Recombinant newcastle disease viruses useful as vaccines or vaccine vectors
The present invention concerns an antigenomic RNA of Newcastle Disease virus (NDV) carrying one or more foreign genes inserted before NP gene, between P and M genes, and/or between HN and L genes. The invention is also directed toward a cDNA encoding a recombinant antigenomic RNA having one or more foreign genes inserted according to the invention, a cell containing the cDNA, a plasmid comprising the cDNA, a cell containing the plasmid, a cell containing the recombinant antigenomic RNA, and a recombinant NDV containing the recombinant antigenomic RNA of the invention, such as a recombinant NDV carrying one or more foreign genes recovered from transcription of the cDNA or the plasmid in a competent cell. The recombinant NDV carrying the one or more foreign genes can be used as a vaccine or vaccine vector.
Latest The University of Maryland, College Park Patents:
This application is a Continuation of U.S. patent application Ser. No. 10/440,419, filed May 19, 2003; which is a Continuation-In-Part application of U.S. patent application Ser. No. 09/926,431, filed Mar. 6, 2002, now U.S. Pat. No. 7,244,558; which is National Stage entry of International Application No.: PCT/US00/06700 filed on May 5, 2000. The present patent application also claims the benefit of U.S. Provisional Patent Application Nos. 60/381,462 filed on May 17, 2002; 60/132,597, filed May 5, 1999; and 60/171,072, filed Dec. 16, 1999. The disclosures of each of these applications are hereby incorporated in their entirety by reference.
SEQUENCE LISTINGThe instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Sep. 22, 2014, is named 108172-00146_SL.txt and is 84,473 bytes in size.
The present application relates to recombinant Newcastle disease viruses carrying one or more foreign genes, i.e. genes not found naturally in the Newcastle disease virus, which are useful as vaccines or vaccine vectors.
BACKGROUND OF THE INVENTIONNewcastle disease is a highly contagious viral disease affecting all species of birds. The disease can vary from an asymptomatic infection to a highly fatal disease, depending on the virus strain and the host species. Newcastle disease has a worldwide distribution and is a major threat to the poultry industries of all countries. Based on the severity of the disease produced in chickens, Newcastle disease virus (NDV) strains are grouped into three main pathotypes: lentogenic (strains that do not usually cause disease in adult chickens), mesogenic (strains of intermediate virulence) and velogenic (strains that cause high mortality).
NDV is a member of the genus Rubulavirus in the family Paramyxoviridae. The genome of NDV is a non-segmented, single-stranded, negative-sense RNA of 15186 nucleotides (Krishnamurthy & Samal, 1998; Phillips et el., 1998; de Leeuw & Peeters, 1999). The genomic RNA contains six genes that encode the following proteins in the order of: the nucleocapsid protein (NP), phosphoprotein (P), matrix protein (M), fusion protein (F), haemagglutinin-neuraminidase (HN) and large polymerase protein (L). Two additional proteins, V and W, of unknown function are produced by RNA editing during P gene transcription (Steward et al., 1993). A schematic diagram of the genetic map of NDV genomic RNA is shown in
Three proteins, i.e. NP, P and L proteins, constitute the nucleocapsid. The genomic RNA is tightly bound by the NP protein and together with the P and L proteins form the functional nucleocapsid within which resides the viral transcriptive and replicative activities. The F and HN proteins form the external envelope spikes, where the HN glycoprotein is responsible for attachment of the virus to host cell receptors and the F glycoprotein mediates fusion of the viral envelope with the host cell plasma membrane thereby enabling penetration of the viral genome into the cytoplasm of the host cell. The HN and F proteins are the main targets for the immune response. The M protein forms the inner layer of the virion.
NDV follows the general scheme of transcription and replication of other non-segmented negative-strand RNA viruses. The polymerase enters the genome at a promoter in the 3′ extragenic leader region and proceeds along the entire length by a sequential stop-start mechanism during which the polymerase remains template bound and is guided by short consensus gene start (GS) and gene end (GE) signals. This generates a free leader RNA and six non-overlapping subgenomic mRNAs. The abundance of the various mRNAs decreases with increasing gene distance from the promoter. The genes are separated by short intergenic regions (1-47 nucleotides) which are not copied into the individual mRNAs. RNA replication occurs when the polymerase somehow switches to a read-through mode in which the transcription signals are ignored. This produces a complete encapsulated positive-sense replicative intermediate which serves as the template for progeny genomes.
Reverse-genetic techniques have been reported to recover negative-sense viruses from cloned cDNA (Conzelmann, 1996). For NDV, reverse-genetic technology is currently available for avirulent strain LaSota (Römer-Oberdörfer et al., 1999; Peeters et al., 1999).
SUMMARY OF THE INVENTIONReverse-genetic techniques were used in making the recombinant NDV of the present invention from cloned cDNA. This approach involves co-expression of the cloned cDNA of full length NDV genome and nucleocapsid proteins (the NP, P and L proteins) from transfected plasmids using the vaccinia virus/T7 RNA polymerase expression system.
Within the scope of the present invention, recombinant NDV can be recovered from cDNA and the genome of NDV can be manipulated at the cDNA level. The production of infectious NDV from cloned cDNA can be used to engineer NDV carrying foreign genes. With the manipulation of the genome of NDV, one can insert foreign sequences into the NDV genome for co-expression. For example, the gene for protective antigen of another avian pathogen or the genes for avian cytokines can be inserted into the NDV genome for co-expression. Thus, the present invention includes multivalent genetically engineered NDV vaccines carrying genes encoding immunogens (e.g. immunogenic proteins) for influenza virus, infectious bursal disease virus, rotavirus, infectious bronchitis virus, infectious laryngotracheitis virus, chicken anemia virus, Marek's disease virus, avian Leukosis virus, avian adenovirus and avian pneumovirus.
The present invention also is directed toward a genetically engineered NDV carrying avian cytokine genes. A NDV carrying at least one gene encoding an avian cytokine, e.g. an interleukin such as IL-2 and IL-4, can be used as a vaccine.
The recombinant NDV prepared by insertion of foreign genes into the NDV genome can express the foreign genes in cells infected by the recombinant NDV. As a result, the recombinant NDV can be used to express proteins of non-avian pathogens or other avian pathogens. Therefore, the recombinant NDV can be used as a vaccine vector.
One of the objects of the present invention is a recombinant antigenomic RNA of Newcastle disease virus, comprising NP gene, P gene, M gene, F gene, HN gene and L gene in this order from a 5′ to 3′ direction, said antigenomic RNA further comprising n foreign nucleotide complexes inserted (a) before the NP gene, (b) between the P and M genes, and/or (c) between the HN and L genes, wherein n is 1, 2, 3 or 4;
each of the foreign nucleotide complexes comprising a Newcastle disease virus gene start sequence, an open reading frame of a foreign gene and a Newcastle disease virus gene end sequence in this order from the 5′ to 3′ direction, wherein the foreign gene is a gene not found naturally in the Newcastle disease virus;
wherein when n is 2, 3 or 4, the foreign nucleotide complexes are the same or different; and
wherein when 2, 3 or 4 foreign nucleotide complexes are inserted together before the NP gene, between the P and M genes, or between the HN and L genes, the foreign nucleotide complexes are sequentially linked directly or indirectly.
Since each foreign nucleotide complex has a NDV gene start signal, i.e. GS sequence motif, upstream of the open reading frame (ORF) of the foreign gene and a NDV gene end signal, i.e. GE sequence motif, downstream of the ORF of the foreign gene, each foreign nucleotide complex forms a transcriptional unit.
The recombinant antigenomic RNA of NDV of the present invention preferably further comprises NP-P intergenic region between the NP gene and P gene, P-M intergenic region between the P gene and M gene, M-F intergenic region between the M gene and F gene, F-HN intergenic region between the F gene and HN gene, and/or HN-L intergenic region between the HN gene and L gene. More preferably, the recombinant antigenomic RNA of NDV of the present invention further comprises NP-P intergenic region between the NP gene and P gene, P-M intergenic region between the P gene and M gene, M-F intergenic region between the M gene and F gene, F-HN intergenic region between the F gene and HN gene, and HN-L intergenic region between the HN gene and L gene. When one or more of the foreign nucleotide complexes are inserted between the P and M genes, the foreign nucleotide complexes can be inserted into the P-M intergenic region if present. Similarly, when one or more of the foreign nucleotide complexes are inserted between the HN and L genes, the foreign nucleotide complexes can be inserted into the HN-L intergenic region. Optionally, one or more of the NP-P intergenic region, P-M intergenic region, M-F intergenic region, F-HN intergenic region, and HN-L intergenic region are replaced with a single nucleotide, dinucleotide or an oligonucleotide of 3-80 nucleotides (preferably 4-60 nucleotides) in length, wherein the oligonucleotide optionally contains one or more restriction sites.
When one or more of the foreign nucleotide complexes are inserted before the NP gene, the foreign nucleotide complexes preferably are inserted into a non-coding region immediately before the ORF of the NP gene, so that the ORF of the foreign gene in each of the foreign nucleotide complexes is flanked by NDV gene start and gene end signals and the ORF of the NP gene is preceded by a NDV gene start signal, with the GS-foreign gene ORF-GE structure preceding the GS signal for the NP ORF.
Within the scope of the invention is a recombinant antigenomic RNA of NDV having one or more foreign nucleotide complexes inserted between P and M genes. The antigenomic RNA can be made by inserting the one or more foreign nucleotide complexes into the noncoding region of P gene after the stop codon, but before the NDV gene end signal of the P gene. When only one foreign nucleotide complex is inserted into the noncoding region of P gene after the stop codon, the ORF of the foreign gene is preceded by a NDV gene end and NDV gene start signals, resulting in the ORF of the P gene being preceded by a NDV gene end signal, which is followed by a NDV gene start signal, the ORF of the foreign gene, and a NDV gene end signal in that order (the ORF of the following M gene is preceded by a NDV gene start signal). More foreign gene complexes can be inserted after this foreign gene complex. Similarly, the recombinant antigenomic RNA of NDV having one or more foreign nucleotide complexes inserted between P and M genes can be made by inserting the one or more foreign nucleotide complexes into the noncoding region of M gene before the ORF of the M gene.
The present invention is also directed toward a process of preparing the recombinant antigenomic RNA of the invention, comprising the following steps:
(i) providing a cDNA comprising NP gene, P gene, M gene, F gene, HN gene and L gene in this order, said cDNA further comprising n foreign nucleotide complexes inserted (a) before the NP gene, (b) between the P and M genes, and/or (c) between the HN and L genes, wherein n is 1, 2, 3 or 4;
each of the foreign nucleotide complexes comprising a Newcastle disease virus gene start sequence, an open reading frame of a foreign gene and a Newcastle disease virus gene end sequence in this order from the 5′ to 3′ direction, wherein the foreign gene is a gene not found naturally in the Newcastle disease virus;
wherein when n is 2, 3 or 4, the foreign nucleotide complexes are the same or different; and
wherein when 2, 3 or 4 foreign nucleotide complexes are inserted together before the NP gene, between the P and M genes, or between the HN and L genes, the foreign nucleotide complexes are sequentially linked directly or indirectly;
(ii) transcribing the antigenomic cDNA to form a mixture containing an antigenomic RNA; and thereafter
(iii) isolating the antigenomic RNA.
In some embodiments of the process of preparing the recombinant antigenomic RNA of the invention, the cDNA used in step (i), comprising NP gene, P gene, M gene, F gene, HN gene and L gene having the n foreign nucleotide complexes inserted, is prepared by (I) constructing a cDNA comprising the NP gene, P gene, M gene, F gene, HN gene and L gene in this order; and thereafter (II) inserting the n foreign nucleotide complexes (a) before the NP gene, (b) between the P and M genes, and/or (c) between the HN and L genes. Preferably, the cDNA constructed in step (I) and/or the cDNA constructed in step (II) are in a plasmid, such as pBR322 or pGEM-7Z. In step (ii), the cDNA preferably is transcribed in cells expressing a RNA polymerase, such as T7 RNA polymerase.
The present invention is also directed toward a recombinant NDV comprising a recombinant antigenomic RNA carrying one or more foreign genes of the present invention. The recombinant NDV can be produced by a process comprising the following steps:
(i) providing cells capable of synthesizing T7 RNA polymerase;
(ii) transfecting the cells with a plasmid comprising the cDNA encoding the antigenomic RNA having one or more foreign genes inserted according to the invention, a plasmid encoding NP protein, a plasmid encoding P protein, and a plasmid encoding L protein to obtain transfected cells in a medium; and thereafter
(iii) isolating Newcastle disease virus from a supernatant of the medium of step (ii) to obtain the recombinant Newcastle disease virus.
The cells capable of synthesizing T7 RNA polymerase provided in step (i) can be animal cells of an avian or mammalian species, plant cells, or cells from a cell line expressing T7 RNA polymerase.
Within the scope of the present invention are a cDNA encoding a recombinant antigenomic RNA having one or more foreign genes inserted according to the invention, a cell containing the cDNA, a plasmid comprising the cDNA, a cell containing the plasmid, a cell containing the recombinant antigenomic RNA, and a recombinant NDV containing the recombinant antigenomic RNA of the invention, e.g. a recombinant NDV carrying one or more foreign genes recovered from transcription of the cDNA or the plasmid in a competent cell. The recombinant NDV containing the recombinant antigenomic RNA of the invention is preferably substantially purified. Also preferred is a substantially purified recombinant antigenomic RNA of NDV carrying one or more foreign genes prepared according to the invention.
The present invention also includes a method of vaccinating an avian animal against Newcastle disease, wherein the avian animal is in need of the vaccination, comprising administering an effective amount of the recombinant NDV carrying one or more foreign genes according to the invention to the avian animal.
One of the objects of the inventions is a method of treating an avian animal with an avian cytokine, wherein the avian animal is in need of the treatment, said method comprising administering an effective amount of the recombinant NDV of the invention carrying one or more foreign genes encoding one or more avian cytokines, such as avian interleukins (preferably IL-2 and/or IL-4) to the avian animal.
Another aspect of the invention is a method of immunizing an avian animal against an avian pathogen selected from the group consisting of influenza virus, infectious bursal disease virus, rotavirus, infectious bronchitis virus, infectious laryngotracheitis virus, chicken anemia virus, Marek's disease virus, avian Leukosis virus, avian adenovirus and avian pneumovirus, wherein the avian animal is in need of the immunization, said method comprising administering an effective amount of the recombinant NDV of the invention to the avian animal, wherein the recombinant NDV carries one or more foreign genes encoding one or more immunogenic proteins of the avian pathogen against which the avian animal is immunized.
Also within the scope of the invention is a method of immunizing a mammal against a non-avian pathogen, wherein the mammal is in need of the immunization, said method comprising administering an effective amount of the recombinant NDV of the invention to the mammal, wherein the recombinant NDV carries one or more foreign genes encoding one or more immunogenic proteins of the non-avian pathogen, e.g. influenza virus, SARS-causing virus, human respiratory syncytial virus, human immunodeficiency virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, poliovirus, rabies virus, Hendra virus, Nipah virus, human parainfluenza 3 virus, measles virus, mumps virus, Ebola virus, Marburg virus, West Nile virus, Japanese encephalitis virus, Dengue virus, Hantavirus, Rift Valley fever virus, Lassa fever virus, herpes simplex virus and yellow fever virus, against which the mammal is immunized.
In some embodiments of the recombinant antigenomic RNA of the present invention, n is 2, 3 or 4 (preferably 2 or 3, and more preferably 2) and the foreign nucleotide complexes are different. In some embodiments of the recombinant antigenomic RNA, n is 2, 3 or 4 (preferably 2 or 3, and more preferably 2) and the foreign nucleotide complexes are the same. In still some embodiments of the recombinant antigenomic RNA, n is 1 or 2.
In some of the recombinant antigenomic RNAs of the invention, the ORF of each of the foreign genes in inserted the foreign nucleotide complexes is no more than about 3000 nucleotides, no more than about 2000 nucleotides, no more than about 1500 nucleotides, no more than about 1000 nucleotides, no more than about 800 nucleotides, no more than about 500 nucleotides, or no more than about 300 nucleotides in length.
In some of the embodiments of the recombinant antigenomic RNA of the present invention, where 2, 3 or 4 foreign nucleotide complexes are inserted together before the NP gene, between the P and M genes, or between the HN and L genes, the foreign nucleotide complexes are sequentially linked directly or indirectly, and the foreign nucleotide complexes have a combined length of no more than about 5000 nucleotides, no more than about 4000 nucleotides, no more than about 3000 nucleotides, no more than about 2000 nucleotides, no more than about 1000 nucleotides, or no more than about 800.
The foreign gene inserted in the recombinant antigenomic RNA of the invention preferably encode a substance selected from the group consisting of chloramphenical acetyltransferase, GFP, an avian cytokine, and an immunogenic protein of influenza virus, infectious bursal disease virus, rotavirus, infectious bronchitis virus, infectious laryngotracheitis virus, chicken anemia virus, Marek's disease virus, avian leukosis virus, avian adenovirus, or avian pneumovirus. The foreign gene may encode an immunogenic protein of a non-avian pathogen, e.g. influenza virus, SARS-causing virus, human respiratory syncytial virus, human immunodeficiency virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, poliovirus, rabies virus, Hendra virus, Nipah virus, human parainfluenza 3 virus, measles virus, mumps virus, Ebola virus, Marburg virus, West Nile disease virus, Japanese encephalitis virus, Dengue virus, Hantavirus, Rift Valley fever virus, Lassa fever virus, herpes simplex virus and yellow fever virus.
When more than one foreign gene encoding the avian cytokine is inserted, the foreign genes may encode the same or different avian cytokines, such as avian interleukins, e.g. IL-2 and IL-4.
Examples of the foreign gene encoding an immunogenic protein of an avian pathogen are HA or NA gene of influenza virus, VP2 or polyprotein gene of infectious bursal disease virus, S or S1 gene of infectious bronchitis virus, glycoprotein gene of infectious laryngotracheitis virus, the complete genome of chicken anemia virus, glycoprotein gene of Marek's disease virus, envelope gene of avian leukosis virus, avian adenovirus, and G or F gene of avian pneumovirus.
Examples of the foreign gene encoding an immunogenic protein of a non-avian pathogen are HA or NA gene of influenza virus, S or S1 gene of SARS-causing virus, G or F gene of human respiratory syncytial virus, gp60, gp120 or gp41 gene of human immunodeficiency virus, surface antigen gene of hepatitis A virus, surface antigen gene of hepatitis B virus, surface antigen of hepatitis C virus, capsid proteins gene of poliovirus, G protein gene of rabies virus, G or F protein gene of Hendra virus, G or F protein gene of Nipah virus, HN or F protein gene of human parainfluenza 3 virus, H or F protein gene of measles virus, HN or F protein gene of mumps virus, G protein gene of Ebola virus, G protein gene of Marburg virus, envelope protein gene of West Nile disease virus, envelope protein gene of Japanese encephalitis virus, envelope protein gene of Dengue virus, glycoprotein gene of Hantavirus, glycoprotein gene of Rift Valley fever virus, G1 or G2 protein gene of Lassa fever virus, glycoprotein genes of herpes simplex virus, and glycoprotein gene of yellow fever virus.
The present invention is also directed toward an antigenomic RNA of NDV carrying one or more foreign genes inserted before the NP gene, between the P and M genes, and/or between the HN and L genes, wherein at least one of the foreign genes encodes a tumor antigen, such as pg100, MAGE1, MAGE3 and CDK4.
In the recombinant antigenomic RNA of the invention, the foreign nucleotide complexes preferably are inserted before the NP gene, and/or between the P and M genes. More preferably, at least one of the foreign nucleotide complexes is inserted before the NP gene. In some embodiments of the recombinant antigenomic RNA, at least one of the foreign nucleotide complexes is inserted before the NP gene and at least one of the foreign nucleotide complexes is inserted between the P and M genes. In some embodiments, at least one of the foreign nucleotide complexes is inserted before the NP gene and at least one of the foreign nucleotide complexes is inserted between the HN and L genes. In still some embodiments, at least one of the foreign nucleotide complexes is inserted before the NP gene, at least one of the foreign nucleotide complexes is inserted between the P and M genes, and at least one of the foreign nucleotide complexes is inserted between the HN and L genes. In yet some embodiments, at least one of the foreign nucleotide complexes is inserted between the P and M genes. Most preferably, the foreign nucleotide complexes are inserted only before the NP gene.
NDV grows to very high titers (<109 PFU/ml) in many cell lines and eggs and elicits strong humoral and cellular immune responses in vivo. NDV naturally infects via respiratory and alimentary tract mucosal surfaces. NDV replicates in the cytoplasm of infected cells and does not undergo genetic recombination, making vaccine vectors based on the recombinant NDV carrying foreign genes stable and safe. Due to these characteristics of NDV described herein, recombinant NDVs that can express foreign genes carried in the recombinant NDVs are good vaccines, wherein the foreign genes encode immunogenic proteins of pathogens.
The recombinant NDV on the invention carrying one or more inserted foreign genes show robust expression of the foreign genes. Moreover, the recombinant NDV expressing one or more of the foreign gene can replicate in cell culture and in vivo. Avirulent NDV recombinants expressing heterologous proteins could be used as multivalent vaccines.
The recombinant NDV generated from the recombinant antigenomic RNA carrying one or more foreign genes inserted according to the invention can also be used as an inactivated vaccine.
The vaccine or vaccine vector based on the recombinant NDV generated from the recombinant antigenomic RNA carrying one or more foreign genes inserted according to the invention can be administered topically, via the respiratory route, orally or via an injection. The dose of the vaccine or vaccine vector to be used can be readily determined by a person skilled in the art based on the disease, the host subject species, and the age, sex and/or health condition of the host subject involved.
Within the scope of the present invention is a method to recover NDV with amino acid changes at the cleavage site. The codon of the changed amino acid is different from that of the original amino acid by at least two nucleotides. Such a difference in at least two nucleotides stabilizes the viral genome against reversion from a nonbasic amino acid residue to a basic amino acid residue.
Within the scope of the present invention is a Newcastle disease virus having at least two of the features selected from the group consisting of (1) a F0 protein cleavage site having at least two less basic amino acid residues than a F0 protein cleavage site of Newcastle disease virus wild type strain Beaudette C; (2) an amino acid having a non-aromatic side chain at the N terminus of the F1 cleavage fragment, wherein the amino acid having a non-aromatic side chain is glycine, alanine, valine, leucine or isoleucine, preferably leucine; and (3) an open reading frame of a HN glycoprotein being longer than an open reading frame of a HN glycoprotein of Newcastle disease virus wild type strain Beaudette C.
Example 1In this working example, an embodiment of the invention in which the recombinant NDV containing CAT as the foreign gene inserted before the NP gene was prepared.
A. Assembly of a Full-Length Clone of NDV Strain LaSota and Recovery of NDV LaSota from a Plasmid
NDV lentogenic strain LaSota was grown in 10-day-old embryonated, specific-pathogen-free (SPF) eggs. The virus was purified from allantoic fluid as described previously (Kingsbury, 1966). Viral RNA was extracted from the purified virus by using TRIzol according to the manufacturer's protocol (Life Technologies). The extracted RNA was subjected to RT-PCR with virus-specific primer pairs (Table 1) to generate seven overlapping PCR fragments of the entire viral genome with high-fidelity Pfx DNA polymerase (Life Technologies). In Table 1, the cDNA fragments correspond to the fragments shown in
A cDNA clone encoding NDV strain LaSota antigenomic RNA was assembled from seven cDNA fragments, as shown in
In order to recover NDV from the cloned cDNA to the antigenome of NDV LaSota, transfection was carried out as described here (based on a general procedure schematically shown in
Nucleotide sequence analysis of RT-PCR products also confirmed the presence of the genetic markers. The procedures for RT-PCR and demonstration of genetic marker are described herein. RNA was isolated from recovered virus by using TRIzol reagent. RT-PCR was performed with primers P1 (5′ TCCCCTGGTATTTATTCCTGC, (SEQ ID NO: 21) positions 5609-5629) and P1R (5′ GTTGGCCACCCAGTCCCCGA, (SEQ ID NO: 22) negative sense, positions 7286-7305) to amplify a fragment including the introduced MluI site in the intergenic region between the F and HN genes. Similarly, a fragment containing the SnaBI site within the HN-L intergenic region was amplified with primers P2 (5′ CGCATACAGCAGGCTATCTTATC, (SEQ ID NO: 23) positions 7513-7535) and P2R (5′GGGTCATATTCTATACATGGC, (SEQ ID NO: 24) negative sense, positions 9739-9759). The RT-PCR products were then subjected to restriction enzyme digestion, the first product with MluI, the second with SnaBI. The restriction patterns were analysed by agarose gel electrophoresis. RT-PCR was also performed to demonstrate the location of the CAT gene insert in the recombinant NDV expressing the CAT gene.
B. Construction of a Full-Length Plasmid Containing the Chloramphenicol Acetyltransferase (CAT) Gene
For the convenience of inserting CAT into the most 3′-proximal locus, an AscI-SacII fragment of the full-length cDNA clone was subcloned into plasmid pGEM-7Z between the XbaI and HindIII sites by using a specific primer pair with XbaI and HindIII site overhangs. An 18 nt insert with a unique PmeI site was then introduced just before the NP ORF by the method described previously (Byrappa et al., 1995). To insert the CAT gene into the PmeI site, the CAT gene ORF was amplified by primers (5′ gctagtttaaacATGGAGAAAAAAATCACTGGATATACC 3′ (SEQ ID NO: 25), positive sense, and 5′ gctagtttaaacttctacccgtgttttttctaatctgcagTTACGCCCCGCCCTGCCACTCAT CGC 3′ (SEQ ID NO: 26), negative sense; PmeI site and NDV gene start and gene end signal in lower case, CAT-specific sequence in capitals), digested with PmeI and placed into the NP non-coding region in pGEM-7Z (
The CAT gene ORF, flanked by NDV gene start and gene end sequences, was inserted into the non-coding region of the NP gene immediately before the NP ORF (
To examine the expression of the CAT protein from rLaSota/CAT, cell lysates from 12 passages, beginning with the third, were tested for CAT activity. For rLaSota/CAT, all passages showed similar CAT enzyme activity by CAT assay (procedure described below, but data not shown). These results showed that the inserted CAT gene was stable, at least up to passage 12. In Example 2 described below, an NDV-CAT chimeric transcription cassette was inserted between the HN and L genes of the full-length cDNA of virulent NDV strain Beaudette C and infectious CAT-expressing recombinant NDV (rBC/CAT) was recovered. In order to compare the level of expression of the CAT genes from rLaSota/CAT and rBC/CAT, replicate monolayers of DF1 cells were infected with each virus separately at an m.o.i. of 0.1. Four days after infection, CAT enzyme activities in the cell lysates were examined (
The activity of CAT was assayed as described below for analysis of the stability of CAT expression. Chicken embryo fibroblast DF1 cell pellets were lysed by three freeze-thaw cycles and 1% of the lysed pellet from a 25 cm2 flask was analysed by TLC for the ability to acetylate [14C]chloramphenicol (Amersham Pharmacia). To study the stability of CAT expression by the recombinant virus, a total of 12 serial passages were performed at a passage interval of 4 days. At each passage, 100 μl of the medium supernatant was used for passing to fresh DF1 cells in a 25 cm2 flask. Acetyltrypsin (1 μg/ml) was included in the medium of DF1 cells for cleavage of the F protein of rLaSota and rLaSota/CAT.
To examine the presence of CAT mRNA and the level of synthesis of the immediate downstream NP mRNA, Northern blot hybridization was performed with poly(A)+RNA from cells infected with rLaSota or rLaSota/CAT, each at passage 6. Northern blot hybridization was carried out as described herein. RNA was isolated from cells infected with either rLaSota or rLaSota/CAT at an m.o.i. of 1. Total RNA was extracted with TRIzol reagent and poly(A)+mRNA was selected by using an mRNA isolation kit (Promega). mRNA samples were subjected to electrophoresis on 1.5% agarose gels containing 0.44 M formaldehyde, transferred to nitrocellulose membrane and used for hybridization with [32P]CTP-labelled riboprobes. The negative-sense CAT and NP probes where synthesized by in vitro transcription of linearized plasmids containing these genes. Hybridization of the mRNA extracted from rLaSota/CAT-infected cells with a negative-sense CAT-specific riboprobe detected a single major band of the size predicted for CAT mRNA (
In this working example, an embodiment of the invention in which the recombinant NDV containing a gene encoding CAT as the foreign gene inserted between the HN and L genes was prepared.
A. Construction of a Full-Length NDV cDNA Clone
A cDNA clone encoding the entire 15,186-nt antigenome of NDV strain Beaudette C was constructed from 8 cDNA segments that were synthesized by RT-PCR from NDV Beaudette C derived genomic RNA (
To recover recombinant NDV from the cDNA located in the plasmid, the strategy shown in
B. Construction of Recombinant NDV Having a Foreign Gene Inserted Between the HN and L Genes
The recombinant pBR322 plasmid containing the cDNA clone encoding the entire 15,186-nt antigenome of NDV strain Beaudette C prepared in Part A of Working Example 2 above was used to construct the recombinant NDV having a foreign gene inserted. The gene encoding chloramphenicol acetyltransferase (CAT) was the foreign gene in this example. The sequence in the NH-L intergenic region of the full-length antigenome cDNA clone of NDV strain Beaudette C was modified to contain a unique Sna B I restriction site downstream of the Age I restriction site. The open reading frame (ORF) encoding the CAT protein was engineered to be flanked by the NDV GS and GE signals. This transcription cassette was inserted into the HN-L intergenic region of NDV full-length antigenomic cDNA to prepare a recombinant pBR322 containing the full-length antigenomic cDNA containing the CAT gene inserted between the HN and L genes (see
To recover the recombinant NDV containing the CAT gene, the strategy shown in
RT-PCR of the genomic RNA isolated from the recovered virus showed the presence of the inserted CAT gene. The recovered virus expressed abundant levels of CAT enzyme. In
Some of the characteristics of the recombinant viruses, rLaSota and rLaSota/CAT, were determined using the recombinant viruses recovered from transcription of the recombinant cDNA of NDV carrying the CAT gene inserted before the NP gene or between the HN and L genes as obtained in Examples 1 and 2.
A. Nucleotide Sequences
The nucleotide sequence of the recombinant cDNA for NDV LaSota expressing the CAT gene inserted in front of the NP gene as prepared in Example 1 is shown in Table 3 (labeled as LASO_CAT.TXT). The nucleotide sequence of the recombinant cDNA for NDV Beaudette C expressing the CAT gene inserted between the HN and L genes as prepared in Example 2 is shown in Table 4 (labeled as BC_CAT_.TXT).
B. Growth Characteristics of the Recombinant Viruses
The efficiency of replication in tissue culture of rLaSota, rLaSota/CAT and wild-type NDV LaSota was compared in a multiple-step growth cycle. Triplicate monolayers of DF1 cells were infected with each virus at an m.o.i. of 0.005 and samples were collected at 8 h intervals. The virus titers of these samples were quantified by plaque assay (
C. Determination of the Intracerebral Pathogenicity Index (ICPI) in 1-Day-Old Chicks
ICPI was used to determine the virulence of wild-type and recombinant NDVs in 1-day-old chicks. For each ICPI test, 15 1-day-old SPF chicks were used (ten birds for test and five birds for control). The inoculum consisted of fresh, infective allantoic fluid with an HA titer >24 (1:16) for the test birds and allantoic fluid from uninfected embryonated chicken eggs for control birds. Both inocula were diluted 1:10 in sterile PBS. Each bird was inoculated intracerebrally with 0.05 ml inoculum. The birds were observed for clinical signs and mortality every 24 h for a period of 8 days. The scoring and determination of ICPI were done according to the method described by Alexander (1997).
In order to compare the pathogenicity of rLaSota, rLaSota/CAT and wild-type NDV strain LaSota, ICPI tests in 1-day-old chicks were performed by scoring clinical signs and mortality. The most virulent NDV strains give indices close to 2.0, while avirulent viruses give values close to 0. In our experiment, the results of ICPI were 0.27 for wild-type NDV LaSota, 0.29 for rLaSota and 0.24 for rLaSota/CAT. These results show that the recombinant viruses were similar in virulence to wild-type NDV strain LaSota.
The results described here show that attenuated NDV can be used as a vaccine vector to express a foreign gene. Development of recombinant NDV as a vaccine vector has several applications. Several foreign genes can be inserted and expressed in the same virus to obtain simultaneous immune responses to the expressed antigens in inoculated animals. For example, a single recombinant NDV could be generated that expressed the immunogenic proteins of multiple avian pathogens. Alternatively, several NDVs, each expressing various heterologous antigens, could be administered as a multivalent vaccine. A further extension would be to use NDV vectors in non-avian species, where NDV is capable of undergoing incomplete replication to the extent necessary to express inserted genes. Thus, development of NDV as a vector should prove to be useful against avian and non-avian diseases for which suitable vaccines are not currently available.
Example 4A recombinant cDNA to the genome of NDV strain Beaudette C having a foreign gene, a gene encoding green fluorescent protein (GFP), inserted between P and M genes was prepared by inserting the GFP gene into the noncoding region of P gene after the P gene ORF and stop codon, but before the P gene GE signal (see
- Alexander, D. J. (1997). Newcastle disease and other avian Paramyxoviridae infections. In Diseases of Poultry, 10th edition, pp. 541-569. Edited by B. W. Calnek, Iowa State University Press, Ames, Iowa.
- Byrappa, S., Gavin, D. K. & Gupta, K. C. (1995). A highly efficient procedure for site-specific mutagenesis of full-length plasmids using Vent DNA polymerase. Genome Research 5, 404-407.
- Conzelmann, K.-K. (1996). Genetic manipulation of non-segmented negative-strand RNA viruses. Journal of General Virology 77, 381-389.
- de Leeuw, O. & Peeters, B. (1999). Complete nucleotide sequence of Newcastle disease virus: evidence for the existence of a new genus within the subfamily Paramyxovirinae. Journal of General Virology 80, 131-136.
- Kingsbury, D. W. (1966). Newcastle disease virus. I. Isolation and preliminary characterization of RNA from virus particles. Journal of Molecular Biology 18, 195-203.
- Krishnamurthy, S. & Samal, S. K. (1998). Nucleotide sequences of the trailer, nucleocapsid protein gene and intergenic regions of Newcastle disease virus strain Beaudette C and completion of the entire genome sequence. Journal of General Virology 79, 2419-2424.
- Peeters, B. P., de Leeuw, O. S., Koch, G. & Gielkens, A. L. (1999). Rescue of Newcastle disease virus from cloned cDNA: evidence that cleavability of the fusion protein is a major determinant for virulence. Journal of Virology 73, 5001-5009.
- Phillips, R. J., Samson, A. R. & Emmerson, P. T. (1998). Nucleotide sequence of the 5′-terminus of Newcastle disease virus and assembly of the complete genomic sequence: agreement with the ‘rule of six’. Archives of Virology 143, 1993-2002.
- Römer-Oberdörfer, A., Mundt, E., Mebatsion, T., Buchholz, U. J. & Mettenleiter, T. C. (1999). Generation of recombinant lentogenic Newcastle disease virus from cDNA. Journal of General Virology 80, 2987-2995.
- Steward, M., Vipond, I. B., Millar, N. S. & Emmerson, P. T. (1993). RNA editing in Newcastle disease virus. Journal of General Virology 74, 2539-2547.
Claims
1. An antigenomic RNA of Newcastle disease virus, consisting of:
- NP gene, P gene, M gene, F gene, HN gene and L gene in this order from a 5′ to 3′ direction, a 55 nucleotide 3′ leader, a 113 nucleotide 5′ terminus, and n foreign nucleotide complexes inserted (a) before the NP gene, (b) between the P and M genes, and/or (c) between the HN and L genes, wherein n is 1, 2, 3 or 4;
- each of the foreign nucleotide complexes comprising a Newcastle disease virus gene start sequence, an open reading frame of a foreign gene and a Newcastle disease virus gene end sequence in this order from the 5′ to 3′ direction, wherein the foreign gene is a gene not found naturally in the Newcastle disease virus;
- wherein when 2, 3 or 4 foreign nucleotide complexes are inserted together before the NP gene, between the P and M genes, or between the HN and L genes, the foreign nucleotide complexes are sequentially linked directly or indirectly;
- wherein the antigenomic RNA of Newcastle disease virus has a length of m nucleotides, wherein m is a multiple of 6,
- wherein three G residues are inserted before the 5′ terminus, and
- wherein the Newcastle disease virus has an F0 protein cleavage site having at least two less basic amino acid residues than an F0 protein cleavage site of a virulent strain of Newcastle disease virus, wherein codons of non-basic amino acid residues replacing the at least two basic amino acid residues are different from codons of the basic amino acid residues by at least two nucleotides, and wherein an amino acid having a non-aromatic side chain at the N terminus of an F1 cleavage fragment is glycine, alanine, valine, leucine or isoleucine.
2. The antigenome RNA of claim 1, wherein n is 2, 3 or 4 and the foreign nucleotide complexes are different.
3. The antigenome RNA of claim 1, wherein n is 2, 3 or 4 and the foreign nucleotide complexes are the same.
4. The antigenome RNA of claim 1, wherein n is 1 or 2.
5. The antigenome RNA of claim 4, wherein n is 2 and the foreign nucleotide complexes are different.
6. The antigenome RNA of claim 4, wherein n is 2 and the foreign nucleotide complexes are the same.
7. The antigenome RNA of claim 1, wherein the length of the open reading frame of the foreign gene is no more than about 3000 nucleotides.
8. The antigenome RNA of claim 7, wherein the length of the open reading frame of the foreign gene is no more than about 1500 nucleotides.
9. The antigenome RNA of claim 8, wherein the length of the open reading frame of the foreign gene is no more than about 1000 nucleotides.
10. The antigenome RNA of claim 9, wherein the length of the open reading frame of the foreign gene is no more than about 800 nucleotides.
11. The antigenome RNA of claim 10, wherein the length of the open reading frame of the foreign gene is no more than about 500 nucleotides.
12. The antigenome RNA of claim 11, wherein the length of the open reading frame of the foreign gene is no more than about 300 nucleotides.
13. The antigenome RNA of claim 1, wherein 2, 3 or 4 foreign nucleotide complexes are inserted together before the NP gene, between the P and M genes, or between the HN and L genes, the sequentially linked foreign nucleotide complexes having a combined length of no more than about 5000 nucleotides.
14. The antigenomic RNA of claim 13, wherein the sequentially linked foreign nucleotide complexes have a combined length of no more than about 2000 nucleotides.
15. The antigenomic RNA of claim 14, wherein the sequentially linked foreign nucleotide complexes have a combined length of no more than about 1000 nucleotides.
16. The antigenomic RNA of claim 15, wherein the sequentially linked foreign nucleotide complexes have a combined length of no more than about 800 nucleotides.
17. The antigenomic RNA of claim 1, wherein the foreign genes of the foreign nucleotide complexes are selected from the group consisting of genes encoding chloramphenical acetyltransferase, green fluorescent protein, an avian cytokine, and an immunogenic protein of a virus selected from the group consisting of influenza virus, infectious bursal disease virus, rotavirus, infectious bronchitis virus, infectious laryngotracheitis virus, chicken anemia virus, Marek's disease virus, avian leukosis virus, avian adenovirus, and avian pneumovirus.
18. The antigenomic RNA of claim 1, wherein the foreign genes of the foreign nucleotide complexes encode chloramphenical acetyltransferase.
19. The antigenomic RNA of claim 1, wherein the foreign genes of the foreign nucleotide complexes encode the same or different avian cytokines.
20. The antigenomic RNA of claim 19, wherein the avian cytokines are avian interleukins.
21. The antigenomic RNA of claim 20, wherein the avian cytokines are avian IL-2 and/or IL-4.
22. The antigenomic RNA of claim 1, wherein the foreign genes of the foreign nucleotide complexes encode an immunogenic protein of the same or different viruses selected from the group consisting of influenza virus, infectious bursal disease virus, rotavirus, infectious bronchitis virus, infectious laryngotracheitis virus, chicken anemia virus, Marek's disease virus, avian leukosis virus, avian adenovirus and avian pneumovirus.
23. The antigenomic RNA of claim 1, wherein the n foreign nucleotide complexes are inserted (a) before the NP gene, and/or (b) between the P and M genes.
24. The antigenomic RNA of claim 23, wherein the n foreign nucleotide complexes are inserted before the NP gene.
25. The antigenome RNA of claim 24, wherein 2, 3 or 4 foreign nucleotide complexes are inserted together before the NP gene, the sequentially linked foreign nucleotide complexes having a combined length of no more than about 4000 nucleotides.
26. The antigenomic RNA of claim 25, wherein the sequentially linked foreign nucleotide complexes have a combined length of no more than about 2000 nucleotides.
27. The antigenomic RNA of claim 26, wherein the sequentially linked foreign nucleotide complexes have a combined length of no more than about 1000 nucleotides.
28. The antigenomic RNA of claim 27, wherein the sequentially linked foreign nucleotide complexes have a combined length of no more than about 800 nucleotides.
29. The antigenomic RNA of claim 23, wherein the n foreign nucleotide complexes are inserted between the P and M genes.
30. The antigenomic RNA of claim 29, wherein the sequentially linked foreign nucleotide complexes have a combined length of no more than about 4000 nucleotides.
31. The antigenomic RNA of claim 30, wherein the sequentially linked foreign nucleotide complexes have a combined length of no more than about 2000 nucleotides.
32. The antigenomic RNA of claim 31, wherein the sequentially linked foreign nucleotide complexes have a combined length of no more than about 1000 nucleotides.
33. The antigenomic RNA of claim 32, wherein the sequentially linked foreign nucleotide complexes have a combined length of no more than about 800 nucleotides.
34. The antigenomic RNA of claim 18, wherein n is 1.
35. The antigenomic RNA of claim 19, wherein n is 1.
36. The antigenomic RNA of claim 22, wherein n is 1.
37. The antigenomic RNA of claim 24, wherein n is 1.
38. The antigenomic RNA of claim 37, wherein the open reading frame of the foreign gene encodes chloramphenicol acetyltransferase.
39. The antigenomic RNA of claim 37, wherein the open reading frame of the foreign gene encodes an avian cytokine.
40. The antigenomic RNA of claim 39, wherein the avian cytokine is an avian interleukin.
41. The antigenomic RNA of claim 40, wherein the avian interleukin is IL-2 or IL-4.
42. The antigenomic RNA of claim 1, wherein at least one of the foreign nucleotide complexes contain foreign gene encoding an immunogenic protein of a non-avian pathogen.
43. The antigenomic RNA of claim 42, wherein the non-avian pathogen is a virus selected from the group consisting of influenza virus, SARS-causing virus, human respiratory syncytial virus, human immunodeficiency virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, poliovirus, rabies virus, Hendra virus, Nipah virus, human parainfluenza 3 virus, measles virus, mumps virus, Ebola virus, Marburg virus, West Nile virus, Japanese encephalitis virus, Dengue virus, Hantavirus, Rift Valley fever virus, Lassa fever virus, herpes simplex virus and yellow fever virus.
44. A plasmid comprising a cDNA that encodes for an antigenomic RNA comprising:
- NP gene, P gene, M gene, F gene, HN gene and L gene in this order from a 5′ to 3′ direction, a 55 nucleotide 3′ leader, a 113 nucleotide 5′ terminus, and n foreign nucleotide complexes inserted (a) before the NP gene, (b) between the P and M genes, and/or (c) between the HN and L genes, wherein n is 1, 2, 3 or 4;
- each of the foreign nucleotide complexes comprising a Newcastle disease virus gene start sequence, an open reading frame of a foreign gene and a Newcastle disease virus gene end sequence in this order from the 5′ to 3′ direction, wherein the foreign gene is a gene not found naturally in the Newcastle disease virus;
- wherein when 2, 3 or 4 foreign nucleotide complexes are inserted together before the NP gene, between the P and M genes, or between the HN and L genes, the foreign nucleotide complexes are sequentially linked directly or indirectly;
- wherein the antigenomic RNA of Newcastle disease virus has a length of m nucleotides, wherein m is a multiple of 6,
- wherein three G residues are inserted before the 5′ terminus; and
- wherein the Newcastle disease virus comprises an F0 protein cleavage site having at least two less basic amino acid residues than an F0 protein cleavage site of a virulent strain of Newcastle disease virus, wherein codons of non-basic amino acid residues replacing the at least two basic amino acid residues are different from codons of the basic amino acid residues by at least two nucleotides, and wherein an amino acid having a non-aromatic side chain at the N terminus of an F1 cleavage fragment is glycine, alanine, valine, leucine or isoleucine.
45. A cell comprising the plasmid of claim 44.
46. A cell comprising the antigenomic RNA of claim 1.
47. The antigenomic RNA of claim 1, wherein at least one of the foreign nucleotide complexes is inserted before the NP gene.
48. The antigenomic RNA of claim 1, wherein at least one of the foreign nucleotide complexes is inserted before the NP gene and at least one of the foreign nucleotide complexes is inserted between the P and M genes.
49. The antigenomic RNA of claim 1, wherein at least one of the foreign nucleotide complexes is inserted before the NP gene and at least one of the foreign nucleotide complexes is inserted between the HN and L genes.
50. The antigenomic RNA of claim 1, wherein at least one of the foreign nucleotide complexes is inserted before the NP gene, at least one of the foreign nucleotide complexes is inserted between the P and M genes, and at least one of the foreign nucleotide complexes is inserted between the HN and L genes.
51. The antigenomic RNA of claim 1, wherein at least one of the foreign nucleotide complexes is inserted between the P and M genes.
52. The antigenomic RNA of claim 1, further comprising at least one intergenic region selected from the group consisting of a NP-P intergenic region between the NP and P genes, a P-M intergenic region between the P and M genes, a M-F intergenic region between the M and F genes, a F-HN intergenic region between the F and HN genes, and a HN-L intergenic region between the HN and L genes.
53. The antigenomic RNA of claim 1, further comprising a NP-P intergenic region between the NP and P genes, a P-M intergenic region between the P and M genes, a M-F intergenic region between the M and F genes, a F-HN intergenic region between the F and HN genes, and a HN-L intergenic region between the HN and L genes.
54. The antigenomic RNA of claim 1, wherein the foreign gene of at least one of the foreign nucleotide complexes encodes a tumor antigen.
55. The antigenomic RNA of claim 54, wherein the tumor antigen is selected from the group consisting of pg100, MAGE1, MAGE3 and CDK4.
56. A recombinant Newcastle disease virus comprising the antigenomic RNA of claim 1, wherein the foreign genes of the foreign nucleotide complexes encode an immunogenic protein of infectious bursal disease.
57. The antigenomic RNA of claim 1, wherein at least one foreign nucleotide complex is inserted between the P and M genes and at least one foreign nucleotide complex is inserted before the NP gene.
58. The antigenomic RNA of claim 18, wherein the foreign genes of the foreign nucleotide complexes that encode chloramphenical acetyltransferase are inserted between the HN and L genes and before the NP gene.
59. The antigenomic RNA of claim 17, wherein the foreign genes of the foreign nucleotide complexes encode green fluorescent protein.
60. The antigenomic RNA of claim 59, wherein the foreign genes of the foreign nucleotide complexes that encode green fluorescent protein are inserted between the P and M genes.
| 6121416 | September 19, 2000 | Clark et al. |
| 6146642 | November 14, 2000 | Garcia-Sastre et al. |
| 6451323 | September 17, 2002 | Garcia-Sastre et al. |
| 7244558 | July 17, 2007 | Samal et al. |
- Krishnamurthy et al. (Journal of General Medicine, 1998, vol. 79, p. 2419-2424).
- Krishnamurthy et al. (Virology, 2000, vol. 278, p. 168-182).
- Philippe Calain and Laurent Roux, “The Rule of Six, a Basic Feature for Efficient Replication of Sendai Virus Defective Interfering RNA,” Journal of Virology, Aug. 1993, pp. 4822-2830, vol. 67, No. 8.
- Robert A. Lamb and Griffith D. Parks, “Paramyxoviridae: The Viruses and Their Replication,” Chapter 41, Section II: Specific Virus Families, pp. 1449-1496.
- B.P.H. Peeters et al., “Genome replication o fNewcastle disease virus: involvement of the rule-of-six,” Arch Virol (2000) 145: pp. 1829-1845.
- Siba K. Samal and Peter L. Collins, “RNA Replication by a Respiratory Syncytial Virus RNA Analog Does Not Obey the Rule of Six and Retains a Nonviral Trinucleotide Extension at the Leader End,” Journal of Virology, Aug. 1996, pp. 5075-5082, vol. 70, No. 8.
- Collins, et al. (PNAS, 1995, vol. 92, pp. 11563-11567).
- Phillips, et al. (Archives in Virology, 1998, vol. 143, pp. 1993-2002.
- Fahey, et al. Journal of General Virology, 1989, vol. 70, pp. 1473-1481.
- Peeters, et al. Gerneration of a recombinant chimeric Newcastle disease virus vaccine that allows serological differentiation between accinated and infected nimals. (Feb. 2001) Vaccine 19, pp. 1616-1627.
- Mebastion, et al. A recombinant Newcastle Disease Virus with Low-Level V protein expressions is immunogenic and lacks pathogenicity for chicken embryos. (Jan. 2001) Journal of Virology, pp. 420-428.
- Darteil, et al. Herpesvirus of turkey recombinant viruses expressing infectious bursal disease virus (IBVD) VP2 immunogen induce protection against an IBVD virulent challenge in chickens. (1995) Virology 211, pp. 481-490.
- Huang, et al. Recombinant Newcastle disease virus as a vaccine vector. (2002) Poultry Science, pp. 899-906.
- Yusoff, K. et al., “Location of Neutralizing Epitopes on the Fusion Protein of Newcastle Disease Virus Strain Beaudette C”, J. Gen. Virol. 1989, vol. 70, pp. 3105-3109.
- Krishnamurthy, S. et al., “Nucleotide Sequences of the Trailer, Nucleocapsid Protein gene and Intergenic regions of Newcastle Disease Virus Strain Beaudette C and Completion of the Entire Genome Sequence”, Journal of General Virology, 1998, vol. 79, pp. 2419-2424.
- Schaper, U.M. et al., “Nucleotide Sequence of the Envelope Protein genes of a Highly Virulent, Neurotropic strain of Newcastle Disease Virus”, Virology, 1988, vol. 165, pp. 291-295.
- Yusoff, K. et al., “Nucleotide Sequence Analysis of the L Gene of Newcastle Disease Virus: Homologies with Sendai and Vesicular Stomatitis Viruses”, Nucleic Acids Research 1987, vol. 15, No. 10, pp. 3961-3976.
- Daskalakis, S. et al., “Nucleotide Sequence of the Phosphoprotein (P) Gene of Newcastle Disease Virus (Strain Beaudette C)”, Nucleic Acids Research, 1992, vol. 20, No. 3, p. 616.
Type: Grant
Filed: Jul 21, 2011
Date of Patent: Oct 25, 2016
Patent Publication Number: 20120064112
Assignee: The University of Maryland, College Park (College Park, MD)
Inventors: Siba K. Samal (College Park, MD), Zhuhui Huang (College Park, MD)
Primary Examiner: Agnieszka Boesen
Application Number: 13/188,392
International Classification: A61K 39/295 (20060101); C12N 15/63 (20060101); A61P 31/12 (20060101); C12N 7/00 (20060101); C12N 15/86 (20060101); A61K 39/00 (20060101);