MODULATION OF GENE EXPRESSION AND SCREENING FOR DEREGULATED PROTEIN EXPRESSION
Disclosed herein include compositions and methods of modulating protein expression that utilizes an activator or a repressor of a non-sense mediated RNA decay switch exon (NSE). In some embodiments, also included herein are compositions and methods of modulating protein expression that uses an agent that targets a transposed element.
This application is a continuation of U.S. application Ser. No. 17/159,881, filed on Jan. 27, 2021, which is a Division of U.S. application Ser. No. 16/213,535, filed on Dec. 7, 2018, now issued as U.S. Pat. No. 10,941,405, which is a continuation of U.S. application Ser. No. 15/288,415, filed on Oct. 7, 2016, now issued as U.S. Pat. No. 10,196,639, which claims the benefit of UK Patent Application No: 1517937.7, filed on Oct. 9, 2015, and UK Patent Application No: 1614744.9, filed on Aug. 31, 2016, each of which is incorporated herein by reference in its entirety.
SEQUENCE LISTINGThe instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on Jun. 28, 2023, is named 47991-718_302. xml and is 172,528 bytes in size.
BACKGROUND OF THE INVENTIONThe ATM protein belongs to the PI3/PI4-kinase family and is involved in the developments of the nervous system and the immune system. The ATM protein kinase is activated upon DNA damage and subsequently coordinates the DNA repair mechanism.
SUMMARY OF THE INVENTIONIn certain embodiments, described herein include methods of screening a subject susceptible to functional-ATM protein deficiency and associated conditions, methods for selecting subjects for treatment, methods for treatment or prevention of conditions associated with functional-ATM protein deficiency, methods of modifying a cells susceptibility to DNA damaging radio- and chemotherapy, methods for treatment of cancer, and associated compositions and kits.
Disclosed herein, in certain embodiments, is a method of screening a subject for susceptibility to functional-ATM protein deficiency, wherein the screening comprises determining the presence of a non-thymine variant residue rs609261 located at position −3 relative to the 3′ splice site of NSE (cryptic exon in ATM intron 28) of the human genome, wherein the presence of a non-thymine variant residue rs609261 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency. In some embodiments, the NSE comprises a sequence comprising tctacaggttggctgcatagaagaaaaag (SEQ ID NO: 57). In some embodiments, the NSE repressor agent binds to the NSE within a sequence comprising agTCTACAGGTTGGCTGCATAGAAGAAAAAGgtagag (SEQ ID NO: 58); or tcttagTCTACAGGTTGGCTGCATAGAAGAAAAAGgtagag (SEQ ID NO: 59); or tctcagTCTACAGGTTGGCTGCATAGAAGAAAAAGgtagag (SEQ ID NO: 60). In some embodiments, the NSE repressor agent binds to the NSE or its 5′ or 3′ splice site in ATM intron 28 of the NSE. In some embodiments, the NSE repressor agent and/or NSE activator agent comprises a polynucleic acid polymer. In some embodiments, the NSE repressor agent and/or NSE activator agent is an SSO (Splice Switching Oligonucleotide). In some embodiments, the NSE repressor agent and/or NSE activator agent is associated with a delivery vehicle suitable for delivering the NSE repressor agent and/or NSE activator agent to cells. In some embodiments, the NSE repressor agent comprises: an SSO of the sequence cuucuaugcagccaaccuguagacu (SEQ ID NO: 53) (SSO-NSE3), or a nucleic acid analogue thereof; or an SSO of the sequence accuuuuucuucuaugcagccaac (SEQ ID NO: 54) (SSO-NSE5), or a nucleic acid analogue thereof; and/or the NSE repressor agent comprises or consists of any one SSO selected from the group comprising: aacauuucuauuuaguuaaaagc (SEQ ID NO: 23) (SSO A11); uuaguauuccuugacuuua (SEQ ID NO: 26) (SSO A17); gacugguaaauaauaaacauaauuc (SEQ ID NO: 37) (SSO B2); auauauuagagauacaucagcc (SEQ ID NO: 39) (SSO B4); and uuagagaaucauuuuaaauaagac (SEQ ID NO: 51) (SSO AN3), or combinations thereof.
Disclosed herein, in certain embodiments, is a method of selecting a subject for treatment, wherein the subject is susceptible to a functional-ATM protein deficiency, the method comprising determining the presence of a non-thymine variant residue rs609261 located at position −3 relative to the 3′ splice site of NSE (cryptic exon in ATM intron 28) of the human genome, wherein the presence of a non-thymine variant residue rs609261 indicates that the subject has, or is susceptible to, a functional-ATM protein deficiency, and selecting such subject for treatment with an agent thereby increasing a functional-ATM levels in the subject. In some embodiments, the method further comprises administering the agent for treatment of the selected subject. In some embodiments, the agent comprises a NSE repressor agent. In some embodiments, the NSE comprises a sequence comprising tctacaggttggctgcatagaagaaaaag (SEQ ID NO: 57). In some embodiments, the NSE repressor agent binds to the NSE within a sequence comprising agTCTACAGGTTGGCTGCATAGAAGAAAAAGgtagag (SEQ ID NO: 58); or tcttagTCTACAGGTTGGCTGCATAGAAGAAAAAGgtagag (SEQ ID NO: 59); or tctcagTCTACAGGTTGGCTGCATAGAAGAAAAAGgtagag (SEQ ID NO: 60). In some embodiments, the NSE repressor agent binds to the NSE or its 5′ or 3′ splice site in ATM intron 28 of the NSE. In some embodiments, the NSE repressor agent and/or NSE activator agent comprises a polynucleic acid polymer. In some embodiments, the NSE repressor agent and/or NSE activator agent is an SSO (Splice Switching Oligonucleotide). In some embodiments, the NSE repressor agent and/or NSE activator agent is associated with a delivery vehicle suitable for delivering the NSE repressor agent and/or NSE activator agent to cells. In some embodiments, the NSE repressor agent comprises: an SSO of the sequence cuucuaugcagccaaccuguagacu (SEQ ID NO: 53) (SSO-NSE3), or a nucleic acid analogue thereof; or an SSO of the sequence accuuuuucuucuaugcagccaac (SEQ ID NO: 54) (SSO-NSE5), or a nucleic acid analogue thereof; and/or the NSE repressor agent comprises or consists of any one SSO selected from the group comprising: aacauuucuauuuaguuaaaagc (SEQ ID NO: 23) (SSO A11); uuaguauuccuugacuuua (SEQ ID NO: 26) (SSO A17); gacugguaaauaauaaacauaauuc (SEQ ID NO: 37) (SSO B2); auauauuagagauacaucagcc (SEQ ID NO: 39) (SSO B4); and uuagagaaucauuuuaaauaagac (SEQ ID NO: 51) (SSO AN3), or combinations thereof.
Disclosed herein, in certain embodiments, is a method of treatment or prevention of a functional-ATM protein deficiency in a subject, the method comprising identifying a presence of a non-thymine variant residue rs609261 located at position −3 relative to the 3′ splice site of NSE (cryptic exon in ATM intron 28) of the human genome, wherein the presence of a non-thymine variant residue rs609261 indicates that the subject has, or is susceptible to, a functional-ATM protein deficiency, and administration of an agent to the subject, which is arranged to increase functional-ATM levels. In some embodiments, the NSE comprises a sequence comprising tctacaggttggctgcatagaagaaaaag (SEQ ID NO: 57). In some embodiments, the NSE repressor agent binds to the NSE within a sequence comprising agTCTACAGGTTGGCTGCATAGAAGAAAAAGgtagag (SEQ ID NO: 58); or tcttagTCTACAGGTTGGCTGCATAGAAGAAAAAGgtagag (SEQ ID NO: 59); or tctcagTCTACAGGTTGGCTGCATAGAAGAAAAAGgtagag (SEQ ID NO: 60). In some embodiments, the NSE repressor agent binds to the NSE or its 5′ or 3′ splice site in ATM intron 28 of the NSE. In some embodiments, the NSE repressor agent and/or NSE activator agent comprises a polynucleic acid polymer. In some embodiments, the NSE repressor agent and/or NSE activator agent is an SSO (Splice Switching Oligonucleotide). In some embodiments, the NSE repressor agent and/or NSE activator agent is associated with a delivery vehicle suitable for delivering the NSE repressor agent and/or NSE activator agent to cells. In some embodiments, the NSE repressor agent comprises: an SSO of the sequence cuucuaugcagccaaccuguagacu (SEQ ID NO: 53) (SSO-NSE3), or a nucleic acid analogue thereof; or an SSO of the sequence accuuuuucuucuaugcagccaac (SEQ ID NO: 54) (SSO-NSE5), or a nucleic acid analogue thereof; and/or the NSE repressor agent comprises or consists of any one SSO selected from the group comprising: aacauuucuauuuaguuaaaagc (SEQ ID NO: 23) (SSO A11); uuaguauuccuugacuuua (SEQ ID NO: 26) (SSO A17); gacugguaaauaauaaacauaauuc (SEQ ID NO: 37) (SSO B2); auauauuagagauacaucagcc (SEQ ID NO: 39) (SSO B4); and uuagagaaucauuuuaaauaagac (SEQ ID NO: 51) (SSO AN3), or combinations thereof.
Disclosed herein, in certain embodiments, is a method of treatment or prevention of a condition associated with a functional-ATM protein deficiency, comprising the administration of a NSE repressor agent thereby increasing a functional ATM protein level, wherein the agent binds to a NSE in ATM intron 28 of a pre-mRNA transcript thereby decreasing inclusion of the NSE in the mature RNA transcript. In some embodiments, the decreasing inclusion of the NSE in the mature RNA transcript provides an increase in functional ATM protein expression. In some embodiments, the method is for treatment or prevention of functional-ATM protein deficiency in a subject or an at-risk population of subjects is for treatment or prevention of a condition or symptoms associated with a functional-ATM protein deficiency. In some embodiments, the condition is ataxia-telangiectasia; cancer; immune deficiency; cellular radiosensitivity; or chromosomal instability. In some embodiments, the NSE comprises a sequence comprising tctacaggttggctgcatagaagaaaaag (SEQ ID NO: 57). In some embodiments, the NSE repressor agent binds to the NSE within a sequence comprising agTCTACAGGTTGGCTGCATAGAAGAAAAAGgtagag (SEQ ID NO: 58); or tcttagTCTACAGGTTGGCTGCATAGAAGAAAAAGgtagag (SEQ ID NO: 59); or tctcagTCTACAGGTTGGCTGCATAGAAGAAAAAGgtagag (SEQ ID NO: 60). In some embodiments, the NSE repressor agent binds to the NSE or its 5′ or 3′ splice site in ATM intron 28 of the NSE. In some embodiments, the NSE repressor agent and/or NSE activator agent comprises a polynucleic acid polymer. In some embodiments, the NSE repressor agent and/or NSE activator agent is an SSO (Splice Switching Oligonucleotide). In some embodiments, the NSE repressor agent and/or NSE activator agent is associated with a delivery vehicle suitable for delivering the NSE repressor agent and/or NSE activator agent to cells. In some embodiments, the NSE repressor agent comprises: an SSO of the sequence cuucuaugcagccaaccuguagacu (SEQ ID NO: 53) (SSO-NSE3), or a nucleic acid analogue thereof; or an SSO of the sequence accuuuuucuucuaugcagccaac (SEQ ID NO: 54) (SSO-NSE5), or a nucleic acid analogue thereof; and/or the NSE repressor agent comprises or consists of any one SSO selected from the group comprising: aacauuucuauuuaguuaaaagc (SEQ ID NO: 23) (SSO A11); uuaguauuccuugacuuua (SEQ ID NO: 26) (SSO A17); gacugguaaauaauaaacauaauuc (SEQ ID NO: 37) (SSO B2); auauauuagagauacaucagcc (SEQ ID NO: 39) (SSO B4); and uuagagaaucauuuuaaauaagac (SEQ ID NO: 51) (SSO AN3), or combinations thereof.
Disclosed herein, in certain embodiments, is a method of treatment or prevention of a condition associated with deregulation of ATM expression in a subject comprising administering a NSE-activator agent to the subject, wherein the NSE-activator agent increases inclusion of a NSE in an ATM mature RNA transcript by binding to a regulatory motif in ATM intron 28, or by binding to a U2AF65 binding site upstream of a pseudoexon located 3′ of a NSE in ATM intron 28 of an ATM pre-mRNA transcript. In some embodiments, disclosed herein is a method of treatment or prevention of a condition associated with deregulation of ATM expression in a subject comprising administering a NSE-activator agent to the subject, wherein the NSE-activator agent increases inclusion of a NSE in an ATM mature RNA transcript by binding to a regulatory motif in ATM intron 28, optionally wherein the regulatory motifs in ATM intron 28 compete with NSE for spliceosomal components, and further optionally wherein such motifs comprise a 24 nucleotide pseudoexon (PE) located 3′ of NSE in ATM intron 28 of the pre-mRNA transcript or binding to a U2AF65 binding site upstream of the pseudoexon. In some embodiments, increasing inclusion of the NSE in the mature RNA transcript provides a decrease in functional ATM protein expression. In some embodiments, the pseudoexon comprises the sequence tcatcgaatacttttggaaataag (SEQ ID NO: 61). In some embodiments, the regulatory motif in ATM intron 28 competes with the NSE for spliceosomal components. In some embodiments, the regulatory motif in ATM intron 28 comprises a 24 nucleotide pseudoexon (PE) located 3′ of the NSE in ATM intron 28 of the pre-mRNA transcript. In some embodiments, the NSE repressor agent and/or NSE activator agent comprises a polynucleic acid polymer. In some embodiments, the NSE repressor agent and/or NSE activator agent is an SSO (Splice Switching Oligonucleotide). In some embodiments, the NSE repressor agent and/or NSE activator agent is associated with a delivery vehicle suitable for delivering the NSE repressor agent and/or NSE activator agent to cells. In some embodiments, the NSE repressor agent comprises: an SSO of the sequence cuucuaugcagccaaccuguagacu (SEQ ID NO: 53) (SSO-NSE3), or a nucleic acid analogue thereof; or an SSO of the sequence accuuuuucuucuaugcagccaac (SEQ ID NO: 54) (SSO-NSE5), or a nucleic acid analogue thereof; and/or the NSE repressor agent comprises or consists of any one SSO selected from the group comprising: aacauuucuauuuaguuaaaagc (SEQ ID NO: 23) (SSO A11); uuaguauuccuugacuuua (SEQ ID NO: 26) (SSO A17); gacugguaaauaauaaacauaauuc (SEQ ID NO: 37) (SSO B2); auauauuagagauacaucagcc (SEQ ID NO: 39) (SSO B4); and uuagagaaucauuuuaaauaagac (SEQ ID NO: 51) (SSO AN3), or combinations thereof. In some embodiments, the NSE activator agent comprises the SSO PEkr/PEdel; and/or the NSE activator agent comprises or consists of any one SSO selected from the group comprising: aacuuaaagguuauaucuc (SEQ ID NO: 18) (SSO A2); uauaaauacgaauaaaucga (SEQ ID NO: 19) (SSO A4); caacacgacauaaccaaa (SEQ ID NO: 21) (SSO A9); gguaugagaacuauagga (SEQ ID NO: 32) (SSO A23); gguaauaagugucacaaa (SEQ ID NO: 34) (SSO A25); guaucauacauuagaagg (SEQ ID NO: 35) (SSO A26); and uguggggugaccacagcuu (SEQ ID NO: 45) (SSO B11), or combinations thereof.
Disclosed herein, in certain embodiments, is a method of treatment or prevention of cancer in a subject comprising administering a NSE-activator agent to the subject, wherein the NSE-activator agent increases a cancer cell's susceptibility to cytotoxic therapy with DNA damaging agents such as radiotherapy, wherein the NSE-activator agent increases inclusion of a NSE in an ATM mature RNA transcript by binding to a regulatory motif in ATM intron 28, or by binding to a U2AF65 binding site upstream of a pseudoexon located 3′ of a NSE in ATM intron 28 of an ATM pre-mRNA transcript, and treating the subject with the cytotoxic therapy, such as radiotherapy or chemotherapy. In some embodiments, disclosed herein is a method of treatment or prevention of cancer in a subject comprising the administration of a NSE-activator agent arranged to increase a cancer cell's susceptibility to cytotoxic therapy with DNA damaging agents such as radiotherapy, wherein the NSE-activator agent is arranged to increase NSE inclusion in ATM mature RNA transcript by binding to regulatory motifs in ATM intron 28, optionally wherein the regulatory motifs in ATM intron 28 compete with NSE for spliceosomal components, and further optionally wherein such motifs comprise a 24 nucleotide pseudoexon (PE) located 3′ of NSE in ATM intron 28 of the pre-mRNA transcript or binding to a U2AF65 binding site upstream of the pseudoexon; and treating the subject with the cytotoxic therapy, such as radiotherapy or chemotherapy. In some embodiments, increasing inclusion of the NSE in the mature RNA transcript provides a decrease in functional ATM protein expression. In some embodiments, the pseudoexon comprises the sequence tcatcgaatacttttggaaataag (SEQ ID NO: 61). In some embodiments, increasing inclusion of the NSE in the mature RNA transcript provides a decrease in functional ATM protein expression. In some embodiments, the pseudoexon comprises the sequence tcatcgaatacttttggaaataag (SEQ ID NO: 61). In some embodiments, the regulatory motif in ATM intron 28 competes with the NSE for spliceosomal components. In some embodiments, the regulatory motif in ATM intron 28 comprises a 24 nucleotide pseudoexon (PE) located 3′ of the NSE in ATM intron 28 of the pre-mRNA transcript. In some embodiments, the NSE repressor agent and/or NSE activator agent comprises a polynucleic acid polymer. In some embodiments, the NSE repressor agent and/or NSE activator agent is an SSO (Splice Switching Oligonucleotide). In some embodiments, the NSE repressor agent and/or NSE activator agent is associated with a delivery vehicle suitable for delivering the NSE repressor agent and/or NSE activator agent to cells. In some embodiments, the NSE repressor agent comprises: an SSO of the sequence cuucuaugcagccaaccuguagacu (SEQ ID NO: 53) (SSO-NSE3), or a nucleic acid analogue thereof; or an SSO of the sequence accuuuuucuucuaugcagccaac (SEQ ID NO: 54) (SSO-NSE5), or a nucleic acid analogue thereof; and/or the NSE repressor agent comprises or consists of any one SSO selected from the group comprising: aacauuucuauuuaguuaaaagc (SEQ ID NO: 23) (SSO A11); uuaguauuccuugacuuua (SEQ ID NO: 26) (SSO A17); gacugguaaauaauaaacauaauuc (SEQ ID NO: 37) (SSO B2); auauauuagagauacaucagcc (SEQ ID NO: 39) (SSO B4); and uuagagaaucauuuuaaauaagac (SEQ ID NO: 51) (SSO AN3), or combinations thereof. In some embodiments, the NSE activator agent comprises the SSO PEkr/PEdel; and/or the NSE activator agent comprises or consists of any one SSO selected from the group comprising: aacuuaaagguuauaucuc (SEQ ID NO: 18) (SSO A2); uauaaauacgaauaaaucga (SEQ ID NO: 19) (SSO A4); caacacgacauaaccaaa (SEQ ID NO: 21) (SSO A9); gguaugagaacuauagga (SEQ ID NO: 32) (SSO A23); gguaauaagugucacaaa (SEQ ID NO: 34) (SSO A25); guaucauacauuagaagg (SEQ ID NO: (SSO A26); and uguggggugaccacagcuu (SEQ ID NO: 45) (SSO B11), or combinations thereof.
Disclosed herein, in certain embodiments, is a method of increasing a cell's susceptibility to cytotoxic therapy with DNA damaging agents such as radiotherapy or chemotherapy comprising reducing ATM protein expression by administering a NSE-activator agent, wherein the NSE-activator agent increases inclusion of a NSE in an ATM mature RNA transcript by binding to motifs in ATM intron 28, or by binding to a U2AF65 binding site upstream of a pseudoexon located 3′ of a NSE in ATM intron 28 of an ATM pre-mRNA transcript. Disclosed herein, in certain embodiments, is a method of increasing a cell's susceptibility to cytotoxic therapy with DNA damaging agents such as radiotherapy or chemotherapy comprising reducing ATM protein expression by administrating a NSE-activator agent arranged to increase NSE inclusion in ATM mature RNA transcript by binding to motifs in ATM intron 28, optionally wherein the regulatory motifs in ATM intron 28 compete with NSE for spliceosomal components, and further optionally wherein such motifs comprise a 24 nucleotide pseudoexon (PE) located 3′ of NSE in ATM intron 28 of the pre-mRNA transcript or binding to a U2AF65 binding site upstream of the pseudoexon. In some embodiments, increasing inclusion of the NSE in the mature RNA transcript provides a decrease in functional ATM protein expression. In some embodiments, the pseudoexon comprises the sequence tcatcgaatacttttggaaataag (SEQ ID NO: 61). In some embodiments, the regulatory motif in ATM intron 28 competes with the NSE for spliceosomal components. In some embodiments, the regulatory motif in ATM intron 28 comprises a 24 nucleotide pseudoexon (PE) located 3′ of the NSE in ATM intron 28 of the pre-mRNA transcript. In some embodiments, the NSE repressor agent and/or NSE activator agent comprises a polynucleic acid polymer. In some embodiments, the NSE repressor agent and/or NSE activator agent is an SSO (Splice Switching Oligonucleotide). In some embodiments, the NSE repressor agent and/or NSE activator agent is associated with a delivery vehicle suitable for delivering the NSE repressor agent and/or NSE activator agent to cells. In some embodiments, the NSE repressor agent comprises: an SSO of the sequence cuucuaugcagccaaccuguagacu (SEQ ID NO: 53) (SSO-NSE3), or a nucleic acid analogue thereof; or an SSO of the sequence accuuuuucuucuaugcagccaac (SEQ ID NO: 54) (SSO-NSE5), or a nucleic acid analogue thereof; and/or the NSE repressor agent comprises or consists of any one SSO selected from the group comprising: aacauuucuauuuaguuaaaagc (SEQ ID NO: 23) (SSO A11); uuaguauuccuugacuuua (SEQ ID NO: 26) (SSO A17); gacugguaaauaauaaacauaauuc (SEQ ID NO: 37) (SSO B2); auauauuagagauacaucagcc (SEQ ID NO: 39) (SSO B4); and uuagagaaucauuuuaaauaagac (SEQ ID NO: 51) (SSO AN3), or combinations thereof. In some embodiments, the NSE activator agent comprises the SSO PEkr/PEdel; and/or the NSE activator agent comprises or consists of any one SSO selected from the group comprising: aacuuaaagguuauaucuc (SEQ ID NO: 18) (SSO A2); uauaaauacgaauaaaucga (SEQ ID NO: 19) (SSO A4); caacacgacauaaccaaa (SEQ ID NO: 21) (SSO A9); gguaugagaacuauagga (SEQ ID NO: 32) (SSO A23); gguaauaagugucacaaa (SEQ ID NO: 34) (SSO A25); guaucauacauuagaagg (SEQ ID NO: 35) (SSO A26); and uguggggugaccacagcuu (SEQ ID NO: 45) (SSO B11), or combinations thereof.
Disclosed herein, in certain embodiments, is a method of tailoring functional ATM expression in a subject, cell or tissue, comprising the administration of a NSE-activator agent and/or a NSE-repressor agent described herein. In some embodiments, the NSE repressor agent and/or NSE activator agent comprise a polynucleic acid polymer. In some embodiments, the NSE repressor agent and/or NSE activator agent is an SSO (Splice Switching Oligonucleotide). In some embodiments, the NSE repressor agent and/or NSE activator agent is associated with a delivery vehicle suitable for delivering the NSE repressor agent and/or NSE activator agent to cells. In some embodiments, the NSE repressor agent comprises: an SSO of the sequence cuucuaugcagccaaccuguagacu (SEQ ID NO: 53) (SSO-NSE3), or a nucleic acid analogue thereof; or an SSO of the sequence accuuuuucuucuaugcagccaac (SEQ ID NO: 54) (SSO-NSE5), or a nucleic acid analogue thereof; and/or the NSE repressor agent comprises or consists of any one SSO selected from the group comprising: aacauuucuauuuaguuaaaagc (SEQ ID NO: 23) (SSO A11); uuaguauuccuugacuuua (SEQ ID NO: 26) (SSO A17); gacugguaaauaauaaacauaauuc (SEQ ID NO: 37) (SSO B2); auauauuagagauacaucagcc (SEQ ID NO: 39) (SSO B4); and uuagagaaucauuuuaaauaagac (SEQ ID NO: 51) (SSO AN3), or combinations thereof; or the method of which the NSE activator agent comprises the SSO PEkr/PEdel; and/or the NSE activator agent comprises or consists of any one SSO selected from the group comprising: aacuuaaagguuauaucuc (SEQ ID NO: 18) (SSO A2); uauaaauacgaauaaaucga (SEQ ID NO: 19) (SSO A4); caacacgacauaaccaaa (SEQ ID NO: 21) (SSO A9); gguaugagaacuauagga (SEQ ID NO: 32) (SSO A23); gguaauaagugucacaaa (SEQ ID NO: 34) (SSO A25); guaucauacauuagaagg (SEQ ID NO: 35) (SSO A26); and uguggggugaccacagcuu (SEQ ID NO: 45) (SSO B11), or combinations thereof.
Disclosed herein, in certain embodiments, is use of rs609261 and/or rs4988000 genotyping to predict a subject's response to therapy for conditions associated with ATM deregulation.
Disclosed herein, in certain embodiments, is a composition comprising the NSE repressor agent and/or the NSE activator agent described herein. In some embodiments, the composition is a pharmaceutically acceptable formulation.
Disclosed herein, in certain embodiments, is a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising identifying the presence of a non-thymine variant residue rs609261 located at position −3 relative to the 3′ splice site of NSE (cryptic exon in ATM intron 28) of the human genome, wherein the presence of a non-thymine variant residue rs609261 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and administration of an agent to the subject, which is arranged to replace the non-thymine variant residue rs609261 with a thymine residue. In some embodiments, replacing the non-thymine variant residue rs609261 comprises administration of an agent to the subject, which is arranged to replace the non-thymine variant residue rs609261 with a thymine residue. In some embodiments, the agent for replacement of the non-thymine residue is a genomic editing molecule. In some embodiments, the agent for replacement of the non-thymine residue is CRISPR-Cas9, or a functional equivalent thereof, together with an appropriate RNA molecule arranged to target rs609261.
Disclosed herein, in certain embodiments, is a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising replacing a non-thymine variant residue rs609261 located at position −3 relative to the 3′ splice site of NSE (cryptic exon in ATM intron 28) of the human genome with a thymine residue. In some embodiments, replacing the non-thymine variant residue rs609261 comprises administration of an agent to the subject, which is arranged to replace the non-thymine variant residue rs609261 with a thymine residue. In some embodiments, the agent for replacement of the non-thymine residue is a genomic editing molecule. In some embodiments, the agent for replacement of the non-thymine residue is CRISPR-Cas9, or a functional equivalent thereof, together with an appropriate RNA molecule arranged to target rs609261.
Disclosed herein, in certain embodiments, is a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising identifying the presence of a guanine variant residue at rs4988000 of the human genome, wherein the presence of a guanine variant residue at rs4988000 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and administration of an agent to the subject, which is arranged to replace the guanine variant residue at rs4988000 with adenine. In some embodiments, replacing the guanine variant residue at rs4988000 comprises administration of an agent to the subject, which is arranged to replace the guanine variant residue at rs4988000 with an adenine residue. In some embodiments, the agent for replacement of the guanine residue is a genomic editing molecule. In some embodiments, the agent for replacement of the guanine residue is CRISPR-Cas9, or a functional equivalent thereof, together with an appropriate RNA molecule arranged to target rs4988000.
Disclosed herein, in certain embodiments, is a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising replacing a guanine variant residue at rs4988000 of the human genome with an adenine residue; or blocking the guanine residue by the binding of an SSO. In some embodiments, replacing the guanine variant residue at rs4988000 comprises administration of an agent to the subject, which is arranged to replace the guanine variant residue at rs4988000 with an adenine residue. In some embodiments, the agent for replacement of the guanine residue is a genomic editing molecule. In some embodiments, the agent for replacement of the guanine residue is CRISPR-Cas9, or a functional equivalent thereof, together with an appropriate RNA molecule arranged to target rs4988000.
Disclosed herein, in certain embodiments, is a method of screening a subject or a population of subjects for susceptibility to functional-ATM protein deficiency, wherein the screening comprises determining the presence of a guanine variant residue at rs4988000 of the human genome, wherein the presence of a guanine variant residue at rs4988000 indicates that the subject (or group of subjects) has, or is susceptible to, functional-ATM protein deficiency.
Disclosed herein, in certain embodiments, is a method of selecting a subject or a population of subjects for treatment or prophylaxis, wherein the subject is susceptible to functional-ATM protein deficiency, the method comprising determining a presence of a guanine variant residue at rs4988000 of a human subject's genome, wherein the presence of a guanine variant residue at rs4988000 indicates that the subject has, or is susceptible to, the functional-ATM protein deficiency, and selecting the subject for treatment with an agent that increases functional-ATM levels in the subject.
Disclosed herein, in certain embodiments, is a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising identifying a presence of a guanine variant residue at rs4988000 of a human subject's genome, wherein the presence of a guanine variant residue at rs4988000 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and administering an agent to the subject, wherein the agent increases functional-ATM levels.
In some embodiments, one or more methods disclosed herein is in combination to modify a CG haplotype to TA.
In some embodiments, one or more methods disclosed herein is in combination to identify a CG haplotype in a subject, and optionally treat or select the patient for treatment.
Disclosed herein, in certain embodiments, is a method of modifying regulation of inclusion of a NSE in a mature RNA transcript, the method comprising inserting or deleting one or more splicing regulatory motifs upstream or downstream of the NSE that compete with the NSE for spliceosomal components, said one or more splicing regulatory motifs comprising a cryptic splice site or a pseudo-exon. In some embodiments, the insertion or the deletion of the one or more splicing regulatory motifs is in genomic DNA of ATM intron 28. In some embodiments, insertion of the one or more splicing regulatory motifs causes a reduction in the inclusion of the NSE in the mature RNA transcript. In some embodiments, the deletion of the one or more splicing regulatory motifs causes an increase in the inclusion of the NSE in the mature RNA transcript. In some embodiments, the insertion or the deletion of the one or more splicing regulatory motifs comprises the use of genome editing technology, such as CRISPR-Cas9.
Disclosed herein, in certain embodiments, is a method of modifying regulation of expression of a functional protein, wherein the expression of a functional protein is regulated by inclusion of a NSE in a mature RNA transcript of a gene encoding the functional protein, the method comprising inserting or deleting one or more splicing regulatory motifs upstream or downstream of the NSE that compete with the NSE for spliceosomal components, said one or more splicing regulatory motifs comprising cryptic splice sites or pseudo-exons. In some embodiments, the insertion or the deletion of the one or more splicing regulatory motifs is in genomic DNA of ATM intron 28. In some embodiments, insertion of the one or more splicing regulatory motifs causes a reduction in the inclusion of the NSE in the mature RNA transcript. In some embodiments, the deletion of the one or more splicing regulatory motifs causes an increase in the inclusion of the NSE in the mature RNA transcript. In some embodiments, the insertion or the deletion of the one or more splicing regulatory motifs comprises the use of genome editing technology, such as CRISPR-Cas9.
Disclosed herein, in certain embodiments, is a kit comprising one or more oligonucleotide probes for identifying rs609261 and/or rs4988000 variants. In some embodiments, the one or more oligonucleotide probes are primers for use in PCR amplifying a region of a nucleic acid comprising the rs609261 and/or the rs4988000 variants.
Disclosed herein, in certain embodiments, is a vector comprising a nucleic acid encoding a NSE activating agent and/or a NSE repressor agent.
Disclosed herein, in certain embodiments, is a method of screening for an agent capable of modifying regulation of a gene's expression comprising: identifying a nonsense-mediated RNA decay switch exon (NSE) that limits functional gene expression; identifying one or more splicing regulatory motifs upstream or downstream of the NSE that compete with the NSE for spliceosomal components, said regulatory motifs comprising cryptic splice sites or pseudoexons; targeting the one or more splicing regulatory motifs with an antisense polynucleic acid comprising a sequence that hybridizes to a splicing regulatory motif of the one or more splicing regulatory motifs through Watson-Crick base pairing; and determining if there is an increased or decreased inclusion of the NSE in a mature RNA transcript of the gene.
Disclosed herein, in certain embodiments, is a method of modulating expression of a gene comprising providing an agent that binds to a splicing regulatory motif, such as a cryptic splice site or a pseudoexon, that competes with a nonsense-mediated RNA decay switch exon (NSE) for spliceosomal components.
Disclosed herein, in certain embodiments, is an agent that binds to a gene splicing regulatory motif, such as a cryptic splice site or a pseudoexon, that competes with a nonsense-mediated RNA decay switch exon (NSE) for spliceosomal components, wherein the gene splicing regulatory motif controls inclusion of the NSE into a mature RNA transcript of the gene.
Disclosed herein, in certain embodiments, is a method of modulating protein expression comprising: (a) contacting an isolated polynucleic acid polymer to a target cell of a subject; (b) hybridizing the contacted polynucleic acid polymer to a target motif on a pre-processed mRNA transcript, wherein a hybridization of the contacted polynucleic acid polymer to the target motif either promotes or represses activation of a non-sense mediated RNA decay switch exon (NSE); (c) processing a mRNA transcript of the pre-processed mRNA transcript, wherein the NSE is either present or absent in the mRNA transcript; and (d) translating the processed mRNA transcript of step c), wherein the presence or absence of the NSE modulates protein expression. In some embodiments, the protein is expressed from the processed mRNA transcript. In some embodiments, the presence of the NSE downregulates protein expression. In some embodiments, the absence of the NSE upregulates protein expression. In some embodiments, the polynucleic acid polymer hybridizes to a motif within ATM intron 28. In some embodiments, the motif is a splicing regulatory motif that competes with the NSE for a spliceosomal component. In some embodiments, the splicing regulatory motif comprises a cryptic splice site or a pseudoexon. In some embodiments, the pseudoexon is a 24 nucleotide pseudoexon located at 3′ of a NSE in ATM intron 28 of the pre-mRNA transcript. In some embodiments, the motif is a U2AF65 binding site. In some embodiments, the motif is a motif within a transposed element, upstream of a transposed element, or downstream of a transposed element. In some embodiments, the transposed element is Alu or MER51. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif within Alu. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif that is either upstream or downstream of Alu. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif downstream of MER51. In some embodiments, the polynucleic acid polymer is from about 10 to about 50 nucleotides in length. In some embodiments, the isolated polynucleic acid polymer comprises a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 18-52. In some embodiments, the polynucleic acid polymer is modified at a nucleoside moiety, at a phosphate moiety, at a 5′ terminus, at a 3′ terminus, or a combination thereof. In some embodiments, the polynucleic acid polymer comprises an artificial nucleotide. In some embodiments, the artificial nucleotide is selected from the group consisting of 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), 2′-O-N-methylacetamido (2′-O-NMA), a locked nucleic acid (LNA), an ethylene nucleic acid (ENA), a peptide nucleic acid (PNA), a 1′,5′-anhydrohexitol nucleic acid (HNA), a morpholino, a methylphosphonate nucleotide, a thiolphosphonate nucleotide, and a 2′-fluoro N3-P5′-phosphoramidite.
Disclosed herein, in certain embodiments, is a method of modulating protein expression comprising: (a) contacting an isolated polynucleic acid polymer to a target cell of a subject; (b) hybridizing the contacted polynucleic acid polymer to a target motif within a transposed element, wherein a hybridization of the contacted polynucleic acid polymer to the target motif either promotes or represses activation of a non-sense mediated RNA decay switch exon (NSE); (c) processing a mRNA transcript of the pre-processed mRNA transcript, wherein the NSE is either present or absent in the mRNA transcript; and (d) translating the processed mRNA transcript of step c), wherein the presence or absence of the NSE modulates protein expression. In some embodiments, the protein is expressed from the processed mRNA transcript. In some embodiments, the presence of the NSE downregulates protein expression. In some embodiments, the absence of the NSE upregulates protein expression. In some embodiments, the transposed element is Alu or MER51. In some embodiments, the isolated polynucleic acid polymer comprises a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 18-52. In some embodiments, the polynucleic acid polymer is from about 10 to about nucleotides in length. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif within Alu. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif that is either upstream or downstream of Alu. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif downstream of MER51. In some embodiments, activation of the NSE further induces exon skipping. In some embodiments, the NSE is located in intron 28. In some embodiments, the NSE modulates ATM protein expression. In some embodiments, the polynucleic acid polymer is modified at a nucleoside moiety, at a phosphate moiety, at a 5′ terminus, at a 3′ terminus, or a combination thereof. In some embodiments, the polynucleic acid polymer comprises an artificial nucleotide. In some embodiments, the artificial nucleotide is selected from the group consisting of 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), 2′-O-N-methylacetamido (2′-O-NMA), a locked nucleic acid (LNA), an ethylene nucleic acid (ENA), a peptide nucleic acid (PNA), a 1′,5′-anhydrohexitol nucleic acid (HNA), a morpholino, a methylphosphonate nucleotide, a thiolphosphonate nucleotide, and a 2′-fluoro N3-P5′-phosphoramidite.
Disclosed herein, in certain embodiments, is a method of modulating protein expression comprising: (a) contacting an isolated polynucleic acid polymer to a target cell of a subject; (b) hybridizing the contacted polynucleic acid polymer to a target motif either upstream or downstream of a transposed element, wherein a hybridization of the contacted polynucleic acid polymer to the target motif promotes or represses activation of a non-sense mediated RNA decay switch exon (NSE); (c) processing a mRNA transcript of the pre-processed mRNA transcript, wherein the NSE is either present or absent in the mRNA transcript; and (d) translating the processed mRNA transcript of step c), wherein the presence or absence of the NSE modulates protein expression. In some embodiments, the protein is expressed from the processed mRNA transcript. In some embodiments, the presence of the NSE downregulates protein expression. In some embodiments, the absence of the NSE upregulates protein expression. In some embodiments, the transposed element is Alu or MER51. In some embodiments, the isolated polynucleic acid polymer comprises a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 18-52. In some embodiments, the polynucleic acid polymer is from about 10 to about 50 nucleotides in length. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif within Alu. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif that is either upstream or downstream of Alu. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif downstream of MER51. In some embodiments, activation of the NSE further induces exon skipping. In some embodiments, the NSE is located in intron 28. In some embodiments, the NSE modulates ATM protein expression. In some embodiments, the polynucleic acid polymer is modified at a nucleoside moiety, at a phosphate moiety, at a 5′ terminus, at a 3′ terminus, or a combination thereof. In some embodiments, the polynucleic acid polymer comprises an artificial nucleotide. In some embodiments, the artificial nucleotide is selected from the group consisting of 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), 2′-O-N-methylacetamido (2′-O-NMA), a locked nucleic acid (LNA), an ethylene nucleic acid (ENA), a peptide nucleic acid (PNA), a 1′,5′-anhydrohexitol nucleic acid (HNA), a morpholino, a methylphosphonate nucleotide, a thiolphosphonate nucleotide, and a 2′-fluoro N3-P5′-phosphoramidite.
Disclosed herein, in certain embodiments, is a method of treating or preventing a disease or condition associated with deregulation of ATM expression in a subject in need thereof, the method comprising: administering to the subject a pharmaceutical composition comprising: (i) a non-sense mediated RNA decay switch exon (NSE)-activator agent that interacts with a pre-processed mRNA transcript to promote inclusion of a NSE into a processed mRNA transcript; and (ii) a pharmaceutically acceptable excipient and/or a delivery vehicle; wherein the disease or condition associated with deregulation of ATM expression is treated or prevented in the subject by the administration of the NSE-activator agent. In some embodiments, the NSE-activator agent is an isolated polynucleic acid polymer. In some embodiments, the NSE-repressor agent is an isolated polynucleic acid polymer. In some embodiments, the polynucleic acid polymer hybridizes to a motif within ATM intron 28. In some embodiments, the polynucleic acid polymer hybridizes to a splicing regulatory motif that competes with the NSE for spliceosomal components. In some embodiments, the splicing regulatory motif comprises a cryptic splice site or a pseudoexon. In some embodiments, the pseudoexon is a 24 nucleotide pseudoexon located at 3′ of a NSE in ATM intron 28 of the pre-mRNA transcript. In some embodiments, the polynucleic acid polymer hybridizes to a U2AF65 binding site. In some embodiments, the polynucleic acid polymer hybridizes to a motif within a transposed element, upstream of a transposed element, or downstream of a transposed element. In some embodiments, the transposed element is Alu or MER51. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif within Alu. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif that is either upstream or downstream of Alu. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif downstream of MER51. In some embodiments, the polynucleic acid polymer is from about 10 to about 50 nucleotides in length. In some embodiments, the isolated polynucleic acid polymer comprises a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 18-52. In some embodiments, the disease or condition is cancer. In some embodiments, the polynucleic acid polymer is modified at a nucleoside moiety, at a phosphate moiety, at a 5′ terminus, at a 3′ terminus, or a combination thereof. In some embodiments, the polynucleic acid polymer comprises an artificial nucleotide. In some embodiments, the artificial nucleotide is selected from the group consisting of 2′-O-methyl, 0-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), 2′-O-N-methylacetamido (2′-O-NMA), a locked nucleic acid (LNA), an ethylene nucleic acid (ENA), a peptide nucleic acid (PNA), a 1′,5′-anhydrohexitol nucleic acid (HNA), a morpholino, a methylphosphonate nucleotide, a thiolphosphonate nucleotide, and a 2′-fluoro N3-P5′-phosphoramidite. In some embodiments, the delivery vehicle comprises a nanoparticle-based delivery vehicle.
Disclosed herein, in certain embodiments, is a method of treating or preventing a disease or condition associated with a functional-ATM protein deficiency in a subject in need thereof, the method comprising: administering to the subject a pharmaceutical composition comprising: (i) a non-sense mediated RNA decay switch exon (NSE)-repressor agent that interacts with a pre-processed mRNA transcript to promote exclusion of a NSE into a processed mRNA transcript; and (ii) a pharmaceutically acceptable excipient and/or a delivery vehicle; wherein the disease or condition associated with a functional-ATM protein deficiency is treated or prevented in the subject by the administration of the NSE-repressor agent. In some embodiments, the NSE-activator agent is an isolated polynucleic acid polymer. In some embodiments, the NSE-repressor agent is an isolated polynucleic acid polymer. In some embodiments, the polynucleic acid polymer hybridizes to a motif within ATM intron 28. In some embodiments, the polynucleic acid polymer hybridizes to a splicing regulatory motif that competes with the NSE for spliceosomal components. In some embodiments, the splicing regulatory motif comprises a cryptic splice site or a pseudoexon. In some embodiments, the pseudoexon is a 24 nucleotide pseudoexon located at 3′ of a NSE in ATM intron 28 of the pre-mRNA transcript. In some embodiments, the polynucleic acid polymer hybridizes to a U2AF65 binding site. In some embodiments, the polynucleic acid polymer hybridizes to a motif within a transposed element, upstream of a transposed element, or downstream of a transposed element. In some embodiments, the transposed element is Alu or MER51. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif within Alu. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif that is either upstream or downstream of Alu. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif downstream of MER51. In some embodiments, the polynucleic acid polymer is from about 10 to about 50 nucleotides in length. In some embodiments, the isolated polynucleic acid polymer comprises a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 18-52. In some embodiments, the disease or condition is cancer. In some embodiments, the polynucleic acid polymer is modified at a nucleoside moiety, at a phosphate moiety, at a 5′ terminus, at a 3′ terminus, or a combination thereof. In some embodiments, the polynucleic acid polymer comprises an artificial nucleotide. In some embodiments, the artificial nucleotide is selected from the group consisting of 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), 2′-O-N-methylacetamido (2′-O-NMA), a locked nucleic acid (LNA), an ethylene nucleic acid (ENA), a peptide nucleic acid (PNA), a 1′,5′-anhydrohexitol nucleic acid (HNA), a morpholino, a methylphosphonate nucleotide, a thiolphosphonate nucleotide, and a 2′-fluoro N3-P5′-phosphoramidite. In some embodiments, the delivery vehicle comprises a nanoparticle-based delivery vehicle.
Disclosed herein, in certain embodiments, is a method of treating or preventing a disease or condition in a subject in need thereof, the method comprising: administering to the subject a pharmaceutical composition comprising: (i) a non-sense mediated RNA decay switch exon (NSE)-activator agent that interacts with a pre-processed mRNA transcript to promote inclusion of NSE into a processed mRNA transcript; and (ii) a pharmaceutically acceptable excipient and/or a delivery vehicle; wherein the disease or condition is treated or prevented in the subject by the administration of the NSE-activator agent. In some embodiments, the NSE-activator agent is an isolated polynucleic acid polymer. In some embodiments, the NSE-repressor agent is an isolated polynucleic acid polymer. In some embodiments, the polynucleic acid polymer hybridizes to a motif within ATM intron 28. In some embodiments, the polynucleic acid polymer hybridizes to a splicing regulatory motif that competes with the NSE for spliceosomal components. In some embodiments, the splicing regulatory motif comprises a cryptic splice site or a pseudoexon. In some embodiments, the pseudoexon is a 24 nucleotide pseudoexon located at 3′ of a NSE in ATM intron 28 of the pre-mRNA transcript. In some embodiments, the polynucleic acid polymer hybridizes to a U2AF65 binding site. In some embodiments, the polynucleic acid polymer hybridizes to a motif within a transposed element, upstream of a transposed element, or downstream of a transposed element. In some embodiments, the transposed element is Alu or MER51. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif within Alu. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif that is either upstream or downstream of Alu. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif downstream of MER51. In some embodiments, the polynucleic acid polymer is from about 10 to about 50 nucleotides in length. In some embodiments, the isolated polynucleic acid polymer comprises a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 18-52. In some embodiments, the disease or condition is cancer. In some embodiments, the disease or condition is a disease or condition associated with deregulation of ATM expression. In some embodiments, the disease or condition is a disease or condition associated with a functional-ATM protein deficiency. In some embodiments, the polynucleic acid polymer is modified at a nucleoside moiety, at a phosphate moiety, at a 5′ terminus, at a 3′ terminus, or a combination thereof. In some embodiments, the polynucleic acid polymer comprises an artificial nucleotide. In some embodiments, the artificial nucleotide is selected from the group consisting of 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), 2′-O-N-methylacetamido (2′-O-NMA), a locked nucleic acid (LNA), an ethylene nucleic acid (ENA), a peptide nucleic acid (PNA), a 1′,5′-anhydrohexitol nucleic acid (HNA), a morpholino, a methylphosphonate nucleotide, a thiolphosphonate nucleotide, and a 2′-fluoro N3-P5′-phosphoramidite. In some embodiments, the delivery vehicle comprises a nanoparticle-based delivery vehicle.
Disclosed herein, in certain embodiments, is a method of treating or preventing a disease or condition in a subject in need thereof, the method comprising: administering to the subject a pharmaceutical composition comprising: (i) a non-sense mediated RNA decay switch exon (NSE)-repressor agent that interacts with a pre-processed mRNA transcript to promote exclusion of an NSE into a processed mRNA transcript; and (ii) a pharmaceutically acceptable excipient and/or a delivery vehicle; wherein the disease or condition is treated or prevented in the subject by the administration of the NSE-repressor agent. In some embodiments, the NSE-activator agent is an isolated polynucleic acid polymer. In some embodiments, the NSE-repressor agent is an isolated polynucleic acid polymer. In some embodiments, the polynucleic acid polymer hybridizes to a motif within ATM intron 28. In some embodiments, the polynucleic acid polymer hybridizes to a splicing regulatory motif that competes with the NSE for spliceosomal components. In some embodiments, the splicing regulatory motif comprises a cryptic splice site or a pseudoexon. In some embodiments, the pseudoexon is a 24 nucleotide pseudoexon located at 3′ of a NSE in ATM intron 28 of the pre-mRNA transcript. In some embodiments, the polynucleic acid polymer hybridizes to a U2AF65 binding site. In some embodiments, the polynucleic acid polymer hybridizes to a motif within a transposed element, upstream of a transposed element, or downstream of a transposed element. In some embodiments, the transposed element is Alu or MER51. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif within Alu. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif that is either upstream or downstream of Alu. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif downstream of MER51. In some embodiments, the polynucleic acid polymer is from about 10 to about 50 nucleotides in length. In some embodiments, the isolated polynucleic acid polymer comprises a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 18-52. In some embodiments, the disease or condition is cancer. In some embodiments, the disease or condition is a disease or condition associated with deregulation of ATM expression. In some embodiments, the disease or condition is a disease or condition associated with a functional-ATM protein deficiency. In some embodiments, the polynucleic acid polymer is modified at a nucleoside moiety, at a phosphate moiety, at a 5′ terminus, at a 3′ terminus, or a combination thereof. In some embodiments, the polynucleic acid polymer comprises an artificial nucleotide. In some embodiments, the artificial nucleotide is selected from the group consisting of 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), 2′-O-N-methylacetamido (2′-O-NMA), a locked nucleic acid (LNA), an ethylene nucleic acid (ENA), a peptide nucleic acid (PNA), a 1′,5′-anhydrohexitol nucleic acid (HNA), a morpholino, a methylphosphonate nucleotide, a thiolphosphonate nucleotide, and a 2′-fluoro N3-P5′-phosphoramidite. In some embodiments, the delivery vehicle comprises a nanoparticle-based delivery vehicle.
Disclosed herein, in certain embodiments, is a method of modulating protein expression comprising: (a) contacting an isolated polynucleic acid polymer to a target cell of a subject; (b) hybridizing the contacted polynucleic acid polymer to a target motif within a transposed element, wherein a hybridization of the contacted polynucleic acid polymer to the target motif either promotes or represses activation of an alternative splice site; (c) processing a mRNA transcript of the pre-processed mRNA transcript, wherein the alternative splice site is either present or absent in the mRNA transcript; and (d) translating the processed mRNA transcript of step c), wherein the presence or absence of the alternative splice site modulates protein expression. In some embodiments, the transposon element is on the pre-processed mRNA transcript.
Disclosed herein, in certain embodiments, is a method of modulating protein expression comprising: (a) contacting an isolated polynucleic acid polymer to a target cell of a subject; (b) hybridizing the contacted polynucleic acid polymer to a target motif either upstream or downstream of a transposed element, wherein a hybridization of the contacted polynucleic acid polymer to the target motif promotes or represses activation of an alternative splice site; (c) processing a mRNA transcript of the pre-processed mRNA transcript, wherein the alternative splice site is either present or absent in the mRNA transcript; and (d) translating the processed mRNA transcript of step c), wherein the presence or absence of the alternative splice site modulates protein expression. In some embodiments, the transposon element is on the pre-processed mRNA transcript.
Disclosed herein, in certain embodiments, is a method of modulating protein expression comprising: (a) contacting an isolated polynucleic acid polymer to a target cell of a subject; (b) hybridizing the contacted polynucleic acid polymer to a target motif on a pre-processed mRNA transcript, wherein hybridization of the contacted polynucleic acid polymer to the target motif either promotes or represses activation of an alternative splice site; (c) processing a mRNA transcript of the pre-processed mRNA transcript, wherein the alternative splice site is either present or absent in the mRNA transcript; and (d) translating the processed mRNA transcript of step c), wherein the presence or absence of the alternative splice site modulates protein expression. In some embodiments, the protein is expressed from the processed mRNA transcript. In some embodiments, the presence of NSE downregulates protein expression. In some embodiments, the absence of NSE upregulates protein expression. In some embodiments, the polynucleic acid polymer hybridizes to a motif within ATM intron 28. In some embodiments, the motif is a splicing regulatory motif that competes with NSE for a spliceosomal component. In some embodiments, the splicing regulatory motif comprises a cryptic splice site or a pseudoexon. In some embodiments, the pseudoexon is a 24 nucleotide pseudoexon located at 3′ of a NSE in ATM intron 28 of the pre-mRNA transcript. In some embodiments, the motif is a U2AF65 binding site. In some embodiments, the motif is a motif within a transposed element, upstream of a transposed element, or downstream of a transposed element. In some embodiments, the transposed element is Alu or MER51. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif within Alu. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif that is either upstream or downstream of Alu. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif downstream of MER51. In some embodiments, the polynucleic acid polymer is from about 10 to about 50 nucleotides in length. In some embodiments, the isolated polynucleic acid polymer comprises a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 18-52.
Disclosed herein, in certain embodiments, is a pharmaceutical composition comprising: (a) a non-sense mediated RNA decay switch exon (NSE)-activator agent that interacts with a pre-processed mRNA transcript to promote inclusion of NSE into a processed mRNA transcript, or a non-sense mediated RNA decay switch exon (NSE)-repressor agent that interacts with a pre-processed mRNA transcript to promote exclusion of an NSE into a processed mRNA transcript; and (b) a pharmaceutically acceptable excipient and/or a delivery vehicle. In some embodiments, the NSE-activator agent is an isolated polynucleic acid polymer. In some embodiments, the NSE-repressor agent is an isolated polynucleic acid polymer. In some embodiments, the polynucleic acid polymer hybridizes to a motif within ATM intron 28. In some embodiments, the polynucleic acid polymer hybridizes to a splicing regulatory motif that competes with the NSE for a spliceosomal component. In some embodiments, the splicing regulatory motif comprises a cryptic splice site or a pseudoexon. In some embodiments, the pseudoexon is a 24 nucleotide pseudoexon located at 3′ of NSE in ATM intron 28 of the pre-mRNA transcript. In some embodiments, the polynucleic acid polymer hybridizes to a U2AF65 binding site. In some embodiments, the polynucleic acid polymer hybridizes to a motif within a transposed element, upstream of a transposed element, or downstream of a transposed element. In some embodiments, the transposed element is Alu or MER51. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif within Alu. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif that is either upstream or downstream of Alu. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif downstream of MER51. In some embodiments, the polynucleic acid polymer is from about 10 to about 50 nucleotides in length. In some embodiments, the isolated polynucleic acid polymer comprises a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 18-52.
Disclosed herein, in certain embodiments, is a cell comprising a pharmaceutical composition comprising: (a) a non-sense mediated RNA decay switch exon (NSE)-activator agent that interacts with a pre-processed mRNA transcript to promote inclusion of NSE into a processed mRNA transcript, or a non-sense mediated RNA decay switch exon (NSE)-repressor agent that interacts with a pre-processed mRNA transcript to promote exclusion of an NSE into a processed mRNA transcript; and (b) a pharmaceutically acceptable excipient and/or a delivery vehicle. In some embodiments, the NSE-activator agent is an isolated polynucleic acid polymer. In some embodiments, the NSE-repressor agent is an isolated polynucleic acid polymer. In some embodiments, the polynucleic acid polymer hybridizes to a motif within ATM intron 28. In some embodiments, the polynucleic acid polymer hybridizes to a splicing regulatory motif that competes with the NSE for a spliceosomal component. In some embodiments, the splicing regulatory motif comprises a cryptic splice site or a pseudoexon. In some embodiments, the pseudoexon is a 24 nucleotide pseudoexon located at 3′ of NSE in ATM intron 28 of the pre-mRNA transcript. In some embodiments, the polynucleic acid polymer hybridizes to a U2AF65 binding site. In some embodiments, the polynucleic acid polymer hybridizes to a motif within a transposed element, upstream of a transposed element, or downstream of a transposed element. In some embodiments, the transposed element is Alu or MER51. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif within Alu. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif that is either upstream or downstream of Alu. In some embodiments, the isolated polynucleic acid polymer hybridizes to a target motif downstream of MER51. In some embodiments, the polynucleic acid polymer is from about 10 to about 50 nucleotides in length. In some embodiments, the isolated polynucleic acid polymer comprises a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 18-52.
Disclosed herein, in certain embodiments, is a method, use, composition, vector, or agent substantially described herein, optionally with reference to the accompanying figures.
INCORPORATION BY REFERENCEAll publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
Intervening sequences or introns are removed by a large and highly dynamic RNA-protein complex termed the spliceosome, which orchestrates complex interactions between primary transcripts, small nuclear RNAs (snRNAs) and a large number of proteins. Spliceosomes assemble ad hoc on each intron in an ordered manner, starting with recognition of the 5′ splice site (5′ss) by U1 snRNA or the 3′ss by the U2 pathway, which involves binding of the U2 auxiliary factor (U2AF) to the 3′ss region to facilitate U2 binding to the branch point sequence (BPS). U2AF is a stable heterodimer composed of a U2AF2-encoded 65-kD subunit (U2AF65), which binds the polypyrimidine tract (PPT), and a U2AF1-encoded 35-kD subunit (U2AF35), which interacts with highly conserved AG dinucleotides at 3′ss and stabilizes U2AF65 binding. In addition to the BPS/PPT unit and 3′ss/5′ss, accurate splicing requires auxiliary sequences or structures that activate or repress splice site recognition, known as intronic or exonic splicing enhancers or silencers. These elements allow genuine splice sites to be recognized among a vast excess of cryptic or pseudo-sites in the genome of higher eukaryotes, which have the same sequences but outnumber authentic sites by an order of magnitude. Although they often have a regulatory function, the exact mechanisms of their activation or repression are poorly understood.
Exome sequencing studies have revealed a highly restricted pattern of somatic mutations in U2AF1/U2AF2 and other genes involved in 3′ss recognition (SF3B1, ZRSR2, SF1, SF3A1, PRPF40B, and SRSF2) in cancer cells, most prominently myelodysplastic syndromes. These genes encode products that often interact during spliceosome assembly, suggesting the existence of shared pathways in oncogenesis, which is further supported by a high degree of mutual exclusivity of cancer-associated mutations. Genome-wide transcriptome profiling in leukemic samples carrying these mutations detected numerous alterations in splicing of mRNA precursors, however, key links between specific RNA processing defects and cancer initiation or progression have remained obscure, despite the great promise of these targets for therapeutic modulation. The interconnections between these RNA-binding proteins and DNA damage response (DDR) pathways remain to be fully characterized.
Mutations in traditional (BPS/PPT/3′ss/5′ss) and auxiliary splicing motifs often cause aberrant splicing, such as exon skipping or cryptic exon or splice-site activation, and contribute significantly to human morbidity and mortality. Both aberrant and alternative splicing patterns can be influenced by natural DNA variants in exons and introns, which play an important role in heritability of both Mendelian and complex traits. However, the molecular mechanisms that translate the allele- or haplotype-specific RNA expression to phenotypic variability as well as interactions between intronic and exonic variant alleles and trans-acting factors are largely obscure.
Antisense technology has now reached important clinical applications. For example, antisense splice-switching oligonucleotides (SSOs) targeting the ATM gene have been used to repair splicing mutations in ataxia-telangiectasia (A-T) and were successful in normalizing ATM protein levels (Du et al., 2011; Du et al., 2007).
A large fraction of both leukemias and solid tumors show deregulation of ATM expression (for example, Stankovic et al., 1999; Starczynski et al., 2003). Chemical inhibitors of ATM (wortmannin, CP-466722, KU-55933, and KU60019) have not reached clinical trials, largely because of nonspecific effects and/or high toxicity, although KU-559403 has shown good bioavailability and reliably conferred radiosensitivity.
In some instances, the ability to up or down regulate gene expression in a sequence-specific manner is desirable.
In certain embodiments, provided herein is a method of screening a subject or a population of subjects for susceptibility to functional-ATM protein deficiency, wherein the screening comprises determining the presence of a non-thymine variant residue rs609261 located at position −3 relative to the 3′ splice site of NSE (cryptic or nonsense-mediated RNA decay switch exon in ATM intron 28) of the human genome, wherein the presence of a non-thymine variant residue rs609261 indicates that the subject (or group of subjects) has, or is susceptible to, functional-ATM protein deficiency.
The term “functional ATM-protein deficiency” means the reduction in the presence/expression of ATM protein that is functional in a subject, cell or tissue. Functional ATM-deficiency is the result of a functional variant rs609261 in ATM intron 28 that alters RNA processing of ATM precursor messenger RNA (pre-mRNA). Cytosine allele at rs609261 results in a higher inclusion of a nonsense-mediated RNA decay switch exon (termed here NSE) in ATM mRNA than a thymine allele at this position, limiting the expression of ATM protein more efficiently than the thymine allele. This limitation can be removed or modulated by novel SSOs that block access to NSE or to NSE-regulatory sequences in the same intron, leading to derepression or inhibition of ATM protein, respectively.
In some embodiments, provided herein is a method of selecting a subject or a population of subjects for treatment or prophylaxis, wherein the subject is susceptible to functional-ATM protein deficiency, the method comprising determining the presence of a non-thymine variant residue rs609261 located at position −3 relative to the 3′ splice site of NSE (cryptic exon in ATM intron 28) of the human genome, wherein the presence of a non-thymine variant residue rs609261indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and selecting such subject for treatment with an agent arranged to increase functional-ATM levels in the subject.
According to another aspect of the invention, there is provided a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising identifying the presence of a non-thymine variant residue rs609261 located at position −3 relative to the 3′ splice site of NSE of the human genome, wherein the presence of a non-thymine variant residue rs609261 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and administration of an agent to the subject, which is arranged to increase functional-ATM levels.
According to another aspect of the invention, there is provided a method of treatment or prevention of a condition associated with a functional-ATM protein deficiency, comprising the administration of a NSE repressor agent arranged to increase levels of functional ATM protein, wherein the agent is arranged to bind to a NSE in ATM intron 28 of the pre-mRNA transcript or to NSE-activating regulatory sequences in the same intron to decrease inclusion of the NSE in the mature transcript.
According to another aspect of the invention, there is provided a method of treatment or prevention of a condition associated with deregulation of ATM expression in a subject comprising the administration of a NSE-activator agent, wherein the NSE-activator agent is arranged to increase NSE inclusion in the ATM mature RNA transcript by binding to NSE-inhibiting regulatory motifs in ATM intron 28.
NSE-inhibiting regulatory motifs in ATM intron 28 may comprise sequences that compete with NSE for spliceosomal components, such as a 24 nucleotide pseudoexon (PE) located 3′ of NSE in ATM intron 28 of the pre-mRNA transcript or U2AF65 binding site upstream of the pseudoexon.
According to another aspect of the invention, there is provided a method of treatment or prevention of cancer in a subject comprising the administration of a NSE-activator agent arranged to increase a cancer cell's susceptibility to DNA damaging agents that induce double strand DNA breaks, such as radiotherapy, wherein the NSE-activator agent is arranged to increase NSE inclusion in the ATM mature RNA by binding NSE regulatory motifs in ATM intron 28; and treating the subject with DNA damaging agents that cause double strand breaks, such as radiotherapy or chemotherapy.
According to another aspect of the invention, there is provided a method of increasing a cell's susceptibility to cytotoxic therapy, such as radiotherapy treatment, comprising the reduction of ATM protein expression by administration of a NSE-activator agent arranged to increase NSE inclusion in ATM mature RNA transcript by binding to regulatory motifs in ATM intron 28.
The regulatory motifs in ATM intron 28 may compete with NSE for spliceosomal components, wherein such motifs may comprise a 24 nucleotide pseudoexon (PE) located 3′ of NSE in ATM intron 28 of the pre-mRNA transcript or U2AF65 binding site upstream of the pseudoexon.
According to another aspect of the invention, there is provided a method of tailoring functional ATM expression in a subject, cell or tissue, comprising the administration of a NSE-activator agent and/or a NSE-repressor agent described herein.
According to another aspect of the invention, there is provided use of rs609261 genotyping to predict a subject response to therapy for conditions associated with ATM deregulation.
According to another aspect of the invention, there is provided a composition comprising the NSE repressor agent of the invention herein.
According to another aspect of the invention, there is provided a composition comprising the NSE activator agent of the invention herein.
According to another aspect of the invention, there is provided a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising identifying the presence of a non-thymine variant residue rs609261 located at position −3 relative to the 3′ splice site of NSE (cryptic exon in ATM intron 28) of the human genome, wherein the presence of a non-thymine variant residue rs609261 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and administration of an agent to the subject, which is arranged to replace the non-thymine variant residue rs609261 with a thymine residue.
According to another aspect of the invention, there is provided a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising replacing a non-thymine variant residue rs609261 located at position −3 relative to the 3′ splice site of NSE (cryptic exon in ATM intron 28) of the human genome with a thymine residue.
According to another aspect of the invention, there is provided a vector comprising the polynucleic acid polymer of the invention.
According to another aspect of the invention, there is provided a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising identifying the presence of a guanine variant residue at rs4988000 of the human genome, wherein the presence of a guanine variant residue at rs4988000 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and administration of an agent to the subject, which is arranged to replace the guanine variant residue at rs4988000 with adenine.
According to another aspect of the invention, there is provided a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising replacing a guanine variant residue at rs4988000 of the human genome with an adenine residue.
According to a first aspect of the invention, there is provided a method of screening a subject or a population of subjects for susceptibility to functional-ATM protein deficiency, wherein the screening comprises determining the presence of a guanine variant residue at rs4988000 of the human genome, wherein the presence of a guanine variant residue at rs4988000 indicates that the subject (or group of subjects) has, or is susceptible to, functional-ATM protein deficiency.
According to another aspect of the invention, there is provided a method of selecting a subject or a population of subjects for treatment or prophylaxis, wherein the subject is susceptible to functional-ATM protein deficiency, the method comprising determining the presence of a guanine variant residue at rs4988000 of the human genome, wherein the presence of a guanine variant residue at rs4988000 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and selecting such subject for treatment with an agent arranged to increase functional-ATM levels in the subject.
According to another aspect of the invention, there is provided a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising identifying the presence of a guanine variant residue at rs4988000 of the human genome, wherein the presence of a guanine variant residue at rs4988000 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and administration of an agent to the subject, which is arranged to increase functional-ATM levels.
According to another aspect of the invention, there is provided a method of screening for an agent or a combination of agents capable of modifying regulation of a gene's expression (
According to another aspect of the invention, there is provided a method of modulating gene's expression comprising providing an agent arranged to bind to NSE splicing regulatory motifs.
According to another aspect of the invention, there is provided an agent arranged to bind to a gene splicing regulatory motif of NSE, wherein the splicing regulatory motif controls inclusion of the NSE into a mature RNA transcript of the gene.
According to another aspect of the invention, provided herein is a method of a treatment or prevention of a disease pathology caused by an NSE inclusion in an mRNA gene transcript comprising providing an agent arranged to bind to a gene NSE splicing regulatory motif that controls inclusion of the NSE into a mature RNA transcript of the gene.
While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.
The determination may use any suitable assay or genetic analysis available to the skilled person. In some instances, detection is done at a nucleic acid level with nucleic acid-based techniques such as in situ hybridization and RT-PCR. Sequencing technologies can include next-generation sequencing technologies such as Helicos True Single Molecule Sequencing (tSMS) (Harris T. D. et al., (2008) Science 320:106-109); 454 sequencing (Roche) (Margulies, M. et al., 2005, Nature, 437, 376-380); SOLiD technology (Applied Biosystems); SOLEXA sequencing (Illumina); single molecule, real-time (SMRT™) technology of Pacific Biosciences; nanopore sequencing (Soni GV and Meller A. (2007) Clin Chem 53: 1996-2001); semiconductor sequencing (Ion Torrent; Personal Genome Machine); DNA nanoball sequencing; sequencing using technology from Dover Systems (Polonator), and technologies that do not require amplification or otherwise transform native DNA prior to sequencing (e.g., Pacific Biosciences and Helicos), such as nanopore-based strategies (e.g., Oxford Nanopore, Genia Technologies, and Nabsys). Sequencing technologies can also include Sanger sequencing, Maxam-Gilbert sequencing, Shotgun sequencing, bridge PCR, mass spectrometry based sequencing, microfluidic based Sanger sequencing, microscopy-based sequencing, RNAP sequencing, or hybridization based sequencing.
Sequencing of a gene transcript of interest may also include an amplification step. Exemplary amplification methodologies include, but are not limited to, polymerase chain reaction (PCR), nucleic acid sequence based amplification (NASBA), self-sustained sequence replication (3SR), loop mediated isothermal amplification (LAMP), strand displacement amplification (SDA), whole genome amplification, multiple displacement amplification, strand displacement amplification, helicase dependent amplification, nicking enzyme amplification reaction, recombinant polymerase amplification, reverse transcription PCR, ligation mediated PCR, or methylation specific PCR.
Additional methods that can be used to obtain a nucleic acid sequence include, e.g., whole-genome RNA expression array, enzyme-linked immunosorbent assay (ELISA), genome sequencing, de novo sequencing, Pacific Biosciences SMRT sequencing, immunohistochemistry (IHC), immunocytochemistry (ICC), mass spectrometry, tandem mass spectrometry, matrix-assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF MS), in-situ hybridization, fluorescent in-situ hybridization (FISH), chromogenic in-situ hybridization (CISH), silver in situ hybridization (SISH), digital PCR (dPCR), reverse transcription PCR, quantitative PCR (Q-PCR), single marker qPCR, real-time PCR, nCounter Analysis (Nanostring technology), Western blotting, Southern blotting, SDS-PAGE, gel electrophoresis, and Northern blotting.
According to another aspect of the invention, there is provided a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising identifying the presence of a non-thymine variant residue rs609261 located at position −3 relative to the 3′ splice site of NSE (cryptic exon in ATM intron 28) of the human genome, wherein the presence of a non-thymine variant residue rs609261 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and administration of an agent to the subject, which is arranged to increase functional-ATM levels.
According to another aspect of the invention, there is provided a method of treatment or prevention of a condition associated with a functional-ATM protein deficiency, comprising the administration of a NSE repressor agent arranged to increase levels of functional ATM protein, wherein the agent is arranged to bind to a NSE in ATM intron 28 of the pre-mRNA transcript to decrease inclusion of the NSE in the mature RNA transcript.
Decreasing inclusion of the NSE in the mature RNA transcript may provide an increase in functional ATM protein expression.
The method of treatment or prevention of functional-ATM protein deficiency in a subject or an at-risk population of subjects may be a method of treatment or prevention of a condition associated with functional-ATM protein deficiency. The condition may be any symptom of ataxia-telangiectasia; cerebellar ataxia; oculocutaneous angiectasia; cancer; immune deficiency; cellular radiosensitivity; or chromosomal instability. The cancer may comprise lymphoblastoid leukemias, or lymphomas. In one embodiment, the condition is ataxia-telangiectasia. In another embodiment, the condition is cancer. The cancer may comprise a non-Hodgkin or Hodgkin lymphoma.
In one embodiment, the NSE comprises the sequence tctacaggttggctgcatagaagaaaaag (SEQ ID NO: 57). The NSE repressor agent may be arranged to bind to NSE within the sequence agTCTACAGGTTGGCTGCATAGAAGAAAAAGgtagag (SEQ ID NO: 58) (respective 3′ and 5′ splice site dinucleotides of flanking intervening sequences are underlined). The NSE repressor agent may be arranged to bind to the 5′ or 3′ splice site of the NSE in ATM intron 28. In another embodiment, the NSE repressor agent is arranged to bind to the 3′ splice site of the NSE in ATM intron 28. In another embodiment, the NSE repressor agent may be arranged to bind to NSE within the sequence tcttagTCTACAGGTTGGCTGCATAGAAGAAAAAGgtagag (SEQ ID NO: 59) (respective 3′ and 5′ splice site dinucleotides of flanking intervening sequences are underlined). In another embodiment, the NSE repressor agent may be arranged to bind to NSE within the sequence tctcagTCTACAGGTTGGCTGCATAGAAGAAAAAGgtagag (SEQ ID NO: 60) (respective 3′ and 5′ splice site dinucleotides of flanking intervening sequences are underlined).
According to another aspect of the invention, there is provided a method of treatment or prevention of a condition associated with deregulation of ATM expression in a subject comprising the administration of a NSE-activator agent, wherein the NSE-activator agent is arranged to increase NSE inclusion in ATM mature RNA transcript by binding to splicing regulatory motifs in ATM intron 28.
Increasing inclusion of the NSE in the mature RNA transcript may provide a decrease in functional ATM protein expression.
According to another aspect of the invention, there is provided a method of treatment or prevention of cancer in a subject comprising the administration of a NSE-activator agent arranged to increase a cancer cell's susceptibility to cytotoxic therapy with DNA damaging agents such as radiotherapy, wherein the NSE-activator agent is arranged to increase NSE inclusion in ATM mature RNA transcript by binding to splicing regulatory motifs in ATM intron 28; and treating the subject with the cytotoxic therapy, such as radiotherapy or chemotherapy.
Chemotherapy may comprise a therapeutic that induces double strand DNA breaks. The skilled person will understand that there are several chemotherapy/therapeutic agents that are capable of inducing double strand DNA breaks. In one embodiment, the chemotherapy agents may comprise bleomycin.
Increasing inclusion of the NSE in the mature RNA transcript may provide a decrease in functional ATM protein expression.
The radiotherapy or chemotherapy may be following the administration of the agent. The radiotherapy or chemotherapy may one or more days following the administration of the agent. The radiotherapy or chemotherapy may be one or more weeks following the administration of the agent
In one embodiment the pseudoexon comprises the sequence tcatcgaatacttttggaaataag (SEQ ID NO: 61).
According to another aspect of the invention, there is provided a method of increasing a cell's susceptibility to cytotoxic therapy with DNA damaging agents such as radiotherapy comprising the reduction of ATM protein expression by administration of a NSE-activator agent arranged to increase NSE inclusion in ATM mature RNA transcript by binding to NSE regulatory motifs in ATM intron 28.
In one embodiment the cell is a cancerous cell. In another embodiment the cell is a precancerous cell.
According to another aspect of the invention, there is provided a method of tailoring functional ATM expression in a subject, cell or tissue, comprising the administration of a NSE-activator agent and/or a NSE-repressor agent described herein.
Nonsense-Mediated mRNA Decay
Nonsense-mediated mRNA decay (NMD) is a surveillance pathway that exists in all eukaryotes. Its main function is to reduce errors in gene expression by eliminating mRNA transcripts that contain premature stop codons. NMD targets transcripts with premature stop codons but also a broad array of mRNA isoforms expressed from many endogenous genes, suggesting that NMD is a master regulator that drives both fine and coarse adjustments in steady-state RNA levels in the cell.
A nonsense-mediated RNA decay switch exon (NSE) is an exon or a pseudoexon that activates the NMD pathway if included in a mature RNA transcript. A NSE inclusion in mature transcripts downregulates gene expression.
Cryptic (or pseudo-splice sites) have the same splicing recognition sequences as genuine splice sites but are not used in the splicing reactions. They outnumber genuine splice sites in the human genome by an order of a magnitude and are normally repressed by thus far poorly understood molecular mechanisms. Cryptic 5′ splice sites have the consensus NNN/GUNNNN or NNN/GCNNNN where N is any nucleotide and/is the exon-intron boundary. Cryptic 3′ splice sites have the consensus NAG/N. Their activation is positively influenced by surrounding nucleotides that make them more similar to the optimal consensus of authentic splice sites, namely MAG/GURAGU and YAG/G, respectively, where M is C or A, R is G or A, and Y is C or U.
Cryptic (or pseudo-) exons have the same splicing recognition sequences as genuine exons but are not used in the splicing reactions. They outnumber genuine exons by an order of a magnitude and are normally repressed by thus far poorly understood molecular mechanisms.
Splice sites and their regulatory sequences can be readily identified by a skilled person using suitable algorithms publicly available, listed for example in Kralovicova, J. and Vorechovsky, I. (2007) Global control of aberrant splice site activation by auxiliary splicing sequences: evidence for a gradient in exon and intron definition. Nucleic Acids Res., 35, 6399-6413, (http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2095810/pdfigkm680.pdf).
The cryptic splice sites or splicing regulatory sequences may compete for RNA-binding proteins such as U2AF with a splice site of the NSE. In one embodiment, the agent may bind to the cryptic splice site or splicing regulatory sequences to prevent the binding of RNA-binding proteins and thereby favoring utilization of the NSE splice sites.
In one embodiment, the cryptic splice site may not comprise the 5′ or 3′ splice site of the NSE. The cryptic splice site may be at least 10 nucleotides upstream of the NSE 5′ splice site. The cryptic splice site may be at least 20 nucleotides upstream of the NSE 5′ splice site. The cryptic splice site may be at least 50 nucleotides upstream of the NSE 5′ splice site. The cryptic splice site may be at least 100 nucleotides upstream of the NSE 5′ splice site. The cryptic splice site may be at least 200 nucleotides upstream of the NSE 5′ splice site.
The cryptic splice site may be at least 10 nucleotides downstream of the NSE 3′ splice site. The cryptic splice site may be at least 20 nucleotides downstream of the NSE 3′ splice site. The cryptic splice site may be at least 50 nucleotides downstream of the NSE 3′ splice site. The cryptic splice site may be at least 100 nucleotides downstream of the NSE 3′ splice site. The cryptic splice site may be at least 200 nucleotides downstream of the NSE 3′ splice site.
The NSE Repressor Agent and NSE Activator AgentThe NSE repressor agent and/or NSE activator agent may comprise a polynucleic acid polymer. In one embodiment, the NSE repressor agent and/or NSE activator agent is an SSO (Splice Switching Oligonucleotide).
In an embodiment wherein the NSE repressor agent and/or NSE activator agent comprises a polynucleic acid polymer the following statements may apply equally to both the NSE repressor agent and the NSE activator agent unless otherwise indicated. The polynucleic acid polymer may be about 50 nucleotides in length. The polynucleic acid polymer may be about 45 nucleotides in length. The polynucleic acid polymer may be about 40 nucleotides in length. The polynucleic acid polymer may be about 35 nucleotides in length. The polynucleic acid polymer may be about 30 nucleotides in length. The polynucleic acid polymer may be about 24 nucleotides in length. The polynucleic acid polymer may be about 25 nucleotides in length. The polynucleic acid polymer may be about 20 nucleotides in length. The polynucleic acid polymer may be about 19 nucleotides in length. The polynucleic acid polymer may be about 18 nucleotides in length. The polynucleic acid polymer may be about 17 nucleotides in length. The polynucleic acid polymer may be about 16 nucleotides in length. The polynucleic acid polymer may be about 15 nucleotides in length. The polynucleic acid polymer may be about 14 nucleotides in length. The polynucleic acid polymer may be about 13 nucleotides in length. The polynucleic acid polymer may be about 12 nucleotides in length. The polynucleic acid polymer may be about 11 nucleotides in length. The polynucleic acid polymer may be about 10 nucleotides in length. The polynucleic acid polymer may be between about 10 and about nucleotides in length. The polynucleic acid polymer may be between about 10 and about 45 nucleotides in length. The polynucleic acid polymer may be between about 10 and about 40 nucleotides in length. The polynucleic acid polymer may be between about 10 and about 35 nucleotides in length. The polynucleic acid polymer may be between about 10 and about 30 nucleotides in length. The polynucleic acid polymer may be between about 10 and about 25 nucleotides in length. The polynucleic acid polymer may be between about 10 and about 20 nucleotides in length. The polynucleic acid polymer may be between about 15 and about 25 nucleotides in length. The polynucleic acid polymer may be between about 15 and about 30 nucleotides in length. The polynucleic acid polymer may be between about 12 and about 30 nucleotides in length.
The sequence of the polynucleic acid polymer may be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% complementary to a target sequence of the partially processed mRNA transcript. The sequence of the polynucleic acid polymer may be 100% complementary to a target sequence of the pre-mRNA transcript.
The sequence of the polynucleic acid polymer may have 4 or less mismatches to a target sequence of the pre-mRNA transcript. The sequence of the polynucleic acid polymer may have 3 or less mismatches to a target sequence of the pre-mRNA transcript. The sequence of the polynucleic acid polymer may have 2 or less mismatches to a target sequence of the pre-mRNA transcript. The sequence of the polynucleic acid polymer may have 1 or less mismatches to a target sequence of the pre-mRNA transcript.
The polynucleic acid polymer may specifically hybridize to a target sequence of the pre-mRNA transcript. The specificity may be at least a 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% sequence complementarity of the polynucleic acid polymer to a target sequence of the pre-mRNA transcript. The hybridization may be under high stringent hybridization conditions.
The polynucleic acid polymer may have a sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% sequence identity to a sequence illustrated in Table 2 or
In some instances, the polynucleic acid polymer has a sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% sequence identity to a sequence selected from SEQ ID NOs: 18-52. In some cases, the polynucleic acid polymer has a sequence with at least 50% sequence identity to a sequence selected from SEQ ID NOs: 18-52. In some cases, the polynucleic acid polymer has a sequence with at least 60% sequence identity to a sequence selected from SEQ ID NOs: 18-52. In some cases, the polynucleic acid polymer has a sequence with at least 70% sequence identity to a sequence selected from SEQ ID NOs: 18-52. In some cases, the polynucleic acid polymer has a sequence with at least 80% sequence identity to a sequence selected from SEQ ID NOs: 18-52. In some cases, the polynucleic acid polymer has a sequence with at least 85% sequence identity to a sequence selected from SEQ ID NOs: 18-52. In some cases, the polynucleic acid polymer has a sequence with at least 90% sequence identity to a sequence selected from SEQ ID NOs: 18-52. In some cases, the polynucleic acid polymer has a sequence with at least 91% sequence identity to a sequence selected from SEQ ID NOs: 18-52. In some cases, the polynucleic acid polymer has a sequence with at least 92% sequence identity to a sequence selected from SEQ ID NOs: 18-52. In some cases, the polynucleic acid polymer has a sequence with at least 93% sequence identity to a sequence selected from SEQ ID NOs: 18-52. In some cases, the polynucleic acid polymer has a sequence with at least 94% sequence identity to a sequence selected from SEQ ID NOs: 18-52. In some cases, the polynucleic acid polymer has a sequence with at least 95% sequence identity to a sequence selected from SEQ ID NOs: 18-52. In some cases, the polynucleic acid polymer has a sequence with at least 96% sequence identity to a sequence selected from SEQ ID NOs: 18-52. In some cases, the polynucleic acid polymer has a sequence with at least 97% sequence identity to a sequence selected from SEQ ID NOs: 18-52. In some cases, the polynucleic acid polymer has a sequence with at least 98% sequence identity to a sequence selected from SEQ ID NOs: 18-52. In some cases, the polynucleic acid polymer has a sequence with at least 99% sequence identity to a sequence selected from SEQ ID NOs: 18-52. In some cases, the polynucleic acid polymer has a sequence with at least 99.5% sequence identity to a sequence selected from SEQ ID NOs: 18-52. In some cases, the polynucleic acid polymer has a sequence with 100% sequence identity to a sequence selected from SEQ ID NOs: 18-52.
In some embodiments, a polynucleic acid polymer hybridizes to a motif within a transposed element, upstream of a transposed element, or downstream of a transposed element. In some instances, the transposed element is Alu, MER51, UC or L4C. In some instances, the transposed element is Alu (e.g., Alu− or Alu+) or MER51. In some cases, the transposed element is Alu (e.g., Alu− or Alu+). In other cases, the transposed element is MER51. In some instances, the polynucleic acid polymer hybridizes to a target motif within Alu (e.g., Alu− or Alu+). In other instances, the polynucleic acid polymer hybridizes to a target motif downstream of MER51. In some instances, the polynucleic acid polymer has a sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% sequence identity to a sequence selected from SEQ ID NOs: 18-52.
In some embodiments, the polynucleic acid polymer hybridizes to a target motif that is either upstream or downstream of Alu (e.g., Alu− or Alu+). In some instances, the polynucleic acid polymer hybridizes to a target motif that is upstream of Alu. In some cases, the target motif is about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, or more bases upstream of Alu. In some cases, the target motif is about 5 or more bases upstream of Alu. In some cases, the target motif is about 10 or more bases upstream of Alu. In some cases, the target motif is about 20 or more bases upstream of Alu. In some cases, the target motif is about 30 or more bases upstream of Alu. In some cases, the target motif is about 40 or more bases upstream of Alu. In some cases, the target motif is about 50 or more bases upstream of Alu. In some cases, the target motif is about 80 or more bases upstream of Alu. In some cases, the target motif is about 100 or more bases upstream of Alu. In some cases, the target motif is about 150 or more bases upstream of Alu. In some cases, the target motif is about 200 or more bases upstream of Alu. In some cases, the target motif is about 300 or more bases upstream of Alu. In some cases, the target motif is about 500 or more bases upstream of Alu. In some cases, the target motif is about 800 or more bases upstream of Alu. In some instances, the polynucleic acid polymer has a sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% sequence identity to a sequence selected from SEQ ID NOs: 18-52.
In some instances, the polynucleic acid polymer hybridizes to a target motif that is downstream of Alu (e.g., Alu− or Alu+). In some cases, the target motif is about 5, 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, or more bases downstream of Alu. In some cases, the target motif is about 5 or more bases downstream of Alu. In some cases, the target motif is about 10 or more bases downstream of Alu. In some cases, the target motif is about 20 or more bases downstream of Alu. In some cases, the target motif is about 30 or more bases downstream of Alu. In some cases, the target motif is about 40 or more bases downstream of Alu. In some cases, the target motif is about 50 or more bases downstream of Alu. In some cases, the target motif is about 80 or more bases downstream of Alu. In some cases, the target motif is about 100 or more bases downstream of Alu. In some cases, the target motif is about 150 or more bases downstream of Alu. In some cases, the target motif is about 200 or more bases downstream of Alu. In some cases, the target motif is about 300 or more bases downstream of Alu. In some cases, the target motif is about 500 or more bases downstream of Alu. In some cases, the target motif is about 800 or more bases downstream of Alu. In some instances, the polynucleic acid polymer has a sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% sequence identity to a sequence selected from SEQ ID NOs: 18-52.
In some embodiments, the polynucleic acid polymer hybridizes to a target motif that is either upstream or downstream of MER51. In some instances, the polynucleic acid polymer hybridizes to a target motif that is upstream of MER51. In some cases, the target motif is about 5, 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, or more bases upstream of MER51. In some cases, the target motif is about 5 or more bases upstream of MER51. In some cases, the target motif is about 10 or more bases upstream of MER51. In some cases, the target motif is about 20 or more bases upstream of MER51. In some cases, the target motif is about 30 or more bases upstream of MER51. In some cases, the target motif is about 40 or more bases upstream of MER51. In some cases, the target motif is about 50 or more bases upstream of MER51. In some cases, the target motif is about 80 or more bases upstream of MER51. In some cases, the target motif is about 100 or more bases upstream of MER51. In some cases, the target motif is about 150 or more bases upstream of MER51. In some cases, the target motif is about 200 or more bases upstream of MER51. In some cases, the target motif is about 300 or more bases upstream of MER51. In some cases, the target motif is about 500 or more bases upstream of MER51. In some cases, the target motif is about 800 or more bases upstream of MER51. In some instances, the polynucleic acid polymer has a sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% sequence identity to a sequence selected from SEQ ID NOs: 18-52.
In some instances, the polynucleic acid polymer hybridizes to a target motif that is downstream of MER51. In some cases, the target motif is about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 100, 110, 120, 130, 140, 150, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, or more bases downstream of MER51. In some cases, the target motif is about 5 or more bases downstream of MER51. In some cases, the target motif is about 10 or more bases downstream of MER51. In some cases, the target motif is about 20 or more bases downstream of MER51. In some cases, the target motif is about 30 or more bases downstream of MER51. In some cases, the target motif is about 40 or more bases downstream of MER51. In some cases, the target motif is about 50 or more bases downstream of MER51. In some cases, the target motif is about 80 or more bases downstream of MER51. In some cases, the target motif is about 100 or more bases downstream of MER51. In some cases, the target motif is about 150 or more bases downstream of MER51. In some cases, the target motif is about 200 or more bases downstream of MER51. In some cases, the target motif is about 300 or more bases downstream of MER51. In some cases, the target motif is about 500 or more bases downstream of MER51. In some cases, the target motif is about 800 or more bases downstream of MER51. In some instances, the polynucleic acid polymer has a sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% sequence identity to a sequence selected from SEQ ID NOs: 18-52.
Where reference is made to a polynucleic acid polymer sequence, the skilled person will understand that one or more substitutions may be tolerated, optionally two substitutions may be tolerated in the sequence, such that it maintains the ability to hybridize to the target sequence, or where the substitution is in a target sequence, the ability to be recognized as the target sequence. References to sequence identity may be determined by BLAST sequence alignment (www.ncbi.nlm.nih.gov/BLAST/) using standard/default parameters. For example, the sequence may have 99% identity and still function according to the invention. In other embodiments, the sequence may have 98% identity and still function according to the invention. In another embodiment, the sequence may have 95% identity and still function according to the invention.
A polynucleic acid polymer, such as the SSOs, may comprise RNA or DNA. The polynucleic acid polymer, such as the SSOs, may comprise RNA. The polynucleic acid polymer, such as the SSOs, may comprise natural or synthetic or artificial nucleotide analogues or bases, having equivalent complementation as DNA or RNA. The polynucleic acid polymer, such as the SSOs, may comprise combinations of DNA, RNA and/or nucleotide analogues. Nucleotide analogues may comprise PNA or LNA. In another embodiment, the nucleic acid, such as the SSOs, may comprise or consist of PMO.
In some instances, the synthetic or artificial nucleotide analogues or bases can comprise modifications at one or more of ribose moiety, phosphate moiety, nucleoside moiety, or a combination thereof. For example, a nucleotide base may be any naturally occurring, unmodified nucleotide base such as adenine, guanine, cytosine, thymine and uracil, or any synthetic or modified base that is sufficiently similar to an unmodified nucleotide base such that it is capable of hydrogen bonding with a base present on a target pre-mRNA. Examples of modified nucleotide bases include, without limitation, hypoxanthine, xanthine, 7-methylguanine, 5,6-dihydrouracil, 5-methylcytosine, and 5-hydroxymethoylcytosine.
Sometimes, the polynucleic acid polymers described herein also comprise a backbone structure that connects the components of an oligomer. The term “backbone structure” and “oligomer linkages” may be used interchangeably and refer to the connection between monomers of the polynucleic acid polymer. In naturally occurring oligonucleotides, the backbone comprises a 3′-phosphodiester linkage connecting sugar moieties of the oligomer. The backbone structure or oligomer linkages of the polynucleic acid polymers described herein may include (but are not limited to) phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoraniladate, phosphoramidate, and the like. See e.g., LaPlanche et al., Nucleic Acids Res. 14:9081 (1986); Stec et al., J. Am. Chem. Soc. 106:6077 (1984), Stein et al; Nucleic Acids Res. 16:3209 (1988), Zon et al., Anti Cancer Drug Design 6:539 (1991); Zon et al; Oligonucleotides and Analogues: A Practical Approach, pp. 87-108 (F. Eckstein, Ed., Oxford University Press, Oxford England (1991)); Stec et al., U.S. Pat. No. 5,151,510; Uhlmann and Peyman, Chemical Reviews 90:543 (1990).
In embodiments, the stereochemistry at each of the phosphorus internucleotide linkages of the polynucleic acid polymer backbone is random. In embodiments, the stereochemistry at each of the phosphorus internucleotide linkages of the polynucleic acid polymer backbone is controlled and is not random. For example, U.S. Pat. App. Pub. No. 2014/0194610, “Methods for the Synthesis of Functionalized Nucleic Acids,” incorporated herein by reference, describes methods for independently selecting the handedness of chirality at each phosphorous atom in a nucleic acid oligomer. In embodiments, a polynucleic acid polymer described herein comprises a polynucleic acid polymer having phosphorus internucleotide linkages that are not random. In embodiments, a composition used in the methods of the invention comprises a pure diastereomeric polynucleic acid polymer. In embodiments, a composition used in the methods of the invention comprises a polynucleic acid polymer that has diastereomeric purity of at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, about 100%, about 90% to about 100%, about 91% to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to about 100%.
In embodiments, the polynucleic acid polymer has a nonrandom mixture of Rp and Sp configurations at its phosphorus internucleotide linkages. For example, a mix of Rp and Sp may be required in antisense oligonucleotides to achieve a balance between good activity and nuclease stability (Wan, et al., 2014, “Synthesis, biophysical properties and biological activity of second generation antisense oligonucleotides containing chiral phosphorothioate linkages,” Nucleic Acids Research 42(22): 13456-13468, incorporated herein by reference). In embodiments, a polynucleic acid polymer described herein comprises about 5-100% Rp, at least about 5% Rp, at least about 10% Rp, at least about 15% Rp, at least about 20% Rp, at least about 25% Rp, at least about 30% Rp, at least about 35% Rp, at least about 40% Rp, at least about 45% Rp, at least about 50% Rp, at least about 55% Rp, at least about 60% Rp, at least about 65% Rp, at least about 70% Rp, at least about 75% Rp, at least about 80% Rp, at least about 85% Rp, at least about 90% Rp, or at least about 95% Rp, with the remainder Sp, or about 100% Rp. In embodiments, a polynucleic acid polymer described herein comprises about 10% to about 100% Rp, about 15% to about 100% Rp, about 20% to about 100% Rp, about 25% to about 100% Rp, about 30% to about 100% Rp, about 35% to about 100% Rp, about 40% to about 100% Rp, about 45% to about 100% Rp, about 50% to about 100% Rp, about 55% to about 100% Rp, about 60% to about 100% Rp, about 65% to about 100% Rp, about 70% to about 100% Rp, about 75% to about 100% Rp, about 80% to about 100% Rp, about 85% to about 100% Rp, about 90% to about 100% Rp, or about 95% to about 100% Rp, about 20% to about 80% Rp, about 25% to about 75% Rp, about 30% to about 70% Rp, about 40% to about 60% Rp, or about 45% to about 55% Rp, with the remainder Sp.
In embodiments, a polynucleic acid polymer described herein comprises about 5-100% Sp, at least about 5% Sp, at least about 10% Sp, at least about 15% Sp, at least about 20% Sp, at least about 25% Sp, at least about 30% Sp, at least about 35% Sp, at least about 40% Sp, at least about 45% Sp, at least about 50% Sp, at least about 55% Sp, at least about 60% Sp, at least about 65% Sp, at least about 70% Sp, at least about 75% Sp, at least about 80% Sp, at least about 85% Sp, at least about 90% Sp, or at least about 95% Sp, with the remainder Rp, or about 100% Sp. In embodiments, a polynucleic acid polymer described herein comprises about 10% to about 100% Sp, about 15% to about 100% Sp, about 20% to about 100% Sp, about 25% to about 100% Sp, about 30% to about 100% Sp, about 35% to about 100% Sp, about 40% to about 100% Sp, about 45% to about 100% Sp, about 50% to about 100% Sp, about 55% to about 100% Sp, about 60% to about 100% Sp, about 65% to about 100% Sp, about 70% to about 100% Sp, about 75% to about 100% Sp, about 80% to about 100% Sp, about 85% to about 100% Sp, about 90% to about 100% Sp, or about 95% to about 100% Sp, about 20% to about 80% Sp, about 25% to about 75% Sp, about 30% to about 70% Sp, about 40% to about 60% Sp, or about 45% to about 55% Sp, with the remainder Rp.
Nucleotide analogues or artificial nucleotide base may comprise a nucleic acid with a modification at a 2′ hydroxyl group of the ribose moiety. The modification can be a 2′-O-methyl modification or a 2′-O-methoxyethyl (2′-O-MOE) modification. The 2′-O-methyl modification can add a methyl group to the 2′ hydroxyl group of the ribose moiety whereas the 2′O-methoxyethyl modification can add a methoxyethyl group to the 2′ hydroxyl group of the ribose moiety. Exemplary chemical structures of a 2′-O-methyl modification of an adenosine molecule and 2′O-methoxyethyl modification of an uridine are illustrated below.
An additional modification at the 2′ hydroxyl group can include a 2′-O-aminopropyl sugar conformation which can involve an extended amine group comprising a propyl linker that binds the amine group to the 2′ oxygen. This modification can neutralize the phosphate derived overall negative charge of the oligonucleotide molecule by introducing one positive charge from the amine group per sugar and can thereby improve cellular uptake properties due to its zwitterionic properties. An exemplary chemical structure of a 2′-O-aminopropyl nucleoside phosphoramidite is illustrated below.
Another modification at the 2′ hydroxyl group can include a locked or bridged ribose conformation (e.g., locked nucleic acid or LNA) where the 4′ ribose position can also be involved. In this modification, the oxygen molecule bound at the 2′ carbon can be linked to the 4′ carbon by a methylene group, thus forming a 2′-C,4′-C-oxy-methylene-linked bicyclic ribonucleotide monomer. Exemplary representations of the chemical structure of LNA are illustrated below. The representation shown to the left highlights the chemical connections of an LNA monomer. The representation shown to the right highlights the locked 3′-endo (3E) conformation of the furanose ring of an LNA monomer.
A further modification at the 2′ hydroxyl group may comprise ethylene nucleic acids (ENA) such as for example 2′-4′-ethylene-bridged nucleic acid, which locks the sugar conformation into a C3′-endo sugar puckering conformation. ENA are part of the bridged nucleic acids class of modified nucleic acids that also comprises LNA. Exemplary chemical structures of the ENA and bridged nucleic acids are illustrated below.
Still other modifications at the 2′ hydroxyl group can include 2′-deoxy, T-deoxy-2′-fluoro, 2′-(2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), or 2′-O-N-methylacetamido (2′-O-NMA).
Nucleotide analogues may further comprise Morpholinos, peptide nucleic acids (PNAs), methylphosphonate nucleotides, thiolphosphonate nucleotides, 2′-fluoro N3-P5′-phosphoramidites, 1′, 5′-anhydrohexitol nucleic acids (RNAs), or a combination thereof. Morpholino or phosphorodiamidate morpholino oligo (PMO) comprises synthetic molecules whose structure mimics natural nucleic acid structure by deviates from the normal sugar and phosphate structures. Instead, the five member ribose ring can be substituted with a six member morpholino ring containing four carbons, one nitrogen and one oxygen. The ribose monomers can be linked by a phosphordiamidate group instead of a phosphate group. These backbone alterations can remove all positive and negative charges making morpholinos neutral molecules that can cross cellular membranes without the aid of cellular delivery agents such as those used by charged oligonucleotides.
Peptide nucleic acid (PNA) does not contain sugar ring or phosphate linkage. Instead, the bases can be attached and appropriately spaced by oligoglycine-like molecules, therefore, eliminating a backbone charge.
Modification of the phosphate backbone may also comprise methyl or thiol modifications such as methylphosphonate nucleotide and. Exemplary thiolphosphonate nucleotide (left) and methylphosphonate nucleotide (right) are illustrated below.
Furthermore, exemplary 2′-fluoro N3-P5′-phosphoramidites is illustrated as:
And exemplary hexitol nucleic acid (or 1′, 5′-anhydrohexitol nucleic acids (HNA)) is illustrated as:
In addition to modification of the ribose moiety, phosphate backbone and the nucleoside, the nucleotide analogues can also be modified by for example at the 3′ or the 5′ terminus. For example, the 3′ terminus can include a 3′ cationic group, or by inverting the nucleoside at the 3′-terminus with a 3′-3′ linkage. In another alternative, the 3′-terminus can be blocked with an aminoalkyl group, e.g., a 3′ C5-aminoalkyl dT. The 5′-terminus can be blocked with an aminoalkyl group, e.g., a 5′-O-alkylamino substituent. Other 5′ conjugates can inhibit 5′-3′ exonucleolytic cleavage. Other 3′ conjugates can inhibit 3′-5′ exonucleolytic cleavage.
Unless specified otherwise, the left-hand end of single-stranded nucleic acid (e.g., pre-mRNA transcript, oligonucleotide, SSO, etc.) sequences is the 5′ end and the left-hand direction of single or double-stranded nucleic acid sequences is referred to as the 5′ direction. Similarly, the right-hand end or direction of a nucleic acid sequence (single or double stranded) is the 3′ end or direction. Generally, a region or sequence that is 5′ to a reference point in a nucleic acid is referred to as “upstream,” and a region or sequence that is 3′ to a reference point in a nucleic acid is referred to as “downstream.” Generally, the 5′ direction or end of an mRNA is where the initiation or start codon is located, while the 3′ end or direction is where the termination codon is located. In some aspects, nucleotides that are upstream of a reference point in a nucleic acid may be designated by a negative number, while nucleotides that are downstream of a reference point may be designated by a positive number. For example, a reference point (e.g., an exon-exon junction in mRNA) may be designated as the “zero” site, and a nucleotide that is directly adjacent and upstream of the reference point is designated “minus one,” e.g., “—I,” while a nucleotide that is directly adjacent and downstream of the reference point is designated “plus one,” e.g., “+1.”
In some cases, one or more of the artificial nucleotide analogues described herein are resistant toward nucleases such as for example ribonuclease such as RNase H, deoxyribonuclease such as DNase, or exonuclease such as 5′-3′ exonuclease and 3′-5′ exonuclease when compared to natural polynucleic acid polymers. In some instances, artificial nucleotide analogues comprising 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), or 2′-O-N-methylacetamido (2′-O-NMA) modified, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2′-fluoro N3-P5′-phosphoramidites, or combinations thereof are resistant toward nucleases such as for example ribonuclease such as RNase H, deoxyribonuclease such as DNase, or exonuclease such as 5′-3′ exonuclease and 3′-5′ exonuclease. 2′-O-methyl modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistance). 2′O-methoxyethyl (2′-O-MOE) modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistance). 2′-O-aminopropyl modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistance). 2′-deoxy modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistance). T-deoxy-2′-fluoro modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistance). 2′-O-aminopropyl (2′-O-AP) modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistance). 2′-O-dimethylaminoethyl (2′-O-DMAOE) modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistance). 2′-O-dimethylaminopropyl (2′-O-DMAP) modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistance). T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE) modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistance). 2′-O-N-methylacetamido (2′-O-NMA) modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistance). LNA modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistance). ENA modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistance). HNA modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistance). Morpholinos may be nuclease resistance (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistance). PNA can be resistant to nucleases (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistance). Methylphosphonate nucleotides modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistance). Thiolphosphonate nucleotides modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistance). Polynucleic acid polymer comprising 2′-fluoro N3-P5′-phosphoramidites may be nuclease resistance (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistance).
In some instances, one or more of the artificial nucleotide analogues described herein have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. The one or more of the artificial nucleotide analogues comprising 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′40-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), or T-O-N-methylacetamido (T-O-NMA) modified, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, or 2′-fluoro N3-P5′-phosphoramidites can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. 2′-O-methyl modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. 2′-O-methoxyethyl (2′-O-MOE) modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. 2′-O-aminopropyl modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. 2′-deoxy modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. T-deoxy-T-fluoro modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. 2′-O-aminopropyl (2′-O-AP) modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. 2′-O-dimethylaminoethyl (T-O-DMAOE) modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. 2′-O-dimethylaminopropyl (2′-O-DMAP) modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE) modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. 2′-O-N-methylacetamido (2′-O-NMA) modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. LNA modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. ENA modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. PNA modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. HNA modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. Morpholino modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. Methylphosphonate nucleotides modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. Thiolphosphonate nucleotides modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. Polynucleic acid polymer comprising 2′-fluoro N3-P5′-phosphoramidites can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. The increased affinity can be illustrated with a lower Kd, a higher melt temperature (Tm), or a combination thereof.
In additional instances, a polynucleic acid polymer described herein may be modified to increase its stability. In an embodiment where the polynucleic acid polymer is RNA, the polynucleic acid polymer may be modified to increase its stability. The polynucleic acid polymer may be modified by one or more of the modifications described above to increase its stability. The polynucleic acid polymer may be modified at the 2′ hydroxyl position, such as by 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (T-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), or 2′-O-N-methylacetamido (2′-O-NMA) modification or by a locked or bridged ribose conformation (e.g., LNA or ENA). The polynucleic acid polymer may be modified by 2′-O-methyl and/or 2′-O-methoxyethyl ribose. The polynucleic acid polymer may also include morpholinos, PNAs, HNA, methylphosphonate nucleotides, thiolphosphonate nucleotides, or 2′-fluoro N3-P5′-phosphoramidites to increase its stability. Suitable modifications to the RNA to increase stability for delivery will be apparent to the skilled person.
A polynucleic acid polymer described herein can be constructed using chemical synthesis and/or enzymatic ligation reactions using procedures known in the art. For example, a polynucleic acid polymer can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the polynucleic acid polymer and target nucleic acids. Exemplary methods can include those described in: U.S. Pat. Nos. 5,142,047; 5,185,444; WO2009099942; or EP1579015. Additional exemplary methods can include those described in: Griffey et al., “2′-O-aminopropyl ribonucleotides: a zwitterionic modification that enhances the exonuclease resistance and biological activity of antisense oligonucleotides,” J. Med. Chem. 39(26):5100-5109 (1997)); Obika, et al., “Synthesis of 2′-0,4′-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C3, -endo sugar puckering”. Tetrahedron Letters 38 (50): 8735(1997); Koizumi, M. “ENA oligonucleotides as therapeutics”. Current opinion in molecular therapeutics 8 (2): 144-149 (2006); and Abramova et al., “Novel oligonucleotide analogues based on morpholino nucleoside subunits-antisense technologies: new chemical possibilities,” Indian Journal of Chemistry 48B:1721-1726 (2009). Alternatively, the polynucleic acid polymer can be produced biologically using an expression vector into which a polynucleic acid polymer has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted polynucleic acid polymer will be of an antisense orientation to a target polynucleic acid polymer of interest).
A polynucleic acid polymer may be bound to any nucleic acid molecule, such as another antisense molecule, a peptide, or other chemicals to facilitate delivery of the polynucleic acid polymer and/or target the nucleic acid to a specific tissue, cell type, or cell developmental stage. The polynucleic acid polymer may be bound to a protein or RNA. The protein tethered to the polynucleic acid polymer may comprise a splicing factor to enhance, inhibit or modulate splicing and intron removal. RNA tethered to the polynucleic acid polymer may comprise an aptamer or any structure that enhance, inhibit or modulate splicing and intron removal. The polynucleic acid polymer may be isolated nucleic acid.
A polynucleic acid polymer may be conjugated to, or bound by, a delivery vehicle suitable for delivering the polynucleic acid polymer to cells. The cells may be a specific cell type, or specific developmental stage. The delivery vehicle may be capable of site specific, tissue specific, cell specific or developmental stage-specific delivery. For example, the delivery vehicle may be a cell specific viral particle, or component thereof, alternatively, the delivery vehicle may be a cell specific antibody particle, or component thereof. The polynucleic acid polymer may be targeted for delivery to beta cells in the pancreas. The polynucleic acid polymer may be targeted for delivery to thymic cells. The polynucleic acid polymer may be targeted for delivery to malignant cells. The polynucleic acid polymer may be targeted for delivery to pre-malignant cells (that are known to develop into overt malignant phenotypes within a foreseeable future, such as pre-leukemias and myelodysplastic syndromes or histopathologically defined precancerous lesions or conditions.
A polynucleic acid polymer may be conjugated to, or bound by, a nanoparticle-based delivery vehicle. A nanoparticle may be a metal nanoparticle, e.g., a nanoparticle of scandium, titanium, vanadium, chromium, manganese, iron, cobalt, nickel, copper, zinc, yttrium, zirconium, niobium, molybdenum, ruthenium, rhodium, palladium, silver, cadmium, hafnium, tantalum, tungsten, rhenium, osmium, iridium, platinum, gold, gadolinium, aluminum, gallium, indium, tin, thallium, lead, bismuth, magnesium, calcium, strontium, barium, lithium, sodium, potassium, boron, silicon, phosphorus, germanium, arsenic, antimony, and combinations, alloys or oxides thereof. Sometimes a nanoparticle may be prepared from polymeric materials. Illustrative polymeric materials include, but are not limited to, poly(ethylenimine) (PEI), poly(alkylcyanoacrylates), poly(amidoamine) dendrimers (PAMAM), poly(ε-caprolactone) (PCL), poly(lactic-co-glycolic acid) (PLGA), or polyesters (poly(lactic acid) (PLA). Sometimes a nanoparticle may be further coated with molecules for attachment of functional elements. In some cases, a coating comprises chondroitin sulfate, dextran sulfate, carboxymethyl dextran, alginic acid, pectin, carragheenan, fucoidan, agaropectin, porphyran, karaya gum, gellan gum, xanthan gum, hyaluronic acids, glucosamine, galactosamine, chitin (or chitosan), polyglutamic acid, polyaspartic acid, lysozyme, cytochrome C, ribonuclease, trypsinogen, chymotrypsinogen, α-chymotrypsin, polylysine, polyarginine, histone, protamine, graphene, ovalbumin or dextrin or cyclodextrin. A nanoparticle may include a core or a core and a shell, as in a core-shell nanoparticle. Sometimes, a nanoparticle may have at least one dimension of less than about 500 nm, 400 nm, 300 nm, 200 nm, or 100 nm.
In some embodiments, a polynucleic acid polymer may be formulated with a nanoparticle-based delivery vehicle for delivery to a site of interest (e.g., a malignant tissue site or a cell with deregulated protein expression). In some cases, a polynucleic acid polymer may be formulated with a nanoparticle-based delivery vehicle to facilitate and/or enable transport across the blood-brain barrier (BBB).
Sometimes, a polynucleic acid polymer is coupled to a substance, known in the art to promote penetration or transport across the blood-brain barrier, e.g., an antibody to the transferrin receptor. In some embodiments, the polynucleic acid polymer is linked with a viral vector, e.g., to render the compound more effective or increase transport across the blood-brain barrier. In some embodiments, osmotic blood brain barrier disruption is assisted by infusion of sugars, e.g., meso erythritol, xylitol, D(+) galactose, D(+) lactose, D(+) xylose, dulcitol, myo-inositol, L(−) fructose, D(−) mannitol, D(+) glucose, D(+) arabinose, D(−) arabinose, cellobiose, D(+) maltose, D(+) raffinose, L(+) rhamnose, D(+) melibiose, D(−) ribose, adonitol, D(+) arabitol, L(−) arabitol, D(+) fucose, L(−) fucose, D(−) lyxose, L(+) lyxose, and L(−) lyxose, or amino acids, e.g., glutamine, lysine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glycine, histidine, leucine, methionine, phenylalanine, proline, serine, threonine, tyrosine, valine, and taurine. Methods and materials for enhancing blood brain barrier penetration are described, e.g., in U.S. Pat. Nos. 4,866,042, 6,294,520 and 6,936,589, each incorporated herein by reference.
In one embodiment the polynucleic acid polymer may be bound to a chemical molecule (e.g., non-peptide or nucleic acid based molecule), such as a drug. The drug may be a small molecule (e.g., having a MW of less than 900 Da).
In one embodiment of the invention, the delivery vehicle may comprise a cell penetrating peptide (CPP). For example, the polynucleic acid polymer may be bound or complexed with a CPP. The skilled person will understand that any suitable CPP may be conjugated with the polynucleic acid polymer to aid delivery of the polynucleic acid polymer to and/or into cells. Such CPPs may be any suitable CPP technology described by Boisguerin et al., Advanced Drug Delivery Reviews (2015), which is herein incorporated by reference. Suitable delivery vehicles for conjugation to the polynucleic acid polymer are also described in Lochmann et al., ((European Journal of Pharmaceutics and Biopharmaceutics 58 (2004) 237-251), which is herein incorporated by reference).
The CPP may be an arginine and/or lysine rich peptide, for example, wherein the majority of residues in the peptide are either lysine or arginine. The CPP may comprise a poly-L-lysine (PLL). Alternatively, the CPP may comprise a poly-arginine. Suitable CPPs may be selected from the group comprising Penetratin; R6-Penetratin (“R6” disclosed as SEQ ID NO: 120); Transportan; oligo-arginines; F-3; B-peptide; B-MSP; Pip peptides, such as Pip1, Pip2a, Pip2b, Pip5e, Pip5f, Pip5h, Pip5j; Pip5k, Pip5l, Pip5m, Pip5n, Pip5o, Pip6a, Pip6b, Pip6c, Pip6d, Pip6e, Pip6f, Pip6g, or Pip6h; peptide of sequence PKKKRKV (SEQ ID NO: 121); Penatratin; Lys4; SPACE; Tat; Tat-DRBD (dsRNA-binding domain); (RXR)4 (SEQ ID NO: 122); (RFF)3RXB (SEQ ID NO: 123); (KFF)3K (SEQ ID NO: 124); RgF2; T-cell derived CPP; Pep-3; PEGpep-3; MPG-8; MPG-8-Chol; PepFect6; P5RHH; R15 (SEQ ID NO: 125); and Chol-R9 (“R9” disclosed as SEQ ID NO: 126); or functional variants thereof (e.g., see Boisguerin et al., Advanced Drug Delivery Reviews (2015)).
In one embodiment, the CPP comprises or consists of a Pip peptide. The Pip peptide may be selected from the group comprising Pip1, Pip2a, Pip2b, Pip5e, Pip5f, Pip5h, Pip5j; Pip5k, Pip5l, Pip5m, Pip5n, Pip5o, Pip6a, Pip6b, Pip6c, Pip6d, Pip6e, Pip6f, Pip6g, and Pip6h.
In one embodiment of the invention, the delivery vehicle may comprise a peptide-based nanoparticle (PBN), wherein a plurality of CPPs (for example one or more suitable CPPs discussed herein) form a complex with the polynucleic acid polymer through charge interactions. Such nanoparticles may be between about 50 nm and 250 nm in size. In one embodiment the nanoparticles may be about 70-200 nm in size. In another embodiment the nanoparticles may be about 70-100 nm in size or 125-200 nm in size.
In one embodiment, the polynucleic acid polymer may be complexed with a delivery vehicle, for example by ionic bonding. Alternatively, the polynucleic acid polymer may be covalently bound to the delivery vehicle. Conjugation/binding methods are described in Lochmann et al., ((European Journal of Pharmaceutics and Biopharmaceutics 58 (2004) 237-251), which is herein incorporated by reference). For example, a conjugation method may comprise introducing a suitable tether containing a reactive group (e.g., —NH2 or —SH2) to the polynucleic acid polymer and to add the delivery vehicle, such as a peptide, post-synthetically as an active intermediate, followed by carrying out the coupling reaction in aqueous medium. An alternative method may comprise carrying out the conjugation in a linear mode on a single solid-phase support.
The delivery vehicle and polynucleic acid polymer may be thiol and/or maleimide linked, such as thiol-maleimide linked. The conjugation of the polynucleic acid polymer and the delivery vehicle may be by click-chemistry, such as reaction of azido or 2′-O-propyargyl functional groups and alkyne groups on the respective molecules to be conjugated. In one embodiment, the delivery vehicle and polynucleic acid polymer may be linked by a thioether bridge. In another embodiment, the delivery vehicle and polynucleic acid polymer may be linked by a disulphide bridge. The skilled person will readily identify suitable linking groups or reactions for conjugation of polynucleic acid polymer and the delivery vehicle, such as a peptide.
In one embodiment the NSE repressor agent may comprise an SSO of the sequence cuucuaugcagccaaccuguagacu (SSO-NSE3) (SEQ ID NO: 53), or a nucleic acid analogue thereof. In one embodiment the NSE repressor agent may comprise an SSO of the sequence accuuuuucuucuaugcagccaac (SSO-NSE5) (SEQ ID NO: 54), or a nucleic acid analogue thereof. The skilled person will note that NSE3 (cuucuaugcagccaaccuguagacu) (SEQ ID NO: 53) and NSE5 (accuuuuucuucuaugcagccaac) (SEQ ID NO: 54) overlap in sequence. In one embodiment, the NSE repressor agent may comprise an SSO having a sequence of, or within, this overlapping sequence (i.e. accuuuuucuucuaugcagccaaccuguagacu) (SEQ ID NO: 55).
In one embodiment, the NSE repressor or activator agent comprises or consists of any one SSO selected from the group comprising:
-
- or combinations thereof.
In another embodiment, the NSE activator agent comprises or consists of any one SSO selected from the group comprising:
-
- or combinations thereof.
The NSE activator agent may comprise or consist of an SSO of the sequence aacuuaaagguuauaucuc (SSO A2) (SEQ ID NO: 18). The NSE activator agent may comprise or consist of an SSO of the sequence uauaaauacgaauaaaucga (SSO A4) (SEQ ID NO: 19). The NSE activator agent may comprise or consist of an SSO of the sequence caacacgacauaaccaaa (SSO A9) (SEQ ID NO: 21). The NSE activator agent may comprise or consist of an SSO of the sequence gguaugagaacuauagga (SSO A23) (SEQ ID NO: 32). The NSE activator agent may comprise or consist of an SSO of the sequence gguaauaagugucacaaa (SSO A25) (SEQ ID NO: 34). The NSE activator agent may comprise or consist of an SSO of the sequence guaucauacauuagaagg (SSO A26) (SEQ ID NO: 35). The NSE activator agent may comprise or consist of an SSO of the sequence uguggggugaccacagcuu (SSO B11) (SEQ ID NO: 45).
In one embodiment the NSE-activator agent may comprise the SSO PEkr herein described. In one embodiment the NSE-activator agent may comprise an SSO of the sequence CUGUAAAAGAAAAUAGA (PEkr) (SEQ ID NO: 56). PEkr may also be referred to as PEdel and it is understood that these terms are interchangeable.
In one embodiment, the NSE repressor agent comprises or consists of any one SSO selected from the group comprising:
or combinations thereof.
The NSE repressor agent may comprise or consist of an SSO of the sequence cuucuaugcagccaaccuguagacu (SSO-NSE3) (SEQ ID NO: 53). The NSE repressor agent may comprise or consist of an SSO of the sequence accuuuuucuucuaugcagccaac (SSO-NSE5) (SEQ ID NO: 54). The NSE repressor agent may comprise or consist of an SSO of the sequence aacauuucuauuuaguuaaaagc (SSO All) (SEQ ID NO: 23). The NSE repressor agent may comprise or consist of an SSO of the sequence uuaguauuccuugacuuua (SSO A17) (SEQ ID NO: 26). The NSE repressor agent may comprise or consist of an SSO of the sequence gacugguaaauaauaaacauaauuc (SSO B2) (SEQ ID NO: 37). The NSE repressor agent may comprise or consist of an SSO of the sequence auauauuagagauacaucagcc (SSO B4) (SEQ ID NO: 39). The NSE repressor agent may comprise or consist of an SSO of the sequence uuagagaaucauuuuaaauaagac (SSO AN3) (SEQ ID NO: 51).
In one embodiment the NSE repressor agent, such as an SSO, may be arranged to bind to guanine variant residue at rs4988000.
The skilled person will understand that combinations of two or more SSOs described herein may be provided and/or used for treatment. For example, combinations of two, three, four, five or more NSE repressor agents may be provided or combinations of two, three, four, five or more NSE activating agents may be provided.
Where reference is made to reducing NSE inclusion in the mature RNA, the reduction may be complete, e.g., 100%, or may be partial. The reduction may be clinically significant. The reduction/correction may be relative to the level of NSE inclusion in the subject without treatment, or relative to the amount of NSE inclusion in a population of similar subjects. The reduction/correction may be at least 10% less NSE inclusion relative to the average subject, or the subject prior to treatment. The reduction may be at least 20% less NSE inclusion relative to an average subject, or the subject prior to treatment. The reduction may be at least 40% less NSE inclusion relative to an average subject, or the subject prior to treatment. The reduction may be at least 50% less NSE inclusion relative to an average subject, or the subject prior to treatment. The reduction may be at least 60% less NSE inclusion relative to an average subject, or the subject prior to treatment. The reduction may be at least 80% less NSE inclusion relative to an average subject, or the subject prior to treatment. The reduction may be at least 90% less NSE inclusion relative to an average subject, or the subject prior to treatment.
Where reference is made to increasing active-ATM protein levels, the increase may be clinically significant. The increase may be relative to the level of active-ATM protein in the subject without treatment, or relative to the amount of active-ATM protein in a population of similar subjects. The increase may be at least 10% more active-ATM protein relative to the average subject, or the subject prior to treatment. The increase may be at least 20% more active-ATM protein relative to the average subject, or the subject prior to treatment. The increase may be at least 40% more active-ATM protein relative to the average subject, or the subject prior to treatment. The increase may be at least 50% more active-ATM protein relative to the average subject, or the subject prior to treatment. The increase may be at least 80% more active-ATM protein relative to the average subject, or the subject prior to treatment. The increase may be at least 100% more active-ATM protein relative to the average subject, or the subject prior to treatment. The increase may be at least 200% more active-ATM protein relative to the average subject, or the subject prior to treatment. The increase may be at least 500% more active-ATM protein relative to the average subject, or the subject prior to treatment.
The terms active-ATM and functional-ATM may be used interchangeably herein.
According to another aspect of the invention, there is provided use of rs609261 genotyping to predict a subject response to therapy for conditions associated with ATM deregulation.
The conditions associated with ATM deregulation may comprise A-T or cancer.
In one embodiment, the presence of an rs609261 cytosine residue is associated with a higher NSE activation, less efficient response of ATM to DNA double-strand break signaling, a higher cancer risk and lower survival relative to non-cytosine residue at the same position.
According to another aspect of the invention, there is provided a composition comprising the NSE repressor agent of the invention herein.
According to another aspect of the invention, there is provided a composition comprising the NSE activator agent of the invention herein.
In one embodiment, the composition is a pharmaceutically acceptable formulation.
The composition may comprise at least one other biologically active molecule in addition to the polynucleic acid polymer. The biologically active molecule may be drug or a pro-drug. The biologically active molecule may comprise nucleic acid or amino acid. The biologically active molecule may comprise a small molecule (e.g., a molecule of <900 Daltons).
In some embodiments, pharmaceutical formulations described herein are administered to a subject by an enteral administration route, by a parenteral administration route, or by a topical administration route. In some cases, pharmaceutical formulations described herein are administered to a subject by an enteral administration route. In other cases, pharmaceutical formulations described herein are administered to a subject by a parenteral administration route. In additional cases, pharmaceutical formulations described herein are administered to a subject by a topical administration route.
Illustrative administration routes include, but are not limited to, parenteral (e.g., intravenous, subcutaneous, intramuscular, intra-arterial, intracranial, intracerebral, intracerebroventricular, intrathecal, or intravitreal), oral, intranasal, buccal, topical, rectal, transmucosal, or transdermal administration routes. In some instances, the pharmaceutical composition describe herein is formulated for parenteral (e.g., intravenous, subcutaneous, intramuscular, intra-arterial, intracranial, intracerebral, intracerebroventricular, intrathecal, or intravitreal) administration. In other instances, the pharmaceutical composition describe herein is formulated for oral administration. In still other instances, the pharmaceutical composition describe herein is formulated for intranasal administration.
Pharmaceutical formulations described herein may include, but are not limited to, aqueous liquid dispersions, self-emulsifying dispersions, solid solutions, liposomal dispersions, aerosols, solid dosage forms, powders, immediate release formulations, controlled release formulations, fast melt formulations, tablets, capsules, pills, delayed release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations, and mixed immediate and controlled release formulations.
Pharmaceutical formulations may include a carrier or carrier materials which may include any commonly used excipients in pharmaceutics and should be selected on the basis of compatibility with the composition disclosed herein, and the release profile properties of the desired dosage form. Exemplary carrier materials include, e.g., binders, suspending agents, disintegration agents, filling agents, surfactants, solubilizers, stabilizers, lubricants, wetting agents, diluents, and the like. Pharmaceutically compatible carrier materials may include, but are not limited to, acacia, gelatin, colloidal silicon dioxide, calcium glycerophosphate, calcium lactate, maltodextrin, glycerin, magnesium silicate, polyvinylpyrrollidone (PVP), cholesterol, cholesterol esters, sodium caseinate, soy lecithin, taurocholic acid, phosphotidylcholine, sodium chloride, tricalcium phosphate, dipotassium phosphate, cellulose and cellulose conjugates, sugars sodium stearoyl lactylate, carrageenan, monoglyceride, diglyceride, pregelatinized starch, and the like. Liposomes can include sterically stabilized liposomes, e.g., liposomes comprising one or more specialized lipids. These specialized lipids can result in liposomes with enhanced circulation lifetimes. Sometimes, a sterically stabilized liposome can comprise one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. See, e.g., Remington: The Science and Practice of Pharmacy, Nineteenth Ed (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, H. A. and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y., 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Ed. (Lippincott Williams & Wilkins 1999).
According to another aspect of the invention, there is provided a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising identifying the presence of a non-thymine variant residue rs609261 located at position −3 relative to the 3′ splice site of NSE (cryptic exon in ATM intron 28) of the human genome, wherein the presence of a non-thymine variant residue rs609261 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and administration of an agent to the subject, which is arranged to replace the non-thymine variant residue rs609261 with a thymine residue.
According to another aspect of the invention, there is provided a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising replacing a non-thymine variant residue rs609261 located at position −3 relative to the 3′ splice site of NSE (cryptic exon in ATM intron 28) of the human genome with a thymine residue.
In one embodiment, replacing the non-thymine variant residue rs609261 may comprise administration of an agent to the subject, which is arranged to replace the non-thymine variant residue rs609261 with a thymine residue.
The agent for replacement of the non-thymine residue may be a genomic editing molecule, such as CRISPR-Cas9, or a functional equivalent thereof, together with an appropriate RNA molecule arranged to target rs609261.
According to another aspect of the invention, there is provided a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising identifying the presence of a guanine variant residue at rs4988000 of the human genome, wherein the presence of a guanine variant residue at rs4988000 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and administration of an agent to the subject, which is arranged to replace the guanine variant residue at rs4988000 with adenine.
According to another aspect of the invention, there is provided a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising replacing a guanine variant residue at rs4988000 of the human genome with an adenine residue.
In one embodiment, replacing the guanine variant residue at rs4988000 may comprise administration of an agent to the subject, which is arranged to replace the guanine variant residue at rs4988000 with an adenine residue.
The agent for replacement of the guanine residue may be a genomic editing molecule, such as CRISPR-Cas9, or a functional equivalent thereof, together with an appropriate RNA molecule arranged to target rs4988000.
According to a first aspect of the invention, there is provided a method of screening a subject or a population of subjects for susceptibility to functional-ATM protein deficiency, wherein the screening comprises determining the presence of a guanine variant residue at rs4988000 of the human genome, wherein the presence of a guanine variant residue at rs4988000 indicates that the subject (or group of subjects) has, or is susceptible to, functional-ATM protein deficiency.
According to another aspect of the invention, there is provided a method of selecting a subject or a population of subjects for treatment or prophylaxis, wherein the subject is susceptible to functional-ATM protein deficiency, the method comprising determining the presence of a guanine variant residue at rs4988000 of the human genome, wherein the presence of a guanine variant residue at rs4988000 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and selecting such subject for treatment with an agent arranged to increase functional-ATM levels in the subject.
According to another aspect of the invention, there is provided a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising identifying the presence of a guanine variant residue at rs4988000 of the human genome, wherein the presence of a guanine variant residue at rs4988000 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and administration of an agent to the subject, which is arranged to increase functional-ATM levels.
The methods of the invention herein may comprise blocking a guanine variant residue at rs4988000, for example using an SSO.
PE contains a natural DNA variant rs4988000 (G/A), which also influences NSE recognition (
The highest NSE inclusion is produced by the haplotype that is most frequent in Caucasians (CG), followed by haplotypes CA>TG>TA (referring tors609261 and rs4988000 respectively). Therefore, the methods and compositions of the invention may be used in combination (concurrently or sequentially) to modify a CG haplotype to CA, TG, or TA. In one embodiment, the methods and compositions of the invention may be used to modify a CG haplotype to TA. In one embodiment, the methods and compositions of the invention may be used to modify a CA haplotype to TG or TA. In one embodiment, the methods and compositions of the invention may be used to modify a CA haplotype to TA. In one embodiment, the methods and compositions of the invention may be used to modify a TG haplotype to TA.
The methods and compositions of the invention may also be used in combination (concurrently or sequentially) to identify a CG haplotype in a subject, and optionally treat or select the patient according to the invention. The methods and compositions of the invention may also be used in combination (concurrently or sequentially) to identify a CA haplotype in a subject, and optionally treat or select the patient according to the invention. The methods and compositions of the invention may also be used in combination (concurrently or sequentially) to identify a TG haplotype in a subject, and optionally treat or select the patient according to the invention.
According to another aspect of the invention, there is provided a method of modifying regulation of NSE inclusion in a mature RNA transcript, the method comprising the insertion or deletion of one or more splicing regulatory motifs upstream or downstream of the NSEs that compete with the NSE for spliceosomal components, said regulatory motifs comprising cryptic splice sites or pseudo-exons.
According to another aspect of the invention, there is provided a method of modifying regulation of a functional protein expression, wherein the functional protein expression is regulated by NSE inclusion in a mature RNA transcript of the gene encoding protein, the method comprising the insertion or deletion of one or more splicing regulatory motifs upstream or downstream of the NSE that compete with the NSE for spliceosomal components, said regulatory motifs comprising cryptic splice sites or pseudo-exons.
In one embodiment, the insertion or deletion of one or more splicing regulatory motifs is in genomic DNA of ATM intron 28.
The insertion of one or more splicing regulatory motifs may cause a reduction in NSE inclusion in the mature RNA transcript. The deletion of one or more splicing regulatory motifs may cause an increase in NSE inclusion in the mature RNA transcript.
The insertion or deletion of one or more splicing regulatory motifs may comprise the use of genome editing technology, such as CRISPR-Cas9. CRISPR-Cas9 may be provided with an appropriate targeting RNA molecule.
The subject or cells that are treated or screened according to the invention may be mammalian. In one embodiment, the subject is a human. In one embodiment, the cells are human.
Kits and articles of manufacture are provided herein for use with one or more methods described herein. The kits can contain one or more of the polynucleic acid polymers described herein.
According to another aspect of the invention, there is provided a kit comprising one or more oligonucleotide probes for identifying rs609261 and/or rs4988000 variants.
The skilled person will be familiar with techniques for probing the presence or absence of genetic sequence features. For example, the oligonucleotide probes may comprise primers for use in PCR amplifying a region of a nucleic acid comprising rs609261 and/or rs4988000. In another embodiment the oligonucleotide probes may directly bind rs609261 or rs4988000, wherein the binding may be detectable. The binding of the probe may be detectable for example using SERS or SERRS technology.
The kits can also include a carrier, package, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements, such as the polynucleic acid polymers and reagents, to be used in a method described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers can be formed from a variety of materials such as glass or plastic.
The articles of manufacture provided herein contain packaging materials. Examples of pharmaceutical packaging materials include, but are not limited to, bottles, tubes, bags, containers, bottles, and any packaging material suitable for a selected formulation and intended mode of administration and treatment.
A kit typically includes labels listing contents and/or instructions for use, and package inserts with instructions for use. A set of instructions will also typically be included.
According to another aspect of the invention, there is provided a vector comprising the polynucleic acid polymer of the invention.
The vector may comprise a viral vector. The viral vector may comprise adeno-associated viral vector. The vector may comprise any virus that targets the polynucleic acid polymer to malignant cells or specific cell type.
IndicationsIn some instances, compositions and methods described herein are used to treat a genetic disorder or condition such as a hereditary disease. Compositions and methods described herein can be used to treat a genetic disorder or condition such as a hereditary disease that is characterized by an impaired production of a protein. Compositions and methods described herein can be used to treat a genetic disorder or condition such as a hereditary disease that is characterized by a defective splicing.
Compositions and methods described herein can also be used to treat a genetic disorder or condition such as an autosomal dominant disorder, an autosomal recessive disorder, X-linked dominant disorder, X-linked recessive disorder, Y-linked disorder, mitochondrial disease, or multifactorial or polygenic disorder. Compositions and methods described herein can be used to treat an autosomal dominant disorder, an autosomal recessive disorder, X-linked dominant disorder, X-linked recessive disorder, Y-linked disorder, mitochondrial disease, or multifactorial or polygenic disorder, in which the disorder or condition is characterized by an impaired production of a protein. Compositions and methods described herein can also be used to treat an autosomal dominant disorder, an autosomal recessive disorder, X-linked dominant disorder, X-linked recessive disorder, Y-linked disorder, mitochondrial disease, or multifactorial or polygenic disorder, in which the disorder or condition is characterized by a defective splicing.
The condition associated with deregulated ATM expression may comprise cancer. Compositions and methods described herein can be used to treat cancer. In one embodiment the cancer comprises breast cancer. Cancer can be a solid tumor or a hematologic malignancy. A solid tumor can be a sarcoma or a carcinoma. Sarcoma can be a cancer of bone, cartilage, fat muscle, vascular or hematopoietic tissues. Exemplary sarcoma can include alveolar rhabdomyosarcoma, alveolar soft part sarcoma, ameloblastoma, angiosarcoma, chondrosarcoma, chordoma, clear cell sarcoma of soft tissue, dedifferentiated liposarcoma, desmoid, desmoplastic small round cell tumor, embryonal rhabdomyosarcoma, epithelioid fibrosarcoma, epithelioid hemangioendothelioma, epithelioid sarcoma, esthesioneuroblastoma, Ewing sarcoma, extrarenal rhabdoid tumor, extraskeletal myxoid chondrosarcoma, extraskeletal osteosarcoma, fibrosarcoma, giant cell tumor, hemangiopericytoma, infantile fibrosarcoma, inflammatory myofibroblastic tumor, Kaposi sarcoma, leiomyosarcoma of bone, liposarcoma, liposarcoma of bone, malignant fibrous histiocytoma (MFH), malignant fibrous histiocytoma (MFH) of bone, malignant mesenchymoma, malignant peripheral nerve sheath tumor, mesenchymal chondrosarcoma, myxofibrosarcoma, myxoid liposarcoma, myxoinflammatory fibroblastic sarcoma, neoplasms with perivascular epitheioid cell differentiation, osteosarcoma, parosteal osteosarcoma, neoplasm with perivascular epitheioid cell differentiation, periosteal osteosarcoma, pleomorphic liposarcoma, pleomorphic rhabdomyosarcoma, PNET/extraskeletal Ewing tumor, rhabdomyosarcoma, round cell liposarcoma, small cell osteosarcoma, solitary fibrous tumor, synovial sarcoma, telangiectatic osteosarcoma.
Carcinoma can be a cancer developed from epithelial cells. Exemplary carcinoma can include adenocarcinoma, squamous cell carcinoma, adenosquamous carcinoma, anaplastic carcinoma, large cell carcinoma, small cell carcinoma, anal cancer, appendix cancer, bile duct cancer (i.e., cholangiocarcinoma), bladder cancer, brain tumor, breast cancer, cervical cancer, colon cancer, cancer of Unknown Primary (CUP), esophageal cancer, eye cancer, fallopian tube cancer, gastroenterological cancer, kidney cancer, liver cancer, lung cancer, medulloblastoma, melanoma, oral cancer, ovarian cancer, pancreatic cancer, parathyroid disease, penile cancer, pituitary tumor, prostate cancer, rectal cancer, skin cancer, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, vaginal cancer, or vulvar cancer. Hematologic malignancy is a malignancy of the blood system and can include T-cell based and B-cell based malignancies. Exemplary hematologic malignancy can include myeloid leukemia, myeloproliferative neoplasias, peripheral T-cell lymphoma not otherwise specified (PTCL-NOS), anaplastic large cell lymphoma, angioimmunoblastic lymphoma, cutaneous T-cell lymphoma, adult T-cell leukemia/lymphoma (ATLL), blastic NK-cell lymphoma, enteropathy-type T-cell lymphoma, hematosplenic gamma-delta T-cell lymphoma, lymphoblastic lymphoma, nasal NK/T-cell lymphomas, treatment-related T-cell lymphomas, chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), high risk CLL, non-CLL/SLL lymphoma, prolymphocytic leukemia (PLL), follicular lymphoma (FL), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), Waldenstrom's macroglobulinemia, multiple myeloma, extranodal marginal zone B cell lymphoma, nodal marginal zone B cell lymphoma, Burkitt's lymphoma, non-Burkitt high grade B cell lymphoma, primary mediastinal B-cell lymphoma (PMBL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma, B cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, plasma cell myeloma, plasmacytoma, mediastinal (thymic) large B cell lymphoma, intravascular large B cell lymphoma, primary effusion lymphoma, or lymphomatoid granulomatosis.
According to another aspect of the invention, there is provided a method of a treatment or prevention of a disease pathology caused by an NSE inclusion in a pre-mRNA gene transcript comprising providing an agent arranged to bind to a cryptic splice site of a pseudoexon present on the pre-mRNA gene transcript, wherein the cryptic splice site is capable of regulating inclusion of a nonsense-mediated RNA decay switch exon (NSE) into a mature RNA transcript of the gene.
Wherein the binding of the agent to the cryptic splice site of the pseudoexon present on the pre-mRNA gene transcript reduces the NSE inclusion.
The method may comprise a step of determining if a disease pathology is caused by an NSE inclusion in a gene transcript prior to treatment.
The skilled person will understand that optional features of one embodiment or aspect of the invention may be applicable, where appropriate, to other embodiments or aspects of the invention.
EXAMPLESEmbodiments of the invention will now be described in more detail, by way of example only, with reference to the accompanying figures. These examples are provided for illustrative purposes only and not to limit the scope of the claims provided herein.
Abbreviations
-
- NSE nonsense-mediated RNA decay switch exon in ATM intron 28
- PE a 24-nt pseudoexon located 3′ of NSE in ATM intron 28
- NMD nonsense-mediated RNA decay
- A-T ataxia-telangiectasia
- ATM gene deficient in ataxia-telangiectasia
- SSO splice-switching oligonucleotide
- DSB double-strand DNA break
- DDR DNA damage response
- MIR mammalian-wide interspersed repeat
- BPS branch point sequence
- PPT polypyrimidine tract
- IR ionizing radiation
- U2AF auxiliary factor of U2 small nuclear ribonucleoprotein
- U2AF35 a 35-kD subunit of U2AF encoded by U2AF1
- U2AF65 a 65-kD subunit of U2AF encoded by U2AF2
- snRNA small nuclear RNAs
Summary
Phenotypic diversity and susceptibility to genetic disease is influenced by natural intronic variants, but their interactions with RNA-binding proteins are largely unknown. Here a single-nucleotide polymorphism in a detained ATM intron was shown to gain functionality in cells lacking the auxiliary factor of U2 small nuclear ribonucloprotein (U2AF). Each U2AF subunit was required for repression of a nonsense-mediated RNA decay switch exon (NSE) in ATM intron 28. NSE was activated to a greater degree in the presence of cytosine than thymine at rs609261 located at position −3 relative to the NSE 3′ splice site. The cytosine allele, which is predominant in Caucasians, resulted in a more efficient NSE-mediated inhibition of ATM expression than thymine, the principal allele in Asian populations. NSE activation was deregulated in leukemic cells and was influenced by the amino acid identity at U2AF35 residue 34. Exploiting competition between NSE and a downstream pseudoexon, splice-switching oligonucleotides (SSOs) that repress or activate NSE to modulate ATM expression were identified. Using RNA-Seq, U2AF-regulated exon usage in the ATM signaling pathway was shown to be centered on the MRN/ATM-CHEK2-CDC25-cdc2/cyclin B axis and that U2AF preferentially controls RNA processing of transcripts involved in cancer-associated fusions and chromosomal translocations. These results reveal important links between 3′ splice-site control and ATM-dependent response to double strand DNA breaks, illustrate functional plasticity of intronic variants in response to RNA-binding factors, demonstrate versatility of SSOs to modify gene expression by targeting pseudo-splice sites in introns and may explain ethnic differences in cancer risk and survival.
Introduction
Here, U2AF was shown to repress a nonsense-mediated decay (NMD) switch exon (NSE) in the ATM gene (ataxia-telangiectasia, A-T, mutated) and other proteins involved in 3′ss recognition that regulate NSE inclusion in mature transcripts were identified. The extent to which this event limits ATM expression depends on a common C/T variant rs609261 located in the NSE 3′ss consensus deep in intron 28. Also identified are intronic cis-elements that control NSE inclusion in mature transcripts and splice-switching oligonucleotides (SSOs) that modulate NSE activation by targeting a competing pseudoexon in the same intron. Using RNA-Seq, it was next shown that the U2AF-mediatedregulation of DNA damage response (DDR) pathway is centered on the ATM-CHEK2-CDC25-cdc2/cyclin B axis, suggesting that it has coevolved with cellular responses to double-strand DNA breaks (DSBs). Finally, a preferential involvement of U2AF-regulated transcripts is demonstrated in cancer-associated gene fusions and chromosome translocations.
Results
Identification of a U2AF-Repressed Cryptic Exon in ATMIt has been recently shown that depletion of each U2AF subunit resulted in down- and upregulation of a large number of exons that were predominantly alternatively spliced. When inspecting global RNA processing changes in cells depleted of U2AF35, an unexpectedly strong activation of a cryptic, 29-nt ATM exon that was not annotated by RefSeq (termed NSE,
Examination of genomic sequences surrounding NSE revealed that position −3 relative to the NSE 3′ss is polymorphic (rs609261,
To test whether the allele-specific NSE usage results in differential protein expression in cells lacking U2AF35, DNA was first sequenced from available cell lines across rs609261 to obtain transfectable cells homozygous for each allele. HEK293 cells were found to be homozygous for the C allele and HeLa cells were homozygous for the T allele (
Because U2AF-repressed and -activated exons show preferential responses to U2AF-related proteins, HEK293 cells were depleted of PUF60 and CAPERa, and several heterogeneous nuclear RNPs, including hnRNP A1. PUF60 interacts with uridine-rich motifs at 3′ss and hnRNP A1 forms a ternary complex with the U2AF heterodimer on AG-containing U-rich RNAs. Depletion of either PUF60 or hnRNP A1 increased NSE inclusion (
To test if NSE activation in cells lacking U2AF can be repressed to restore ATM expression, the C-allele reporter construct was individually cotransfected with SSOs targeting each NSE splice site (
Whether the NSE 3′ss SSO can increase ATM protein expression and activation in cells exposed to ionizing radiation (IR) was next examined. The low ATM expression in cells lacking U2AF35 was partially rescued by this SSO, both in unexposed and IR-exposed cells (lanes 1 vs 2 and 5 vs 6,
Taken together, NSE activation was efficiently inhibited by SSOs that block access to NSE splice sites and do not support RNase H cleavage. The more efficient SSO partially rescued the NSE-mediated inhibition of ATM.
Activation of a NMD Switch Exon is Influenced by a Downstream PseudoexonTo identify intronic regulatory cis-elements that control NSE inclusion in mature transcripts, a previously reported A-T mutation IVS28-159A>G was utilized. This mutation was observed to activate the NSE 3′ss while repressing its 5′ss and promoting a downstream 5′ss instead, introducing a 112-nt cryptic exon in the mRNA. There is a strong 3′ss consensus preceded by optimal BPS/PPT motifs observed within this exon, which may bind U2AF and activate a smaller, 24-nt pseudoexon (termed PE;
To test if NSE inactivation can influence PE inclusion in mRNA, the NSE 3′ss was first eliminated. This mutation activated a cryptic 3′ss 7-nt downstream of the authentic NSE 3′ss (lanes 1, 2 and 6, 7,
Next, the MIR reporter was employed to test the impact of NSE and PE SSOs on exon usage and ATM expression.
PE contains a natural DNA variant rs4988000 (G/A), which may also influence NSE recognition (
Taken together, the haplotype-dependent activation of the U2AF-repressed NSE can be modified by SSOs that target U2AF65 intronic binding sites upstream of competing pseudo-3′ss, potentially providing a general method to manipulate exon-centric gene expression by antisense-based targeting of NMD switch exons and their regulatory motifs in introns.
Regulation of ATM Signaling by U2AF: DSBs at the Focal PointBecause ATM is a key apical kinase in the DDR pathway and NMD switch exons often regulate genes encoding protein interaction partners, U2AF35-induced RNA processing changes of currently known ATM substrates and other constituents of the ATM signaling network were systematically characterized. Interestingly, although genes involved in the DDR and cell cycle control that contained U2AF35-dependent exons were only marginally enriched (FDR=0.08), each component in the ATM-CHEK2-CDC25-CDC2/cyclin B axis showed RNA processing alterations (
First, reduced ATM expression in cells lacking U2AF (
Second, U2AF was required for full activation of CDC25A exon 6 (
ATM recruitment to DSB is facilitated by the MRN complex, consisting of MRE11, RAD50 and NBN. NBN showed no obvious RNA processing changes in cells lacking U2AF35, but RAD50 mRNA was downregulated, possibly through activation of a NMD switch exon and/or additional splicing alterations (
Depletion of U2AF35 was associated with preferential alterations of genes/exons involved in chromatin modification, which have numerous functional links to ATM signaling (
Collectively, these results show that the MRN/ATM-CHEK2-CDC25-cdc2/cyclin B axis is at the center of the U2AF35-mediated control of DDR, although the U2AF regulation extends into additional ATM substrates involved in chromatin modification and telomere length control.
U2AF Preferentially Controls RNA Processing of Transcripts Involved in Leukemia-Associated FusionsCHEK2 phosphorylates PML (Promyelocytic Leukemia) and appears to require PML for subsequent autophosphorylation. Depletion of U2AF35 promoted the use of proximal alternative polyadenylation site of PML, leading to the upregulation of the shortest PML isoform, which lacks the last exon coding for the nuclear export signal (
Apart from PML, U2AF35 depletion upregulated other RARA partners, including NPM1 (
Interestingly, the overlap between U2AF35-sensitive genes/exons and 1,187 genes involved in cancer-associated gene fusions and 300 genes involved in recurrent chromosome translocations was greater than expected, with more significant P values observed for genes with differentially used exons than those implicated by Cufflinks at the transcript level (Table 1). Similarly, sharing of genes frequently mutated in the myelodysplastic syndrome and genes differentially expressed upon U2AF35 depletion was significantly higher than expected (P<0.01, hypergeometric test). Thus, RNA processing of transcripts involved in cancer-associated gene fusions and chromosome translocations is preferentially regulated by U2AF.
To test the function of cancer-associated U2AF1 mutations in NSE splicing, reconstitution experiments were performed with wild-type and mutated U2AF35 constructs that were cotransfected with the C minigene into cells (mock)-depleted of U2AF35 (
Finally, a low degree of NSE activation was detected in diverse human tissues, both in hexamer-primed samples and polyadenylated transcripts (
The work described herein significantly expands currently known links between RNA processing and DDR pathways (
U2AF is an important 3′ss recognition complex and a critical regulator of alternative splicing. In addition to expanding protein-protein interactions, alternative splicing has evolved to fine-tune quantitative gene expression through NMD, in agreement with alterations of many NMD exons in cells lacking this factor (
These results suggest that U2AF is an integral part of the DDR control, contributing to fine-tuning of its PTM network and subject to PTMs itself. U2AF35 was found among proteins that showed increased phosphorylation at S59 upon DNA damage. This serine residue is present only in U2AF35a and is replaced by alanine in U2AF35b. Exogenous expression of U2AF35b was higher than U2AF35a and the relative abundance of U2AF35b increased upon depletion of U2AF65, suggesting that the two U2AF35 isoforms may differentially interact with U2AF65 and may not have equivalent roles in DDR. However, U2AF35- and U2AF65-regulated exons vastly overlap and most, but not all, RNA processing changes found in U2AF35 depleted cells are attributable to the lack of the U2AF heterodimer, including the NSE activation (
U2AF-repressed exons have a distinct 3′ss organization and response to U2AF-related proteins as compared to U2AF-activated exons, suggesting that the exon repression involves direct RNA binding. This is supported by the observed NSE activation on exogenous transcripts that do not undergo NMD and by the SSO-induced NSE blockage (
Apart from U2AF1/U2AF2, additional genes involved in 3′ss selection have been found mutated in cancer. Interestingly, chronic lymphocytic leukemias with SF3B1 mutation were associated with a cryptic 3′ss activation of ATM exon 46, leading to ATM truncation. Recently, splicing of an EZH2 exon as a result of cancer-associated SRSF2 mutation was implicated in impaired hematopoietic differentiation and the same NMD exon was upregulated also upon U2AF35 depletion (
Because NSE activation may restrict ATM expression both in normal and cancer cells (
These results predict that NSE activation is on average more efficient in Caucasians than in Asian populations as a result of a higher frequency of the C allele at rs609261 in the former (
Although these considerations collectively support the importance of rs609261-dependent NSE activation in cancer risk and survival, the U2AF- and hnRNP A1-dependency of NSE inclusion (
Although RNA-Seq is a powerful tool to examine global transcriptome in response to DNA damage, rigorous standards that correctly estimate biological and statistical significance of the observed alterations in RNA processing are yet to be implemented. Given a high stringency of the DEXSeq algorithm, the existence of additional biologically important RNA processing events responsive to U2AF cannot be excluded. For example, upregulation of a proximal polyadenylation site in CHEK1, which was coupled with upregulation of 24-nt and 27-nt exons in CLASP1, would implicate the ATM apoptotic pathway. These events were not detected by DEXSeq but were see genomic browsers and require confirmation. The apoptotic pathways are of particular interest in the myelodysplastic syndrome which shows susceptibility of myeloid progenitors to the programmed cell death and where deregulation of genes involved in ATM signaling was found in more advanced but not initial clinical stages. Interestingly, U2AF1 mutations were also found to be more frequent in advanced stages and were associated with shorter survival. This study also highlights current limitations of incomplete transcript annotation and the importance of examining cryptic exons in RNA-Seq data. Future RNA-Seq studies should therefore attempt at global detection of NMD events associated with alternative splicing, which has been hindered by the instability of stop codon-containing transcripts.
Finally, this study demonstrates efficient repression of a key NMD switch exon in ATM by SSOs that also increased ATM protein levels (
ATM minigenes were prepared by cloning −0.9-kb amplicons into XhoI/XbaI sites of the U2AF1 construct. Cloning primers are shown in Table SI. Full inserts were sequenced to confirm the identity of intended changes and exclude undesired mutations. PUF60 expression vectors were also used. The hnRNP A1 construct was a generous gift of Gideon Dreyfuss (University of Pennsylvania).
Cell Cultures and TransfectionsCell cultures were maintained in standard conditions in DMEM supplemented with 10% (v/v) bovine calf serum (Life Technologies). Depletion of U2AF subunits and U2AF35 isoforms with small interfering RNAs (siRNAs) and splice-switching oligonucleotides (SSOs), were carried out following a time course experiment that established depletion levels of each isoform. Oligo(ribo)nucleotides and siRNAs are listed in Table Si. Transfections were carried out in 6- or 12-well plates using jetPRIME (Polyplus) according to manufacturer's recommendations. The cells were harvested 48 hrs after the second hit, except for those exposed to IR, which received a single hit. For SF3B1 depletion, HEK293 cells were exposed to a siRNAs mixture (S23850, 523852, and S223598 (LifeTechnologies)) and were harvested 48 hrs later.
RNA-SeqAnalysis of differential exon usage was performed using DEXSeq (v. 1.12.1), based on q-values less than 0.05. Differential gene and isoform expression between sample sets was analyzed with Cufflinks (v. 2.1.1), which normalizes the reads using a fragments per kilobase of exon model per million reads measure. Selection of significantly differentially expressed genes was made on the basis of FDR-adjusted P-values (q<0.05).
NSE Expression in Human Tissues and Cell LinesThe FirstChoice human total RNA survey panel containing total RNA samples from 19 different tissues was purchased from LifeTechnologies. Each tissue sample contained a pool of RNAs from different donors. Lymphoblastoid cell lines were exposed to cold and heat shock. Total RNA samples were reverse transcribed with the Moloney murine leukemia virus reverse transcriptase (Promega) and random hexamer or oligo-d(T) primers. cDNA samples were amplified using primers shown in
SSOs were designed to maximize interactions with single-stranded regions and avoid secondary structures predicted by Mfold. All SSOs were purchased from Eurofins, diluted in water and their aliquots were stored at −80° C. All transfections were carried out with jetPRIME (Polyplus) according to manufacturer's recommendations.
Exposure of Cell Cultures to Ionizing Irradiation(Mock)-depleted HEK293 cells were exposed to IR 48 hours after the first hit using a Gulmay Medical (X-Strahl) D3225 Orthovoltage X-ray system at a dose-rate of 0.63 Gy/min at room temperature. The actual dose rate was monitored by a constancy meter. Cells were harvested as indicated in figure legends.
ImmunoblottingAntibodies against ATM (D2E2), ATM-pS1981 (D6H9), CHEK2 (D9C6) and CHEK2pThr68 (C13C1) were purchased from the Cell Signaling Technology, Inc. RBM39 antibodies were purchased from Thermo Fisher Scientific (PA5-31103). Antibodies detecting X-press tag, U2AF35, U2AF65, and tubulin were used. SF3B1 immunoblotting was performed with mouse monoclonal anti-SAP155 antibody (D138-3, MBL). Preparation of cell lysates and immunoblotting was carried out.
ATM is an important cancer susceptibility gene that encodes a critical kinase of the DNA damage response (DDR) pathway. ATM deficiency results in ataxia-telangiectasia (A-T), a rare genetic syndrome exhibiting a high susceptibility to lymphoid malignancies. ATM expression is limited by a nonsense-mediated RNA decay (NMD) switch exon (termed NSE) located in intron 28, which is tightly controlled by the spliceosome. NSE inclusion in mature transcripts can be modulated by splice-switching oligonucleotides (SSOs), but their optimal targets in the intron are unknown and their delivery to lymphoid cells has not been tested. Here a systematic search for efficient SSOs targeting intron 28 to identify NSE activators and inhibitors was employed. Discovery of these antisense compounds was assisted by a segmental deletion analysis of intronic transposed elements, revealing NSE repression upon removal of a distant antisense Alu and NSE activation upon elimination of a long terminal repeat transposon MER51A. Efficient NSE repression upon SSO delivery with chitosan-based nanoparticles to embryonic and lymphoblastoid cells was also demonstrated, opening a possibility for NSE-mediated modulation of ATM expression in cancer and A-T. Taken together, these results highlight an important role of transposed elements in regulating NMD switch exons and the power of intronic SSOs to modify gene expression.
IntroductionEukaryotic genes contain intervening sequences or introns that need to be removed by a large and highly dynamic RNA protein complex termed the spliceosome to ensure accurate protein synthesis. The cell requires excessive energy and time to complete transcription of intron containing precursor messenger RNAs (pre-mRNAs) from at least a quarter of the human genome and also needs to synthesize non-coding RNAs and >200 different spliceosomal proteins to achieve this task. Although once regarded a ‘selfish’ or ‘junk’ DNA, introns are now recognized as critical functional components of eukaryotic genes that enhance gene expression, regulate alternative RNA processing, mRNA export and RNA surveillance. They are also an important source of new gene-coding and -regulatory sequences and noncoding RNAs, including microRNAs and circular RNAs. Their removal process is tightly coupled with transcription, mRNA export and translation, with most human introns eliminated from pre-mRNA co-transcriptionally, however, their potential as targets for nucleic acid therapy is only beginning to be unleashed.
Spliceosomes assemble ad hoc on each intron in an ordered manner, starting with recognition of the 5′ splice site (5′ss) by U1 small nuclear RNP or the 3′ss by the U2 pathway. In addition to traditional splice site recognition sequences (5′ss, branch point, polypyrimidine tracts and 3′ss), accurate splicing requires auxiliary sequences or structures that activate or repress splice sites, known as intronic or exonic splicing enhancers or silencers. These elements allow genuine splice sites to be recognized among a vast excess of cryptic or pseudo-sites in eukaryotic genomes that have similar sequences but outnumber authentic sites by an order of magnitude. Activation of cryptic splice sites can introduce premature termination codons (PTCs) in translational reading frames that may lead to genetic disease. Such transcripts are usually recognized by a NMD pathway and downregulated. However, cryptic exons and NMD have also an important role in controlling the expression of naturally occurring transcripts and for differentiation stage-specific splicing switches, as exemplified by terminal stages of hematopoiesis. In addition, cryptic splice sites may permit unproductive or partial spliceosome assemblies that may compete with natural splice sites, facilitating their accurate selection at a single-nucleotide resolution. Cryptic splice sites activating such ‘pseudo-exons’ (also known as ‘poison’ or ‘NMD switch’ exons) that limit gene expression and regulate the pool of mRNA isoforms could thus provide interesting targets for nucleic acid therapeutics, however, exploitation of such approaches is in its infancy.
Splice-switching oligonucleotides (SSOs) are antisense reagents that modulate intron splicing by binding splice-site recognition or regulatory sequences and competing with cis- and trans-acting factors for their targets. They have been shown to restore aberrant RNA processing, modify the relative abundance of existing mRNA isoforms or produce novel splice variants that are not normally expressed by the cell. Most SSOs employed in pre-clinical and clinical development have targeted exonic sequences. Functional intronic SSOs are more difficult to identify, unless SSOs block access to intronic cryptic splice sites activated by a disease-causing mutation. First, a large fraction of intronic sequences may not affect RNA processing, despite the wealth of intronic auxiliary splicing motifs in the human genome. In addition, their identification is costly and inefficient in long introns. Most exonic SSOs designed to induce exon skipping have usually a desired effect. For example, most SSOs systematically covering SMN2 exon 7 stimulated exon skipping, a prerequisite for antisense therapy of spinal muscular atrophy, however, −20% increased exon inclusion. By contrast, stimulation of intron splicing was found only for −10% of SSOs targeting INS intron 1 while the majority failed to show this effect. Identification of effective SSOs may be facilitated by global pre-mRNA folding and ultraviolet crosslinking and immunoprecipitation studies that identify binding sites for components of the spliceosome or the exon junction complex. However, these binding sites may not reflect optimal antisense targets and their resolution may not be sufficient. Thus, a search for intronic SSOs with desired effects on RNA processing remains challenging.
The RNA-Seq studies have recently revealed activation of a NMD switch exon (termed NSE) deep in ATM intron 28 in cells depleted of each subunit of the auxiliary factor of U2 small nuclear RNP (U2AF). U2AF binds to polypyrimidine tracts coupled with highly conserved 3′ss AG dinucleotides at intron ends and this binding promotes U2 recruitment to the branch site and formation of lariat introns. However, the recent identification of a large number of exons that were activated in cells depleted of each U2AF subunit (U2AF35 and U2AF65) and exhibited a distinct 3′ss organization suggested that a subset of both canonical and NMD switch exons is repressed by U2AF, similar to exon-repressing and -activating activities found for a growing number of RNA binding proteins. The NSE levels were responsive to knockdown of additional splicing factors involved in 3′ss recognition and were influenced by two natural DNA variants (r54988000 and rs609261) located in the NSE itself and its 3′ss, respectively. SSOs that modulate NSE inclusion levels in the ATM mRNA by targeting NSE and its competing pseudoexon in the same intron have also been identified. The ATM NSE provides an interesting and promising target for anticancer therapy for several reasons: (i) the ATM kinase is activated in response to double-strand breakage, mobilizing an extensive signaling network with a broad range of targets, influencing cellular sensitivity to DNA-damaging agents; (ii) the U2AF-regulated exon usage in the ATM signaling pathway was centered on the MRN/ATM-CHEK2-CDC25 axis and preferentially involved transcripts implicated in cancer-associated gene fusions and chromosomal translocations; and (iii) the ATM NSE activation limits ATM expression in cells lacking each U2AF subunit. However, optimal NSE SSOs are unknown and their delivery to lymphoid cells has not been tested.
In the present study, SSOs covering the entire intron 28 were systematically screened and additional SSOs that activate or repress NSE and could be exploited as putative NSE-based ATM inhibitors and activators in therapeutic strategies were identified. Distant transposed elements in the same intron that influence NSE inclusion were also identified. Finally, efficient NSE repression upon SSO delivery to embryonic and lymphoblastoid cell lines using chitosan-based nanoparticles was also shown.
Materials and Methods Plasmid ConstructsReporter constructs containing full ATM intron 28 and flanking exons were cloned in the HindIII/XbaI site of pCR3.1 (Invitrogen) using amplification primers ATM26 and ATM27 (Table 2). Deletion constructs (
To test SSOs with both endogenous and exogenous pre-mRNAs, SSOs were designed to avoid transposed elements in intron 28. Transposons were confirmed in sequences of the constructs using RepeatMasker. The SSO GC content was at least 24% (mean 31%) and their average length was ˜20 nt. The SSOs comprehensively covered three unique regions in ATM intron 28 (termed A, B and AN,
The PU (probability of unpaired) values estimate RNA single-strandedness using the equilibrium partition function by considering all possible RNA structures of short sequences, permitting their comparison at each nucleotide position. Higher PU values indicate a higher single-strandedness of an RNA motif. The PU values were computed as described using the three intronic regions and their 30-nt flanks as an input. PU values for each position of an SSO target were averaged and correlated with SSO-induced NSE inclusion levels.
Preparation of Stearylated Trimethyl ChitosanTrimethyl chitosan, originally derived from ultrapure chitosan obtained from Agaricus bisporus, was provided by KitoZyme (Belgium).
Purified products had the number average molecular weight (Mn) of 43.3±5.5 kDa and the polydispersity index (Mw/Mn) of 2.4±0.3, as determined by gel permeation chromatography in a M NaCH3COOH/0.28 M CH3COOH eluent at a flow rate of 1 mL/min. The degrees of acetylation and quaternization, determined by the Fourier-transform infrared spectroscopy and 1H-nuclear magnetic resonance spectroscopy (′H NMR), respectively, were 11.1±0.9% and 30.1±4.6%. Trimethyl chitosan was functionalized with N-succinimidyl stearate (Santa Cruz BioTechnologies), achieving a final degree of substitution of 2.1±0.6% (mol %), as determined by 1H NMR.
Formation of NanocomplexesThe nanocomplexes were prepared by mixing equal volumes (30 μL) of SSO and polymer solutions. Briefly, SSOs were diluted in buffer A (20 mM HEPES, pH 7.3, 5% (w/v) glucose) and supplemented with 1 M Na2SO4 to a final concentration of 50 mM. Both the polymer and SSO solutions were heated at 60° C. for 5 min before mixing with vortex at 1,000 rpm for 15 s. The tested complexes were prepared with molar ratios of quaternized amines (N) to phosphate groups (P) of 20, and 80, as previously optimized, and had a hydrodynamic diameter between 110-130 nm for N/P ratios between 20-80. The complexes were allowed to stabilize for 30 min at room temperature before adding to a 240 uL of the culture medium (DMEM) without serum and antibiotics. Final concentration of SSOs in chitosan-containing cultures was 300 nM. Twenty four hours after transfections, 300 μL of the culture medium with serum/antibiotics was added. The cells were harvested 24 hrs later.
Cell cultures and transfections. HEK293 and lymphoblastoid VAVY cells were maintained in standard culture conditions in DMEM supplemented with 10% (v/v) bovine calf serum. Cells were seeded at 70% confluency 24 hrs prior to transfections. Transfections of wild-type and deletion constructs were carried out in 12- or 24-well plates using jetPRIME (Polyplus) according to manufacturer's recommendations. The cells were harvested 24 hrs later for total RNA extraction. Each SSO was transfected with or without the full-length ATM construct at 50 nM and cells were harvested 48 hours later for RNA extraction.
Analysis of spliced products. RNA samples were isolated using TRI-reagent (Ambion). Total RNA samples from chitosan experiments were extracted with the RNeasy kit (Qiagen). RNA was quantified and 1 μg of total RNA was reverse transcribed with the Moloney murine leukemia virus reverse transcriptase (Promega) and random hexamer or oligo-d(T) primers. Exogenous cDNA samples were amplified using primers PL4 and ATM-F and endogenous products were amplified with primers ATM-F and ATM-R (Table 2). Spliced products were separated on agarose and polyacrylamide gels and their signal intensities were measured. Statistical analysis was carried out with Stat200 (BioSoft, UK).
SSOs targeting either 3′ or 5′ss of the NSE efficiently repress this exon in a haplotype dependent manner. To facilitate identification of optimal intronic SSOs that activate NSE, splicing reporter constructs with the entire ATM intron 28 (
To determine the importance of transposed elements for NSE inclusion, each transposon from intron 28 was individually deleted using overlap-extension PCR (deletions 1-5,
Measurements of spliced products revealed that SSO-NSE3 yielded the most efficient NSE repression (
Experiments in
The experiments described above identified a small set of intronic SSOs that activated NSE inclusion in mature exogenous and endogenous transcripts. Since NSE can limit ATM expression through NMD, activator and repressor SSOs could serve as tunable gene-specific inhibitors. Transient ATM repression by NSE-activating SSOs could be advantageous for cancer treatment by inhibiting the double-strand break signaling pathway and radiosensitization.
To test if ATM SSOs can be delivered to cells that have much lower transfection efficiency than HEK293 cells, a stearylated trimethylated chitosan (TMC-SA) was employed. Chitosan is a natural copolymer of D-glucosamine and N-acetyl-D-glucosamine known for biocompatibility, biodegradability and low toxicity and immunogenicity. When trimethylated, chitosan acquires a permanent positive charge that improves its solubility at neutral pH. Stearylation was found necessary for formation of stable nanocomplexes with SSOs and their transfection activity in a HeLa/pLuc705 system, which makes use of a luciferase gene interrupted by a mutated HBB1 intron.
Whether TMC-SA can facilitate delivery of SSO-NSE3 into HEK293 cells was first tested.
This work shows the first example of transposed elements that promote and repress activation of a NMD switch exon (
Mutation-induced exonizations have been shown for all other classes of transposed elements, including more ancient short interspersed elements termed mammalian interspersed repeats. In the present study, an intronic transposed element with the highest similarity to MER51A (Medium Reiterated frequency repeat, family 51) repressed NSE, acting as a buffer to counteract the Alu-mediated NSE activation (
In this work, candidate sequence-specific ATM inhibitors that act by promoting a regulated NMD switch exon critical for ATM expression were also identified (
The average length of SSOs employed in the screening was close to the minimum for unique targets (Table 2). The short SSOs may induce more off-target effects than longer SSOs, which could contribute to the low correlation between inclusion levels of endogenous and exogenous NSE transcripts. Apart from the possible suboptimal target specificity, intron 28 splicing and NSE inclusion can be influenced by adjacent introns that were absent in exogenous transcripts. In addition, intron 28 splicing may not be entirely co-transcriptional and folding and folding kinetics of RNAs transcribed from different promoters are likely to be distinct, contributing to the low correlation. Nevertheless, this study clearly demonstrates a wealth of candidate intronic target sites for SSOs in the human genome, consistent with a higher information content of intronic auxiliary splicing sequences as compared to lower organisms, which have smaller introns with a lower regulatory potential for alternative splicing. Although SSO-NSE3 and other SSOs can repress endogenous NSE-containing mRNAs (
Claims
1. A method of modulating protein expression, the method comprising:
- binding an agent to a target motif within a pre-processed mRNA transcript in a target cell,
- wherein the pre-processed mRNA transcript is processed into a processed mRNA transcript in the target cell,
- wherein the pre-processed mRNA transcript is a wild-type pre-processed mRNA transcript encoding a functional protein,
- wherein binding of the agent to the target motif represses activation of a cryptic splice site of a pseudoexon within the pre-processed mRNA and represses inclusion of the pseudoexon in the processed mRNA transcript, and
- wherein inclusion of the pseudoexon in the processed mRNA transcript downregulates expression of the functional protein in the target cell.
2. The method of claim 1, wherein inclusion of the pseudoexon in the processed mRNA transcript introduces a premature termination codon (PTC) in a translational reading frame of the processed mRNA transcript.
3. The method of claim 1, wherein the target motif is within the pseudoexon.
4. The method of claim 1, wherein the target motif comprises the cryptic splice site.
5. The method of claim 1, wherein the target motif is within an intronic region between two canonical exons of the pre-processed mRNA transcript.
6. The method of claim 1, wherein the target motif is from 7 to 100 nucleotides in length.
7. The method of claim 1, wherein the target motif is from 10 to 50 nucleotides in length.
8. The method of claim 1, wherein the target cell is a cell of a human subject.
9. The method of claim 1, wherein the pre-processed mRNA transcript is an endogenous pre-processed mRNA transcript.
10. The method of claim 1, wherein the functional protein translated from the processed mRNA transcript is a wild-type protein.
11. The method of claim 1, wherein the functional protein translated from the processed mRNA transcript is a full-length protein.
12. The method of claim 1, wherein a protein translated from an equivalent processed mRNA transcript that is processed from the pre-processed mRNA but comprises the pseudoexon is not a full-length protein.
13. The method of claim 1, wherein the agent comprises a polynucleic acid polymer that hybridizes to the target motif within the pre-processed mRNA transcript.
14. The method of claim 13, wherein the polynucleic acid polymer is modified at a nucleoside moiety, at a phosphate moiety, at a 5′ terminus, at a 3′ terminus, or a combination thereof.
15. The method of claim 13, wherein the polynucleic acid polymer comprises an artificial nucleotide selected from the group consisting of 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), 2′-O-N-methylacetamido (2-O-NMA), a locked nucleic acid (LNA), an ethylene nucleic acid (ENA), a peptide nucleic acid (PNA), a 1′,5′-anhydrohexitol nucleic acid (HNA), a morpholino, a methylphosphonate nucleotide, a thiolphosphonate nucleotide, and a 2′-fluoro N3-P5′-phosphoramidite.
16. The method of claim 13, wherein the method comprises expressing the polynucleic acid polymer from a vector encoding the polynucleic acid polymer.
17. The method of claim 16, wherein the vector is a viral vector.
18. The method of claim 17, wherein the viral vector is adeno-associated viral vector.
19. The method of claim 1, wherein the polynucleic acid polymer is associated with a delivery vehicle suitable for delivering the polynucleic acid polymer to cells.
20. The method of claim 19, wherein the delivery vehicle comprises a cell-penetrating peptide.
21. The method of claim 19, wherein the delivery vehicle comprises a viral vector.
22. A method of treating or preventing a disease or condition in a subject in need thereof, the method comprising administering to the subject a pharmaceutical composition that comprises (i) an agent, or a vector encoding the agent, and (ii) a pharmaceutically acceptable excipient and/or a delivery vehicle,
- wherein the agent interacts with a target motif within a pre-processed mRNA transcript in a target cell of the subject,
- wherein the pre-processed mRNA transcript is processed into a processed mRNA transcript in the target cell,
- wherein the pre-processed mRNA transcript is a wild-type pre-processed mRNA transcript encoding a functional protein,
- wherein hybridization of the polynucleic acid polymer to the target motif represses activation of a cryptic splice site of a pseudoexon within the pre-processed mRNA and represses inclusion of the pseudoexon in the processed mRNA transcript, and
- wherein inclusion of the pseudoexon in the processed mRNA transcript downregulates expression of the functional protein in the target cell.
23. The method of claim 22, wherein the disease or condition is cancer or a genetic disorder or condition selected from an autosomal dominant disorder, an autosomal recessive disorder, an X-linked dominant disorder, an X-linked recessive disorder, a Y-linked disorder, a mitochondrial disease, a multifactorial disorder and a polygenic disorder.
24. The method of claim 22, wherein the disease or condition is an autosomal dominant disorder.
25. The method of claim 22, wherein the target motif is within the pseudoexon.
26. The method of claim 22, wherein the target motif is within an intronic region between two canonical exons of the pre-processed mRNA transcript.
27. The method of claim 22, wherein the target motif is from 7 to 100 nucleotides in length.
28. The method of claim 22, wherein the target motif is from 10 to 50 nucleotides in length.
29. The method of claim 22, wherein the target motif comprises the cryptic splice site.
30. The method of claim 22, wherein inclusion of the pseudoexon in the processed mRNA transcript introduces a premature termination codon (PTC) in a translational reading frame of the processed mRNA transcript.
31. The method of claim 22, wherein the agent comprises a polynucleic acid polymer that hybridizes to the target motif within the pre-processed mRNA transcript.
32. The method of claim 31, wherein the polynucleic acid polymer is modified at a nucleoside moiety, at a phosphate moiety, at a 5′ terminus, at a 3′ terminus, or a combination thereof.
33. The method of claim 31, wherein the polynucleic acid polymer comprises an artificial nucleotide selected from the group consisting of 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), 2′-O-N-methylacetamido (2-O-NMA), a locked nucleic acid (LNA), an ethylene nucleic acid (ENA), a peptide nucleic acid (PNA), a 1′,5′-anhydrohexitol nucleic acid (HNA), a morpholino, a methylphosphonate nucleotide, a thiolphosphonate nucleotide, and a 2′-fluoro N3-P5′-phosphoramidite.
34. The method of claim 31, wherein the functional protein translated from the processed mRNA transcript is a full-length protein.
35. The method of claim 31, wherein a protein translated from an equivalent processed mRNA transcript that is processed from the pre-processed mRNA transcript but comprises the pseudoexon is not a full-length protein.
36. The method of claim 31, wherein the pharmaceutical composition comprises the vector encoding the polynucleic acid polymer, and wherein the vector is a viral vector.
37. The method of claim 31, wherein the pharmaceutical composition comprises the polynucleic acid polymer, wherein the polynucleic acid polymer is associated with the delivery vehicle suitable for delivering the polynucleic acid polymer to cells of the subject, and wherein the delivery vehicle comprises a cell-penetrating peptide or a viral vector.
38. The method of claim 22, wherein the pharmaceutical composition further comprises a genomic editing molecule or a polynucleotide encoding the genomic editing molecule.
39. A pharmaceutical composition comprising:
- an agent, or a vector encoding the agent, wherein the agent interacts with a target motif within a wild-type pre-processed mRNA transcript to repress activation of a cryptic splice site of a pseudoexon within the pre-processed mRNA; and
- a pharmaceutically acceptable excipient and/or a delivery vehicle.
Type: Application
Filed: Apr 12, 2023
Publication Date: Dec 28, 2023
Inventors: Igor VORECHOVSKY (Hampshire), Jana KRALOVICOVA (Hampshire)
Application Number: 18/299,509