsGdsGds	42	2788
						TdsTdsTksTdsGksTdsGk
1198943	N/A	N/A	115907	115922	TCTTATATGGTTTTGT	TksmCksTdsTdsAdsTdsAdsTdsGds	31	2841
						GdsTdsTksTdsTksGdsTk
1198944	N/A	N/A	115908	115923	CTCTTATATGGTTTTG	mCksTksmCdsTdsTdsAdsTdsAdsTds	34	2842
						GdsGdsTksTdsTksTdsGk
1198945	N/A	N/A	115909	115924	ACTCTTATATGGTTTT	AksmCksTdsmCdsTdsTdsAdsTdsAds	48	2859
						TdsGdsGksTdsTksTdsTk
1198946	N/A	N/A	115910	115925	AACTCTTATATGGTTT	AksAksmCdsTdsmCdsTdsTdsAdsTds	72	2860
						AdsTdsGksGdsTksTdsTk
1198947	N/A	N/A	115911	115926	CAACTCTTATATGGTT	mCksAksAdsmCdsTdsmCdsTdsTds	88	2861
						AdsTdsAdsTksGdsGksTdsTk
1198948	N/A	N/A	115913	115928	GACAACTCTTATATGG	GksAksmCdsAdsAdsmCdsTdsmCds	96	2862
						TdsTdsAdsTksAdsTksGdsGk
1198949	N/A	N/A	117325	117340	ATTGCAATCTGTCTGA	AksTksTdsGdsmCdsAdsAdsTdsmCds	61	2843
						TdsGdsTksmCdsTksGdsAk
1198950	N/A	N/A	117327	117342	ATATTGCAATCTGTCT	AksTksAdsTdsTdsGdsmCdsAdsAds	85	2844
						TdsmCdsTksGdsTksmCdsTk
1198951	N/A	N/A	117328	117343	AATATTGCAATCTGTC	AksAksTdsAdsTdsTdsGdsmCdsAds	81	2845
						AdsTdsmCksTdsGksTdsmCk
1198952	N/A	N/A	117329	117344	TAATATTGCAATCTGT	TksAksAdsTdsAdsTdsTdsGdsmCds	77	2846
						AdsAdsTksmCdsTksGdsTk
1198953	N/A	N/A	117330	117345	GTAATATTGCAATCTG	GksTksAdsAdsTdsAdsTdsTdsGds	58	1404
						mCdsAdsAksTdsmCksTdsGk
1198954	N/A	N/A	117331	117346	TGTAATATTGCAATCT	TksGksTdsAdsAdsTdsAdsTdsTdsGds	94	2847
						mCdsAksAdsTksmCdsTk
1198955	N/A	N/A	117332	117347	ATGTAATATTGCAATC	AksTksGdsTdsAdsAdsTdsAdsTdsTds	92	2848
						GdsmCksAdsAksTdsmCk
1198956	N/A	N/A	117333	117348	TATGTAATATTGCAAT	TksAksTdsGdsTdsAdsAdsTdsAdsTds	76	2849
						TdsGksmCdsAksAdsTk
1198957	N/A	N/A	117335	117350	TTTATGTAATATTGCA	TksTksTdsAdsTdsGdsTdsAdsAdsTds	81	2850
						AdsTksTdsGksmCdsAk
1198958	N/A	N/A	117755	117770	TGTATGTCAGAAGAGT	TksGksTdsAdsTdsGdsTdsmCdsAds	12	2863
						GdsAdsAksGdsAksGdsTk
1198959	N/A	N/A	117757	117772	AGTGTATGTCAGAAGA	AksGksTdsGdsTdsAdsTdsGdsTds	8	2864
						mCdsAdsGksAdsAksGdsAk
1198960	N/A	N/A	117758	117773	AAGTGTATGTCAGAAG	AksAksGdsTdsGdsTdsAdsTdsGdsTds	6	2865
						mCdsAksGdsAksAdsGk
1198961	N/A	N/A	117759	117774	AAAGTGTATGTCAGAA	AksAksAdsGdsTdsGdsTdsAdsTds	12	2866
						GdsTdsmCksAdsGksAdsAk
1198962	N/A	N/A	117760	117775	TAAAGTGTATGTCAGA	TksAksAdsAdsGdsTdsGdsTdsAdsTds	52	2867
						GdsTksmCdsAksGdsAk
1198963	N/A	N/A	117761	117776	TTAAAGTGTATGTCAG	TksTksAdsAdsAdsGdsTdsGdsTdsAds	27	2868
						TdsGksTdsmCksAdsGk
1198964	N/A	N/A	117762	117777	TTTAAAGTGTATGTCA	TksTksTdsAdsAdsAdsGdsTdsGdsTds	59	2869
						AdsTksGdsTksmCdsAk
1198965	N/A	N/A	117763	117778	CTTTAAAGTGTATGTC	mCksTksTdsTdsAdsAdsAdsGdsTds	95	1634
						GdsTdsAksTdsGksTdsmCk
1198967	N/A	N/A	119667	119682	TAAGGTTTCCCAGATT	TksAksAdsGdsGdsTdsTdsTdsmCds	65	2851
						mCdsmCdsAksGdsAksTdsTk
1198968	N/A	N/A	119669	119684	AGTAAGGTTTCCCAGA	AksGksTdsAdsAdsGdsGdsTdsTdsTds	57	2852
						mCdsmCksmCdsAksGdsAk
1198969	N/A	N/A	119670	119685	AAGTAAGGTTTCCCAG	AksAksGdsTdsAdsAdsGdsGdsTdsTds	31	2853
						TdsmCksmCdsmCksAdsGk
1198970	N/A	N/A	119671	119686	TAAGTAAGGTTTCCCA	TksAksAdsGdsTdsAdsAdsGdsGdsTds	29	2854
						TdsTksmCdsmCksmCdsAk
1198971	N/A	N/A	119672	119687	CTAAGTAAGGTTTCCC	mCksTksAdsAdsGdsTdsAdsAdsGds	31	1101
						GdsTdsTksTdsmCksmCdsmCk
1198972	N/A	N/A	119673	119688	ACTAAGTAAGGTTTCC	AksmCksTdsAdsAdsGdsTdsAdsAds	46	2855
						GdsGdsTksTdsTksmCdsmCk
1198973	N/A	N/A	119674	119689	GACTAAGTAAGGTTTC	GksAksmCdsTdsAdsAdsGdsTdsAds	53	2856
						AdsGdsGksTdsTksTdsmCk
1198974	N/A	N/A	119675	119690	AGACTAAGTAAGGTTT	AksGksAdsmCdsTdsAdsAdsGdsTds	73	2857
						AdsAdsGksGdsTksTdsTk
1198975	N/A	N/A	119677	119692	TTAGACTAAGTAAGGT	TksTksAdsGdsAdsmCdsTdsAdsAds	52	2858
						GdsTdsAksAdsGksGdsTk

TABLE 46
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
	SEQ	SEQ	SEQ	SEQ
	ID	ID	ID	ID
	NO: 1	NO: 1	NO: 2	NO: 2			YAP1	SEQ
Compound	Start	Stop	Start	Stop	Sequence		(%	ID
Number	Site	Site	Site	Site	(5′ to 3′)	CHEMSITRY NOTATION	UTC)	NO
715487	3630	3645	124655	124670	ATTACTTCATAGCTTA	AksTksTksAdsmCdsTdsTdsmCdsAds	25	52
						TdsAdsGdsmCdsTksTksAk
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksksAdsGdsAdsGdsTdsAdsTds	16	810
						GdsTdsGdsGksmCksAk
1074461	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAksAdsTdsTdsGdsTdsmCds	14	2800
						TdsmCdsAdsTdsGksmCksmCk
1095407	4443	4458	125468	125483	ACTGAGGTATAACTGG	AksmCksTdsGdsAdsGdsGdsTdsAds	54	392
						TdsAdsAksmCesTksGesGk
1095425	4441	4456	125466	125481	TGAGGTATAACTGGGC	TksGksAdsGdsGdsTdsAdsTdsAdsAds	57	1580
						mCdsTksGesGksGesmCk
1095426	4442	4457	125467	125482	CTGAGGTATAACTGGG	mCksTksGdsAdsGdsGdsTdsAdsTds	54	2801
						AdsAdsmCksTesGksGesGk
1095427	4444	4459	125469	125484	CACTGAGGTATAACTG	mCksAksmCdsTdsGdsAdsGdsGdsTds	45	2802
						AdsTdsAksAesmCksTesGk
1198804	2524	2539	123549	123564	TGTCTCATGCCTTATA	TksGksTdsmCdsTdsmCdsAdsTdsGdsm	22	2803
						CdsmCdsTksTesAksTesAk
1198805	2526	2541	123551	123566	ATTGTCTCATGCCTTA	AksTksTdsGdsTdsmCdsTdsmCdsAds	23	2804
						TdsGdsmCksmCesTksTesAk
1198806	2527	2542	123552	123567	AATTGTCTCATGCCTT	AksAksTdsTdsGdsTdsmCdsTdsmCds	33	2805
						AdsTdsGksmCesmCksTesTk
1198807	2528	2543	123553	123568	AAATTGTCTCATGCCT	AksAksAdsTdsTdsGdsTdsmCdsTdsm	44	433
						CdsAdsTksGesmCksmCesTk
1198808	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAdsAdsTdsTdsGdsTdsmCds	40	2800
						TdsmCdsAksTesGksmCesmCk
1198809	2530	2545	123555	123570	GGAAATTGTCTCATGC	GksGksAdsAdsAdsTdsTdsGdsTdsm	27	2806
						CdsTdsmCksAesTksGesmCk
1198810	2531	2546	123556	123571	TGGAAATTGTCTCATG	TksGksGdsAdsAdsAdsTdsTdsGdsTds	50	2807
						mCdsTksmCesAksTesGk
1198811	2532	2547	123557	123572	ATGGAAATTGTCTCAT	AksTksGdsGdsAdsAdsAdsTdsTdsGds	38	2808
						TdsmCksTesmCksAesTk
1198812	2534	2549	123559	123574	ATATGGAAATTGTCTC	AksTksAdsTdsGdsGdsAdsAdsAdsTds	26	656
						TdsGksTesmCksTesmCk
1198813	2560	2575	123585	123600	AGTATGTGGCAATAAT	AksGksTdsAdsTdsGdsTdsGdsGdsm	55	2809
						CdsAdsAksTesAksAesTk
1198814	2562	2577	123587	123602	AGAGTATGTGGCAATA	AksGksAdsGdsTdsAdsTdsGdsTdsGds	13	2810
						GdsmCksAesAksTesAk
1198815	2563	2578	123588	123603	TAGAGTATGTGGCAAT	TksAksGdsAdsGdsTdsAdsTdsGdsTds	24	2811
						GdsGksmCesAksAesTk
1198816	2564	2579	123589	123604	TTAGAGTATGTGGCAA	TksTksAdsGdsAdsGdsTdsAdsTdsGds	27	963
						TdsGksGesmCksAesAk
1198817	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTdsAdsGdsAdsGdsTdsAdsTds	43	810
						GdsTksGesGksmCesAk
1198818	2566	2581	123591	123606	TATTAGAGTATGTGGC	TksAksTdsTdsAdsGdsAdsGdsTdsAds	15	2812
						TdsGksTesGksGesmCk
1198819	2567	2582	123592	123607	ATATTAGAGTATGTGG	AksTksAdsTdsTdsAdsGdsAdsGdsTds	44	2813
						AdsTksGesTksGesGk
1198820	2568	2583	123593	123608	TATATTAGAGTATGTG	TksAksTdsAdsTdsTdsAdsGdsAdsGds	62	2814
						TdsAksTesGksTesGk
1198821	2570	2585	123595	123610	TCTATATTAGAGTATG	TksmCksTdsAdsTdsAdsTdsTdsAds	62	887
						GdsAdsGksTesAksTesGk
1198822	4436	4451	125461	125476	TATAACTGGGCAAATT	TksAksTdsAdsAdsmCdsTdsGdsGds	97	2815
						GdsmCdsAksAesAksTesTk
1198823	4438	4453	125463	125478	GGTATAACTGGGCAAA	GksGksTdsAdsTdsAdsAdsmCdsTds	65	1427
						GdsGdsGksmCesAksAesAk
1198824	4439	4454	125464	125479	AGGTATAACTGGGCAA	AksGksGdsTdsAdsTdsAdsAdsmCds	72	905
						TdsGdsGksGesmCksAesAk
1198825	4440	4455	125465	125480	GAGGTATAACTGGGCA	GksAksGdsGdsTdsAdsTdsAdsAdsm	64	1503
						CdsTdsGksGesGksmCesAk
1198826	4446	4461	125471	125486	AACACTGAGGTATAAC	AksAksmCdsAdsmCdsTdsGdsAdsGds	64	2816
						GdsTdsAksTesAksAesmCk
1198827	4595	4610	125620	125635	TTACATTAGGAACAAG	TksTksAdsmCdsAdsTdsTdsAdsGds	60	2817
						GdsAdsAksmCesAksAesGk
1198828	4597	4612	125622	125637	TTTTACATTAGGAACA	TksTksTdsTdsAdsmCdsAdsTdsTdsAds	59	2818
						GdsGksAesAksmCesAk
1198829	4598	4613	125623	125638	CTTTTACATTAGGAAC	mCksTksTdsTdsTdsAdsmCdsAdsTds	36	1124
						TdsAdsGksGesAksAesmCk
1198830	4599	4614	125624	125639	ACTTTTACATTAGGAA	AksmCksTdsTdsTdsTdsAdsmCdsAds	37	2819
						TdsTdsAksGesGksAesAk
1198831	4600	4615	125625	125640	CACTTTTACATTAGGA	mCksAksmCdsTdsTdsTdsTdsAdsmCds	12	1200
						AdsTdsTksAesGksGesAk
1198832	4601	4616	125626	125641	GCACTTTTACATTAGG	GksmCksAdsmCdsTdsTdsTdsTdsAdsm	20	1276
						CdsAdsTksTesAksGesGk
1198833	4602	4617	125627	125642	AGCACTTTTACATTAG	AksmCdsAdsmCdsTdsTdsTdsTds	54	2820
						AdsmCdsAksTesTksAesGk
1198834	4603	4618	125628	125643	AAGCACTTTTACATTA	AksAksGdsmCdsAdsmCdsTdsTdsTds	54	2821
						TdsAdsmCksAesTksTesAk
1198835	4605	4620	125630	125645	TTAAGCACTTTTACAT	TksTksAdsAdsGdsmCdsAdsmCdsTds	85	2822
						TdsTdsTksAesmCksAesTk
1198836	4795	4810	125820	125835	GGAAGATCTGAAACTC	GksGksAdsAdsGdsAdsTdsmCdsTds	43	2823
						GdsAdsAksAesmCksTesmCk
1198837	4797	4812	125822	125837	TTGGAAGATCTGAAAC	TksTksGdsGdsAdsAdsGdsAdsTdsm	66	2824
						CdsTdsGksAesAksAesmCk
1198838	4798	4813	125823	125838	TTTGGAAGATCTGAAA	TksTksTdsGdsGdsAdsAdsGdsAdsTds	66	2825
						mCdsTksGesAksAesAk
1198839	4799	4814	125824	125839	CTTTGGAAGATCTGAA	mCksTksTdsTdsGdsGdsAdsAdsGds	36	2826
						AdsTdsmCksTesGksAesAk
1198840	4800	4815	125825	125840	GCTTTGGAAGATCTGA	GksmCksTdsTdsTdsGdsGdsAdsAds	26	2044
						GdsAdsTksmCesTksGesAk
1198841	4801	4816	125826	125841	TGCTTTGGAAGATCTG	TksGksmCdsTdsTdsTdsGdsGdsAds	116	2121
						AdsGdsAksTesmCksTesGk
1198842	4802	4817	125827	125842	GTGCTTTGGAAGATCT	GksTksGdsmCdsTdsTdsTdsGdsGds	37	2827
						AdsAdsGksAesTksmCesTk
1198843	4803	4818	125828	125843	AGTGCTTTGGAAGATC	AksGksTdsGdsmCdsTdsTdsTdsGds	45	2828
						GdsAdsAksGesAksTesmCk
1198844	4805	4820	125830	125845	ATAGTGCTTTGGAAGA	AksTksAdsGdsTdsGdsmCdsTdsTds	56	2829
						TdsGdsGksAesAksGesAk
1198845	N/A	N/A	94729	94744	AGGATGCATGGTTTTT	AksGksGdsAdsTdsGdsmCdsAdsTds	43	2830
						GdsGdsTksTesTksTesTk
1198846	N/A	N/A	94731	94746	TTAGGATGCATGGTTT	TksTksAdsGdsGdsAdsTdsGdsmCds	34	2831
						AdsTdsGksGesTksTesTk
1198847	N/A	N/A	94732	94747	TTTAGGATGCATGGTT	TksTksTdsAdsGdsGdsAdsTdsGdsm	51	2832
						CdsAdsTksGesGksTesTk
1198848	N/A	N/A	94733	94748	ATTTAGGATGCATGGT	AksTksTdsTdsAdsGdsGdsAdsTdsGds	47	2833
						mCdsAksTesGksGesTk
1198849	N/A	N/A	94734	94749	GATTTAGGATGCATGG	GksAksTdsTdsTdsAdsGdsGdsAdsTds	42	2834
						GdsmCksAesTksGesGk
1198850	N/A	N/A	94735	94750	AGATTTAGGATGCATG	AksGksAdsTdsTdsTdsAdsGdsGdsAds	33	2835
						TdsGksmCesAksTesGk
1198851	N/A	N/A	94736	94751	CAGATTTAGGATGCAT	mCksAksGdsAdsTdsTdsTdsAdsGds	82	2836
						GdsAdsTksGesmCksAesTk
1198852	N/A	N/A	94737	94752	TCAGATTTAGGATGCA	TksmCksAdsGdsAdsTdsTdsTdsAds	41	2837
						GdsGdsAksTesGksmCesAk
1198853	N/A	N/A	94739	94754	ATTCAGATTTAGGATG	AksTksTdsmCdsAdsGdsAdsTdsTds	105	2838
						TdsAdsGksGesAksTesGk
1198854	N/A	N/A	115903	115918	ATATGGTTTTGTGTGT	AksTksAdsTdsGdsGdsTdsTdsTdsTds	56	2839
						GdsTksGesTksGesTk
1198855	N/A	N/A	115905	115920	TTATATGGTTTTGTGT	TksTksAdsTdsAdsTdsGdsGdsTdsTds	30	2840
						TdsTksGesTksGesTk
1198856	N/A	N/A	115906	115921	CTTATATGGTTTTGTG	mCksTksTdsAdsTdsAdsTdsGdsGds	20	2788
						TdsTdsTksTesGksTesGk
1198857	N/A	N/A	115907	115922	TCTTATATGGTTTTGT	TksmCksTdsTdsAdsTdsAdsTdsGds	19	2841
						GdsTdsTksTesTksGesTk
1198863	N/A	N/A	117325	117340	ATTGCAATCTGTCTGA	AksTksTdsGdsmCdsAdsAdsTdsmCds	65	2843
						TdsGdsTksmCesTksGesAk
1198864	N/A	N/A	117327	117342	ATATTGCAATCTGTCT	AksTksAdsTdsTdsGdsmCdsAdsAds	56	2844
						TdsmCdsTksGesTksmCesTk
1198865	N/A	N/A	117328	117343	AATATTGCAATCTGTC	AksAdsTdsTdsGdsmCdsAds	38	2845
						dAsTdsmCksTesGksTesmCk
1198866	N/A	N/A	117329	117344	TAATATTGCAATCTGT	TksAksAdsTdsAdsTdsTdsGdsmCds	60	2846
						AdsAdsTksmCesTksGesTk
1198867	N/A	N/A	117330	117345	GTAATATTGCAATCTG	GksTksAdsAdsTdsAdsTdsTdsGdsm	25	1404
						CdsAdsAksTesmCksTesGk
1198868	N/A	N/A	117331	117346	TGTAATATTGCAATCT	TksGksTdsAdsAdsTdsAdsTdsTdsGds	49	2847
						mCdsAksAesTksmCesTk
1198869	N/A	N/A	117332	117347	ATGTAATATTGCAATC	AksTksGdsTdsAdsAdsTdsAdsTdsTds	49	2848
						GdsmCksAesAksTesmCk
1198870	N/A	N/A	117333	117348	TATGTAATATTGCAAT	TksAksTdsGdsTdsAdsAdsTdsAdsTds	86	2849
						TdsGksmCesAksAesTk
1198871	N/A	N/A	117335	117350	TTTATGTAATATTGCA	TksTksTdsAdsTdsGdsTdsAdsAdsTds	77	2850
						AdsTksTesGksmCesAk
1198881	N/A	N/A	119667	119682	TAAGGTTTCCCAGATT	TksAksAdsGdsGdsTdsTdsTdsmCdsm	36	2851
						CdsmCdsAksGesAksTesTk
1198882	N/A	N/A	119669	119684	AGTAAGGTTTCCCAGA	AksGksTdsAdsAdsGdsGdsTdsTdsTds	56	2852
						mCdsmCksmCesAksGesAk
1198883	N/A	N/A	119670	119685	AAGTAAGGTTTCCCAG	AksAksGdsTdsAdsAdsGdsGdsTdsTds	47	2853
						TdsmCksmCesmCksAesGk
1198884	N/A	N/A	119671	119686	TAAGTAAGGTTTCCCA	TksAksAdsGdsTdsAdsAdsGdsGdsTds	28	2854
						TdsTksmCesmCksmCesAk
1198885	N/A	N/A	119672	119687	CTAAGTAAGGTTTCCC	mCksTksAdsAdsGdsTdsAdsAdsGds	41	1101
						GdsTdsTksTesmCksmCesmCk
1198886	N/A	N/A	119673	119688	ACTAAGTAAGGTTTCC	AksmCksTdsAdsAdsGdsTdsAdsAds	45	2855
						GdsGdsTksTesTksmCesmCk
1198887	N/A	N/A	119674	119689	GACTAAGTAAGGTTTC	GksAksmCdsTdsAdsAdsGdsTdsAds	71	2856
						AdsGdsGksTesTksTesmCk
1198888	N/A	N/A	119675	119690	AGACTAAGTAAGGTTT	AksGksAdsmCdsTdsAdsAdsGdsTds	51	2857
						AdsAdsGksGesTksTesTk
1198889	N/A	N/A	119677	119692	TTAGACTAAGTAAGGT	TksTksAdsGdsAdsmCdsTdsAdsAds	27	2858
						GdsTdsAksAesGksGesTk
1198966	N/A	N/A	117765	117780	AACTTTAAAGTGTATG	AksAksmCdsTdsTdsTdsAdsAdsAds	78	2870
						GdsTdsGksTdsAksTdsGk

TABLE 47
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
	SEQ	SEQ	SEQ	SEQ
	ID	ID	ID	ID
	NO: 1	NO: 1	NO: 2	NO: 2			YAP1	SEQ
Compound	Start	Stop	Start	Stop	Sequence		(%	ID
Number	Site	Site	Site	Site	(5′ to 3′)	CHEMSITRY NOTATION	UTC)	NO
715487	3630	3645	124655	124670	ATTACTTCATAGCTTA	AksTksTksAdsmCdsTdsTdsmCdsAds	39	52
						TdsAdsGdsmCdsTksTksAk
716444	2528	2543	123553	123568	AAATTGTCTCATGCCT	AksAksAksTdsTdsGdsTdsmCdsTdsm	46	443
						CdsAdsTdsGdsmCksmCksTk
958497	2534	2549	123559	123574	ATATGGAAATTGTCTC	AksTksAksTdsGdsGdsAdsAdsAdsTds	20	656
						TdsGdsTdsmCksTksmCk
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTksAdsGdsAdsGdsTdsAdsTds	17	810
						GdsTdsGdsGksmCksAk
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTksAdsGdsAdsGdsTdsAdsTds	10	810
						GdsTdsGdsGksmCksAk
958500	2570	2585	123595	123610	TCTATATTAGAGTATG	TksmCksTksAdsTdsAdsTdsTdsAds	53	887
						GdsAdsGdsTdsAksTksGk
1009324	2560	2575	36419	36434	AGTATGTGGCAATAAT	AksGksTksAdsTdsGdsTdsGdsGdsm	27	2809
			63341	63356		CdsAdsAdsTdsAksAksTk
			123585	123600
1009325	2562	2577	63343	63358	AGAGTATGTGGCAATA	AksGksAksGdsTdsAdsTdsGdsTdsGds	16	2810
			71690	71705		GdsmCdsAdsAksTksAk
			123587	123602
1009326	2566	2581	123591	123606	TATTAGAGTATGTGGC	TksAksTksTdsAdsGdsAdsGdsTdsAds	10	2812
						TdsGdsTdsGksGksmCk
1009327	2567	2582	123592	123607	ATATTAGAGTATGTGG	AksTksAksTdsTdsAdsGdsAdsGdsTds	27	2813
						AdsTdsGdsTksGksGk
1009328	2568	2583	123593	123608	TATATTAGAGTATGTG	TksAksTksAdsTdsTdsAdsGdsAdsGds	67	2814
						TdsAdsTdsGksTksGk
1009394	2223	2238	123248	123263	TATAACTGGGCAAATT	TksAksTksAdsAdsmCdsTdsGdsGds	73	2815
	4436	4451	125461	125476		GdsmCdsAdsAdsAksTksTk
1074461	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAksAdsTdsTdsGdsTdsCds	5	2800
						TdsmCdsAdsTdsGksmCksmCk
1074462	2530	2545	123555	123570	GGAAATTGTCTCATGC	GksGksAksAdsAdsTdsTdsGdsTdsm	7	2806
						CdsTdsmCdsAdsTksGksmCk
1074463	2563	2578	123588	123603	TAGAGTATGTGGCAAT	TksAksGksAdsGdsTdsAdsTdsGdsTds	20	2811
						GdsGdsmCdsAksAksTk
1074464	2564	2579	123589	123604	TTAGAGTATGTGGCAA	TksTksAksGdsAdsGdsTdsAdsTdsGds	5	963
						TdsGdsGdsmCksAksAk
1074754	4598	4613	125623	125638	CTTTTACATTAGGAAC	mCksTksTksTdsTdsAdsmCdsAdsTds	69	1124
						TdsAdsGdsGdsAksAksmCk
1074755	4600	4615	125625	125640	CACTTTTACATTAGGA	mCksAksmCksTdsTdsTdsTdsAdsmCds	23	1200
						AdsTdsTdsAdsGksGksAk
1074756	4601	4616	125626	125641	GCACTTTTACATTAGG	GksmCksAdsmCdsTdsTdsTdsTdsAdsm	8	1276
						CdsAdsTdsTdsAksGksGk
1074798	4800	4815	125825	125840	GCTTTGGAAGATCTGA	GksmCksTksTdsTdsGdsGdsAdsAds	19	2044
						GdsAdsTdsmCdsTksGksAk
1074799	4801	4816	125826	125841	TGCTTTGGAAGATCTG	TksGksmCksTdsTdsTdsGdsGdsAds	21	2121
						AdsGdsAdsTdsmCksTksGk
1076186	N/A	N/A	94733	94748	ATTTAGGATGCATGGT	AksTksTksTdsAdsGdsGdsAdsTdsGds	31	2833
						mCdsAdsTdsGksGksTk
1076187	N/A	N/A	94734	94749	GATTTAGGATGCATGG	GksAksTksTdsTdsAdsGdsGdsAdsTds	17	2834
						GdsmCdsAdsTksGksGk
1076453	N/A	N/A	117330	117345	GTAATATTGCAATCTG	GksTksAksAdsTdsAdsTdsTdsGdsm	7	1404
						CdsAdsAdsTdsmCksTksGk
1076481	N/A	N/A	119672	119687	CTAAGTAAGGTTTCCC	mCksTksAksAdsGdsTdsAdsAdsGds	13	1101
						GdsTdsTdsTdsmCksmCksmCk
1096369	4802	4817	125827	125842	GTGCTTTGGAAGATCT	GksTksGksmCdsTdsTdsTdsGdsGds	45	2827
						AdsAdsGdsAdsTksmCksTk
1097037	N/A	N/A	94735	94750	AGATTTAGGATGCATG	AksGksAksTdsTdsTdsAdsGdsGdsAds	38	2835
						TdsGdsmCdsAksTksGk
1097238	N/A	N/A	117325	117340	ATTGCAATCTGTCTGA	AksTksTksGdsmCdsAdsAdsTdsmCds	77	2843
						TdsGdsTdsmCdsTksGksAk
1197176	2524	2539	123549	123564	TGTCTCATGCCTTATA	TksGksTksmCdsTdsmCdsAdsTdsGdsm	17	2803
						CdsmCdsTdsTdsAksTksAk
1197177	2526	2541	123551	123566	ATTGTCTCATGCCTTA	AksTksTksGdsTdsmCdsTdsmCdsAds	15	2804
						TdsGdsmCdsmCdsTksTksAk
1197178	2527	2542	123552	123567	AATTGTCTCATGCCTT	AksAksTksTdsGdsTdsmCdsTdsmCds	12	2805
						AdsTdsGdsmCdsmCksTksTk
1197179	2531	2546	123556	123571	TGGAAATTGTCTCATG	TksGksGksAdsAdsAdsTdsTdsGdsTds	16	2807
						mCdsTdsmCdsAksTksGk
1197180	2532	2547	123557	123572	ATGGAAATTGTCTCAT	AksTksGksGdsAdsAdsAdsTdsTdsGds	47	2808
						TdsmCdsTdsmCksAksTk
1197181	4595	4610	125620	125635	TTACATTAGGAACAAG	TksTksAksmCdsAdsTdsTdsAdsGds	87	2817
						GdsAdsAdsmCdsAksAksGk
1197182	4597	4612	125622	125637	TTTTACATTAGGAACA	TksTksTksTdsAdsmCdsAdsTdsTds	115	2818
						AdsGdsGdsAdsAksmCksAk
1197183	4599	4614	125624	125639	ACTTTTACATTAGGAA	AksmCksTksTdsTdsTdsAdsmCdsAds	41	2819
						TdsTdsAdsGdsGksAksAk
1197184	4602	4617	125627	125642	AGCACTTTTACATTAG	AksGksmCksAdsmCdsTdsTdsTdsTds	20	2820
						AdsmCdsAdsTdsTksAksGk
1197185	4603	4618	125628	125643	AAGCACTTTTACATTA	AksAksGksmCdsAdsmCdsTdsTdsTds	55	2821
						TdsAdsmCdsAdsTksTksAk
1197186	4605	4620	125630	125645	TTAAGCACTTTTACAT	TksTksAksAdsGdsmCdsAdsmCdsTds	65	2822
						TdsTdsTdsAdsmCksAksTk
1197187	4795	4810	125820	125835	GGAAGATCTGAAACTC	GksGksAksAdsGdsAdsTdsmCdsTds	24	2823
						GdsAdsAdsAdsmCksTksmCk
1197188	4797	4812	125822	125837	TTGGAAGATCTGAAAC	TksTksGksGdsAdsAdsGdsAdsTdsm	96	2824
						CdsTdsGdsAdsAksAksmCk
1197189	4798	4813	125823	125838	TTTGGAAGATCTGAAA	TksTksTksGdsGdsAdsAdsGdsAdsTds	71	2825
						mCdsTdsGdsAksAksAk
1197190	4799	4814	125824	125839	CTTTGGAAGATCTGAA	mCksTksTksTdsGdsGdsAdsAdsGds	57	2826
						AdsTdsmCdsTdsGksAksAk
1197191	4803	4818	125828	125843	AGTGCTTTGGAAGATC	AksGksTksGdsmCdsTdsTdsTdsGds	40	2828
						GdsAdsAdsGdsAksTksmCk
1197192	4805	4820	125830	125845	ATAGTGCTTTGGAAGA	AksTksAksGdsTdsGdsmCdsTdsTds	39	2829
						TdsGdsGdsAdsAksGksAk
1197193	N/A	N/A	94729	94744	AGGATGCATGGTTTTT	AksGksGksAdsTdsGdsmCdsAdsTds	15	2830
						GdsGdsTdsTdsTksTksTk
1197194	N/A	N/A	94731	94746	TTAGGATGCATGGTTT	TksTksAksGdsGdsAdsTdsGdsmCds	37	2831
						AdsTdsGdsGdsTksTksTk
1197195	N/A	N/A	94732	94747	TTTAGGATGCATGGTT	TksTksTksAdsGdsGdsAdsTdsGdsm	38	2832
						CdsAdsTdsGdsGksTksTk
1197196	N/A	N/A	94736	94751	CAGATTTAGGATGCAT	mCksAksGksAdsTdsTdsTdsAdsGds	27	2836
						GdsAdsTdsGdsmCksAksTk
1197197	N/A	N/A	94737	94752	TCAGATTTAGGATGCA	TksmCksAksGdsAdsTdsTdsTdsAds	20	2837
						GdsGdsAdsTdsGksmCksAk
1197198	N/A	N/A	94739	94754	ATTCAGATTTAGGATG	AksTksTksmCdsAdsGdsAdsTdsTds	139	2838
						TdsAdsGdsGdsAksTksGk
1197206	N/A	N/A	117327	117342	ATATTGCAATCTGTCT	AksTksAksTdsTdsGdsmCdsAdsAds	63	2844
						TdsmCdsTdsGdsTksmCksTk
1197207	N/A	N/A	117328	117343	AATATTGCAATCTGTC	AksAksTksAdsTdsTdsGdsmCdsAds	51	2845
						AdsTdsmCdsTdsGksTksmCk
1197208	N/A	N/A	117329	117344	TAATATTGCAATCTGT	TksAksAksTdsAdsTdsTdsGdsmCds	66	2846
						AdsAdsTdsmCdsTksGksTk
1197209	N/A	N/A	117331	117346	TGTAATATTGCAATCT	TksGksTksAdsAdsTdsAdsTdsTdsGds	33	2847
						mCdsAdsAdsTksmCksTk
1197210	N/A	N/A	117332	117347	ATGTAATATTGCAATC	AksTksGksTdsAdsAdsTdsAdsTdsTds	105	2848
						GdsmCdsAdsAksTksmCk
1197211	N/A	N/A	117333	117348	TATGTAATATTGCAAT	TksAksTksGdsTdsAdsAdsTdsAdsTds	80	2849
						TdsGdsmCdsAksAksTk
1197212	N/A	N/A	117335	117350	TTTATGTAATATTGCA	TksTksTksAdsTdsGdsTdsAdsAdsTds	55	2850
						AdsTdsTdsGksmCksAk
1197220	N/A	N/A	119667	119682	TAAGGTTTCCCAGATT	TksAksAksGdsGdsTdsTdsTdsmCdsm	32	2851
						CdsmCdsAdsGdsAksTksTk
1197221	N/A	N/A	119669	119684	AGTAAGGTTTCCCAGA	AksGksTksAdsAdsGdsGdsTdsTdsTds	42	2852
						mCdsmCdsmCdsAksGksAk
1197222	N/A	N/A	119670	119685	AAGTAAGGTTTCCCAG	AksAksGksTdsAdsAdsGdsGdsTdsTds	40	2853
						TdsmCdsmCdsmCksAksGk
1197223	N/A	N/A	119671	119686	TAAGTAAGGTTTCCCA	TksAksAksGdsTdsAdsAdsGdsGdsTds	11	2854
						TdsTdsmCdsmCksmCksAk
1197224	N/A	N/A	119673	119688	ACTAAGTAAGGTTTCC	AksmCksTksAdsAdsGdsTdsAdsAds	24	2855
						GdsGdsTdsTdsTksmCksmCk
1197225	N/A	N/A	119674	119689	GACTAAGTAAGGTTTC	GksAksmCksTdsAdsAdsGdsTdsAds	46	2856
						AdsGdsGdsTdsTksTksmCk
1197226	N/A	N/A	119675	119690	AGACTAAGTAAGGTTT	AksGksAksmCdsTdsAdsAdsGdsTds	67	2857
						AdsAdsGdsGdsTksTksTk
1197227	N/A	N/A	119677	119692	TTAGACTAAGTAAGGT	TksTksAksGdsAdsmCdsTdsAdsAds	64	2858
						GdsTdsAdsAdsGksGksTk
1198858	N/A	N/A	115908	115923	CTCTTATATGGTTTTG	mCksTksmCdsTdsTdsAdsTdsAdsTds	29	2842
						GdsGdsTksTesTksTesGk
1198859	N/A	N/A	115909	115924	ACTCTTATATGGTTTT	AksmCksTdsmCdsTdsTdsAdsTdsAds	33	2859
						TdsGdsGksTesTksTesTk
1198860	N/A	N/A	115910	115925	AACTCTTATATGGTTT	AksAksmCdsTdsmCdsTdsTdsAdsTds	82	2860
						AdsTdsGksGesTksTesTk
1198861	N/A	N/A	115911	115926	CAACTCTTATATGGTT	mCksAksAdsmCdsTdsmCdsTdsTds	100	2861
						AdsTdsAdsTksGesGksTesTk
1198862	N/A	N/A	115913	115928	GACAACTCTTATATGG	GksAksmCdsAdsAdsmCdsTdsmCds	72	2862
						TdsTdsAdsTksAesTksGesGk
1198872	N/A	N/A	117755	117770	TGTATGTCAGAAGAGT	TksGksTdsAdsTdsGdsTdsmCdsAds	8	2863
						GdsAdsAksGesAksGesTk
1198873	N/A	N/A	117757	117772	AGTGTATGTCAGAAGA	AksGdsTdsGdsTdsAdsTdsGdsTdsm	4	2864
						CdsAdsGksAesAksGesAk
1198874	N/A	N/A	117758	117773	AAGTGTATGTCAGAAG	AksAksGdsTdsGdsTdsAdsTdsGdsTds	2	2865
						mCdsAksGesAksAesGk
1198875	N/A	N/A	117759	117774	AAAGTGTATGTCAGAA	AksAksAdsGdsTdsGdsTdsAdsTdsGds	5	2866
						TdsmCksAesGksAesAk
1198876	N/A	N/A	117760	117775	TAAAGTGTATGTCAGA	TksAksAdsAdsGdsTdsGdsTdsAdsTds	31	2867
						GdsTksmCesAksGesAk
1198877	N/A	N/A	117761	117776	TTAAAGTGTATGTCAG	TksTksAdsAdsAdsGdsTdsGdsTdsAds	11	2868
						TdsGksTesmCksAesGk
1198878	N/A	N/A	117762	117777	TTTAAAGTGTATGTCA	TksTksTdsAdsAdsAdsGdsTdsGdsTds	42	2869
						AdsTksGesTksmCesAk
1198879	N/A	N/A	117763	117778	CTTTAAAGTGTATGTC	mCksTksTdsTdsAdsAdsAdsGdsTds	29	1634
						GdsTdsAksTesGksTesmCk
1198880	N/A	N/A	117765	117780	AACTTTAAAGTGTATG	AksAksmCdsTdsTdsTdsAdsAdsAds	98	2870
						GdsTdsGksTesAksTesGk

TABLE 48
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
	SEQ	SEQ	SEQ	SEQ
	ID	ID	ID	ID
	NO: 1	NO: 1	NO: 2	NO: 2			YAP1	SEQ
Compound	Start	Stop	Start	Stop	Sequence		(%	ID
Number	Site	Site	Site	Site	(5′ to 3′)	CHEMSITRY NOTATION	UTC)	NO
715487	3630	3645	124655	124670	ATTACTTCATAGCTTA	AksTksTksAdsmCdsTdsTdsmCdsAds	34	52
						TdsAdsGdsmCdsTksTksAk
716524	4443	4458	125468	125483	ACTGAGGTATAACTGG	AksmCksTksGdsAdsGdsGdsTdsAds	59	392
						TdsAdsAdsmCdsTksGksGk
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTksAdsGdsAdsGdsTdsAdsTds	15	810
						GdsTdsGdsGksmCksAk
958590	4439	4454	125464	125479	AGGTATAACTGGGCAA	AksGksGksTdsAdsTdsAdsAdsmCds	18	905
						TdsGdsGdsGdsmCksAksAk
1009395	4442	4457	125467	125482	CTGAGGTATAACTGGG	mCksTksGksAdsGdsGdsTdsAdsTds	43	2801
						AdsAdsmCdsTdsGksGksGk
1009396	4444	4459	106028	106043	CACTGAGGTATAACTG	mCksAksmCksTdsGdsAdsGdsGdsTds	41	2802
			125469	125484		AdsTdsAdsAdsmCksTksGk
1009397	4446	4461	106030	106045	AACACTGAGGTATAAC	AksAksmCksAdsmCdsTdsGdsAdsGds	44	2816
			125471	125486		GdsTdsAdsTdsAksAksmCk
1074461	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAksAdsTdsTdsGdsTdsmCds	20	2800
						TdsmCdsAdsTdsGksmCksmCk
1074726	4438	4453	125463	125478	GGTATAACTGGGCAAA	GksGksTksAdsTdsAdsAdsmCdsTds	23	1427
						GdsGdsGdsmCdsAksAksAk
1074727	4440	4455	125465	125480	GAGGTATAACTGGGCA	GksAksGksGdsTdsAdsTdsAdsAdsm	51	1503
						CdsTdsGdsGdsGksmCksAk
1074728	4441	4456	125466	125481	TGAGGTATAACTGGGC	TksGksAksGdsGdsTdsAdsTdsAdsAds	14	1580
						mCdsTdsGdsGksGksmCk
1076439	N/A	N/A	115906	115921	CTTATATGGTTTTGTG	mCksTksTksAdsTdsAdsTdsGdsGds	31	2788
						TdsTdsTdsTdsGksTksGk
1076456	N/A	N/A	117763	117778	CTTTAAAGTGTATGTC	mCksTksTksTdsAdsAdsAdsGdsTds	44	1634
						GdsTdsAdsTdsGksTksmCk
1097224	N/A	N/A	115908	115923	CTCTTATATGGTTTTG	mCksTksmCksTdsTdsAdsTdsAdsTds	22	2842
						GdsGdsTdsTdsTksTksGk
1097247	N/A	N/A	117760	117775	TAAAGTGTATGTCAGA	TksAksAksAdsGdsTdsGdsTdsAdsTds	9	2867
						GdsTdsmCdsAksGksAk
1197199	N/A	N/A	115903	115918	ATATGGTTTTGTGTGT	AksTksAksTdsGdsGdsTdsTdsTdsTds	75	2839
						GdsTdsGdsTksGksTk
1197200	N/A	N/A	115905	115920	TTATATGGTTTTGTGT	TksTksAksTdsAdsTdsGdsGdsTdsTds	49	2840
						TdsTdsGdsTksGksTk
1197201	N/A	N/A	115907	115922	TCTTATATGGTTTTGT	TksmCTksTdsAdsTdsAdsTdsGdsGds	46	2841
						TdsTdsTdsTksGksTk
1197202	N/A	N/A	115909	115924	ACTCTTATATGGTTTT	AksmCksTksmCdsTdsTdsAdsTdsAds	27	2859
						TdsGdsGdsTdsTksTksTk
1197203	N/A	N/A	115910	115925	AACTCTTATATGGTTT	AksAksmCksTdsmCdsTdsTdsAdsTds	68	2860
						AdsTdsGdsGdsTksTksTk
1197204	N/A	N/A	115911	115926	CAACTCTTATATGGTT	mCksAksAksmCdsTdsmCdsTdsTds	89	2861
						AdsTdsAdsTdsGdsGksTksTk
1197205	N/A	N/A	115913	115928	GACAACTCTTATATGG	GksAksmCksAdsAdsmCdsTdsmCds	67	2862
						TdsTdsAdsTdsAdsTksGksGk
1197213	N/A	N/A	117755	117770	TGTATGTCAGAAGAGT	TksGksTksAdsTdsGdsTdsmCdsAds	5	2863
						GdsAdsAdsGdsAksGksTk
1197214	N/A	N/A	117757	117772	AGTGTATGTCAGAAGA	AksGksTksGdsTdsAdsTdsGdsTdsm	5	2864
						CdsAdsGdsAdsAksGksAk
1197215	N/A	N/A	117758	117773	AAGTGTATGTCAGAAG	AksAksGksTdsGdsTdsAdsTdsGdsTds	13	2865
						mCdsAdsGdsAksAksGk
1197216	N/A	N/A	117759	117774	AAAGTGTATGTCAGAA	AksAksAksGdsTdsGdsTdsAdsTdsGds	12	2866
						TdsmCdsAdsGksAksAk
1197217	N/A	N/A	117761	117776	TTAAAGTGTATGTCAG	TksTksAksAdsAdsTdsTdsGdsTdsAds	8	2868
						TdsGdsTdsmCksAksGk
1197218	N/A	N/A	117762	117777	TTTAAAGTGTATGTCA	TksTksTksAdsAdsAdsGdsTdsGdsTds	29	2869
						AdsTdsGdsTksmCksAk
1197219	N/A	N/A	117765	117780	AACTTTAAAGTGTATG	AksAksmCksTdsTdsTdsAdsAdsAds	71	2870
						GdsTdsGdsTdsAksTksGk
1198284	2524	2539	123549	123564	TGTCTCATGCCTTATA	TksGksTksmCdsTdsmCdsAdsTdsGdsm	27	2803
						CdsmCdsTdsTksAesTksAe
1198285	2526	2541	123551	123566	ATTGTCTCATGCCTTA	AksTksTksGdsTdsmCdsTdsmCdsAds	13	2804
						TdsGdsmCdsmCksTesTksAe
1198286	2527	2542	123552	123567	AATTGTCTCATGCCTT	AksAksTksTdsGdsTdsmCdsTdsmCds	17	2805
						AdsTdsGdsmCksmCesTksTe
1198287	2528	2543	123553	123568	AAATTGTCTCATGCCT	AksAksAksTdsTdsGdsTdsmCdsTdsm	13	443
						CdsAdsTdsGksmCesmCksTe
1198288	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAksAdsTdsTdsGdsTdsmCds	10	2800
						TdsmCdsAdsTksGesmCksmCe
1198289	2530	2545	123555	123570	GGAAATTGTCTCATGC	GksGksAksAdsAdsTdsTdsGdsTdsm	12	2806
						CdsTdsmCdsAksTesGksmCe
1198290	2531	2546	123556	123571	TGGAAATTGTCTCATG	TksGksGksAdsAdsAdsTdsTdsGdsTds	15	2807
						mCdsTdsmCksAesTksGe
1198291	2532	2547	123557	123572	ATGGAAATTGTCTCAT	AksTksGksGdsAdsAdsAdsTdsTdsGds	58	2808
						TdsmCdsTksmCesAksTe
1198292	2534	2549	123559	123574	ATATGGAAATTGTCTC	AksTksAksTdsGdsGdsAdsAdsAdsTds	58	656
						TdsGdsTksmCesTksmCe
1198293	2560	2575	123585	123600	AGTATGTGGCAATAAT	AksGksTksAdsTdsGdsTdsGdsGdsm	25	2809
						CdsAdsAdsTksAesAksTe
1198294	2562	2577	123587	123602	AGAGTATGTGGCAATA	AksGksAksGdsTdsAdsTdsGdsTdsGds	13	2810
						GdsmCdsAksAesTksAe
1198295	2563	2578	123588	123603	TAGAGTATGTGGCAAT	TksAksGksAdsGdsTdsAdsTdsGdsTds	15	2811
						GdsGdsmCksAesAksTe
1198296	2564	2579	123589	123604	TTAGAGTATGTGGCAA	TksTksAksGdsAdsGdsAdsTdsGds	29	963
						TdsGdsGksmCesAksAe
1198297	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTksAdsGdsAdsGdsTdsAdsTds	8	810
						GdsTdsGksGesmCksAe
1198298	2566	2581	123591	123606	TATTAGAGTATGTGGC	TksAksTksTdsAdsGdsAdsGdsTdsAds	23	2812
						TdsGdsTksGesGksmCe
1198299	2567	2582	123592	123607	ATATTAGAGTATGTGG	AksTksAksTdsTdsAdsGdsAdsGdsTds	27	2813
						AdsTdsGksTesGksGe
1198300	2568	2583	123593	123608	TATATTAGAGTATGTG	TksAksTksAdsTdsTdsAdsGdsAdsGds	60	2814
						TdsAdsTksGesTksGe
1198301	2570	2585	123595	123610	TCTATATTAGAGTATG	TksmCksTksAdsTdsAdsTdsTdsAds	43	887
						GdsAdsGdsTksAesTksGe
1198307	4595	4610	125620	125635	TTACATTAGGAACAAG	TksTksAksmCdsAdsTdsTdsAdsGds	49	2817
						GdsAdsAdsmCksAesAksGe
1198308	4597	4612	125622	125637	TTTTACATTAGGAACA	TksTksTksTdsAdsmCdsAdsTdsTds	68	2818
						AdsGdsGdsAksAesmCksAe
1198309	4598	4613	125623	125638	CTTTTACATTAGGAAC	mCksTksTksTdsTdsAdsmCdsAdsTds	85	1124
						TdsAdsGdsGksAesAksmCe
1198310	4599	4614	125624	125639	ACTTTTACATTAGGAA	AksmCksTksTdsTdsTdsAdsmCdsAds	28	2819
						TdsTdsAdsGksGesAksAe
1198311	4600	4615	125625	125640	CACTTTTACATTAGGA	mCksAksmCksTdsTdsTdsTdsAdsmCds	39	1200
						AdsTdsTdsAksGesGksAe
1198312	4601	4616	125626	125641	GCACTTTTACATTAGG	GksmCksAksmCdsTdsTdsTdsTdsAdsm	7	1276
						CdsAdsTdsTksAesGksGe
1198313	4602	4617	125627	125642	AGCACTTTTACATTAG	AksGksmCksAdsmCdsTdsTdsTdsTds	31	2820
						AdsmCdsAdsTksTesAksGe
1198314	4603	4618	125628	125643	AAGCACTTTTACATTA	AksAksGksmCdsAdsmCdsTdsTdsTds	82	2821
						TdsAdsmCdsAksTesTksAe
1198315	4605	4620	125630	125645	TTAAGCACTTTTACAT	TksTksAksAdsGdsmCdsAdsmCdsTds	85	2822
						TdsTdsTdsAksmCesAksTe
1198316	4795	4810	125820	125835	GGAAGATCTGAAACTC	GksGksAksAdsGdsAdsTdsmCdsTds	49	2823
						GdsAdsAdsAksmCesTksmCe
1198317	4797	4812	125822	125837	TTGGAAGATCTGAAAC	TksTksGksGdsAdsAdsGdsAdsTdsm	74	2824
						CdsTdsGdsAksAesAksmCe
1198318	4798	4813	125823	125838	TTTGGAAGATCTGAAA	TksTksTksGdsGdsAdsAdsGdsAdsTds	120	2825
						mCdsTdsGksAesAksAe
1198319	4799	4814	125824	125839	CTTTGGAAGATCTGAA	mCksTksTksTdsGdsGdsAdsAdsGds	47	2826
						AdsTdsmCdsTksGesAksAe
1198320	4800	4815	125825	125840	GCTTTGGAAGATCTGA	GksmCksTksTdsTdsGdsGdsAdsAds	26	2044
						GdsAdsTdsmCksTesGksAe
1198321	4801	4816	125826	125841	TGCTTTGGAAGATCTG	TksGksmCksTdsTdsTdsGdsGdsAds	45	2121
						AdsGdsAdsTksmCesTksGe
1198322	4802	4817	125827	125842	GTGCTTTGGAAGATCT	GksTksGksmCdsTdsTdsTdsGdsGds	48	2827
						AdsAdsGdsAksTesmCksTe
1198323	4803	4818	125828	125843	AGTGCTTTGGAAGATC	AksGksTksGdsmCdsTdsTdsTdsGds	32	2828
						GdsAdsAdsGksAesTksmCe
1198324	4805	4820	125830	125845	ATAGTGCTTTGGAAGA	AksTksAksGdsTdsGdsmCdsTdsTds	53	2829
						TdsGdsGdsAksAesGksAe
1198325	N/A	N/A	94729	94744	AGGATGCATGGTTTTT	AksGksGksAdsTdsGdsmCdsAdsTds	34	2830
						GdsGdsTdsTksTesTksTe
1198326	N/A	N/A	94731	94746	TTAGGATGCATGGTTT	TksTksAksGdsGdsAdsTdsGdsmCds	84	2831
						AdsTdsGdsGksTesTksTe
1198327	N/A	N/A	94732	94747	TTTAGGATGCATGGTT	TksTksTksAdsGdsGdsAdsTdsGdsm	29	2832
						CdsAdsTdsGksGesTksTe
1198328	N/A	N/A	94733	94748	ATTTAGGATGCATGGT	AksTksTksTdsAdsGdsGdsAdsTdsGds	42	2833
						mCdsAdsTksGesGksTe
1198329	N/A	N/A	94734	94749	GATTTAGGATGCATGG	GksAksTksTdsTdsAdsGdsGdsAdsTds	36	2834
						GdsmCdsAksTesGksGe
1198330	N/A	N/A	94735	94750	AGATTTAGGATGCATG	AksGksAksTdsTdsTdsAdsGdsGdsAds	27	2934
						TdsGdsmCksAesTksGe
1198331	N/A	N/A	94736	94751	CAGATTTAGGATGCAT	mCksAksGksAdsTdsTdsTdsAdsGds	26	2836
						GdsAdsTdsGksmCesAksTe
1198332	N/A	N/A	94737	94752	TCAGATTTAGGATGCA	TksmCksAksGdsAdsTdsTdsTdsAds	58	2837
						GdsGdsAdsTksGesmCksAe
1198333	N/A	N/A	94739	94754	ATTCAGATTTAGGATG	AksTksTksmCdsAdsGdsAdsTdsTds	77	2838
						TdsAdsGdsGksAesTksGe
1198343	N/A	N/A	117325	117340	ATTGCAATCTGTCTGA	AksTksTksGdsmCdsAdsAdsTdsmCds	39	2843
						TdsGdsTdsmCksTesGksAe
1198344	N/A	N/A	117327	117342	ATATTGCAATCTGTCT	AksTksAksTdsTdsGdsmCdsAdsAds	55	2844
						TdsmCdsTdsGksTesmCksTe
1198345	N/A	N/A	117328	117343	AATATTGCAATCTGTC	AksAksTksAdsTdsTdsGdsmCdsAds	75	2845
						AdsTdsmCdsTksGesTksmCe
1198346	N/A	N/A	117329	117344	TAATATTGCAATCTGT	TksAksAksTdsAdsTdsTdsGdsmCds	40	2846
						AdsAdsTdsmCksTesGksTe
1198347	N/A	N/A	117330	117345	GTAATATTGCAATCTG	GksTksAksAdsTdsAdsTdsTdsGdsm	14	1404
						CdsAdsAdsTksmCesTksGe
1198348	N/A	N/A	117331	117346	TGTAATATTGCAATCT	TksGksTksAdsAdsTdsAdsTdsTdsGds	40	2847
						mCdsAdsAksTesmCksTe

TABLE 49
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
	SEQ	SEQ	SEQ	SEQ
	ID	ID	ID	ID
	NO: 1	NO: 1	NO: 2	NO: 2			YAP1	SEQ
Compound	Start	Stop	Start	Stop	Sequence		(%	ID
Number	Site	Site	Site	Site	(5′ to 3′)	CHEMSITRY NOTATION	UTC)	NO
715487	3630	3645	124655	124670	ATTACTTCATAGCTTA	AksTksksAdsmCdsTdsTdsmCdsAds	30	52
						TdsAdsGdsmCdsTksTksAk
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTksAdsGdsAdsGdsTdsAdsTds	13	810
						GdsTdsGdsGksmCksAk
1074461	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAksAdsTdsTdsGdsTdsmCds	10	2800
						TdsmCdsAdsTdsGksmCksmCk
1095547	4443	4458	125468	125483	ACTGAGGTATAACTGG	AksmCksTksGdsAdsGdsGdsTdsAds	42	392
						TdsAdsAdsmCksTesGksGe
1095565	4441	4456	125466	125481	TGAGGTATAACTGGGC	TksGksAksGdsGdsTdsAdsTdsAdsAds	25	1580
						mCdsTdsGksGesGksmCe
1095566	4442	4457	125467	125482	CTGAGGTATAACTGGG	mCksTksGksAdsGdsGdsTdsAdsTds	47	2801
						AdsAdsmCdsTksGesGksGe
1095567	4444	4459	125469	125484	CACTGAGGTATAACTG	mCksAksmCksTdsGdsAdsGdsGdsTds	92	2802
						AdsTdsAdsAksmCesTksGe
1198302	4436	4451	125461	125476	TATAACTGGGCAAATT	TksAksTksAdsAdsmCdsTdsGdsGds	67	2815
						GdsmCdsAdsAksAesTksTe
1198303	4438	4453	125463	125478	GGTATAACTGGGCAAA	GksGksTksAdsTdsAdsAdsmCdsTds	27	1427
						GdsGdsGdsmCksAesAksAe
1198304	4439	4454	125464	125479	AGGTATAACTGGGCAA	AksGksGksTdsAdsTdsAdsAdsmCds	33	905
						TdsGdsGdsGksmCesAksAe
1198305	4440	4455	125465	125480	GAGGTATAACTGGGCA	GksAksGksGdsTdsAdsTdsAdsAdsm	78	1503
						CdsTdsGdsGksGesmCksAe
1198306	4446	4461	125471	125486	AACACTGAGGTATAAC	AksAksmCksAdsmCdsTdsGdsAdsGds	64	2816
						GdsTdsAdsTksAesAksmCe
1198334	N/A	N/A	115903	115918	ATATGGTTTTGTGTGT	AksTksAksTdsGdsGdsTdsTdsTdsTds	57	2839
						GdsTdsGksTesGksTe
1198335	N/A	N/A	115905	115920	TTATATGGTTTTGTGT	TksTksAksTdsAdsTdsGdsGdsTdsTds	26	2840
						TdsTdsGksTesGksTe
1198336	N/A	N/A	115906	115921	CTTATATGGTTTTGTG	mCksTksTksAdsTdsAdsTdsGdsGds	31	2788
						TdsTdsTdsTksGesTksGe
1198337	N/A	N/A	115907	115922	TCTTATATGGTTTTG	TksmCksTksTdsAdsTdsAdsTdsGds	26	2841
						GdsTdsTdsTksTesGksTe
1198338	N/A	N/A	115908	115923	CTCTTATATGGTTTTG	mCksTksmCksTdsTdsAdsTdsAdsTds	24	2842
						GdsGdsTdsTksTesTksGe
1198339	N/A	N/A	115909	115924	ACTCTTATATGGTTTT	AksmCksTksmCdsTdsTdsAdsTdsAds	25	2859
						TdsGdsGdsTksTesTksTe
1198340	N/A	N/A	115910	115925	AACTCTTATATGGTTT	AksAksmCksTdsmCdsTdsTdsAdsTds	123	2860
						AdsTdsGdsGksTesTksTe
1198341	N/A	N/A	115911	115926	CAACTCTTATATGGTT	mCksAksAksmCdsTdsmCdsTdsTds	90	2861
						AdsTdsAdsTdsGksGesTksTe
1198342	N/A	N/A	115913	115928	GACAACTCTTATATGG	GksAksmCksAdsAdsmCdsTdsmCds	101	2862
						TdsTdsAdsTdsAksTesGksGe
1198349	N/A	N/A	117332	117347	ATGTAATATTGCAATC	AksTksGksTdsAdsAdsdsAdsTdsTds	85	2848
						GdsmCdsAksAesTksmCe
1198350	N/A	N/A	117333	117348	TATGTAATATTGCAAT	TksAksTksGdsTdsAdsAdsTdsAdsTds	83	2849
						TdsGdsmCksAesAksTe
1198351	N/A	N/A	117335	117350	TTTATGTAATATTGCA	TksTksTksAdsTdsGdsTdsAdsAdsTds	40	2850
						AdsTdsTksGesmCksAe
1198352	N/A	N/A	117755	117770	TGTATGTCAGAAGAGT	TksGksTksAdsTdsGdsTdsmCdsAds	7	2863
						GdsAdsAdsGksAesGksTe
1198353	N/A	N/A	117757	117772	AGTGTATGTCAGAAGA	AksGksTksGdsTdsAdsTdsGdsTdsm	8	2864
						CdsAdsGdsAksAesGksAe
1198354	N/A	N/A	117758	117773	AAGTGTATGTCAGAAG	AksAksGksTdsGdsTdsAdsTdsGdsTds	6	2865
						mCdsAdsGksAesAksGe
1198355	N/A	N/A	117759	117774	AAAGTGTATGTCAGAA	AksAksAksGdsTdsGdsTdsAdsTdsGds	6	2866
						TdsmCdsAksGesAksAe
1198356	N/A	N/A	117760	117775	TAAAGTGTATGTCAGA	TksAksAksAdsGdsTdsGdsTdsAdsTds	5	2867
						GdsTdsmCksAesGksAe
1198357	N/A	N/A	117761	117776	TTAAAGTGTATGTCAG	TksTksAksAdsAdsGdsTdsGdsTdsAds	21	2868
						TdsGdsTksmCesAksGe
1198358	N/A	N/A	117762	117777	TTTAAAGTGTATGTCA	TksTksTksAdsAdsAdsGdsTdsGdsTds	15	2869
						AdsTdsGksTesmCksAe
1198359	N/A	N/A	117763	117778	CTTTAAAGTGTATGTC	mCksTksTksTdsAdsAdsAdsGdsTds	28	1634
						GdsTdsAdsTksGesTksmCe
1198360	N/A	N/A	117765	117780	AACTTTAAAGTGTATG	AksAksmCksTdsTdsTdsAdsAdsAds	74	2870
						GdsTdsGdsTksAesTksGe
1198361	N/A	N/A	119667	119682	TAAGGTTTCCCAGATT	TksAksAksGdsGdsTdsTdsTdsmCdsm	39	2851
						CdsmCdsAdsGksAesTksTe
1198362	N/A	N/A	119669	119684	AGTAAGGTTTCCCAGA	AksGksTksAdsAdsGdsGdsTdsTdsTds	24	2852
						mCdsmCdsmCksAesGksAe
1198363	N/A	N/A	119670	119685	AAGTAAGGTTTCCCAG	AksAksGksTdsAdsAdsGdsGdsTdsTds	55	2853
						TdsmCdsmCksmCesAksGe
1198364	N/A	N/A	119671	119686	TAAGTAAGGTTTCCCA	TksAksAksGdsTdsAdsAdsGdsGdsTds	29	2854
						TdsTdsmCksmCesmCksAe
1198365	N/A	N/A	119672	119687	CTAAGTAAGGTTTCCC	mCksTksAksAdsGdsTdsAdsAdsGds	13	1101
						GdsTdsTdsTksmCesmCksmCe
1198366	N/A	N/A	119673	119688	ACTAAGTAAGGTTTCC	AksmCksTksAdsAdsGdsTdsAdsAds	45	2855
						GdsGdsTdsTksTesmCksmCe
1198367	N/A	N/A	119674	119689	GACTAAGTAAGGTTTC	GksAksmCksTdsAdsAdsGdsTdsAds	58	2856
						AdsGdsGdsTksTesTksmCe
1198368	N/A	N/A	119675	119690	AGACTAAGTAAGGTTT	AksGksAksmCdsTdsAdsAdsGdsTds	79	2857
						AdsAdsGdsGksTesTksTe
1198369	N/A	N/A	119677	119692	TTAGACTAAGTAAGGT	TksTksAksGdsAdsmCdsTdsAdsAds	51	2858
						GdsTdsAdsAksGesGksTe
1198542	2524	2539	123549	123564	TGTCTCATGCCTTATA	TksGksTksmCdsTdsmCdsAdsTdsGdsm	23	2803
						CdsmCdsTdsTksAksTksAe
1198543	2526	2541	123551	123566	ATTGTCTCATGCCTTA	AksTksTksGdsTdsmCdsTdsmCdsAds	15	2804
						TdsGdsmCdsmCksTksTksAe
1198544	2527	2542	123552	123567	AATTGTCTCATGCCTT	AksAksTksTdsGdsTdsmCdsTdsmCds	21	2805
						AdsTdsGdsmCksmCksTksTe
1198545	2528	2543	123553	123568	AAATTGTCTCATGCCT	AksAksAksTdsTdsGdsTdsmCdsTdsm	32	443
						CdsAdsTdsGksmCksmCksTe
1198546	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAksAdsTdsTdsGdsTdsmCds	11	2800
						TdsmCdsAdsTksGksmCksmCe
1198547	2530	2545	123555	123570	GGAAATTGTCTCATGC	GksGksAksAdsAdsTdsTdsGdsTdsm	27	2806
						CdsTdsmCdsAksTksGksmCe
1198548	2531	2546	123556	123571	TGGAAATTGTCTCATG	TksGksGksAdsAdsAdsTdsTdsGdsTds	26	2807
						mCdsTdsmCksAksTksGe
1198549	2532	2547	123557	123572	ATGGAAATTGTCTCAT	AksTksGksGdsAdsAdsAdsTdsTdsGds	84	2808
						TdsmCdsTksmCksAksTe
1198550	2534	2549	123559	123574	ATATGGAAATTGTCTC	AksTksAksTdsGdsGdsAdsAdsAdsTds	17	656
						TdsGdsTksmCksTksmCe
1198551	2560	2575	123585	123600	AGTATGTGGCAATAAT	AksGksTksAdsTdsGdsTdsGdsGdsm	34	2809
						CdsAdsAdsTksAksAksTe
1198552	2562	2577	123587	123602	AGAGTATGTGGCAATA	AksGksAksGdsTdsAdsTdsGdsTdsGds	17	2810
						GdsmCdsAksAksTksAe
1198553	2563	2578	123588	123603	TAGAGTATGTGGCAAT	TksAksGksAdsGdsTdsAdsTdsGdsTds	13	2811
						GdsGdsmCksAksAksTe
1198554	2564	2579	123589	123604	TTAGAGTATGTGGCAA	TksTksAksGdsAdsGdsTdsAdsTdsGds	16	963
						TdsGdsGksmCksAksAe
1198555	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTksAdsGdsAdsGdsTdsAdsTds	11	810
						GdsTdsGksGksmCksAe
1198556	2566	2581	123591	123606	TATTAGAGTATGTGGC	TksAksTksTdsAdsGdsAdsGdsTdsAds	25	2812
						TdsGdsTksGksGksmCe
1198557	2567	2582	123592	123607	ATATTAGAGTATGTGG	AksiTksAksTdsTdsAdsGdsAdsGdsTds	16	2813
						AdsTdsGksTksGksGe
1198558	2568	2583	123593	123608	TATATTAGAGTATGTG	TksAksTksAdsTdsTdsAdsGdsAdsGds	46	2814
						TdsAdsTksGksTksGe
1198559	2570	2585	123595	123610	TCTATATTAGAGTATG	TksmCksTksAdsTdsAdsTdsTdsAds	55	887
						GdsAdsGdsTksAksTksGe
1198565	4595	4610	125620	125635	TTACATTAGGAACAAG	TksTksAksmCdsAdsTdsTdsAdsGds	53	2817
						GdsAdsAdsmCksAksAksGe
1198566	4597	4612	125622	125637	TTTTACATTAGGAACA	TksTksTksTdsAdsmCdsAdsTdsTds	83	2818
						AdsGdsGdsAksAksmCksAe
1198567	4598	4613	125623	125638	CTTTTACATTAGGAAC	mCksTksTksTdsTdsAdsmCdsAdsTds	54	1124
						TdsAdsGdsGksAksAksmCe
1198568	4599	4614	125624	125639	ACTTTTACATTAGGAA	AksmCksTksTdsTdsTdsAdsmCdsAds	31	2819
						TdsTdsAdsGksGksAksAe
1198569	4600	4615	125625	125640	CACTTTTACATTAGGA	mCksAksmCksTdsTdsTdsTdsAdsmCds	14	1200
						AdsTdsTdsAksGksGksAe
1198570	4601	4616	125626	125641	GCACTTTTACATTAGG	GksmCksAksmCdsTdsTdsTdsTdsAdsm	15	1276
						CdsAdsTdsTksAksGksGe
1198571	4602	4617	125627	125642	AGCACTTTTACATTAG	AksGksmCksAdsmCdsTdsTdsTdsTds	32	2820
						AdsmCdsAdsTksTksAksGe
1198572	4603	4618	125628	125643	AAGCACTTTTACATTA	AksAksGksmCdsAdsmCdsTdsTdsTds	53	2821
						TdsAdsmCdsAksTksTksAe
1198573	4605	4620	125630	125645	TTAAGCACTTTTACAT	TksTksAksAdsGdsmCdsAdsmCdsTds	76	2822
						TdsTdsTdsAksmCksAksTe
1198574	4795	4810	125820	125835	GGAAGATCTGAAACTC	GksGksAksAdsGdsAdsTdsmCdsTds	37	2823
						GdsAdsAdsAksmCksTksmCe
1198575	4797	4812	125822	125837	TTGGAAGATCTGAAAC	TksTksGksGdsAdsAdsGdsAdsTdsm	94	2824
						CdsTdsGdsAksAksAksmCe
1198576	4798	4813	125823	125838	TTTGGAAGATCTGAAA	TksTksTksGdsGdsAdsAdsGdsAdsTds	92	2825
						mCdsTdsGksAksAksAe
1198577	4799	4814	125824	125839	CTTTGGAAGATCTGAA	mCksTksTksTdsGdsGdsAdsAdsGds	40	2826
						AdsTdsmCdsTksGksAksAe
1198578	4800	4815	125825	125840	GCTTTGGAAGATCTGA	GksmCksTksTdsTdsGdsGdsAdsAds	18	2044
						GdsAdsTdsmCksTksGksAe
1198579	4801	4816	125826	125841	TGCTTTGGAAGATCTG	TksGksmCksTdsTdsTdsGdsGdsAds	34	2121
						AdsGdsAdsTksmCksTksGe
1198580	4802	4817	125827	125842	GTGCTTTGGAAGATCT	GksTksGksmCdsTdsTdsTdsGdsGds	43	2827
						AdsAdsGdsAksTksmCksTe
1198581	4803	4818	125828	125843	AGTGCTTTGGAAGATC	AksGksTksGdsmCdsTdsTdsTdsGds	42	2828
						GdsAdsAdsGksAksTksmCe
1198582	4805	4820	125830	125845	ATAGTGCTTTGGAAGA	AksTksAksGdsTdsGdsmCdsTdsTds	63	2829
						TdsGdsGdsAksAksGksAe
1198583	N/A	N/A	94729	94744	AGGATGCATGGTTTTT	AksGksGksAdsTdsGdsmCdsAdsTds	27	2830
						GdsGdsTdsTksTksTksTe
1198584	N/A	N/A	94731	94746	TTAGGATGCATGGTTT	TksTksAksGdsGdsAdsTdsGdsmCds	37	2831
						AdsTdsGdsGksTksTksTe

TABLE 50
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
	SEQ	SEQ	SEQ	SEQ
	ID	ID	ID	ID
	NO: 1	NO: 1	NO: 2	NO: 2			YAP1	SEQ
Compound	Start	Stop	Start	Stop	Sequence		(%	ID
Number	Site	Site	Site	Site	(5′ to 3′)	CHEMSITRY NOTATION	UTC)	NO
715487	3630	3645	124655	124670	ATTACTTCATAGCTTA	AksTksTksAdsmCdsTdsTdsmCdsAds	31	52
						TdsAdsGdsmCdsTksTksAk
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTksAdsGdsAdsGdsTdsAdsTds	12	810
						GdsTdsGdsGksmCksAk
1074461	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAksAdsTdsTdsGdsTdsmCds	16	2800
						TdsmCdsAdsTdsGksmCksmCk
1095435	4443	4458	125468	125483	ACTGAGGTATAACTGG	AksmCksTksGdsAdsGdsGdsTdsAds	39	392
						TdsAdsAdsmCksTksGksGe
1095453	4441	4456	125466	125481	TGAGGTATAACTGGGC	TksGksAksGdsGdsTdsAdsTdsAdsAds	32	1580
						mCdsTdsGksGksGksmCe
1095454	4442	4457	125467	125482	CTGAGGTATAACTGGG	mCksTksGksAdsGdsGdsTdsAdsTds	47	2801
						AdsAdsmCdsTksGksGksGe
1197228	2527	2542	123552	123567	AATTGTCTCATGCCTT	AksAksTksTdsGysTdsmCdsTdsmCds	25	2805
						AdsTdsGdsmCdsmCksTksTk
1197229	2530	2545	123555	123570	GGAAATTGTCTCATGC	GksGksAksAdsAysTdsTdsGdsTdsm	21	2806
						CdsTdsmCdsAdsTksGksmCk
1197230	2531	2546	123556	123571	TGGAAATTGTCTCATG	TksGksGksAdsAysAdsTdsTdsGdsTds	29	2807
						mCdsTdsmCdsAksTksGk
1197231	2532	2547	123557	123572	ATGGAAATTGTCTCAT	AksTksGksGdsAysAdsAdsTdsTdsGds	50	2808
						TdsmCdsTdsmCksAksTk
1197232	2534	2549	123559	123574	ATATGGAAATTGTCTC	AksTksAksTdsGysGdsAdsAdsAdsTds	55	656
						TdsGdsTdsmCksTksmCk
1197233	2563	2578	123588	123603	TAGAGTATGTGGCAAT	TksAksGksAdsGysTdsAdsTdsGdsTds	36	2811
						GdsGdsmCdsAksAksTk
1197234	2564	2579	123589	123604	TTAGAGTATGTGGCAA	TksTksAksGdsAysGdsTdsAdsTdsGds	24	963
						TdsGdsGdsmCksAksAk
1197235	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTksAdsGysAdsGdsTdsAdsTds	16	810
						GdsTdsGdsGksmCksAk
1197236	2566	2581	123591	123606	TATTAGAGTATGTGGC	TksAksTksTdsAysGdsAdsGdsTdsAds	17	2812
						TdsGdsTdsGksGksmCk
1197244	4595	4610	125620	125635	TTACATTAGGAACAAG	TksTksAksmCdsAysTdsTdsAdsGds	60	2817
						GdsAdsAdsmCdsAksAksGk
1197245	4597	4612	125622	125637	TTTTACATTAGGAACA	TksTksTksTdsAysmCdsAdsTdsTds	88	2818
						AdsGdsGdsAdsAksmCksAk
1197246	4602	4617	125627	125642	AGCACTTTTACATTAG	AksGksmCksAdsCysTdsTdsTdsTds	33	2820
						AdsmCdsAdsTdsTksAksGk
1197247	4603	4618	125628	125643	AAGCACTTTTACATTA	AksAksGksmCdsAysmCdsTdsTdsTds	47	2821
						TdsAdsmCdsAdsTksTksAk
1197280	2524	2539	123549	123564	TGTCUCATGCCTTATA	TksGksTksmCdsUysmCdsAdsTdsGds	53	2871
						mCdsmCdsTdsTdsAksTksAk
1197281	2526	2541	123551	123566	ATTGUCTCATGCCTTA	AksTksTksGdsUysmCdsTdsmCdsAds	42	2872
						TdsGdsmCdsmCdsTksTksAk
1197282	2528	2543	123553	123568	AAATUGTCTCATGCCT	AksAksAksTdsUysGdsTdsmCdsTdsm	40	2873
						CdsAdsTdsGdsmCksmCksTk
1197283	2529	2544	123554	123569	GAAAUTGTCTCATGCC	GksAksAksAdsUysTdsGdsTdsmCds	29	2874
						TdsmCdsAdsTdsGksmCksmCk
1197284	2560	2575	123585	123600	AGTAUGTGGCAATAAT	AksGksTksAdsUysGdsTdsGdsGdsm	35	2875
						CdsAdsAdsTdsAksAksTk
1197285	2562	2577	123587	123602	AGAGUATGTGGCAATA	AksGksAksGdsUysAdsTdsGdsTds	28	2876
						GdsGdsmCdsAdsAksTksAk
1197286	2567	2582	123592	123607	ATATUAGAGTATGTGG	AksTksAksTdsUysAdsGdsAdsGdsTds	43	2877
						AdsTdsGdsTksGksGk
1197287	2568	2583	123593	123608	TATAUTAGAGTATGTG	TksAksTksAdsUysTdsAdsGdsAdsGds	108	2878
						TdsAdsTdsGksTksGk
1197288	2570	2585	123595	123610	TCTAUATTAGAGTATG	TksmCksTksAdsUysAdsTdsTdsAds	94	2879
						GdsAdsGdsTdsAksTksGk
1197291	4598	4613	125623	125638	CTTTUACATTAGGAAC	mCksTksTksTdsUysAdsmCdsAdsTds	83	2880
						TdsAdsGdsGdsAksAksmCk
1197292	4599	4614	125624	125639	ACTTUTACATTAGGAA	AksmCksTksTdsUysTdsAdsmCdsAds	84	2881
						TdsTdsAdsGdsGksAksAk
1197293	4600	4615	125625	125640	CACTUTTACATTAGGA	mCksAksmCksTdsUysTdsTdsAdsm	94	2882
						CdsAdsTdsTdsAdsGksGksAk
1197294	4601	4616	125626	125641	GCACUTTTACATTAGG	GksmCksAksmCdsUysTdsTdsTdsAds	25	2883
						mCdsAdsTdsTdsAksGksGk
1198560	4436	4451	125461	125476	TATAACTGGGCAAATT	TksAksTksAdsAdsmCdsTdsGdsGds	53	2815
						GdsmCdsAdsAksAksTksTe
1198561	4438	4453	125463	125478	GGTATAACTGGGCAAA	GksGksTksAdsTdsAdsAdsmCdsTds	29	1427
						GdsGdsGdsmCksAksAksAe
1198562	4439	4454	125464	125479	AGGTATAACTGGGCAA	AksGksGksTdsAdsTdsAdsAdsmCds	30	905
						TdsGdsGdsGksmCksAksAe
1198563	4440	4455	125465	125480	GAGGTATAACTGGGCA	GksAksGksGdsTdsAdsTdsAdsAdsm	53	1503
						CdsTdsGdsGksGksmCksAe
1198564	4446	4461	125471	125486	AACACTGAGGTATAAC	AksAksmCksAdsmCdsTdsGdsAdsGds	44	2816
						GdsTdsAdsTksAksAksmCe
1198585	N/A	N/A	94732	94747	TTTAGGATGCATGGTT	TksTksTksAdsGdsGdsAdsTdsGdsm	22	2832
						CdsAdsTdsGksGksTksTe
1198586	N/A	N/A	94733	94748	ATTTAGGATGCATGGT	AksTksTksTdsAdsGdsGdsAdsTdsGds	96	2833
						mCdsAdsTksGksGksTe
1198587	N/A	N/A	94734	94749	GATTTAGGATGCATGG	GksAksTksTdsTdsAdsGdsGdsAdsTds	41	2834
						GdsmCdsAksTksGksGe
1198588	N/A	N/A	94735	94750	AGATTTAGGATGCATG	AksGksAksTdsTdsTdsAdsGdsGdsAds	32	2835
						TdsGdsmCksAksTksGe
1198589	N/A	N/A	94736	94751	CAGATTTAGGATGCAT	mCksAksGksAdsTdsTdsTdsAdsGds	24	2836
						GdsAdsTdsGksmCksAksTe
1198590	N/A	N/A	94737	94752	TCAGATTTAGGATGCA	TksmCksAksGdsAdsTdsTdsTdsAds	46	2837
						GdsGdsAdsTksGksmCksAe
1198591	N/A	N/A	94739	94754	ATTCAGATTTAGGATG	AksTksTksmCdsAdsGdsAdsTdsTds	106	2838
						TdsAdsGdsGksAksTksGe
1198592	N/A	N/A	115903	115918	ATATGGTTTTGTGTGT	AksTksAksTdsGdsGdsTdsTdsTdsTds	50	2839
						GdsTdsGksTksGksTe
1198593	N/A	N/A	115905	115920	TTATATGGTTTTGTGT	TksTksAksTdsAdsTdsGdsGdsTdsTds	45	2840
						TdsTdsGksTksGksTe
1198594	N/A	N/A	115906	115921	CTTATATGGTTTTGTG	mCksTksTksAdsTdsAdsTdsGdsGds	23	2788
						TdsTdsTdsTksGksTksGe
1198595	N/A	N/A	115907	115922	TCTTATATGGTTTTGT	TksmCksTksTdsAdsTdsAdsTdsGds	27	2841
						GdsTdsTdsTksTksGksTe
1198596	N/A	N/A	115908	115923	CTCTTATATGGTTTTG	mCksTksmCksTdsTdsAdsTdsAdsTds	16	2842
						GdsGdsTdsTksTksTksGe
1198597	N/A	N/A	115909	115924	ACTCTTATATGGTTTT	AksmCksTksmCdsTdsTdsAdsTdsAds	27	2859
						TdsGdsGdsTksTksTksTe
1198598	N/A	N/A	115910	115925	AACTCTTATATGGTTT	AksAksmCksTdsmCdsTdsTdsAdsTds	76	2860
						AdsTdsGdsGksTksTksTe
1198599	N/A	N/A	115911	115926	CAACTCTTATATGGTT	mCksAksAksmCdsTdsmCdsTdsTds	90	2861
						AdsTdsAdsTdsGksGksTksTe
1198600	N/A	N/A	115913	115928	GACAACTCTTATATGG	GksAksmCksAdsAdsmCdsTdsmCds	72	2862
						TdsTdsAdsTdsAksTksGksGe
1198601	N/A	N/A	117325	117340	ATTGCAATCTGTCTGA	AksTksTksGdsmCdsAdsAdsTdsmCds	50	2843
						TdsGdsTdsmCksTksGksAe
1198602	N/A	N/A	117327	117342	ATATTGCAATCTGTCT	AksTksAksTdsTdsGdsmCdsAdsAds	29	2844
						TdsmCdsTdsGksTksmCksTe
1198603	N/A	N/A	117328	117343	AATATTGCAATCTGTC	AksAksTksAdsTdsTdsGdsmCdsAds	51	2845
						AdsTdsmCdsTksGksTksmCe
1198604	N/A	N/A	117329	117344	TAATATTGCAATCTGT	TksAksAksTdsAdsTdsTdsGdsmCds	48	2846
						AdsAdsTdsmCksTksGksTe
1198605	N/A	N/A	117330	117345	GTAATATTGCAATCTG	GksTksAksAdsTdsAdsTdsTdsGdsm	7	1404
						CdsAdsAdsTksmCksTksGe
1198606	N/A	N/A	117331	117346	TGTAATATTGCAATCT	TksGksTksAdsAdsTdsAdsTdsTdsGds	25	2847
						mCdsAdsAksTksmCksTe
1198607	N/A	N/A	117332	117347	ATGTAATATTGCAATC	AksTksGksTdsAdsAdsTdsAdsTdsTds	77	2848
						GdsmCdsAksAksTksmCe
1198608	N/A	N/A	117333	117348	TATGTAATATTGCAAT	TksAksTksGdsTdsAdsAdsTdsAdsTds	83	2849
						TdsGdsmCksAksAksTe
1198609	N/A	N/A	117335	117350	TTTATGTAATATTGCA	TksTksTksAdsTdsGdsTdsAdsAdsTds	52	2850
						AdsTdsTksGksmCksAe
1198610	N/A	N/A	117755	117770	TGTATGTCAGAAGAGT	TksGksTksAdsTdsGdsTdsmCdsAds	4	2863
						GdsAdsAdsGksAksGksTe
1198611	N/A	N/A	117757	117772	AGTGTATGTCAGAAGA	AksGksTksGdsTdsAdsTdsGdsTdsm	7	2864
						CdsAdsGdsAksAksGksAe
1198612	N/A	N/A	117758	117773	AAGTGTATGTCAGAAG	AksAksGksTdsGdsTdsAdsTdsGdsTds	5	2865
						mCdsAdsGksAksAksGe
1198613	N/A	N/A	117759	117774	AAAGTGTATGTCAGAA	AksAksAksGdsTdsGdsTdsAdsTdsGds	3	2866
						TdsmCdsAksGksAksAe
1198614	N/A	N/A	117760	117775	TAAAGTGTATGTCAGA	TksAksAksAdsGdsTdsGdsTdsAdsTds	4	2867
						GdsTdsmCksAksGksAe
1198615	N/A	N/A	117761	117776	TTAAAGTGTATGTCAG	TksTksAksAdsAdsGdsTdsGdsTdsAds	10	2868
						TdsGdsTksmCksAksGe
1198616	N/A	N/A	117762	117777	TTTAAAGTGTATGTCA	TksTksTksAdsAdsAdsGdsTdsGdsTds	16	2869
						AdsTdsGksTksmCksAe
1198617	N/A	N/A	117763	117778	CTTTAAAGTGTATGTC	mCksTksTksTdsAdsAdsAdsGdsTds	34	1634
						GdsTdsAdsTksGksTksmCe
1198618	N/A	N/A	117765	117780	AACTTTAAAGTGTATG	AksAksmCksTdsTdsTdsAdsAdsAds	74	2870
						GdsTdsGdsTksAksTksGe
1198619	N/A	N/A	119667	119682	TAAGGTTTCCCAGATT	TksAksAksGdsGdsTdsTdsTdsmCdsm	53	2851
						CdsmCdsAdsGksAksTksTe
1198620	N/A	N/A	119669	119684	AGTAAGGTTTCCCAGA	AksGksTksAdsAdsGasGdsTdsTdsTds	26	2852
						mCdsmCdsmCksAksGksAe
1198621	N/A	N/A	119670	119685	AAGTAAGGTTTCCCAG	AksAksGksTdsAdsAdsGdsGdsTdsTds	80	2853
						TdsmCdsmCksmCksAksGe
1198622	N/A	N/A	119671	119686	TAAGTAAGGTTTCCCA	TksAksAksGdsTdsAdsAdsGdsGdsTds	26	2854
						TdsTdsmCksmCksmCksAe
1198623	N/A	N/A	119672	119687	CTAAGTAAGGTTTCCC	mCksTksAksAdsGdsTdsAdsAdsGds	9	1101
						GdsTdsTdsTksmCksmCksmCe
1198624	N/A	N/A	119673	119688	ACTAAGTAAGGTTTCC	AksmCksTksAdsAdsGdsTdsAdsAds	20	2855
						GdsGdsTdsTksTksmCksmCe
1198625	N/A	N/A	119674	119689	GACTAAGTAAGGTTTC	GksAksmCksTdsAdsAdsGdsTdsAds	64	2856
						AdsGdsGdsTksTksTksmCe
1198626	N/A	N/A	119675	119690	AGACTAAGTAAGGTTT	AksGksAksmCdsTfsAdsAdsGdsTds	99	2857
						AdsAdsGdsGksTksTksTe
1198627	N/A	N/A	119677	119692	TTAGACTAAGTAAGGT	TksTksAksGdsAdsmCdsTdsAdsAds	39	2858
						GdsTdsAdsAksGksGksTe

TABLE 51
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
	SEQ	SEQ	SEQ	SEQ
	ID	ID	ID	ID
	NO: 1	NO: 1	NO: 2	NO: 2			YAP1	SEQ
Compound	Start	Stop	Start	Stop	Sequence		(%	ID
Number	Site	Site	Site	Site	(5′ to 3′)	CHEMSITRY NOTATION	UTC)	NO
715487	3630	3645	124655	124670	ATTACTTCATAGCTTA	AksTksTksAdsmCdsTdsTdsmCdsAds	24	52
						TdsAdsGdsmCdsTksTksAk
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTksAdsGdsAdsGdsTdsAdsTds	9	810
						GdsTdsGdsGksmCksAk
1074461	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAksAdsTdsTdsGdsTdsmCds	5	2800
						TdsmCdsAdsTdsGksmCksmCk
1197237	4436	4451	125461	125476	TATAACTGGGCAAATT	TksAksTksAdsAysmCdsTdsGdsGds	74	2815
						GdsmCdsAdsAdsAksTksTk
1197238	4439	4454	125464	125479	AGGTATAACTGGGCAA	AksGksGksTdsAysTdsAdsAdsmCds	43	905
						TdsGdsgdsGdsmCksAksAk
1197239	4441	4456	125466	125481	TGAGGTATAACTGGGC	TksGksAksGdsGysTdsAdsTdsAdsAds	47	1580
						mCdsTdsGdsGksGksmCk
1197240	4442	4457	125467	125482	CTGAGGTATAACTGGG	mCksTksGksAdsGysGdsTdsAdsTds	58	2801
						AdsAdsmCdsTdsGksGksGk
1197241	4443	4458	125468	125483	ACTGAGGTATAACTGG	AksmCksTksGdsAysGdsGdsTdsAds	19	392
						TdsAdsAdsmCdsTksGksGk
1197242	4444	4459	125469	125484	CACTGAGGTATAACTG	mCksAksmCksTdsGysAdsGdsGdsTds	46	2802
						AdsTdsAdsAdsmCksTksGk
1197243	4446	4461	125471	125486	AACACTGAGGTATAAC	AksAksmCksAdsCysTdsGdsAdsGds	81	2816
						GdsTdsAdsTdsAksAksmCk
1197248	4605	4620	125630	125645	TTAAGCACTTTTACAT	TksTksAksAdsGysmCdsAdsmCdsTds	75	2822
						TdsTdsTdsAdsmCksAksTk
1197249	4795	4810	125820	125835	GGAAGATCTGAAACTC	GksGksAksAdsGysAdsTdsmCdsTds	28	2823
						GdsAdsAdsAdsmCksTksmCk
1197250	4797	4812	125822	125837	TTGGAAGATCTGAAAC	TksTksGksGdsAysAdsGdsAdsTdsm	60	2824
						CdsTdsGdsAdsAksAksmCk
1197251	4798	4813	125823	125838	TTTGGAAGATCTGAAA	TksTksTksGdsGysAdsAdsGdsAdsTds	74	2825
						mCdsTdsGdsAksAksAk
1197252	4799	4814	125824	125839	CTTTGGAAGATCTGAA	mCksTksTksTdsGysGdsAdsAdsGds	53	2826
						AdsTdsmCdsTdsGksAksAk
1197253	4803	4818	125828	125843	AGTGCTTTGGAAGATC	AksGksTksGdsCysTdsTdsTdsGdsGds	58	2828
						AdsAdsGdsAksTksmCk
1197254	N/A	N/A	94731	94746	TTAGGATGCATGGTTT	TksTksAksGdsGysAdsTdsGdsmCds	51	2831
						AdsTdsGdsGdsTksTksTk
1197255	N/A	N/A	94732	94747	TTTAGGATGCATGGTT	TksTksTksAdsGysGdsAdsTdsGdsm	38	2832
						CdsAdsTdsGdsGksTksTk
1197256	N/A	N/A	94733	94748	ATTTAGGATGCATGGT	AksTksTksTdsAysGdsGdsAdsTdsGds	31	2833
						mCdsAdsTdsGksGksTk
1197257	N/A	N/A	94737	94752	TCAGATTTAGGATGCA	TksmCksAksGdsAysTdsTdsTdsAds	20	2837
						GdsGdsAdsTdsGksmCksAk
1197258	N/A	N/A	94739	94754	ATTCAGATTTAGGATG	AksTksTksmCdsAysGdsAdsTdsTds	57	2838
						TdsAdsGdsGdsAksTksGk
1197259	N/A	N/A	115903	115918	ATATGGTTTTGTGTGT	AksTksAksTdsGysGdsTdsTdsTdsTds	59	2839
						GdsTdsGdsTksGksTk
1197260	N/A	N/A	115905	115920	TTATATGGTTTTGTGT	TksTksAksTdsAysTdsGdsGdsTdsTds	65	2840
						TdsTdsGdsTksGksTk
1197261	N/A	N/A	115907	115922	TCTTATATGGTTTTGT	TksmCksTksTdsAysTdsAdsTdsGds	91	2841
						GdsTdsTdsTdsTksGksTk
1197262	N/A	N/A	115910	115925	AACTCTTATATGGTTT	AksAksmCksTdsCysTdsTdsAdsTds	89	2860
						AdsTdsGdsGdsTksTksTk
1197263	N/A	N/A	115913	115928	GACAACTCTTATATGG	GksAksmCksAdsAysmCdsTdsmCds	91	2862
						TdsTdsAdsTdsAdsTksGksGk
1197264	N/A	N/A	117325	117340	ATTGCAATCTGTCTGA	AksTksTksGdsCysAdsAdsTdsmCds	33	2843
						TdsGdsTdsmCdsTksGksAk
1197265	N/A	N/A	117329	117344	TAATATTGCAATCTGT	TksAksAksTdsAysTdsTdsGdsmCds	103	2846
						AdsAdsTdsmCdsTksGksTk
1197266	N/A	N/A	117331	117346	TGTAATATTGCAATCT	TksGksTksAdsAysTdsAdsTdsTdsGds	31	2847
						mCdsAdsAdsTksmCksTk
1197267	N/A	N/A	117332	117347	ATGTAATATTGCAATC	AksTksGksTdsAysAdsTdsAdsTdsTds	62	2848
						GdsmCdsAdsAksTksmCk
1197268	N/A	N/A	117758	117773	AAGTGTATGTCAGAAG	AksAksGksTdsGysTdsAdsTdsGdsTds	25	2865
						mCdsAdsGdsAksAksGk
1197269	N/A	N/A	117760	117775	TAAAGTGTATGTCAGA	TksAksAksAdsGysTdsGdsTdsAdsTds	3	2867
						GdsTdsmCdsAksGksAk
1197270	N/A	N/A	117761	117776	TTAAAGTGTATGTCAG	TksTksAksAdsAysGdsTdsGdsTdsAds	2	2868
						TdsGdsTdsmCksAksGk
1197271	N/A	N/A	117762	117777	TTTAAAGTGTATGTCA	TksAksTksAdsAysAdsGdsTdsGdsTds	12	2869
						AdsTdsGdsTksmCksAk
1197272	N/A	N/A	117763	117778	CTTTAAAGTGTATGTC	mCksTksTksTdsAysAdsAdsGdsTds	32	1634
						GdsTdsAdsTdsGksTksmCk
1197273	N/A	N/A	119667	119682	TAAGGTTTCCCAGATT	TksAksAksGdsGysTdsTdsTdsmCdsm	68	2851
						CdsmCdsAdsGdsAksTksTk
1197274	N/A	N/A	119669	119684	AGTAAGGTTTCCCAGA	AksGksTksAdsAysGdsGdsTdsTdsTds	31	2852
						mCdsmCdsmCdsAksGksAk
1197275	N/A	N/A	119670	119685	AAGTAAGGTTTCCCAG	AksAksGksTdsAysAdsGdsGdsTdsTds	30	2853
						TdsmCdsmCdsmCksAksGk
1197276	N/A	N/A	119672	119687	CTAAGTAAGGTTTCCC	mCksTksAksAdsGysTdsAdsAdsGds	44	1101
						GdsTdsTdsTdsmCksmCksmCk
1197277	N/A	N/A	119673	119688	ACTAAGTAAGGTTTCC	AksmCksTksAdsAysGdsTdsAdsAds	23	2855
						GdsGdsTdsTdsTksmCksmCk
1197278	N/A	N/A	119674	119689	GACTAAGTAAGGTTTC	GksAksmCksTdsAysAdsGdsTdsAds	36	2856
						AdsGdsGdsTdsTksTksmCk
1197279	N/A	N/A	119677	119692	TTAGACTAAGTAAGGT	TksTksAksGdsAysmCdsTdsAdsAds	54	2858
						GdsTdsAdsAdsGksGksTk
1197289	4438	4453	125463	125478	GGTAUAACTGGGCAAA	GksGksTksAdsUysAdsAdsmCdsTds	48	2884
						GdsGdsGdsmCdsAksAksAk
1197290	4440	4455	125465	125480	GAGGUATAACTGGGCA	GksAksGksGdsUysAdsTdsAdsAdsm	37	2885
						CdsTdsGdsGdsGksmCksAk
1197295	4800	4815	125825	125840	GCTTUGGAAGATCTGA	GksmCksTksTdsUysGdsGdsAdsAds	24	2886
						GdsAdsTdsmCdsTksGksAk
1197296	4801	4816	125826	125841	TGCTUTGGAAGATCTG	TksGksmCksTdsUysTdsGdsGdsAds	36	2887
						AdsGdsAdsTdsmCksTksGk
1197297	4802	4817	125827	125842	GTGCUTTGGAAGATCT	GksTksGksmCdsUysTdsTdsGdsGds	25	2888
						AdsAdsGdsAdsTksmCksTk
1197298	4805	4820	125830	125845	ATAGUGCTTTGGAAGA	AksTksAksGdsUysGdsmCdsTdsTds	46	2889
						TdsGdsGdsAdsAksGksAk
1197299	N/A	N/A	94729	94744	AGGAUGCATGGTTTTT	AksGksGksAdsUysGdsmCdsAdsTds	41	2890
						GdsGdsTdsTdsTksTksTk
1197300	N/A	N/A	94734	94749	GATTUAGGATGCATGG	GksAksTksTdsUysAdsGdsGdsAdsTds	42	2891
						GdsmCdsAdsTksGksGk
1197301	N/A	N/A	94735	94750	AGATUTAGGATGCATG	AksGksAksTdsUysTdsAdsGdsGds	71	2892
						AdsTdsGdsmCdsAksTksGk
1197302	N/A	N/A	94736	94751	CAGAUTTAGGATGCAT	mCksAksGksAdsUysTdsTdsAdsGds	54	2893
						GdsAdsTdsGdsmCksAksTk
1197303	N/A	N/A	115906	115921	CTTAUATGGTTTTGTG	mCksTksTksAdsUysAdsTdsGdsGds	72	2894
						TdsTdsTdsTdsGksTksGk
1197304	N/A	N/A	115908	115923	CTCTUATATGGTTTTG	mCksTksmCksTdsUysAdsTdsAdsTds	45	2895
						GdsGdsTdsTdsTksTksGk
1197305	N/A	N/A	115909	115924	ACTCUTATATGGTTTT	AksmCksTksmCdsUysTdsAdsTdsAds	30	2896
						TdsGdsGdsTdsTksTksTk
1197306	N/A	N/A	115911	115926	CAACUCTTATATGGTT	mCksAksAksmCdsUysmCdsTdsTds	77	2897
						AdsTdsAdsTdsGdsGksTksTk
1197307	N/A	N/A	117327	117342	ATATUGCAATCTGTCT	AksTksAksTdsUysGdsmCdsAdsAds	88	2898
						TdsmCdsTdsGdsTksmCksTk
1197308	N/A	N/A	117328	117343	AATAUTGCAATCTGTC	AksAksTksAdsUysTdsGdsmCdsAds	49	2899
						AdsTdsmCdsTdsGksTksmCk
1197309	N/A	N/A	117330	117345	GTAAUATTGCAATCTG	GksTksAksAdsUysAdsTdsTdsGdsm	11	2900
						CdsAdsAdsTdsmCksTksGk
1197310	N/A	N/A	117333	117348	TATGUAATATTGCAAT	TksAksTksGdsUysAdsAdsTdsAdsTds	109	2901
						TdsGdsmCdsAksAksTk
1197311	N/A	N/A	117335	117350	TTTAUGTAATATTGCA	TksTksTksAdsUysGdsTdsAdsAdsTds	27	2902
						AdsTdsTdsGksmCksAk
1197312	N/A	N/A	117755	117770	TGTAUGTCAGAAGAGT	TksGksTksAdsUysGdsTdsmCdsAds	10	2903
						GdsAdsAdsGdsAksGksTk
1197313	N/A	N/A	117757	117772	AGTGUATGTCAGAAGA	AksGksTksGdsUysAdsTdsGdsTdsm	8	2904
						CdsAdsGdsAdsAksGksAk
1197314	N/A	N/A	117759	117774	AAAGUGTATGTCAGAA	AksAksAksGdsUysGdsTdsAdsTds	22	2905
						GdsTdsmCdsAdsGksAksAk
1197315	N/A	N/A	117765	117780	AACTUTAAAGTGTATG	AksAksmCksTdsUysTdsAdsAdsAds	116	2906
						GdsTdsGdsTdsAksTksGk
1197316	N/A	N/A	119671	119686	TAAGUAAGGTTTCCCA	TksAksAksGdsUysAdsAdsGdsGds	46	2907
						TdsTdsTdsmCdsmCksmCksAk
1197317	N/A	N/A	119675	119690	AGACUAAGTAAGGTTT	AksGksAksmCdsUysAdsAdsGssTds	78	2908
						AdsAdsGdsGdsTksTksTk
1200784	2524	2539	123549	123564	TGTCTCATGCCTTATA	TksGksTksmCdsTdsCysAdsTdsGdsm	19	2803
						CdsmCdsTdsTdsAksTksAk
1200785	2526	2541	123551	123566	ATTGTCTCATGCCTTA	AksTksTksGdsTdsCysTdsmCdsAds	15	2804
						TdsGdsmCdsmCdsTksTksAk
1200786	2527	2542	123552	123567	AATTGUCTCATGCCTT	AksAksTksTdsGdsUysmCdsTdsmCds	21	2909
						AdsTdsGdsmCdsmCksTksTk
1200787	2528	2543	123553	123568	AAATTGTCTCATGCCT	AksAksAksTdsTdsGysTdsmCdsTdsm	38	443
						CdsAdsTdsGdsmCksmCksTk
1200793	2560	2575	123585	123600	AGTATGTGGCAATAAT	AksGksTksAdsTdsGysTdsGdsGdsm	31	2809
						CdsAdsAdsTdsAksAksTk
1200794	2562	2577	123587	123602	AGAGTATGTGGCAATA	AksGksAksGdsTdsAysTdsGdsTdsGds	18	2810
						GdsmCdsAdsAksTksAk
1200795	2563	2578	123588	123603	TAGAGUATGTGGCAAT	TksAksGksAdsGdsUysAdsTdsGdsTds	30	2910
						GdsGdsmCdsAksAksTk
1200796	2564	2579	123589	123604	TTAGAGTATGTGGCAA	TksTksAksGdsAdsGysTdsAdsTdsGds	15	963
						TdsGdsGdsmCksAksAk
1200797	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTksAdsGdsAysGdsTdsAdsTds	11	810
						GdsTdsGdsGksmCksAk
1200798	2566	2581	123591	123606	TATTAGAGTATGTGGC	TksAksTksTdsAdsGysAdsGdsTdsAds	7	2812
						TdsGdsTdsGksGksmCk
1200799	2567	2582	123592	123607	ATATTAGAGTATGTGG	AksTksAksTdsTdsAysGdsAdsGdsTds	27	2813
						AdsTdsGdsTksGksGk
1200800	2568	2583	123593	123608	TATATUAGAGTATGTG	TksAksTksAdsTdsUysAdsGdsAdsGds	61	2911
						TdsAdsTdsGksTksGk
1200801	2570	2585	123595	123610	TCTATATTAGAGTATG	TksmCksTksAdsTdsAysTdsTdsAds	77	887
						GdsAdsGdsTdsAksTksGk

TABLE 52
Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2
	SEQ	SEQ	SEQ	SEQ
	ID	ID	ID	ID
	NO: 1	NO: 1	NO: 2	NO: 2			YAP1	SEQ
Compound	Start	Stop	Start	Stop	Sequence		(%	ID
Number	Site	Site	Site	Site	(5′ to 3′)	CHEMSITRY NOTATION	UTC)	NO
715487	3630	3645	124655	124670	ATTACTTCATAGCTTA	AksTksTksAdsmCdsTdsTdsmCdsAds	29	52
						TdsAdsGdsmCdsTksTksAk
958499	2565	2580	123590	123605	ATTAGAGTATGTGGCA	AksTksTksAdsGdsAdsGdsTdsAdsTds	14	810
						GdsTdsGdsGksmCksAk
1074461	2529	2544	123554	123569	GAAATTGTCTCATGCC	GksAksAksAdsTdsTdsGdsTdsmCds	15	2800
						TdsmCdsAdsTdsGksmCksmCk
1200788	2529	2544	123554	123569	GAAATUGTCTCATGCC	GksAksAksAdsTdsUysGdsTdsmCds	19	2912
						TdsmCdsAdsTdsGksmCksmCk
1200789	2530	2545	123555	123570	GGAAAUTGTCTCATGC	GksGksAksAdsAdsUysTdsGdsTdsm	12	2913
						CdsTdsmCdsAdsTksGksmCk
1200790	2531	2546	123556	123571	TGGAAATTGTCTCATG	TksGksGksAdsAdsAysTdsTdsGdsTds	33	2807
						mCdsTdsmCdsAksTksGk
1200791	2532	2547	123557	123572	ATGGAAATTGTCTCAT	AksTksGksGdsAdsAysAdsTdsTdsGds	46	2808
						TdsmCdsTdsmCksAksTk
1200792	2534	2549	123559	123574	ATATGGAAATTGTCTC	AksTksAksTdsGdsGysAdsAdsAdsTds	52	656
						TdsGdsTdsmCksTksmCk
1200802	4436	4451	125461	125476	TATAACTGGGCAAATT	TksAksTksAdsAdsCysTdsGdsGdsGds	89	2815
						mCdsAdsAdsAksTksTk
1200803	4438	4453	125463	125478	GGTATAACTGGGCAAA	GksGksTksAdsTdsAysAdsmCdsTds	22	1427
						GdsGdsGdsmCdsAksAksAk
1200804	4439	4454	125464	125479	AGGTAUAACTGGGCAA	AksGksGksTdsAdsUysAdsAdsmCds	44	2914
						TdsGdsGdsGdsmCksAksAk
1200805	4440	4455	125465	125480	GAGGTATAACTGGGCA	GksAksGksGdsTdsAysTdsAdsAdsm	50	1503
						CdsTdsGdsGdsGksmCksAk
1200806	4441	4456	125466	125481	TGAGGUATAACTGGGC	TksGksAksGdsGdsUysAdsTdsAds	24	2915
						AdsmCdsTdsGdsGksGksmCk
1200807	4442	4457	125467	125482	CTGAGGTATAACTGGG	mCksTksGksAdsGdsGysTdsAdsTds	69	2801
						AdsAdsmCdsTdsGksGksGk
1200808	4443	4458	125468	125483	ACTGAGGTATAACTGG	AksmCksTksGdsAdsGysGdsTdsAds	45	392
						TdsAdsAdsmCdsTksGksGk
1200809	4444	4459	125469	125484	CACTGAGGTATAACTG	mCksAksmCksTdsGdsAysGdsGdsTds	69	2802
						AdsTasAdsAdsmCksTksGk
1200810	4446	4461	125471	125486	AACACUGAGGTATAAC	AksAksmCksAdsmCdsUysGdsAdsGds	94	2916
						GdsTdsAdsTdsAksAksmCk
1200811	4595	4610	125620	125635	TTACAUTAGGAACAAG	TksTksAksmCdsAdsUysTdsAdsGds	62	2917
						GdsAdsAdsmCdsAksAksGk
1200812	4597	4612	125622	125637	TTTTACATTAGGAACA	TksTksTksTdsAdsCysAdsTdsTdsAds	59	2928
						GdsGdsAdsAksmCksAk
1200813	4598	4613	125623	125638	CTTTTACATTAGGAAC	mCksTksTksTdsTdsAysmCdsAdsTds	58	1124
						TdsAdsGdsGdsAksAksmCk
1200814	4599	4614	125624	125639	ACTTTUACATTAGGAA	AksmCksTksTdsTdsUysAdsmCdsAds	73	2918
						TdsTdsAdsGdsGksAksAk
1200815	4600	4615	125625	125640	CACTTUTACATTAGGA	mCksAksmCksTdsTdsUysTdsAdsm	55	2919
						CdsAdsTdsTdsAdsGksGksAk
1200816	4601	4616	125626	125641	GCACTUTTACATTAGG	GksCksAksmCdsTdsUysTdsTdsAds	37	2920
						mCdsAdsTdsTdsAksGksGk
1200817	4602	4617	125627	125642	AGCACUTTTACATTAG	AksGksmCksAdsmCdsUysTdsTdsTds	38	2921
						AdsmCdsAdsTdsTksAksGk
1200818	4603	4618	125628	125643	AAGCACTTTTACATTA	AksAksGksmCdsAdsCysTdsTdsTds	31	2821
						TdsAdsmCdsAdsTksTksAk
1200819	4605	4620	125630	125645	TTAAGCACTTTTACAT	TksTksAksAdsGdsCysAdsmCdsTds	101	2822
						TdsTdsTdsAdsmCksAksTk
1200820	4795	4810	125820	125835	GGAAGATCTGAAACTC	GksGksAksAdsGdsAysTdsmCdsTds	24	2823
						GdsAdsAdsAdsmCksTksmCk
1200821	4797	4812	125822	125837	TTGGAAGATCTGAAAC	TksTksGksGdsAdsAysGdsAdsTdsm	59	2824
						CdsTdsGdsAdsAksAksmCk
1200822	4798	4813	125823	125838	TTTGGAAGATCTGAAA	TksTksTksGdsGdsAysAdsGdsAdsTds	55	2938
						mCdsTdsGdsAksAksAk
1200823	4799	4814	125824	125839	CTTTGGAAGATCTGAA	mCksTksTksTdsGdsGysAdsAdsGds	46	2826
						AdsTdsmCdsTdsGksAksAk
1200824	4800	4815	125825	125840	GCTTTGGAAGATCTGA	GksmCksTksTdsTdsGysGdsAdsAds	43	2044
						GdsAdsTdsmCdsTksGksAk
1200825	4801	4816	125826	125841	TGCTTUGGAAGATCTG	TksGksmCksTdsTdsUysGdsGdsAds	39	2922
						AdsGdsAdsTdsmCksTksGk
1200826	4802	4817	125827	125842	GTGCTUTGGAAGATCT	GksTksGksmCdsTdsUysTdsGdsGds	26	2923
						AdsAdsGdsAdsTksmCksTk
1200827	4803	4818	125828	125843	AGTGCUTTGGAAGATC	AksGksTksGdsmCdsUysTdsTdsGds	67	2924
						GdsAdsAdsGdsAksTksmCk
1200828	4805	4820	125830	125845	ATAGTGCTTTGGAAGA	AksTksAksGdsTdsGysmCdsTdsTds	54	2829
						TdsGdsGdsAdsAksGksAk
1200829	N/A	N/A	94729	94744	AGGATGCATGGTTTTT	AksGksGksAdsTdsGysmCdsAdsTds	49	2830
						GdsGdsTdsTdsTksTksTk
1200830	N/A	N/A	94731	94746	TTAGGATGCATGGTTT	TksTksAksGdsGdsAysTdsGdsmCds	50	2831
						AdsTdsGdsGdsTksTksTk
1200831	N/A	N/A	94732	94747	TTTAGGATGCATGGTT	TksTksTksAdsGdsGysAdsTdsGdsm	42	2832
						CdsAdsTdsGdsGksTksTk
1200832	N/A	N/A	94733	94748	ATTTAGGATGCATGGT	AksTksTksTdsAdsGysGdsAdsTdsGds	61	2833
						mCdsAdsTdsGksGksTk
1200833	N/A	N/A	94734	94749	GATTTAGGATGCATGG	GksAksTksTdsTdsAysGdsGdsAdsTds	31	2834
						GdsmCdsAdsTksGksGk
1200834	N/A	N/A	94735	94750	AGATTUAGGATGCATG	AksGksAksTdsTdsUysAdsGdsGds	37	2925
						AdsTdsGdsmCdsAksTksGk
1200835	N/A	N/A	94736	94751	CAGATUTAGGATGCAT	mCksAksGksAdsTdsUysTdsAdsGds	82	2926
						GdsAdsTdsGdsmCksAksTk
1200836	N/A	N/A	94737	94752	TCAGAUTTAGGATGCA	TksmCksAksGdsAdsUysTdsTdsAds	72	2927
						GdsGdsAdsTdsGksmCksAk
1200837	N/A	N/A	94739	94754	ATTCAGATTTAGGATG	AksTksTksmCdsAdsGysAdsTdsTds	82	2838
						TdsAdsGdsGdsAksTksGk
1200838	N/A	N/A	115903	115918	ATATGGTTTTGTGTGT	AksTksAksTdsGdsGysTdsTdsTdsTds	65	2839
						GdsTdsGdsTksGksTk
1200839	N/A	N/A	115905	115920	TTATAUGGTTTTGTGT	TksTksAksTdsAdsUysGdsGdsTdsTds	44	2928
						TdsTdsGdsTksGksTk
1200840	N/A	N/A	115906	115921	CTTATATGGTTTTGTG	mCksTksTksAdsTdsAysTdsGdsGds	48	2788
						TdsTdsTdsTdsGksTksGk
1200841	N/A	N/A	115907	115922	TCTTAUATGGTTTTGT	TksmCksTksTdsAdsUysAdsTdsGds	76	2929
						GdsTdsTdsTdsTksGksTk
1200842	N/A	N/A	115908	115923	CTCTTATATGGTTTTG	mCksTksmCksTdsTdsAysTdsAdsTds	168	2842
						GdsGdsTdsTdsTksTksGk
1200843	N/A	N/A	115909	115924	ACTCTUATATGGTTTT	AksmCksTksmCdsTdsUysAdsTdsAds	46	2930
						TdsGdsGdsTdsTksTksTk
1200844	N/A	N/A	115910	115925	AACTCUTATATGGTTT	AksAksmCksTdsmCdsUysTdsAdsTds	132	2931
						AdsTdsGdsGdsTksTksTk
1200845	N/A	N/A	115911	115926	CAACTCTTATATGGTT	mCksAksAksmCdsTdsCysTdsTdsAds	100	2861
						TdsAdsTdsGdsGksTksTk
1200846	N/A	N/A	115913	115928	GACAACTCTTATATGG	GksAksmCksAdsAdsCysTdsmCdsTds	38	2862
						TdsAdsTdsAdsTksGksGk
1200847	N/A	N/A	117325	117340	ATTGCAATCTGTCTGA	AksTksTksGdsmCdsAysAdsTdsmCds	54	2843
						TdsGdsTdsmCdsTksGksAk
1200848	N/A	N/A	117327	117342	ATATTGCAATCTGTCT	AksTksAksTdsTdsGysmCdsAdsAds	58	2844
						TdsmCdsTdsGdsTksmCksTk
1200849	N/A	N/A	117328	117343	AATATUGCAATCTGTC	AksAksTksAdsTdsUysGdsmCdsAds	53	2932
						AdsTdsmCdsTdsGksTksmCk
1200850	N/A	N/A	117329	117344	TAATAUTGCAATCTGT	TksAksAksTdsAdsUysTdsGdsmCds	83	2933
						AdsAdsTdsmCdsTksGksTk
1200851	N/A	N/A	117330	117345	GTAATATTGCAATCTG	GksTksAksAdsTdsAysTdsTdsGdsm	25	1404
						CdsAdsAdsTdsmCksTksGk
1200852	N/A	N/A	117331	117346	TGTAAUATTGCAATCT	TksGksTksAdsAdsUysAdsTdsTdsGds	32	2934
						mCdsAdsAdsTksmCksTk
1200853	N/A	N/A	117332	117347	ATGTAATATTGCAATC	AksTksGksTdsAdsAysTdsAdsTdsTds	69	2848
						GdsmCdsAdsAksTksmCk
1200854	N/A	N/A	117333	117348	TATGTAATATTGCAAT	TksAksTksGdsTdsAysAdsTdsAdsTds	91	2849
						TdsGdsmCdsAksAksTk
1200855	N/A	N/A	117335	117350	TTTATGTAATATTGCA	TksTksTksAdsTdsGysTdsAdsAdsTds	56	2850
						AdsTdsTdsGksmCksAk
1200856	N/A	N/A	117755	117770	TGTATGTCAGAAGAGT	TksGksTksAdsTdsGysTdsmCdsAds	29	2863
						GdsAdsAdsGdsAksGksTk
1200857	N/A	N/A	117757	117772	AGTGTATGTCAGAAGA	AksGksTksGdsTdsAysTdsGdsTdsm	4	2864
						CdsAdsGdsAdsAksGksAk
1200858	N/A	N/A	117758	117773	AAGTGUATGTCAGAAG	AksAksGksTdsGdsUysAdsTdsGdsTds	10	2935
						mCdsAdsGdsAksAksGk
1200859	N/A	N/A	117759	117774	AAAGTGTATGTCAGAA	AksAksAksGdsTdsGysTdsAdsTdsGds	28	2866
						TdsmCdsAdsGksAksAk
1200860	N/A	N/A	117760	117775	TAAAGUGTATGTCAGA	TksAksAksAdsGdsUysGdsTdsAdsTds	16	2936
						GdsTdsmCdsAksGksAk
1200861	N/A	N/A	117761	117776	TTAAAGTGTATGTCAG	TksTksAksAdsAdsGysTdsGdsTdsAds	10	2868
						TdsGdsTdsmCksAksGk
1200862	N/A	N/A	117762	117777	TTTAAAGTGTATGTCA	TksTksTksAdsAdsAysGdsTdsGdsTds	17	2869
						AdsTdsGdsTksmCksAk
1200863	N/A	N/A	117763	117778	CTTTAAAGTGTATGTC	mCksTksTksTdsAdsAysAdsGdsTds	41	1634
						GdsTdsAdsTdsGksTksmCk
1200864	N/A	N/A	117765	117780	AACTTUAAAGTGTATG	AksAksmCksTdsTdsUysAdsAdsAds	84	2937
						GdsTdsGdsTdsAksTksGk
1200865	N/A	N/A	119667	119682	TAAGGUTTCCCAGATT	TksAksAksGdsGdsUysTdsTdsmCdsm	54	2938
						CdsmCdsAdsGdsAksTksTk
1200866	N/A	N/A	119669	119684	AGTAAGGTTTCCCAGA	AksGksTksAdsAdsGysGdsTdsTdsTds	41	2852
						mCdsmCdsmCdsAksGksAk
1200867	N/A	N/A	119670	119685	AAGTAAGGTTTCCCAG	AksAksGksTdsAdsAysGdsGdsTdsTds	38	2853
						TdsmCdsmCdsmCksAksGk
1200868	N/A	N/A	119671	119686	TAAGTAAGGTTTCCCA	TksAksAksGdsTdsAysAdsGdsGdsTds	36	2854
						TdsTdsmCdsmCksmCksAk
1200869	N/A	N/A	119672	119687	CTAAGUAAGGTTTCCC	mCksTksAksAdsGdsUysAdsAdsGds	25	2939
						GdsTdsTdsTdsmCksmCksmCk
1200870	N/A	N/A	119673	119688	ACTAAGTAAGGTTTCC	AksmCksTksAdsAdsGysTdsAdsAds	73	2855
						GdsGdsTdsTdsTksmCksmCk
1200871	N/A	N/A	119674	119689	GACTAAGTAAGGTTTC	GksAksmCksTdsAdsAysGdsTdsAds	65	2856
						AdsGdsGdsTdsTksTksmCk
1200872	N/A	N/A	119675	119690	AGACTAAGTAAGGTTT	AksGksAksmCdsTdsAysAdsGdsTds	98	2857
						AdsAdsGdsGdsTksTksTk
1200873	N/A	N/A	119677	119692	TTAGACTAAGTAAGGT	TksTksAksGdsAdsCysTdsAdsAdsGds	55	2858
						TdsAdsAdsGksGksTk

Example 6: Dose-Dependent Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers

Modified oligonucleotides described in the studies above were tested at various doses in A-431 cells. Cultured A-431 cells at a density of 5,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent control of the amount of Yap11 mRNA relative to untreated control cells (% UTC). IC50s were calculated using a linear regression on a log/linear plot of the data in excel.

TABLE 53
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in A-431 cells
	% UTC
ION	148	444	1333	4000	IC50
No.	nM	nM	nM	nM	(μM)
715415	84	59	55	42	1.8
715423	83	91	80	57	>4.0
715433	87	72	65	40	2.5
715434	84	69	64	43	2.8
715473	89	67	50	30	1.3
715478	70	47	29	16	0.4
715479	98	80	77	64	>4.0
715480	91	79	67	59	>4.0
715483	82	58	43	35	1.1
715486	93	89	81	56	>4.0
715487	87	56	48	29	1.0
715490	98	89	76	43	4.1
715500	97	72	67	48	3.6
715501	82	82	68	56	>4.0
715508	78	70	67	43	3.5
715510	88	67	59	45	2.4
715523	100	62	75	44	3.2
715555	93	71	63	42	2.5
715577	87	76	73	45	>4.0

TABLE 54
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in A-431 cells
	% UTC
ION	148	444	1333	4000	IC50
No.	nM	nM	nM	nM	(μM)
715414	91	91	102	67	>4.0
715435	80	67	61	48	3.4
715471	82	103	105	79	>4.0
715478	72	59	31	18	0.6
715558	94	112	80	66	>4.0
715582	98	63	93	70	>4.0
716370	81	79	69	49	>4.0
716376	103	94	79	50	>4.0
716424	76	69	51	44	2.0
716445	89	82	56	44	2.6
716454	91	71	54	48	2.6
716469	71	78	89	39	>4.0
716481	89	90	58	32	2.0
716484	88	78	80	55	>4.0
716493	95	97	86	72	>4.0
716496	74	87	64	49	>4.0
716502	73	57	45	30	0.8
716505	83	103	82	66	>4.0
716577	109	93	79	60	>4.0

TABLE 55
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in A-431 cells
	% UTC
ION	148	444	1333	4000	IC50
No.	nM	nM	nM	nM	(μM)
715478	76	56	32	18	0.6
716381	106	90	80	44	4.2
716387	94	94	80	67	>4.0
716407	84	75	72	39	3.0
716419	89	84	49	47	2.5
716438	93	75	62	49	3.4
716455	95	70	49	25	1.2
716479	88	78	55	57	>4.0
716480	80	56	38	39	1.0
716489	84	83	69	61	>4.0
716500	88	96	79	46	>4.0
716501	91	69	66	55	>4.0
716503	91	80	67	64	>4.0
716513	82	73	39	39	1.4
716524	103	92	96	62	>4.0
716537	120	96	88	63	>4.0
716543	62	99	79	64	>4.0
716548	99	89	79	67	>4.0
716554	87	90	76	50	>4.0

Example 7: Dose-Dependent Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers

Modified oligonucleotides described in the studies above were tested at various doses in A-431 cells. Cultured A-431 cells at a density of 10,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS36584. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). IC50s were calculated using a linear regression on a log/linear plot of the data in excel.

TABLE 56
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in A-431 cells
	% UTC
ION	15.6	62.5	250.0	4000.00	IC50
No.	nM	nM	nM	nM	(μM)
715483	78	38	15	6	0.05
715491	92	83	48	28	0.27
958356	84	79	39	21	0.18
958361	100	80	42	22	0.22
958369	107	68	34	17	0.17
958370	98	74	41	22	0.20
958371	89	57	27	11	0.10
958373	72	45	21	17	0.05
958375	74	35	11	5	0.04
958377	90	60	38	17	0.13
958403	94	63	30	12	0.12
958476	71	30	13	6	0.03
958496	86	53	27	9	0.09
958536	94	67	30	16	0.14
958596	69	38	14	7	0.04
958721	72	32	9	3	0.03
958726	99	70	40	16	0.17
958736	83	38	14	7	0.06
958796	91	62	32	15	0.13

TABLE 57
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in A-431 cells
	% UTC
ION	15.6	62.5	250.0	4000.00	IC50
No.	nM	nM	nM	nM	(μM)
715483	79	45	15	4	0.1
958451	98	74	51	23	0.2
958466	84	81	49	30	0.3
958481	86	62	28	14	0.1
958486	87	73	45	22	0.2
958491	94	65	27	10	0.1
958506	80	55	24	10	0.1
958526	118	83	40	17	0.2
958531	92	63	26	13	0.1
958541	81	51	18	9	0.1
958546	91	72	45	22	0.2
958551	95	73	34	14	0.2
958556	103	95	63	34	0.5
958616	78	49	29	17	0.1
958686	75	69	38	18	0.1
958731	85	64	39	19	0.1
958761	84	73	41	24	0.2
958781	77	45	20	10	0.1
958786	106	84	51	25	0.3

TABLE 58
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in A-431 cells
	% UTC
ION	15.6	62.5	250.0	4000.00	IC50
No.	nM	nM	nM	nM	(μM)
715483	84	44	15	5	0.1
958457	91	50	24	13	0.1
958472	92	63	39	23	0.2
958477	83	37	14	6	0.1
958497	82	35	11	3	0.1
958527	89	74	35	13	0.1
958532	88	44	16	7	0.1
958537	100	56	21	11	0.1
958542	90	70	35	17	0.1
958547	98	74	43	22	0.2
958567	99	80	44	16	0.2
958577	81	51	22	11	0.1
958587	94	49	18	7	0.1
958622	79	50	18	7	0.1
958727	90	42	25	8	0.1
958742	105	70	39	20	0.2
958752	102	66	26	9	0.1
958757	110	89	43	27	0.3
958807	92	65	30	10	0.1

TABLE 59
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in A-431 cells
	% UTC
ION	15.6	62.5	250.0	4000.00	IC50
No.	nM	nM	nM	nM	(μM)
715483	83	44	16	4	0.1
958498	70	21	5	2	0.02
958507	93	69	38	19	0.2
958518	95	55	18	4	0.1
958533	99	61	27	12	0.1
958553	68	23	12	5	0.03
958562	105	95	59	28	0.4
958563	94	54	22	10	0.1
958572	83	77	31	22	0.2
958573	81	56	23	8	0.1
958597	104	46	45	20	0.2
958603	70	27	11	4	0.03
958623	100	62	29	10	0.1
958668	81	38	12	5	0.1
958737	104	92	57	29	0.4
958758	83	66	33	12	0.1
958763	98	60	22	8	0.1
958767	101	57	20	10	0.1
958798	101	61	26	12	0.1

TABLE 60
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in A-431 cells
	% UTC
ION	15.6	62.5	250.0	4000.00	IC50
No.	nM	nM	nM	nM	(μM)
715483	79	40	13	3	0.1
958473	85	60	29	17	0.1
958508	65	64	32	13	0.1
958523	86	64	31	12	0.1
958538	101	77	52	30	0.3
958543	84	63	36	18	0.1
958554	70	34	11	4	0.03
958558	84	83	67	35	0.5
958568	88	65	37	21	0.1
958578	78	52	23	10	0.1
958588	93	73	46	27	0.2
958593	99	60	27	15	0.1
958598	93	58	36	19	0.1
958648	80	65	48	24	0.2
958658	90	88	59	29	0.4
958718	104	80	44	24	0.2
958753	72	48	20	11	0.1
958793	88	61	42	25	0.2
958813	81	79	47	29	0.2

TABLE 61
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in A-431 cells
	% UTC
ION	15.6	62.5	250.0	4000.00	IC50
No.	nM	nM	nM	nM	(μM)
715483	80	38	13	4	0.1
958454	72	40	12	4	0.04
958474	63	37	18	11	0.03
958484	77	38	10	4	0.05
958499	54	12	3	1	<0.01
958509	66	37	15	7	0.03
958529	103	64	27	11	0.1
958534	85	48	21	9	0.1
958569	82	49	24	7	0.1
958579	85	52	24	12	0.1
958589	75	50	19	8	0.1
958599	100	74	44	16	0.2
958614	84	49	22	13	0.1
958644	97	85	50	24	0.3
958659	91	68	28	9	0.1
958724	89	55	20	6	0.1
958729	73	44	13	4	0.05
958739	77	46	19	7	0.1
958799	88	53	25	10	0.1

TABLE 62
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION	% UTC	IC50
No.	15.6 nM	62.5 nM	250.0 nM	4000.00 nM	(μM)
715483	88	40	12	4	0.1
958485	68	38	13	8	0.04
958525	94	57	26	8	0.1
958544	65	77	40	17	0.1
958545	75	50	19	8	0.1
958549	98	78	47	28	0.3
958550	91	60	26	10	0.1
958555	99	73	34	13	0.2
958565	83	62	30	13	0.1
958580	95	59	24	9	0.1
958590	71	33	9	4	0.03
958594	91	70	42	20	0.2
958615	91	60	34	18	0.1
958650	82	51	17	7	0.1
958725	65	36	7	1	0.03
958730	88	48	19	7	0.1
958734	87	65	35	15	0.1
958785	78	52	18	6	0.1
958819	79	63	34	19	0.1

TABLE 63
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION	% UTC	IC50
No.	15.6 nM	62.5 nM	250.0 nM	4000.00 nM	(μM)
715483	87	45	15	4	0.1
715483	77	36	10	3	0.04
715487	77	44	13	4	0.1
716454	84	39	12	6	0.1
958490	81	54	26	13	0.1
958500	91	63	32	16	0.1
958505	81	72	53	21	0.2
958535	98	64	38	19	0.2
958540	62	28	14	8	0.02
958570	93	60	33	17	0.1
958575	89	58	34	20	0.1
958585	95	71	40	17	0.2
958595	83	57	37	16	0.1
958600	69	44	23	14	0.05
958605	76	63	34	9	0.1
958625	86	59	35	17	0.1
958735	116	69	37	23	0.2
958795	90	69	38	20	0.2
958805	90	89	56	28	0.3

Example 8: Dose-Dependent Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers

Modified oligonucleotides described in the studies above were tested at various doses in A-431 cells. Cultured A-431 cells at a density of 10,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). IC50s were calculated using a linear regression on a log/linear plot of the data in excel.

TABLE 64
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
958499	27	4	3	2	<0.02
1074368	67	34	15	10	0.1
1074464	25	6	3	3	<0.02
1074560	50	16	6	4	<0.02
1074753	42	10	6	4	<0.02
1075137	70	22	8	4	0.1
1075233	45	12	5	3	<0.02
1075712	69	38	13	7	0.1
1075744	55	22	9	7	<0.02
1075808	38	9	4	4	<0.02
1075968	74	37	11	5	0.1
1076000	71	31	10	5	0.1
1076064	68	26	10	5	0.1
1076256	68	33	11	6	0.1
1076288	31	7	3	4	<0.02
1076416	67	33	13	7	0.1
1076448	61	19	4	3	<0.02
1076449	44	8	3	2	<0.02
1076481	21	4	2	3	<0.02

TABLE 65
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
958499	24	4	2	2	<0.02
1074274	42	14	7	5	<0.02
1074593	50	20	9	8	<0.02
1074594	53	23	10	5	<0.02
1074595	67	21	8	4	0.04
1074626	54	18	8	5	<0.02
1074627	17	5	3	3	<0.02
1074755	28	9	5	3	<0.02
1074817	50	22	13	11	<0.02
1074850	63	20	7	5	0.04
1075041	62	31	11	7	0.05
1075138	66	27	8	5	0.05
1075457	52	21	8	6	<0.02
1075458	74	43	17	6	0.1
1075778	56	29	10	5	0.03
1075810	67	28	12	7	0.1
1075842	27	7	3	3	<0.02
1076067	45	13	5	4	<0.02
1076386	61	30	11	5	0.04

TABLE 66
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
958499	28	4	2	2	<0.02
1074563	80	31	7	5	0.1
1074564	40	14	7	4	<0.02
1074628	29	13	7	6	<0.02
1074723	56	24	11	8	<0.02
1074756	22	7	4	4	<0.02
1074851	51	19	9	7	<0.02
1074852	36	11	4	4	<0.02
1075395	60	18	7	5	<0.02
1075748	81	36	12	7	0.1
1075876	47	20	7	5	<0.02
1075939	46	19	10	8	<0.02
1076003	60	28	17	11	0.04
1076004	27	7	3	2	<0.02
1076260	61	30	12	5	0.05
1076291	75	26	8	5	0.1
1076323	41	35	13	5	<0.02
1076388	87	40	13	6	0.1
1076483	63	27	11	6	0.04

TABLE 67
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
958499	23	4	2	2	<0.02
1074245	47	21	8	5	<0.02
1074565	47	20	9	6	<0.02
1074566	41	12	5	3	<0.02
1074597	35	15	8	7	<0.02
1074629	21	5	3	3	<0.02
1074630	57	23	10	6	<0.02
1074726	26	8	4	3	<0.02
1074758	74	23	8	5	0.1
1075078	65	32	12	4	0.1
1075749	46	22	7	4	<0.02
1075781	52	15	4	3	<0.02
1075813	57	31	11	5	0.04
1076293	49	18	6	5	<0.02
1076326	53	20	6	3	<0.02
1076453	11	2	1	2	<0.02
1076486	84	45	16	6	0.1
1076516	64	39	18	13	0.1
1076549	53	24	10	6	<0.02

TABLE 68
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
958499	31	5	2	2	<0.02
1074407	55	27	13	8	<0.02
1074535	57	21	7	5	<0.02
1074536	64	24	9	6	0.04
1074728	28	7	4	4	<0.02
1074792	48	17	7	5	<0.02
1075047	80	63	27	10	0.2
1075048	76	42	13	5	0.1
1075111	42	11	6	5	<0.02
1075112	87	36	13	7	0.1
1075143	59	21	5	3	<0.02
1075207	82	51	17	7	0.1
1075686	72	44	18	14	0.1
1075784	54	18	5	3	<0.02
1076070	55	17	8	6	<0.02
1076294	76	50	21	11	0.1
1076295	55	17	5	3	<0.02
1076327	73	38	17	9	0.1
1076456	43	14	5	3	<0.02

TABLE 69
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
958499	36	5	2	2	<0.02
1074250	67	35	15	9	0.1
1074313	56	21	9	5	<0.02
1074409	60	30	13	7	0.04
1074537	47	21	6	4	<0.02
1074762	74	32	14	8	0.1
1074794	56	23	10	6	<0.02
1075081	76	50	22	9	0.1
1075401	62	26	11	7	0.04
1075465	75	35	14	9	0.1
1075689	97	59	19	8	0.2
1075785	29	7	3	3	<0.02
1075816	66	29	12	8	0.1
1076330	57	31	9	4	0.04
1076393	54	20	8	5	<0.02
1076458	88	52	23	10	0.2
1076489	43	13	4	3	<0.02
1076490	36	9	4	3	<0.02
1076552	73	40	17	12	0.1

TABLE 70
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
958499	27	4	2	2	<0.02
1074251	73	33	16	10	0.1
1074315	57	26	9	5	0.03
1074411	47	20	8	6	<0.02
1074443	69	35	14	8	0.1
1074795	38	14	7	5	<0.02
1075115	57	41	17	9	0.1
1075146	67	38	16	8	0.1
1075242	71	39	18	12	0.1
1075243	50	18	7	5	<0.02
1075498	82	40	21	16	0.1
1075819	48	18	7	5	<0.02
1076298	92	58	29	18	0.2
1076299	68	38	13	5	0.1
1076426	68	46	24	18	0.1
1076427	75	30	9	4	0.1
1076459	67	32	13	7	0.1
1076491	81	45	21	10	0.1
1076523	67	38	18	7	0.1

TABLE 71
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
958499	29	5	2	2	<0.02
1074221	75	38	14	7	0.1
1074413	50	19	6	3	<0.02
1074444	49	21	7	4	<0.02
1074508	62	30	14	8	0.05
1074509	44	12	6	5	<0.02
1075052	40	10	4	4	<0.02
1075053	61	24	8	5	0.04
1075084	103	72	37	14	0.3
1075757	43	14	5	2	<0.02
1075916	73	34	14	8	0.1
1076077	53	19	9	5	<0.02
1076396	64	22	5	3	0.04
1076397	43	14	5	4	<0.02
1076460	79	53	25	12	0.2
1076461	65	24	7	3	0.04
1076524	71	30	12	7	0.1
1076525	43	14	5	2	<0.02
1076556	72	46	19	11	0.1

TABLE 72
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
958499	95	89	82	81	>2.0
1074222	59	21	8	5	<0.02
1074318	48	12	6	4	<0.02
1074414	64	34	14	7	0.1
1074445	57	19	8	6	<0.02
1074446	39	11	5	3	<0.02
1074477	77	48	20	12	0.1
1074606	31	10	6	4	<0.02
1074638	14	4	3	3	<0.02
1074766	72	32	14	7	0.1
1074798	34	12	5	6	<0.02
1075118	85	36	8	4	0.1
1075246	70	34	12	6	0.1
1076174	58	21	7	4	<0.02
1076366	63	25	8	4	0.04
1076430	42	14	6	4	<0.02
1076462	61	22	8	5	0.03
1076494	34	7	3	2	<0.02
1076526	44	9	3	2	<0.02

TABLE 73
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
958499	103	89	85	87	>2.0
1074351	69	33	13	7	0.1
1074447	47	20	8	5	<0.02
1074448	54	13	4	3	<0.02
1074479	23	8	4	4	<0.02
1074480	33	9	5	3	<0.02
1074607	45	22	10	5	<0.02
1074639	46	18	7	5	<0.02
1075055	60	20	6	4	0.03
1075088	37	9	4	2	<0.02
1075824	33	10	5	3	<0.02
1075855	65	30	12	8	0.1
1075983	81	46	17	6	0.1
1076015	70	37	15	9	0.1
1076143	81	48	20	9	0.1
1076367	31	10	4	3	<0.02
1076399	60	29	11	6	0.04
1076464	36	10	3	2	<0.02
1076527	81	41	16	8	0.1

TABLE 74
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
958499	33	5	3	2	<0.02
1074417	68	26	7	3	0.1
1074576	69	41	14	9	0.1
1074577	33	10	4	3	<0.02
1074608	49	20	9	7	<0.02
1074609	65	29	15	11	0.1
1074672	34	18	10	7	<0.02
1074736	34	12	7	7	<0.02
1074737	50	21	8	6	<0.02
1074800	48	21	10	7	<0.02
1074801	76	41	19	12	0.1
1075089	45	9	3	3	<0.02
1075249	77	37	16	8	0.1
1075792	79	41	15	10	0.1
1076017	59	25	9	5	0.03
1076049	61	16	13	6	<0.02
1076369	60	20	6	3	<0.02
1076370	46	12	4	2	<0.02
1076465	72	32	14	7	0.1

TABLE 75
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
958499	27	5	2	2	<0.02
1074290	49	17	9	7	<0.02
1074418	55	26	9	4	<0.02
1074419	48	15	5	3	<0.02
1074420	38	8	3	2	<0.02
1074450	54	22	7	5	<0.02
1074451	63	26	8	4	0.04
1074484	43	12	5	3	<0.02
1074578	66	30	18	11	0.1
1074579	54	22	8	5	<0.02
1074610	57	20	10	7	<0.02
1074675	47	18	6	3	<0.02
1075155	51	15	6	4	<0.02
1075699	26	6	3	2	<0.02
1076114	34	11	6	5	<0.02
1076115	47	17	9	6	<0.02
1076466	43	18	8	6	<0.02
1076467	24	6	3	2	<0.02
1076530	53	26	11	7	<0.02

TABLE 76
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in A-431 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
958499	36	5	2	2	<0.02
1074229	58	24	9	5	<0.02
1074421	61	29	8	5	0.04
1074452	88	28	9	5	0.1
1074453	51	18	9	5	<0.02
1074485	47	14	5	3	<0.02
1074548	50	15	7	8	<0.02
1074549	67	31	12	7	0.1
1074580	55	18	8	5	<0.02
1074613	63	23	9	6	0.04
1074676	54	16	6	5	<0.02
1075061	58	23	9	6	<0.02
1075093	74	26	7	4	0.1
1075701	84	34	11	6	0.1
1075797	43	11	4	3	<0.02
1075893	80	29	11	8	0.1
1076084	69	34	12	8	0.1
1076085	70	34	14	9	0.1
1076340	79	42	17	11	0.1

TABLE 77
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in A-431 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
958499	37	4	2	2	<0.02
1074230	62	30	12	8	0.05
1074454	39	9	3	3	<0.02
1074486	55	26	10	6	<0.02
1074487	73	28	11	6	0.1
1074678	73	37	16	10	0.1
1074679	52	16	6	5	<0.02
1074775	26	5	2	2	<0.02
1075222	75	30	8	5	0.1
1075766	56	21	11	8	<0.02
1075990	28	6	3	3	<0.02
1076022	63	28	8	5	0.04
1076023	60	18	5	3	<0.02
1076119	82	35	12	6	0.1
1076183	65	22	9	6	0.04
1076406	51	20	9	7	<0.02
1076439	48	13	6	5	<0.02
1076471	64	29	9	5	0.05
1076534	88	48	20	10	0.2

Example 9: Dose-Dependent Inhibition of Human Yap1 in SNU-449 Cells by Modified Oligonucleotides

Modified oligonucleotides described in the studies above were tested at various doses in SNU-449 cells. Cultured SNU-449 cells at a density of 10,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS36584. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). IC50s were calculated using a linear regression on a log/linear plot of the data in excel.

TABLE 78
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in SNU-449 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
715487	94	47	23	8	0.2
1198371	85	66	46	21	0.3
1198380	72	55	27	11	0.1
1198382	77	56	36	18	0.2
1198384	76	50	24	17	0.1
1198397	70	53	28	14	0.1
1198398	73	55	33	18	0.2
1198406	70	57	31	16	0.2
1198409	100	68	45	27	0.4
1198412	73	54	33	15	0.2
1198422	88	60	30	19	0.2
1198423	58	35	15	6	0.05
1198424	64	44	24	9	0.1
1198438	62	28	7	2	0.04
1198439	44	21	5	2	<0.03
1198440	55	23	6	2	<0.03
1198718	87	37	14	4	0.1
1198719	67	30	9	3	0.1
1198746	49	24	9	3	<0.03

TABLE 79
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in SNU-449 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
715487	90	44	15	5	0.1
1198202	83	46	16	5	0.1
1198212	74	35	10	2	0.1
1198213	91	33	11	3	0.1
1198638	70	42	13	4	0.1
1198641	55	29	11	3	0.03
1198642	79	48	15	4	0.1
1198656	55	22	8	3	<0.03
1198664	52	33	14	5	<0.03
1198673	51	26	8	3	<0.03
1198696	58	31	11	2	0.04
1198697	60	29	7	1	0.04
1198698	55	29	8	2	0.03
1198724	56	25	8	3	<0.03
1198728	51	28	9	3	<0.03
1198786	63	32	11	2	0.1
1198787	68	21	6	1	0.05
1198788	64	30	7	2	0.1
1198799	62	35	13	4	0.1

TABLE 80
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides SNU-449 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
715487	98	56	25	10	0.2
958590	69	52	29	12	0.1
1074728	69	45	19	8	0.1
1097247	58	28	8	2	0.04
1197215	56	31	7	2	0.04
1197216	66	39	15	4	0.1
1197217	66	39	14	4	0.1
1198285	67	41	16	5	0.1
1198286	64	45	22	8	0.1
1198287	95	68	36	16	0.3
1198288	77	43	17	7	0.1
1198289	72	41	18	9	0.1
1198290	60	39	20	10	0.1
1198294	59	33	14	5	0.05
1198295	82	47	19	8	0.1
1198297	67	42	16	7	0.1
1198347	67	54	24	8	0.1
1198354	66	24	5	1	0.05
1198356	85	30	7	1	0.1

TABLE 81
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in SNU-449 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
715487	109	53	28	12	0.3
1198352	58	29	10	3	0.04
1198353	60	30	10	4	0.04
1198355	63	34	10	4	0.1
1198358	68	39	20	8	0.1
1198365	59	38	15	5	0.1
1198543	75	42	19	6	0.1
1198546	70	42	18	6	0.1
1198550	73	56	30	13	0.2
1198552	72	46	23	9	0.1
1198553	65	38	19	6	0.1
1198554	72	46	22	8	0.1
1198555	73	40	19	9	0.1
1198557	81	52	26	11	0.2
1198569	71	45	22	14	0.1
1198570	58	33	16	9	0.04
1198578	73	45	25	12	0.1
1198610	69	29	7	2	0.1
1198613	80	25	7	2	0.1

TABLE 82
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in SNU-449 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
715487	125	73	35	15	0.4
1197229	54	32	16	7	0.03
1197235	64	36	16	5	0.1
1197236	64	46	25	14	0.1
1197269	48	21	7	1	<0.03
1197270	43	23	8	2	<0.03
1197312	101	58	34	11	0.3
1197313	71	38	16	6	0.1
1198596	73	40	14	4	0.1
1198605	57	27	7	1	0.03
1198611	37	19	4	1	<0.03
1198612	44	12	2	0	<0.03
1198614	69	26	3	1	0.1
1198615	52	23	5	2	<0.03
1198616	78	46	18	5	0.1
1198623	48	24	5	1	<0.03
1198624	62	37	21	9	0.1
1200797	84	52	23	11	0.2
1200798	77	44	17	7	0.1

TABLE 83
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in SNU-449 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
715487	136	70	35	10	0.4
958499	93	47	19	7	0.2
1074461	76	37	15	5	0.1
1197271	70	47	19	8	0.1
1197309	91	63	30	9	0.2
1200784	70	51	26	12	0.1
1200785	98	73	42	24	0.4
1200788	61	38	19	9	0.1
1200789	60	32	15	5	0.05
1200794	85	59	31	13	0.2
1200796	69	47	25	12	0.1
1200803	72	52	34	18	0.2
1200806	91	54	34	18	0.2
1200820	104	69	36	17	0.3
1200857	66	30	8	2	0.1
1200858	71	39	14	4	0.1
1200860	59	35	15	5	0.05
1200861	74	43	17	4	0.1
1200862	88	64	35	13	0.2

TABLE 84
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in SNU-449 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
715487	100	62	29	12	0.3
1074462	90	38	13	3	0.1
1074464	109	50	19	6	0.2
1198804	71	48	19	5	0.1
1198805	61	42	20	7	0.1
1198814	63	25	6	3	0.04
1198815	84	64	34	15	0.2
1198818	68	33	15	5	0.1
1198831	74	33	10	4	0.1
1198832	77	53	23	13	0.1
1198856	72	55	24	7	0.1
1198857	78	44	13	4	0.1
1198873	38	12	2	0	<0.03
1198874	36	8	1	0	<0.03
1198875	61	23	4	1	0.04
1198895	62	37	16	9	0.1
1198911	62	31	12	7	0.05
1198917	81	37	12	6	0.1
1198918	60	33	13	9	0.05

TABLE 85
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in SNU-449 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
715487	103	56	25	10	0.2
1009325	59	36	16	4	0.1
1009326	59	35	14	4	0.05
1074756	42	20	6	3	<0.03
1074798	62	38	17	8	0.1
1076187	68	46	24	12	0.1
1076453	67	29	8	1	0.1
1076481	86	40	15	3	0.1
1197176	66	37	19	6	0.1
1197177	56	29	8	2	0.03
1197178	64	36	14	4	0.1
1197179	58	38	17	7	0.1
1197193	85	52	24	11	0.2
1197213	87	46	14	2	0.1
1197214	88	31	7	1	0.1
1197223	88	55	25	8	0.2
1198312	76	34	10	5	0.1
1198872	49	21	6	1	<0.03
1198877	62	32	13	5	0.05

TABLE 86
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in SNU-449 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
715487	92	53	22	12	0.2
1095481	73	47	16	8	0.1
1095593	73	44	27	10	0.1
1198203	71	51	25	11	0.1
1198211	72	37	23	12	0.1
1198243	55	28	10	5	<0.03
1198267	78	44	15	3	0.1
1198268	83	52	17	5	0.1
1198457	82	56	31	12	0.2
1198460	60	49	28	11	0.1
1198466	68	44	18	6	0.1
1198470	73	41	18	9	0.1
1198484	80	45	24	12	0.1
1198501	65	36	17	11	0.1
1198524	50	32	9	3	<0.03
1198525	62	26	8	1	0.04
1198526	61	30	8	2	0.04
1198527	63	35	12	3	0.1
1198905	75	43	21	6	0.1

TABLE 87
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in SNU-449 cells
ION	% UTC	IC50
No.	31.3 nM	125.0 nM	500.0 nM	2000.00 nM	(μM)
715487	89	48	23	10	0.2
1198492	67	39	19	10	0.1
1198494	59	37	24	13	0.1
1198499	89	42	30	12	0.2
1198500	72	51	34	15	0.2
1198502	76	50	29	15	0.2
1198504	77	46	27	24	0.1
1198507	83	57	29	13	0.2
1198510	71	44	18	6	0.1
1198528	87	54	30	11	0.2
1198529	86	69	37	16	0.3
1198900	69	36	18	7	0.1
1198902	74	46	22	10	0.1
1198904	78	36	23	10	0.1
1198935	50	46	23	11	0.04
1198958	68	39	16	5	0.1
1198959	62	28	8	2	0.04
1198960	77	35	8	2	0.1
1198961	77	35	11	3	0.1

Example 10: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Balb/c Mice

Balb/c mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of male Balb/c mice at 4-6 weeks of age (obtained from Taconic) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male Balb/c mice was injected with PBS. Mice were euthanized on day 26 post start of treatment (24 hours following the final administration).

Plasma Chemistry Markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 88
Plasma chemistry markers in Balb/c mice
	ION	ALT	AST	TBIL
	No.	(U/L)	(U/L)	(mg/dL)
	PBS	35	56	0.18
	715480	791	439	0.15
	715484	116	110	0.15
	715487	79	96	0.13
	715491	33	48	0.11
	715557	1755	2377	0.28
	715558	65	91	0.16
	715582	2460	2320	2.09
	715593	628	610	0.11
	715609	1120	2941	0.67
	715659	332	431	0.23
	715744	164	138	0.15
	715763	522	316	0.18
	715766	182	191	0.12
	715784	47	47	0.13
	715797	188	222	0.15
	715859	306	133	0.17
	715863	2090	903	0.54

Body and Organ Weights

Body weights of Balb/c mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 89
Body and organ weights
	body
ION	weight	Liver	Kidney	Spleen
No.	(g)	(g)	(g)	(g)
PBS	22	1.05	0.37	0.09
715480	22	1.64	0.34	0.12
715484	22	1.47	0.37	0.13
715487	23	1.24	0.36	0.14
715491	22	1.03	0.32	0.12
715557	21	1.96	0.31	0.12
715558	22	1.33	0.38	0.12
715582	22	1.46	0.38	0.16
715593	19	1.12	0.30	0.13
715609	21	2.64	0.33	0.10
715659	20	1.21	0.31	0.11
715744	22	1.18	0.32	0.17
715763	23	1.71	0.36	0.13
715766	21	1.40	0.30	0.12
715784	23	1.15	0.39	0.12
715797	22	1.39	0.36	0.16
715859	22	1.32	0.36	0.14
715863	21	1.79	0.33	0.12

Example 11: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Balb/c Mice

Balb/c mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of male Balb/c mice at 4-6 weeks of age (obtained from Taconic) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male Balb/c mice was injected with PBS. Mice were euthanized on day 26 post start of treatment (24 hours following the final administration).

Plasma Chemistry Markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 90
Plasma chemistry markers in Balb/c mice
ION	ALT	AST	BUN	TBIL
No.	(U/L)	(U/L)	(mg/dL)	(mg/dL)
PBS	18	54	14	0.18
715415	1075	701	17	0.14
715473	3046	2861	20	2.77
715483	62	70	16	0.17
715487	59	81	16	0.18
716424	2077	1422	20	0.22
716454	39	60	14	0.18
716455	1089	1193	22	0.25
716480	2156	844	19	0.14
716481	1935	2248	21	0.46
716502	2920	1329	17	0.27
716513	325	229	17	0.14

Body and Organ Weights

Body weights of Balb/c mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 91
Body and organ weights
	body
ION	weight	Liver	Kidney	Spleen
No.	(g)	(g)	(g)	(g)
PBS	24	1.09	0.40	0.11
715415	25	1.79	0.40	0.17
715473	20	1.46	0.31	0.09
715483	25	1.56	0.43	0.12
715487	27	1.46	0.42	0.15
716424	23	2.08	0.36	0.15
716454	25	1.48	0.42	0.14
716455	21	2.66	0.32	0.14
716480	21	2.58	0.34	0.10
716481	22	1.99	0.36	0.13
716502	23	2.18	0.42	0.10
716513	25	1.59	0.41	0.18

Example 12: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Balb/c Mice

Balb/c mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of male Balb/c mice at 6-7 weeks of age (obtained from Taconic) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male Balb/c mice was injected with PBS. Mice were euthanized on day 26 post start of treatment (24 hours following the final administration).

Plasma Chemistry Markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 92
Plasma chemistry markers in Balb/c mice
ION	ALT	AST	TBIL	BUN
No.	(U/L)	(U/L)	(mg/dL)	(mg/dL)
PBS	22	63	0.16	22
958375	2736	3013	0.43	22
958454	1183	2162	6.53	45
958498	1441	3197	0.74	12
958499	142	146	0.17	26
958509	1483	1627	0.31	26
958540	4127	3940	0.44	25
958553	174	227	0.20	29
958554	583	1051	0.28	17
958590	374	360	0.16	25
958603	1103	927	0.35	27
958721	57	114	0.17	28
958725	3758	3758	0.91	31
958729	4368	4503	2.15	30
958736	2439	1450	0.31	20

Body and Organ Weights

Body weights of Balb/c mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 93
Body and organ weights
	body
ION	weight	Liver	Kidney	Spleen
No.	(g)	(g)	(g)	(g)
PBS	24	1.28	0.37	0.09
958375	23	2.00	0.39	0.12
958454	14	0.68	0.25	0.03
958498	20	1.51	0.45	0.19
958499	23	1.44	0.32	0.14
958509	20	1.50	0.27	0.13
958540	19	1.53	0.33	0.09
958553	21	1.01	0.29	0.11
958554	22	1.05	0.28	0.15
958590	25	1.76	0.40	0.13
958603	21	1.80	0.36	0.20
958721	24	1.45	0.33	0.12
958725	15	1.23	0.21	0.04
958729	15	1.32	0.24	0.05
958736	24	1.95	0.39	0.18

Example 13: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Balb/c Mice

Balb/c mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of male Balb/c mice at 4-6 weeks of age (obtained from Taconic) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male Balb/c mice was injected with PBS. Mice were euthanized on day 25 post start of treatment (24 hours following the final administration).

Plasma Chemistry Markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 94
Plasma chemistry markers in Balb/c mice
ION	ALT	AST	TBIL	BUN
No.	(U/L)	(U/L)	(mg/dL)	(mg/dL)
PBS	26*	65*	0.18	22
958371	249	199	0.24	30
958914	1855	1837	0.68	29
958933	63	122	0.22	33
958939	2236	1863	0.38	23
958941	772	500	0.23	30
958961	66	106	0.19	28
958973	93	126	0.20	22
959022	13242	8058	1.12	25
959030	1160	1328	0.21	29
959155	2146	1686	0.22	26
959167	1556	2096	0.56	24
959196	1169	785	0.31	27
959197	753	493	0.29	23
*Average of 3 values

Body and Organ Weights

Body weights of Balb/c mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 95
Body and organ weights body
	body
ION	weight	Liver	Kidney	Spleen
No.	(g)	(g)	(g)	(g)
PBS	25	1.29	0.39	0.09
958371	23	1.31	0.32	0.15
958914	19	1.22	0.32	0.12
958933	27	1.86	0.37	0.15
958939	24	1.67	0.40	0.23
958941	26	1.81	0.37	0.15
958961	26	1.47	0.39	0.15
958973	26	1.71	0.40	0.19
959022	19	1.76	0.34	0.11
959030	25	1.73	0.38	0.14
959155	21	1.53	0.34	0.25
959167	22	0.96	0.37	0.10
959196	23	1.22	0.34	0.11
959197	23	1.37	0.34	0.14

Example 14: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Balb/c Mice

Balb/c mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of male Balb/c mice at 5-6 weeks of age (obtained from Taconic) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male Balb/c mice was injected with PBS. Mice were euthanized on day 27 post start of treatment (24 hours following the final administration).

Plasma Chemistry Markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 96
Plasma chemistry markers in Balb/c mice
ION	ALT	AST	TBIL	BUN
No.	(U/L)	(U/L)	(mg/dL)	(mg/dL)
PBS	33	123	0.25	22
958497	46	151	0.24	26
958534	1962	1617	0.33	26
958589	35	66	0.21	24
958596	207	162	0.23	24
958622	224	254	0.24	23
958739	145	186	0.21	21

Body and Organ Weights

Body weights of Balb/c mice were measured on day 25, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 97
Body and organ weights
	body
ION	weight	Liver	Kidney	Spleen
No.	(g)	(g)	(g)	(g)
PBS	23	1.14	0.35	0.08
958497	23	1.31	0.35	0.11
958534	22	1.81	0.32	0.09
958589	25	1.40	0.37	0.10
958596	25	2.11	0.36	0.13
958622	23	0.92	0.33	0.12
958739	24	1.58	0.36	0.13

Example 15: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in CD-1 Mice

CD-1 mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of four male CD-1 mice at 4-5 weeks of age (obtained from Charles River) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male CD-1 mice was injected with PBS. Mice were euthanized on day 26 post start of treatment (24 hrs following the final administration).

Plasma Chemistry Markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB) and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 98
Plasma chemistry markers in CD-1 mice
	ION	ALT	AST	TBIL	BUN	ALB
	No.	(U/L)	(U/L)	(mg/dL)	(mg/dL)	(g/dL)
	PBS	32	47	19	0.2	2.5
	1074234	81	187	23	0.2	2.3
	1074461	1563	865	22	0.6	2.2
	1074554	32	49	22	0.2	2.5
	1074557	32	65	23	0.2	2.3
	1074587	163	131	25	0.2	2.4
	1074588	38	67	22	0.2	2.3
	1074622	34	59	20	0.2	2.5
	1074655	1360	978	19	0.3	2.0
	1074680	78	125	19	0.1	2.0
	1075067	28	59	23	6.4	2.5
	1075068	43	81	19	0.2	2.2
	1075741	114	113	20	0.2	2.3
	1075768	48	65	19	0.2	2.3
	1075769	74	103	18	0.2	2.5
	1075774	45	71	20	0.2	2.5
	1075838	97	131	22	0.2	2.2
	715483	79	125	21	0.2	2.2
	715487	66	113	21	0.1	1.9
	716454	44	56	20	0.2	2.3

Body and Organ Weights

Body weights of CD-1 mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 99
Body and organ weights
	body
ION	weight	Liver	Kidney	Spleen
No.	(g)	(g)	(g)	(g)
PBS	44	2.51	0.61	0.12
1074234	37	2.26	0.55	0.12
1074554	38	2.09	0.52	0.11
1074557	38	1.87	0.61	0.15
1074587	39	2.33	0.58	0.16
1074588	40	2.40	0.69	0.20
1074622	38	2.16	0.64	0.21
1074655	39	3.40	0.69	0.30
1074680	42	2.52	0.65	0.24
1075067	40	2.12	0.65	0.17
1075068	38	2.15	0.64	0.20
1075741	39	2.21	0.62	0.23
1075768	37	1.86	0.54	0.13
1075769	35	1.76	0.47	0.10
1075774	37	2.23	0.59	0.14
1075838	41	2.28	0.57	0.25
715483	40	2.26	0.64	0.21
715487	41	2.24	0.59	0.21
716454	38	2.31	0.55	0.20

Example 16: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in CD-1 Mice

CD-1 mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of four male CD-1 mice at 4-5 weeks of age (obtained from Charles River) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male CD-1 mice was injected with PBS. Mice were euthanized on day 27 post start of treatment (24 hrs following the final administration).

Plasma Chemistry Markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB) and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 100
Plasma chemistry markers in CD-1 mice
	ION	ALT	AST	TBIL	BUN	Albumin
	No.	(U/L)	(U/L)	(mg/dL)	(mg/dL)	(g/dL)
	PBS	21	45	0.19	22	2.5
	1076024	41	88	0.19	19	2.3
	1076157	55	105	0.19	19	2.1
	1076186	74	97	0.16	23	2.5
	1076187	57	90	0.18	20	2.3
	1076190	48	63	0.17	20	2.2
	1076287	53	98	0.20	21	2.1
	1076379	37	89	0.15	20	2.1
	1076382	52	87	0.14	19	1.9
	1076475	38	62	0.15	18	2.0
	1095493	1623	1449	0.69	18	1.8

Body and Organ Weights

Body weights of CD-1 mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 101
Body and organ weights
	body
ION	weight	Liver	Kidney	Spleen
No.	(g)	(g)	(g)	(g)
PBS	35	1.78	0.56	0.12
1076024	40	2.28	0.66	0.15
1076157	38	2.48	0.58	0.23
1076186	37	2.42	0.58	0.16
1076187	34	1.95	0.56	0.14
1076190	38	2.28	0.56	0.15
1076287	36	2.36	0.63	0.36
1076379	38	2.21	0.57	0.18
1076382	36	2.22	0.62	0.21
1076475	37	2.16	0.64	0.17
1095493	28	1.94	0.50	0.17

Example 17: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in CD-1 Mice

CD-1 mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of four male CD-1 mice at 4-5 weeks of age (obtained from Charles River) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male CD-1 mice was injected with PBS. Mice were euthanized on day 27 post start of treatment (24 hrs following the final administration).

Plasma Chemistry Markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB) and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 102
Plasma chemistry markers in CD-1 mice
ION	ALT	AST	BUN	TBIL
No.	(U/L)	(U/L)	(mg/dL)	(mg/dL)
PBS	22	100	24	0.16
1095404	1282	503	22	0.14
1095515	1041	951	19	1.12
1095632	92	126	26	0.15
1096947	46	116	23	0.17
1096450	1104	635	25	2.19
1096973	35	59	20	0.22
1097037	73	97	23	0.12
1096522	652	397	21	0.16
1075395	38	51	21	0.18
1097183	834	738	16	0.39
1097224	39	78	21	0.09
1097231	85	112	21	0.13

Body and Organ Weights

Body weights of CD-1 mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 103
Body and organ weights
	body
ION	weight	Liver	Kidney	Spleen
No.	(g)	(g)	(g)	(g)
PBS	34	1.92	0.55	0.11
1095404	33	2.09	0.58	0.15
1095515	26	1.52	0.47	0.20
1095632	33	2.04	0.48	0.17
1096947	33	1.91	0.51	0.21
1096450	35	2.59	0.42	0.19
1096973	35	2.21	0.48	0.18
1097037	33	2.33	0.52	0.21
1096522	31	2.04	0.45	0.18
1075395	34	2.30	0.49	0.20
1097183	28	1.23	0.46	0.20
1097224	37	1.93	0.54	0.16
1097231	34	2.37	0.47	0.24

Example 18: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in CD-1 Mice

CD-1 mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of four male CD-1 mice at 5-6 weeks of age (obtained from Charles River) were injected subcutaneously twice a week for four weeks (for a total of 9 treatments) with 50 mg/kg of modified oligonucleotides. One group of male CD-1 mice was injected with PBS. Mice were euthanized on day 34 post start of treatment (24 hours following the final administration).

Plasma Chemistry Markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB) and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 104
Plasma chemistry markers in CD-1 mice
ION	ALT	AST	BUN	TBIL
No.	(U/L)	(U/L)	(mg/dL)	(mg/dL)
PBS	24	53	20	0.27
958499	79	88	24	0.18
1074755	88	104	22	0.21
1076453	56	113	20	0.24
1076481	71	121	23	0.23

Body and Organ Weights

Body weights of CD-1 mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 105
Body and organ weights
	body
ION	weight	Liver	Kidney	Spleen
No.	(g)	(g)	(g)	(g)
PBS	39	1.84	0.59	0.17
958499	39	2.20	0.57	0.22
1074755	39	2.27	0.61	0.19
1076453	38	1.91	0.56	0.20
1076481	39	2.06	0.57	0.23

Example 19: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in CD-1 Mice

CD-1 mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of four male CD-1 mice at 4-6 weeks of age (obtained from Charles River) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male CD-1 mice was injected with PBS. Mice were euthanized on day 26 post start of treatment (24 hrs following the final administration).

Plasma Chemistry Markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB) and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 106
Plasma chemistry markers in CD-1 mice
ION	ALT	AST	TBIL	BUN
No.	(U/L)	(U/L)	(mg/dL)	(mg/dL)
PBS	32	48	0.25	20
1198439	210	219	0.25	18
1198440	121	140	0.22	19
1198872	192	207	0.25	22
1157929	39	50	0.22	19
1157034	210	165	0.19	17
1157111	48	74	0.22	17

Body and Organ Weights

Body weights of CD-1 mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 107
Body and organ weights
	body
ION	weight	Liver	Kidney	Spleen
No.	(g)	(g)	(g)	(g)
PBS	36	2.04	0.59	0.12
1198439	36	2.03	0.51	0.25
1198440	35	1.97	0.46	0.18
1198872	34	1.84	0.40	0.16
1157929	34	1.98	0.43	0.13
1157034	35	2.43	0.53	0.17
1157111	36	2.53	0.50	0.21

Example 20: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Sprague-Dawley Rats

Sprague-Dawley rats are a multipurpose model used for safety and efficacy evaluations. The rats were treated with Ionis modified oligonucleotides from the studies described in the Examples above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Male Sprague-Dawley rats were maintained on a 12-hour light/dark cycle and fed ad libitum with Purina normal rat chow. Groups of 4 Sprague-Dawley rats each were weekly injected subcutaneously with 50 mg/kg of Ionis oligonucleotide for 6 weeks (total 7 doses). Forty-eight hours after the last dose, the rats were euthanized; and organs, urine and plasma were harvested for further analysis.

Plasma Chemistry Markers

To evaluate the effect of Ionis oligonucleotides on hepatic function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in the table below expressed in IU/L. Plasma levels of total bilirubin (TBIL), albumin (ALB), and blood urea nitrogen (BUN) were also measured using the same clinical chemistry analyzer and the results are also presented in the table below. Ionis modified oligonucleotides that caused changes in the levels of any markers of liver function outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 108
Plasma chemistry markers in Sprague-Dawley rats
		Plasma clinical chemistry
		ALT	AST	TBIL	BUN	ALB
	ASO	(U/L)	(U/L)	(mg/dL)	(mg/dL)	(g/dL)
	PBS	31*	67*	0.17*	16	1.61
	958499	61	109	0.18	24	2.78
	1074755	57	97	0.12	29	2.99
	1076187	54	113	0.10	21	2.91
	1076453	47	77	0.13	23	3.14
	1076481	50	91	0.13	49	2.74
	1097224	31	51	0.07	86	1.61
	*Refers to groups with only 3 data points

Kidney Function

To evaluate the effect of Ionis oligonucleotides on kidney function, urinary levels of total protein and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The ratios of total protein to creatinine (P/C ratio) are presented in the Table below. Ionis oligonucleotides that caused changes in the levels of the ratio outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 109
Total protein to creatinine ratio in Sprague-Dawley rats
ION     URINE
NO.     P/C ratio
PBS     1
958499  5
1074755 5
1076187 5
1076453 5
1076481 5
1097224 87

Body and Organ Weights

Liver, spleen and kidney weights were measured at the end of the study and are presented in the table below. Terminal body weight was measured prior to necropsy. Ionis oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 110
Body and Organ weights
	body
ION	weight	Liver	Kidney	Spleen
No.	(g)	(g)	(g)	(g)
PBS	423	16	3.1	0.9
958499	333	14	3.1	2.8
1074755	357	16	3.3	2.1
1076187	344	17	3.0	1.7
1076453	371	16	3.2	2.1
1076481	367	14	2.6	2.1
1097224	316	13	4.5	1.4

Example 21: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Sprague-Dawley Rats

Sprague-Dawley rats are a multipurpose model used for safety and efficacy evaluations. The rats were treated with Ionis modified oligonucleotides from the studies described in the Examples above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Male Sprague-Dawley rats were maintained on a 12-hour light/dark cycle and fed ad libitum with Purina normal rat chow. Groups of 4 Sprague-Dawley rats each were weekly injected subcutaneously with 50 mg/kg of Ionis oligonucleotide for 6 weeks (total 7 doses). Forty-eight hours after the last dose, the rats were euthanized; and organs, urine and plasma were harvested for further analysis.

Plasma Chemistry Markers

To evaluate the effect of Ionis oligonucleotides on hepatic function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in the Table below expressed in IU/L. Plasma levels of total bilirubin (TBIL) and blood urea nitrogen (BUN) were also measured using the same clinical chemistry analyzer and the results are also presented in the Table below. Ionis modified oligonucleotides that caused changes in the levels of any markers of liver function outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 111
Plasma chemistry markers in Sprague-Dawley rats
		Plasma clinical chemistry
		ALT	AST	TBIL	BUN
	ASO	(U/L)	(U/L)	(mg/dL)	(mg/dL)
	PBS	64	98	0.19	19
	1198874	73	102	0.16	22
	1200857	183	318	4.93	56
	1074756	114*	79*	0.10*	0.57*
	1198873	78*	79*	0.17*	24*
	1198439	54*	94*	0.15*	22*
	1198615	38	71	0.13	21
	1198440	58**	108**	0.17**	20**
	1198612	74	91	0.12	31
	1198312	132	108	0.14	25
	*Refers to groups with 3 samples
	**Refers to groups with 2 samples

Body and Organ Weights

Liver, spleen and kidney weights were measured at the end of the study and are presented in the table below. Terminal body weight was measured prior to necropsy. Ionis oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 112
Body and Organ weights
	body
ION	weight	Liver	Kidney	Spleen
No.	(g)	(g)	(g)	(g)
PBS	453	17	3.64	0.91
1198874	372	20	3.67	2.61
1200857	307	19	6.97	2.55
1074756	349	21*	4.71*	1.99*
1198873	408	19	3.65	2.42
1198439	319*	17*	3.68*	2.28*
1198615	369	16	3.01	2.35
1198440	373	18	3.29	2.78
1198612	345	17	3.60	2.33
1198312	365	19	4.26	2.19
*Refers to groups with 3 samples

Kidney Function

To evaluate the effect of Ionis oligonucleotides on kidney function, urinary levels of total protein and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The ratios of total protein to creatinine (P/C ratio) are presented in the Table below. Ionis oligonucleotides that caused changes in the levels of the ratio outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 113
Total protein to creatinine ratio in Sprague-Dawley rats
        URINE
ION     P/C
NO.     ratio
PBS     1
1198874 9
1200857 52
1074756 167
1198873 9
1198439 8*
1198615 8
1198440 9
1198612 11
1198312 60
*Refers to groups with 3 samples

Example 22: Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Sprague-Dawley Rats

Sprague-Dawley rats are a multipurpose model used for safety and efficacy evaluations. The rats were treated with Ionis modified oligonucleotides from the studies described in the Examples above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Male Sprague-Dawley rats were maintained on a 12-hour light/dark cycle and fed ad libitum with Purina normal rat chow. Groups of 4 Sprague-Dawley rats each were weekly injected subcutaneously with 50 mg/kg of Ionis oligonucleotide for 6 weeks (total 7 doses). Forty-eight hours after the last dose, the rats were euthanized; and organs, urine and plasma were harvested for further analysis.

Plasma Chemistry Markers

To evaluate the effect of Ionis oligonucleotides on hepatic function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in the Table below expressed in IU/L. Plasma levels of total bilirubin (TBIL) and blood urea nitrogen (BUN) were also measured using the same clinical chemistry analyzer and the results are also presented in the Table below. Ionis modified oligonucleotides that caused changes in the levels of any markers of liver function outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 114
Plasma chemistry markers in Sprague-Dawley rats
		Plasma clinical chemistry
		ALT	AST	TBIL	BUN
	ASO	(U/L)	(U/L)	(mg/dL)	(mg/dL)
	PBS	80	105	0.22	19
	1197270	84	120	0.19	24
	1198872	109	134	0.20	18
	1198728	54	71	0.18	22
	1198831	54	69	0.20	23
	1198623	96	87	0.24	21
	1198605	46	76	0.33	18

Kidney Function

To evaluate the effect of Ionis oligonucleotides on kidney function, urinary levels of total protein and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The ratios of total protein to creatinine (P/C ratio) are presented in the Table below. Ionis oligonucleotides that caused changes in the levels of the ratio outside the expected range for modified oligonucleotides were excluded in further studies.

TABLE 115
Total protein to creatinine ratio in Sprague-Dawley rats
        URINE
ION     P/C
NO.     ratio
PBS     1
1197270 14
1198872 8
1198728 7
1198831 17
1198623 5
1198605 28

Body and Organ Weights

Liver, spleen and kidney weights were measured at the end of the study and are presented in the table below. Terminal body weight was measured prior to necropsy. Ionis oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

TABLE 116
Body and Organ weights
	body
ION	weight	Liver	Kidney	Spleen
No.	(g)	(g)	(g)	(g)
PBS	476	18	3.4	0.9
1197270	374	15	3.6	2.0
1198872	417	17	3.4	1.3
1198728	381	15	2.9	1.4
1198831	426	19	3.3	2.0
1198623	472	20	3.6	1.9
1198605	372	18	3.6	2.1

Example 23: Measurement of Viscosity of Modified Oligonucleotides Targeting Human Yap1

The viscosity of select modified oligonucleotides from the studies described above was measured with the aim of screening out modified oligonucleotides which have a viscosity of more than 40 centipoise (cP). Modified oligonucleotides having a viscosity greater than 40 cP would have less than optimal viscosity.

Oligonucleotides (32-38 mg) were weighed into a glass vial; approximately 100 μL of water was added, and the modified oligonucleotide was dissolved into solution by heating the vial to 55° C. Part (75 μL) of the pre-heated sample was pipetted to a micro-viscometer (PAC Cambridge Viscosity Viscometer). The temperature of the micro-viscometer was set to 25° C. and the viscosity of the sample was measured. The entire 75 uL of sample was them combined with the remaining portion of the sample was diluted appropriately for UV reading at 260 nM (Cary UV instrument). Modified oligonucleotides solutions that were not optimal in their viscosity under the criterion stated above were excluded in further studies.

TABLE 117
Viscosity of modified oligonucleotides
	Com-	Concentration	Concentration
	pound	by weight	by UV	Viscocity
	ID	(mg/mL)	(mg/mL)	(cP)
	958499	300	220.7	84.5
	1074755	300	217.2	7.2
	1074756	300	232.8	17.4
	1076187	300	237.4	40.6
	1076453	300	229.1	46.4
	1076481	300	213.0	6.4
	1097224	300	230.7	8.1
	1197269	300	211.4	10.7
	1197270	300	241.6	15.1
	1198243	300	234.0	13.4
	1198312	300	233.1	17.5
	1198439	300	233.8	14
	1198440	300	219.7	8.6
	1198501	300	220.0	14.5
	1198605	300	220.7	59.6
	1198611	300	228.3	8.6
	1198612	300	230.1	10.2
	1198615	300	223.1	23
	1198623	300	215.4	20.8
	1198641	300	223.2	16.4
	1198656	300	227.6	26.1
	1198673	300	237.2	15.3
	1198728	300	241.8	30.9
	1198746	300	232.7	13.4
	1198831	300	204.0	5.8
	1198872	300	220.7	5.5
	1198873	300	229.1	7.6
	1198874	300	222.0	12.5
	1200857	300	226.4	13.1

Example 24: Dose-Dependent Inhibition of Human Yap1 in A-431 Cells by Modified Oligonucleotides

Modified oligonucleotides described in the studies above were tested at various doses in A-431 cells. Cultured A-431 cells at a density of 11,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS36584. Yap1 mRNA levels were normalized to GAPDH content, as measured by primer probe set RTS104 (forward sequence GAAGGTGAAGGTCGGAGTC, designated herein as SEQ ID NO.: 17; reverse sequence GAAGATGGTGATGGGATTTC, designated herein as SEQ ID NO.: 18; probe sequence CAAGCTTCCCGTTCTCAGCC, designated herein as SEQ ID NO.: 19). Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). IC50s were calculated using a linear regression on a log/linear plot of the data in excel.

TABLE 118
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in A-431 cells
ION	% UTC	IC50
No.	0.002 μM	0.008 μM	0.04 μM	0.2 μM	1 μM	(μM)
958499	1	3	28	91	117	0.03
1076453	0	1	23	74	89	0.01
1197270	0	2	26	80	99	0.02
1198439	0	1	11	65	93	0.02
1198440	0	1	14	69	96	0.02
1198605	0	2	26	57	96	0.02
1198623	2	5	28	72	96	0.01
1198728	1	4	27	85	87	0.02
1198831	2	6	28	72	83	0.01
1198872	1	3	19	70	94	0.01

Example 25: Activity of Modified Oligonucleotides Targeting Human Yap1 in SCC25 Cells

Modified oligonucleotides described in the studies above were tested at various doses in squamous cell carcinoma cell line SCC25. A control oligonucleotide 792169 (a 3-10-3 cET gapmer with a full phosphorothioate backbone, CGCCGATAAGGTACAC, designated herein as SEQ ID No.: 2940; is not complementary to any known human gene) was also tested.

RNA Analysis

Cultured SCC25 cells at a density of 5,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002 (forward sequence CGGACTATGACTTAGTTGCGTTACA, designated herein as SEQ ID NO.: 20; reverse sequence GCCATGCCAATCTCATCTTGT, designated herein as SEQ ID NO.: 21; probe sequence CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated herein as SEQ ID NO.: 22). Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 119
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in SCC25 cells
		% UTC
	ION No.	0.04 μM	0.2 μM	1 μM	5 μM
	792169	96	89	93	98
	958499	47	22	10	4
	1076453	59	21	7	3
	1197270	48	24	12	7
	1198439	35	12	5	3
	1198440	39	14	5	3
	1198605	48	23	10	5
	1198623	61	31	15	10
	1198728	71	31	15	7
	1198831	63	36	16	14
	1198872	54	22	9	7

Cell Proliferation Assay

Cultured SCC25 cells at a density of 1,000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 120
Antiproliferative effect of modified
oligonucleotides in SCC25 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	103	104	100	88
958499	76	42	25	14
1076453	81	40	23	15
1197270	75	40	22	14
1198439	62	30	22	16
1198440	73	33	22	16
1198605	77	39	23	13
1198623	84	55	36	29
1198728	88	61	30	20
1198831	88	54	25	21
1198872	82	37	22	18

Example 26: Dose Dependent Inhibition of Human Yap1 by Modified Oligonucleotides in a Human Hepatocellular Carcinoma SNU449 Xenograft Tumor Model

A SNU449 hepatocellular carcinoma xenograft tumor model was used to evaluate activity of modified oligonucleotides targeted to human Yap1. Ten million SNU449 cells in 30% matrigel were implanted subcutaneously into the flanks of female NOD Cg-Prkdcscid ll2rgtm1Wjl/SzJ (NSG) mice (from Jackson Laboratory) at 4-6 weeks of age. When tumors reached an average volume of 100 mm³, approximately two weeks post-implantation, groups of four mice each were administered at 50 mg/kg twice weekly with modified oligonucleotides for five days. Tumors were collected and tested for Yap1 mRNA knockdown by RT-qPCR. Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated animals (% control).

TABLE 121
Inhibition of human Yap1 mRNA expression by
modified oligonucleotides in SNU449 xenografts
ION
No.     % control
PBS     100
958499  54
1074755 70
1076453 56
1197269 57
1197270 54
1198439 51
1198440 51
1198501 54
1198605 55
1198615 62
1198623 60
1198641 68
1198673 52
1198728 64
1198831 67
1198872 52
715487  61

Example 27: Dose Dependent Inhibition of Human Yap1 by Modified Oligonucleotides in a Human Epidermoid Carcinoma A-431 Xenograft Tumor Model

An epidermoid carcinoma A-431 xenograft tumor model was used to evaluate activity of modified oligonucleotides targeted to human Yap1. Five million A-431 cells in 30% matrigel were implanted subcutaneously into the flanks of female NCr-Foxn1nu mice (from Taconic) at 4-6 weeks of age. When tumors reached an average volume of 40 mm³, approximately two weeks post-implantation, groups of four mice each were administered at either 25 mg/kg or 50 mg/kg daily with modified oligonucleotides for four days (5 doses). Tumors were collected 6-8 hours post final dose and tested for Yap1 mRNA knockdown by RT-qPCR. Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated animals (% control).

TABLE 122
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in A-431 xenografts
		% control
	ION No.	25 mpk	50 mpk
	PBS	100	100
	958499	49	29
	1076453	55	25
	1197270	57	38
	1198439	37	19
	1198440	32	21
	1198605	32	30
	1198623	43	36
	1198728	47	39
	1198831	47	37
	1198872	34	26
	715487	61	57

Example 28: Dose Dependent Inhibition of Human Yap1 by Modified Oligonucleotides in a Human Squamous Cell Carcinoma CAL27 Xenograft Tumor Model

A squamous cell carcinoma CAL27 xenograft tumor model was used to evaluate activity of modified oligonucleotides targeted to human Yap1. Five million CAL27 cells in 30% matrigel were implanted subcutaneously into the flanks of female CrTac:NCr-Foxn1nu mice (from Taconic) at 4-6 weeks of age. Groups of four mice each were administered with either 15 mg/kg or 30 mg/kg of modified oligonucleotides daily for five days after tumor size had reached ˜100 mm³ (about 3 weeks post implantation). Tumors were collected and tested for Yap1 mRNA knockdown by RT-qPCR. Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated untreated control cells (% UTC).

TABLE 123
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in CAL27 xenografts
		% UTC
	ION No.	15 mg/kg	30 mg/kg
	PBS	100	100
	958499	68	53
	1076453	69	46
	1197270	55	38
	1198439	66	38
	1198440	67	41
	1198605	65	48
	1198623	52	44
	1198728	77	56
	1198831	70	48
	1198872	55	38

Example 29: Activity of Modified Oligonucleotides Targeting Human Yap1 in a Human Squamous Cell Carcinoma CAL33 Xenograft Tumor Model

A xenograft tumor model was used to evaluate activity of modified oligonucleotides targeted to human Yap1. One million CAL33 cells in 30% matrigel were implanted subcutaneously into the flanks of female CrTac:NCr-Foxn1nu (Taconic) mice. When tumors reached an average volume of 100 mm³, approximately two weeks post-implantation, groups of eight mice were administered at 50 mg/kg twice weekly with modified oligonucleotides for two weeks. ION 792169 was administered as a control.

Tumor samples were collected for measurement of Yap1 mRNA levels by RT-qPCR. Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated animals (% control).

Tumor volume was measured at the indicated days in the table below. Tumor weight was determined at end of study. Mice were sacrificed when tumors from PBS-treated mice reached 2,000 mm3.

TABLE 124
Yap1 mRNA levels in tumors
ION No. % control
PBS     102
792169  74
1198728 40
1198440 12

TABLE 125
Tumor volume (mm3)
Days post-implantation	10	13	17	21	24	27	31	34	38	40	44
ION Number	Average Tumor Volume (mm3)
PBS	144	254	382	666	855	974	1180	1342	1458	1472	1377
792169	123	262	367	531	774	805	962	1057	1171	1160	1069
1198728	113	253	423	621	835	988	1123	1233	1239	1277	1277
1198440	115	279	376	574	651	818	888	857	770	746	834

TABLE 126
Tumor weight (g)
        Average Tumor weight
ION No. (g)
PBS     1.02
792169  0.85
1198728 0.88
1198440 0.36

Example 30: Activity of Modified Oligonucleotides Targeting Human Yap1 in a Human Hepatocellular Carcinoma SNU449 Xenograft Tumor Model

Modified oligonucleotides described in the studies above were tested in a hepatocellular carcinoma SNU449 xenograft tumor model. A control oligonucleotide 792169 was also tested.

Five million SNU449 cells in 30% matrigel were implanted subcutaneously into the fatpads of female NOD.Cg-Prkdcscid II2rgtm1Wjl/SzJ mice (from Jackson Laboratory) at 4-6 weeks of age. 43 days post implantation (when tumors had reached approximately 100 mm³ in size), groups of eight mice each were administered with 50 mg/kg modified oligonucleotide daily for 10 days (loading dose), following which they were administered with 50 mg/kg modified oligonucleotide four times a week for one week, following which they were dosed with 50 mg/kg modified oligonucleotide thrice weekly until the end of the study. Animals were sacrificed and tumors were collected on day 119 post implantation. Yap1 mRNA knockdown in tumors was measured by RT-qPCR as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated animals (% control).

Tumor volumes were also measured at the indicated days in the table below

TABLE 127
Yap1 mRNA levels in tumors
Ion No. % control
PBS     100
792169  90
1198440 34

TABLE 128
Tumor volume (mm3)
	Days Post	Average Tumor Volume
	Tumor	(mm3)
	Implantation	PBS	792169	1198440
	43	111	111	111
	46	175	162	152
	50	208	180	168
	53	252	247	201
	57	292	280	242
	60	362	317	263
	64	396	397	338
	67	438	466	376
	71	463	519	373
	75	570	559	401
	78	597	634	429
	81	657	681	514
	85	760	785	606
	88	786	889	613
	92	955	1170	690
	94	1048	1215	773
	98	1114	1355	804
	101	1175	1417	818
	105	1252	1509	894
	108	1284	1571	921
	119	1431	1697*	978
	*Average of 7 samples

Example 31: Activity of Modified Oligonucleotides Targeting Human Yap1 in NCI H747 Cells

Modified oligonucleotides described in the studies above were tested at various doses in colorectal adeocarcinoma cell line NCI H747. A control oligonucleotide 792169 was also tested.

RNA Analysis

Cultured NCI H747 cells at a density of 10,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 129
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in NCI H747 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	94	83	87	100
715487	83	70	49	30
1198440	73	53	21	9

Cell Proliferation Assay

Cultured NCI H747 cells at a density of 3000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After 7 days, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 130
Antiproliferative effect of modified oligonucleotides in NCI
H747 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	89	97	91	80
715487	91	86	65	42
1198440	87	66	36	18

Example 32: Activity of Modified Oligonucleotides Targeting Human Yap1 in NCI H292 Cells

Modified oligonucleotides described in the studies above were tested at various doses in mucoepidermoid pulmonary carinoma cell line NCI 1-1292. A control oligonucleotide 792169 was also tested.

RNA Analysis

Cultured NCI H292 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 131
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in NCI H292 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	98	112	111	106
715487	104	83	40	12
1198440	89	53	18	5

Cell Proliferation Assay

Cultured NCI H292 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 132
Antiproliferative effect of modified oligonucleotides in NCI
H292 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	98	97	99	92
715487	87	90	69	20
1198440	100	83	30	15

Example 33: Activity of Modified Oligonucleotides Targeting Human Yap1 in BICR56 Cells

Modified oligonucleotides described in the studies above were tested at various doses in squamous cell carcinoma adherent keratinocyte cell line BICR56. A control oligonucleotide 792169 was also tested.

RNA Analysis

Cultured BICR56 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 133
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in BICR56 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	99	92	85	97
715487	68	28	16	11
1198440	40	10	7	7

Cell Proliferation Assay

Cultured BICR56 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 134
Antiproliferative effect of modified oligonucleotides in
BICR56 cells
		% UTC
	ION No.	0.04 μM	0.2 μM	1 μM	5 μM
	792169	106	100	92	87
	715487	70	26	9	4
	1198440	28	10	6	4

Example 34: Effect of Modified Oligonucleotides Targeting Human Yap1 in Cynomolgus Monkeys

Cynomolgus monkeys were treated with Ionis modified oligonucleotides selected from studies described in the Examples above. Modified oligonucleotide tolerability was evaluated.

Treatment

Prior to the study, the monkeys were kept in quarantine during which the animals were observed daily for general health. The monkeys were 2-4 years old and weighed 2-4 kg. Eleven groups of 4 randomly assigned male cynomolgus monkeys each were injected subcutaneously with Ionis oligonucleotide or saline in a clock-wise rotation between four different sites on the back. Following loading doses on days 1, 3, 5 and 7, the monkeys were dosed once per week (on days 14, 21, 28, 35, and 42) with 35 mg/kg of Ionis oligonucleotide. A control group of 4 cynomolgus monkeys was injected with 0.9% saline in a similar manner and served as the control group.

During the study period, the monkeys were observed twice daily for signs of illness or distress. Any animal experiencing more than momentary or slight pain or distress due to the treatment, injury or illness was treated by the veterinary staff with approved analgesics or agents to relieve the pain after consultation with the Study Director. Any animal in poor health or in a possible moribund condition was identified for further monitoring and possible euthanasia. Scheduled euthanasia of the animals was conducted on day 86 approximately 48 hours after the last dose by exsanguination while under deep anesthesia. The protocols described in the Example were approved by the Institutional Animal Care and Use Committee (IACUC).

Body and Organ Weight Measurements

To evaluate the effect of Ionis oligonucleotides on the overall health of the animals, body and organ weights were measured. Terminal body weight was measured prior to necropsy. Organ weights were measured as well, and all weight measurements are presented in the Table below. The results indicate that effect of treatment with modified oligonucleotides on body and organ weights was within the expected range for modified oligonucleotides. Specifically, treatment with ION 1198440 was well tolerated in terms of the body and organ weights of the monkeys.

TABLE 135
Body and Organ weights (g)
		Terminal
	ION	Body				Liver with
	No.	Weight	Heart	kidney	spleen	gallbladder
	Saline	2855	11	14	3	60
	958499	2894	10	15	4	68
	1076453	2955	11	16	5	72
	1197270	2852	10	17	4	73
	1198439	2959	10	15	3	67
	1198440	2919	11	15	3	65
	1198605	2968	11	15	4	67
	1198623	2790	9	13	3	62
	1198728	2722	10	15	5	65
	1198831	2788	11	14	4	65
	1198872	3126	12	15	4	63

Kidney and Liver Function

To evaluate the effect of Ionis oligonucleotides on hepatic and kidney function, blood samples were collected from all the study groups on day 44. The monkeys were fasted overnight prior to blood collection. Blood was collected in tubes without anticoagulant for serum separation. The tubes were kept at room temperature for a minimum of 90 minutes and then centrifuged at 3000 rpm for 10 minutes to obtain serum. Levels of various liver function markers were measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan). Plasma levels of glucose (GLU), blood urea nitrogen (BUN), creatinine (CREA), total protein (TP), albumin (ALB), globulin (GLO), albumin/globulin (A/G) ratio calculated, alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), gamma-glutamyltransferase (GGT), alkaline phosphatase (ALP), triglyceride (TG), high density lipoprotein (HDL), and low density lipoprotein (LDL) were measured and the results are presented in the table below. The results indicate that modified oligonucleotides had no effect on liver function outside the expected range for modified oligonucleotides. Specifically, treatment with ION 1198440 was well tolerated in terms of the liver function in monkeys.

TABLE 136
Liver/Kidney function markers in cynomolgus monkey plasma
ION	ALT	AST	TBIL	GGT	ALP	TG	HDL	LDL
NO.	(IU/L)	(IU/L)	(mg/dL)	(IU/L)	(IU/L)	(mg/dL)	(mg/dL)	(mg/dL)
Saline	60	50	0.3	91	1539	34	96	68
958499	67	73	0.2	67	1449	41	89	46
1076453	53	76	0.2	78	1173	29	98	66
1197270	84	78	0.2	75	1215	31	102	48
1198439	40	65	0.2	63	1298	28	82	59
1198440	45	75	0.2	80	1412	30	104	54
1198605	40	58	0.2	85	1445	25	115	57
1198623	50	47	0.2	59	916	34	87	50
1198728	58	92	0.3	59	1165	24	95	57
1198831	48	63	0.3	65	1096	22	108	63
1198872	48	94	0.3	79	1098	19	114	60

TABLE 137
Liver/Kidney function markers in cynomolgus monkey plasma
ION	GLU	BUN	CREA	TP	ALB	GLO	A/G
NO.	(mg/dL)	(mg/dL)	(mg/dL)	(g/dL)	(g/dL)	(g/dL)	ratio
Saline	84	25	1.0	7.2	4.2	3.0	1.4
958499	83	24	0.9	7.2	4.0	3.2	1.3
1076453	89	27	0.9	7.0	3.9	3.1	1.3
1197270	115	27	0.9	6.8	3.7	3.1	1.2
1198439	115	24	0.9	6.8	4.0	2.8	1.4
1198440	91	26	0.9	7.0	4.1	2.9	1.4
1198605	69	22	0.8	6.7	4.0	2.7	1.5
1198623	70	26	0.8	7.2	4.2	3.0	1.4
1198728	95	26	0.9	7.3	4.1	3.2	1.3
1198831	73	26	0.7	6.7	3.9	2.8	1.4
1198872	80	27	0.9	7.1	4.0	3.1	1.3

Pro-Inflammatory Proteins Analysis

To evaluate any inflammatory effect of Ionis oligonucleotides in cynomolgus monkeys, blood samples were taken for analysis. The monkeys were fasted overnight prior to blood collection. On day 42 (pre-dose and 24 hours post-dose), approximately 0.8 mL of blood was collected from each animal and put into tubes without anticoagulant for serum separation. The tubes were kept at room temperature for a minimum of 90 min and then centrifuged at 3,000 rpm for 10 min at room temperature to obtain serum. Complement C3 were measured using a Toshiba 120 FR NEO chemistry analyzer (Toshiba Co., Japan). The results indicate that treatment with ION 1198440 did not cause any inflammation in monkeys. Another marker of inflammation, C-Reactive Protein (CRP) was tested together with the clinical chemistry parameters tested for liver function above.

TABLE 138
Pro-inflammatory protein analysis in cynomolgus monkeys
		Complement C3 (mg/dL)
		Day 42	day 42	CRP (mg/L)
	ION No.	(pre-dose)	(24 hr post-dose)	day 44
	Saline	117	106	4.1
	958499	112	89	9.9
	1076453	101	88	1.5
	1197270	103	86	9.8
	1198439	99	94	2.9
	1198440	95	88	4.8
	1198605	105	95	4.2
	1198623	105	101	2.0
	1198728	93	90	4.0
	1198831	81	81	1.1
	1198872	103	96	1.1

Hematology

To evaluate any effect of Ionis oligonucleotides in cynomolgus monkeys on hematologic parameters, blood samples of approximately 0.5 mL of blood was collected from each of the available study animals on day 44. The samples were collected in tubes containing K₂-EDTA. Samples were analyzed for red blood cell (RBC) count, Hemoglobin (HGB), Hematocrit (HCT), Mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), RBC Distribution Width (RCDW), reticulocyte count (Retic), platelet count (PLT), mean platelet volume (MPV), white blood cells (WBC) count, individual white blood cell counts, such as that of monocytes (MON), neutrophils (NEU), lymphocytes (LYM), eosinophils (EOS), basophils (BAS), and large unstained cells (LUC) using an ADVIA2120i hematology analyzer (Siemens, USA).

The data indicate the oligonucleotides did not cause any changes in hematologic parameters outside the expected range for modified oligonucleotides at this dose. Specifically, treatment with ION 1198440 was well tolerated in terms of the hematologic parameters of the monkeys.

TABLE 139
Blood cell counts in cynomolgus monkeys
	RBC	HGB	HCT	MCV	MCH	MCHC	RCDW	Retic	PLT
ION NO.	(×10{circumflex over ( )}6/μL)	(g/dL)	(%)	(fL)	(pg)	(g/dL)	(%)	(%)	(103/μL)
Saline	5.8	13	46	79	23	29	13	1.2	334
958499	5.6	12	43	77	22	29	12	1.5	399
1076453	5.5	13	43	79	23	29	15	1.2	358
1197270	5.6	12	44	79	22	28	12	1.1	452
1198439	6.0	14	48	79	22	28	12	1.2	367
1198440	5.9	14	47	80	23	29	12	1.2	420
1198605	6.1	13	46	75	22	29	13	1.1	385
1198623	5.9	14	46	78	23	30	13	1.0	376
1198728	5.9	14	47	80	23	29	12	1.3	428
1198831	5.6	13	43	76	23	30	12	1.0	377
1198872	5.7	13	44	78	23	30	12	1.2	400

TABLE 140
Blood cell counts in cynomolgus monkeys
ION	WBC	NEU	LYM	MON	EOS	BAS	LUC	MPV
NO.	(×103/μL)	(%)	(%)	(%)	(%)	(%)	(%)	(fL)
Saline	9.2	41	55	3.2	1.0	0.3	0.5	8.2
958499	12.0	49	44	3.5	1.1	0.4	1.2	7.6
1076453	10.0	39	54	3.9	1.1	0.4	1.2	8.4
1197270	10.6	38	54	3.5	2.7	0.4	1.2	7.1
1198439	10.3	27	68	2.9	1.5	0.3	0.6	7.6
1198440	10.9	28	65	3.2	2.8	0.4	0.7	7.5
1198605	10.5	44	51	2.8	0.8	0.4	0.5	8.1
1198623	11.7	43	53	2.0	0.8	0.4	0.7	7.8
1198728	10.7	29	64	2.9	2.2	0.5	0.9	8.0
1198831	7.6	44	50	3.3	2.0	0.3	0.8	7.3
1198872	10.4	64	32	2.2	0.6	0.3	0.5	7.1

Coagulation

To evaluate effect of Ionis modified oligonucleotides on coagulation in cynomolgus monkeys, blood samples of approximately 0.9 mL were collected from each of the available study animals on day 44. The samples were collected in tubes containing 3.2% sodium citrate. Coagulation parameters tested include Activated partial thromboplastin time (APTT), prothrombin time (PT) and Figrinogen (FIB).

The data indicate the modified oligonucleotides did not cause any changes in coagulation parameters outside the expected range for modified oligonucleotides at this dose. Specifically, treatment with ION 1198440 was well tolerated in terms of the coagulation parameters of the monkeys.

TABLE 141
Coagulation Parameters in cynomolgus monkeys
	ION	PT	FIB	APTT
	No.	(sec)	(mg/dL)	(sec)
	Saline	9	229	18
	958499	9	275	18
	1076453	9	234	20
	1197270	10	257	17
	1198439	10	246	19
	1198440	10	260	20
	1198605	9	236	23
	1198623	10	229	17
	1198728	9	242	18
	1198831	10	209	18
	1198872	10	206	21

Urine Analysis

Food was removed overnight the day before fresh urine collection, but water was supplied. Fresh urine samples for urinalysis and urine chemistry were collected from all animals using a clean cage pan on wet ice (first in the morning) on day 44. Urinalysis/Urine Chemistry parameters creatinine (UCRE), microprotein (UTP), urine microalbumin (UALB), and protein/creatinine (P/C) ratio were measured using a Toshiba 120FR automated chemistry analyzer (Toshiba Co., Japan). Specifically, treatment with ION 1198440 was well tolerated in terms urine chemistry markers.

TABLE 142
Urinalysis and Urine Chemistry Markers
ION	UTP	UALB	UCRE	P/C
NO.	(mg/dL)	(mg/dL)	(mg/dL)	ratio
Saline	13	0.5	69	0.3
958499	16	0.1	60	0.3
1076453	14	0.1	50	0.3
1197270	18	1.3	56	0.3
1198439	15	0.1	68	0.2
1198440	13	0.2	53	0.3
1198605	12	0.4	69	0.2
1198623	10	0.2	44	0.2
1198728	16	0.3	70	0.2
1198831	13	0.1	46	0.3
1198872	14	0.3	111	0.2

Example 35: Activity of Modified Oligonucleotides Targeting Human Yap1 in BICR-22 Cells

Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous carcinoma (lymph node m cell line BICR-2. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured BICR-22 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 144
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in BICR-22 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	99	98	98	98
715487	82	45	23	13
1198440	44	14	4	4

Cell Proliferation Assay

Cultured BICR-22 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 145
Antiproliferative effect of modified
oligonucleotides in BICR-22 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	97	95	82	65
715487	70	56	28	22
1198440	55	37	29	19

Example 36: Activity of Modified Oligonucleotides Targeting Human Yap1 in CAL33 Cells

Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma line CAL33. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured CAL33 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 146
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in CAL33 cells
		% UTC
	ION No.	0.04 μM	0.2 μM	1 μM	5 μM
	792169	106	106	91	85
	715487	81	41	12	6
	1198440	43	14	5	5

Cell Proliferation Assay

Cultured CAL33 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 147
Antiproliferativeeffect of modified oligonucleotides in
CAL33 cells
		% UTC
	ION No.	0.04 μM	0.2 μM	1 μM	5 μM
	792169	92	93	81	67
	715487	89	79	61	37
	1198440	84	67	58	44

Example 37: Activity of Modified Oligonucleotides Targeting Human Yap1 in CAL27 Cells

Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma line CAL27. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured CAL27 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 148
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in CAL27 cells
		% UTC
	ION No.	0.08 μM	0.4 μM	2 μM	10 μM
	792169	95	90	97	88
	715487	35	23	5	3
	1198440	23	6	4	4

Cell Proliferation Assay

Cultured CAL27 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 149
Antiproliferative effect of modified
oligonucleotides in CAL27 cells
	% UTC
ION No.	0.08 μM	0.4 μM	2 μM	10 μM
792169	96	102	103	90
715487	95	85	67	33
1198440	86	85	83	51

Example 38: Activity of Modified Oligonucleotides Targeting Human Yap1 in Detroit-562 Cells

Modified oligonucleotides described in the studies above were tested at various doses in pharynx carcinoma cell line Detroit-562. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured Detroit-562 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 150
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in Detroit-562 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	102	102	94	99
715487	77	29	10	5
1198440	32	8	3	2

Cell Proliferation Assay

Cultured Detroit-562 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 151
Antiproliferative effect of modified
oligonucleotides in Dctroit-562 cells
	%UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	99	106	100	79
715487	92	84	71	52
1198440	84	67	59	45

Example 39: Activity of Modified Oligonucleotides Targeting Human Yap1 in SCC-4 Cells

Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma cell line SCC-4. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured SCC-4 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 152
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in SCC-4 cells
		% UTC
	ION No.	0.04 μM	0.2 μM	1 μM	5 μM
	792169	92	106	105	104
	715487	81	46	23	13
	1198440	63	27	11	5

Cell Proliferation Assay

Cultured SCC-4 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 153
Antiproliferative effect of modified oligonucleotides in
SCC-4 cells
		% UTC
	ION No.	0.04 μM	0.2 μM	1 μM	5 μM
	792169	125	169	142	136
	715487	158	121	106	69
	1198440	82	60	21	11

Example 40: Activity of Modified Oligonucleotides Targeting Human Yap1 in SCC-9 Cells

Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma cell line SCC-9. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured SCC-9 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 154
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in SCC-9 cells
		% UTC
	ION No.	0.04 μM	0.2 μM	1 μM	5 μM
	792169	86	94	96	101
	715487	74	44	21	11
	1198440	53	18	6	2

Cell Proliferation Assay

Cultured SCC-9 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 155
Antiproliferative effect of modified
oligonucleotides in SCC-9 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	104	111	102	94
715487	97	73	51	34
1198440	88	46	35	31

Example 41: Activity of Modified Oligonucleotides Targeting Human Yap1 in SCC-15 Cells

Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma cell line SCC-15. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured SCC-15 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 156
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in SCC-15 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	91	100	102	105
715487	69	33	12	5
1198440	39	10	4	2

Cell Proliferation Assay

Cultured SCC-15 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 157
Antiproliferative effect of modified
oligonucleotides in SCC-15 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	93	92	89	71
715487	87	66	47	28
1198440	72	54	42	32

Example 42: Activity of Modified Oligonucleotides Targeting Human Yap1 in SCC-25 Cells

Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma cell line SCC-25. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured SCC-25 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 158
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in SCC-25 cells
	% UTC
ION No.	0.08 μM	0.4 μM	2 μM	10 μM
792169	87	87	89	86
715487	70	32	16	11
1198440	32	12	8	7

Cell Proliferation Assay

Cultured SCC-25 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 159
Antiproliferative effect of
modified oligonucleotides in SCC-25 cells
	% UTC
ION No.	0.08 μM	0.4 μM	2 μM	10 μM
792169	97	101	96	92
715487	82	48	25	15
1198440	56	27	20	16

Example 43: Activity of Modified Oligonucleotides Targeting Human Yap1 in SNU-899 Cells

Modified oligonucleotides described in the studies above were tested at various doses in laryngeal squamous cell carcinoma cell line SN-899. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured SNU-899 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 160
Dose-dependent inhibition of human Yap1 mRNA expression
by modified oligonucleotides in SNU-899 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	106	106	111	102
715487	62	26	9	4
1198440	35	12	3	2

Cell Proliferation Assay

Cultured SNU-899 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 161
Antiproliferative effect of modified
oligonucleotides in SNU-899 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	90	94	96	86
715487	82	78	71	62
1198440	82	75	69	66

Example 44: Activity of Modified Oligonucleotides Targeting Human Yap1 in SNU-1066 Cells

Modified oligonucleotides described in the studies above were tested at various doses in laryngeal squamous cell carcinoma line SNU-1066. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured SNU-1066 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 162
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in SNU-1066 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	91	94	93	98
715487	77	49	22	7
1198440	70	28	7	2

Cell Proliferation Assay

Cultured SNU-1066 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 163
Antiproliferative effect of modified
oligonucleotides in SNU-1066 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	100	104	102	96
715487	97	86	72	47
1198440	89	66	58	43

Example 45: Activity of Modified Oligonucleotides Targeting Human Yap1 in SNU-1076 Cells

Modified oligonucleotides described in the studies above were tested at various doses in upper aerodigestive tract/laryngeal squamous cell carcinoma line SNU-1076. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured SNU-1076 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 164
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in SNU-1076 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	89	98	102	107
715487	89	67	31	11
1198440	83	43	11	3

Cell Proliferation Assay

Cultured SNU-1076 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 165
Antiproliferative effect of modified
oligonucleotides in SNU-1076 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	97	104	106	108
715487	91	90	86	79
1198440	99	87	81	81

Example 46: Activity of Modified Oligonucleotides Targeting Human Yap1 in SNU-1214 Cells

Modified oligonucleotides described in the studies above were tested at various doses in laryngeal squamous cell carcinoma cell line SNU-1214. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured SNU-1214 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 166
Dose-dependent inhibition of human Yap1 mRNA expression by
modified oligonucleotides in SNU-1214 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	97	104	106	109
715487	71	36	16	9
1198440	40	11	4	3

Cell Proliferation Assay

Cultured SNU-1214 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 167
Antiproliferative effect of modified
oligonucleotides in SNU-1214 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	105	90	96	72
715487	93	69	52	38
1198440	84	72	53	49

Example 47: Activity of Modified Oligonucleotides Targeting Human Yap1 in UPCI:SCC090 Cells

Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma cell line UPCI:SCC090. A control oligonucleotide 792169, described herein above, was also tested.

RNA Analysis

Cultured UPCI:SCC090 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).

TABLE 168
Dose-dependent inhibition of human Yap1 mRNA
expression by modified oligonucleotides in UPCI:SCC090 cells
	% UTC
ION No.	0.04 μM	0.2 μM	1 μM	5 μM
792169	100	108	112	84
715487	70	37	26	14
1198440	60	26	10	5

Cell Proliferation Assay

Cultured UPCI:SCC090 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 169
Antiproliferative
effect of modified oligonucleotides in UPCI:SCC090 cells
		% UTC
	ION No.	0.04 μM	0.2 μM	1 μM	5 μM
	792169	100	104	99	93
	715487	92	94	72	68
	1198440	101	92	75	70

Example 30: Activity of Modified Oligonucleotides Targeting Human Yap1 in a Human Hepatocellular

carcinoma SNU449 xenograft tumor model (alone and in combination with sorafenib) Modified oligonucleotides described in the studies above were tested in a hepatocellular carcinoma SNU449 xenograft tumor model. In addition to testing the modified oligonucleotide by itself, combination therapy with sorafenib was also tested. A control oligonucleotide 792169, described herein above, was also tested.

Five million SNU449 cells in 30% matrigel were implanted subcutaneously into the fatpads of female NOD.Cg-Prkdcscid II2rgtm1Wjl/SzJ mice (from Jackson Laboratory) at 4-6 weeks of age. 43 days post implantation (when tumors had reached approximately 100 mm³ in size), groups of eight mice each were administered with 50 mg/kg modified oligonucleotide daily for 10 days (loading dose), following which they were administered with 50 mg/kg modified oligonucleotide four times a week for one week, following which they were dosed with 50 mg/kg modified oligonucleotide thrice weekly until the end of the study. Another group of 8 animals was treated with 30 mg/kg of sorafenib orally 7 times a week until end of study. A final group of 8 animals were treated with a combination of 30 mg/kg of sorafenib orally 7 times a week for 11 weeks and 50 mg/kg of modified oligonucleotide 1198440 at 50 mg/kg 5 times a week for 3 weeks, 4 times a week for the following week, then 3 times a week for the duration of the study (7 weeks). Animals were sacrificed, and tumors were collected on day 119 post implantation.

Measurement of RNA

Yap1 mRNA knockdown in tumors was measured by RT-qPCR as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated animals (% control).

TABLE 127
Yap1 mRNA levels in tumors
                    %
Ion No.             control
PBS                 100
792169              90
1198440             34
Sorafenib           103
1198440 + Sorafenib 42

Measurement of Tumor Volume

Tumor volumes were also measured at the indicated days in the table below. Treatment with ION No. 1198440 led to significant reduction in tumor volume. In addition, combination treatment of ION No. 1198440 with sorafenib led to further reduction in tumor volume.

TABLE 128
Tumor volume (mm3)
Days Post	Average Tumor Volume (mm3)
Tumor					1198440 +
Implantation	PBS	792169	1198440	sorafenib	sorafenib
43	111	111	111	112	111
46	175	162	152	145	162
50	208	180	168	159	162
53	252	247	201	173	210
57	292	280	242	200	224
60	362	317	263	234	258
64	396	397	338	217	210
67	438	466	376	277	250
71	463	519	373	249	241
75	570	559	401	283	279
78	597	634	429	322	296
81	657	681	514	391	400
85	760	785	606	416	380
88	786	889	613	451	413
92	955	1170	690	508	421
94	1048	1215	773	581	495
98	1114	1355	804	625	525
101	1175	1417	818	685	541
105	1252	1509	894	671	495
108	1284	1571	921	663	470
119	1431	1697*	978	747	584
*Average of 7 samples

Measurement of ERK Activation

Sorafenib is a RAF inhibitor used for treatment of several cancers including hepatocellular carcinoma. However, it leads to ERK activation in HCCs, which impacts therapeutic efficacy (Chen Y., et al., Overcoming sorafenib evasion in hepatocellular carcinoma using CXCR4-targeted nanoparticles to co-deliver MEK-inhibitors, Sci Rep. 2017; 7: 44123).

The effect of modified oligonucleotide in mitigating the ERK1/2 activation mediated by sorafenib was tested. Protein analysis was carried out using standard procedures. The primary antibody against Erkl/2 was rabbit mAb 4695, Cell Signaling Technology, and against pERK1/2 was rabbit anti-phospho p44/42 antibody 9101, Cell Signaling Technology. ERK protein levels were compared to internal control GAPDH. GAPDH levels were measured using rabbit mAb 5174, Cell Signaling Technology as the primary antibody. The secondary antibody used was donkey anti-rabbit NA934, GE Healthcare. pERK/ERK levels were calculated relative to PBS control to determine % activation of ERK1/2. Combination therapy of ION No. 1198440 with sorafenib led to a significant decrease in ERK1/2 activation mediated by sorafenib treatment alone.

TABLE 129
Tumor volume (mm3)
                    %
                    activation
Ion No.             of ERK1/2
PBS                 100
792169              100
1198440             88
Sorafenib           142
1198440 + Sorafenib 68

Example 48: Activity of Modified Oligonucleotides Targeting Human Yap1 in Combination with Sorafenib in SNU449 Cells

Modified oligonucleotides described in the studies above were tested at various doses in hepatocellular carcinoma cell line SNU449. ION No. 792169, described herein above, was used as a control modified oligonucleotide. ION No. 715487 was used to target Yap1 RNA. Cultured SNU449 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below in combination with sorafenib diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured.

Measurement of RNA

Yap1 mRNA knockdown in tumors was measured by RT-qPCR as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated cells (% control).

TABLE 170
Yap1 mRNA levels
SORAFENIB	YAP1 mRNA (% control)
CONCENTRATION	715487 at	715487	715487	715487	792169 at	792169	792169	792169
(uM)	0.04 uM	at 0.2 uM	at 1 uM	at 5 uM	0.04 uM	at 0.2 uM	at 1 uM	at 5 uM
0	98	54	30	9	115	113	103	103
0.37	97	51	23	8	97	96	99	104
1.11	77	44	22	7	100	97	93	95
3.33	83	45	21	7	99	91	92	97
10	78	46	20	8	102	94	93	97

Cell Proliferation Assay

SNU449 plated at 1000 cells/well were treated with a combination of modified oligonucleotide and sorafenib at concentrations outlined in the table below. 144 hours post treatment, proliferation of SNU449 cells was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).

TABLE 171
Antiproliferative effect of modified oligonucleotides in SNU449 cells
SORAFENIB	% UTC
CONCENTRATION	715487 at	715487	715487	715487	792169 at	792169	792169	792169
(uM)	0.04 uM	at 0.2 uM	at 1 uM	at 5 uM	0.04 uM	at 0.2 uM	at 1 uM	at 5 uM
0	98	93	84	64	99	97	97	86
0.37	102	94	83	64	103	100	95	84
1.11	93	77	45	23	97	91	89	68
3.33	27	12	5	3	51	30	27	6
10	2	2	1	1	3	4	3	1

Example 49: Activity of Modified Oligonucleotides Targeting Human Yap1 in Combination with α-PD1 Antibody in DEN-HCC Model

The DEN model is a chemically induced model of hepatocellular carcinoma (HCC). N-nitrosodiethylamine (DEN) is administered at 25 mg/kg into 15 day old C57/BL6 mice. Carcinomas form 6 months post injection. After formation, carcinomas were then dissected from the liver and passaged subcutaneously into C57BL/6 male mice at 4-6 weeks of age to establish a subcutaneous model. For this experiment, mice were passaged with P8 subcutaneously established DEN carcinomas, rendering P9 for the duration of the experiment. Subcutaneous carcinomas are found to form at 4-6 weeks post implantation. Modified oligonucleotides 792169 (control compound) and 715491 (YAP-1 targeting modified oligonucleotide) were treated subcutaneously into groups of 7-8 mice at 10 mg/kg/week 5 times a week for 11 weeks (total of 55 doses). The PBS-only treated group and the control group were treated 5 times a week for 4 weeks (total of 20 doses). α-PD1 antibody (BioXCell) was treated intraperitoneally at 10 mg/kg/week twice a week for 4 weeks (total of 8 doses). Tumor volume was measured over the time points indicated in the table below. F.D. refers to mice that were sacrificed because their tumor volume became too large. As shown in the table below, mice administered PBS, 792169 (control compound), or α-PD1 antibody were sacrificed before the end of the experiment because their tumor volume became too large.

TABLE 172
Tumor volume (mm3)
	Average Tumor Volume (mm3)
Days on					715491 +
treatment	PBS	792169	715491	α-PD1	α-PD1
1	373	354	356	546	455
5	553	376	417	673	475
8	688	414	463	782	558
11	729	523	461	910	525
15	856	604	523	911	529
18	968	633	526	1127	524
23	1220	773	658	1134	508
25	1337	864	659	1252	513
28	1355	802	661	1412	489
31	F.D.	F.D.	740	F.D.	516
35	F.D.	F.D.	798	F.D.	519
38	F.D.	F.D.	741	F.D.	491
43	F.D.	F.D.	723	F.D.	440
45	F.D.	F.D.	741	F.D.	457
49	F.D.	F.D.	765	F.D.	474
54	F.D.	F.D.	780	F.D.	552
58	F.D.	F.D.	852	F.D.	544
61	F.D.	F.D.	925	F.D.	592
65	F.D.	F.D.	896	F.D.	590
68	F.D.	F.D.	940	F.D.	604
72	F.D.	F.D.	953	F.D.	577
75	F.D.	F.D.	985	F.D.	675
79	F.D.	F.D.	960	F.D.	590

Claims

1.-8. (canceled)

9. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence selected from the group consisting of SEQ ID NOs: 810, 1404, 2868, 2864, 286-5-1-494-1101, 2812, 1200, and 2863.

10.-16. (canceled)

17. A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of a nucleobase sequence selected from the group consisting of SEQ ID NOs: 810, 1404, 2868, 2864, 286-1-404, 1101, 2812, 1200, or 2863.

18. The compound of claim 17, wherein at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage, at least one sugar of the modified oligonucleotide is a modified sugar, or at least one nucleobase of the modified oligonucleotide is a modified nucleobase.

19. The compound of claim 18, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

20. The compound of claim 18, wherein the modified sugar is a bicyclic sugar.

21. The compound of claim 20, wherein the bicyclic sugar is selected from the group consisting of: 4′-(CH2)—O—2′ (LNA); 4′-(CH2)2—O—2′ (ENA); and 4′-CH(CH3)—O—2′ (cEt).

22. The compound of claim 18, wherein the modified sugar is 2′-O-methoxyethyl.

23. The compound of claim 18, wherein the modified nucleobase is 5-methylcytosine.

24. The compound of claim 17, wherein the modified oligonucleotide has:

a gap segment consisting of linked 2′-deoxynucleosides;

a 5′ wing segment consisting of linked nucleosides; and

a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

25.-37. (canceled)

38. A compound consisting of a pharmaceutically acceptable salt of the compound of claim 17.

39. The compound of claim 38, wherein the pharmaceutically acceptable salt is a sodium salt.

40. The compound of claim 38, wherein the pharmaceutically acceptable salt is a potassium salt.

41. (canceled)

42. (canceled)

43. (canceled)

44. A composition comprising the compound of claim 17 and a pharmaceutically acceptable diluent or carrier.

45. A composition comprising the compound of claim 17 and water.

46. (canceled)

47. A combination comprising the compound of claim 17 and a secondary agent.

48. The combination of claim 47, wherein the secondary agent is a CDK4/6 inhibitor.

49. (canceled)

50. The combination of claim 47, wherein the secondary agent is an EGFR inhibitor.

51. (canceled)

52. The combination of claim 47, wherein the secondary agent is a kinase inhibitor.

53.-64. (canceled)

65. A method of inhibiting expression of YAP1 in a cell comprising contacting the cell with a compound of claim 17, thereby inhibiting expression of YAP1 in the cell.

66. The method of claim 65, wherein the cell a cancer cell.

67.-99. (canceled)