plant named ‘Dorris’

A new and distinct cultivar of Corylus plant named ‘Dorris’ characterized by a spreading plant habit and low vigor, yellowish-green developing and fully expanded leaves during the spring and summer, resistance to eastern filbert blight caused by the fungus Anisogramma anomala (Peck) E. Müller, presence of random amplified polymorphic DNA markers 152-800 and 268-580, expression of incompatibility alleles S1 and S12 in the styles, and DNA fingerprints at 14 of 24 microsatellite marker loci differ from both parents OSU 309.074 and ‘Delta’, and from one parent at an additional 9 marker loci.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
ACKNOWLEDGMENT OF GOVERNMENT SUPPORT

This invention was made with government support under Specific Cooperative Agreement No. 58-5358-4542 awarded by the United States Department of Agriculture. The government has certain rights in the invention.

Botanical denomination: Corylus avellana.

Variety designation: ‘Dorris’.

BACKGROUND

The present invention relates to a new and distinct cultivar of Corylus plant, (hazelnut, filbert) botanically known as Corylus avellana, and hereinafter referred to by the name ‘Dorris’. Corylus avellana is in the family Betulaceae.

The new Corylus resulted from a controlled cross of female parent OSU 309.074 (unpatented) and male parent ‘Delta’ (unpatented) made in 1997 by Shawn A. Mehlenbacher and David C. Smith. Hybrid seeds from the cross were harvested in August 1997, stratified, and seedlings grown in the greenhouse during the summer of 1998. From this cross, a total of 307 seedling trees were planted in the field in Corvallis, Oreg., USA in October, 1998. ‘Dorris’ was discovered and selected by the Inventors as a single plant within the progeny of the stated cross-pollination in a controlled environment in Corvallis, Oreg.

‘Dorris’ was originally assigned the designation OSU 876.041, which indicates the row and tree location of the original seedling. OSU 309.074 is from a cross of ‘Tonda Gentile delle Langhe’ (unpatented)×OSU 23.017 (unpatented). ‘Tonda Gentile delle Langhe’ is an important cultivar in Piemonte, northern Italy. OSU 23.017 is from a cross of ‘Barcelona’ (unpatented)בExtra Ghiaghli’ (unpatented). ‘Extra Ghiaghli’, obtained from Greece, is a clone of the important Turkish cultivar ‘Tombul’ (unpatented). ‘Delta’ was released by the Oregon Agricultural Experiment Station in 2002.

The new cultivar was asexually reproduced by rooted suckers annually for eight years (2003-2010) in Corvallis, Oreg. The new cultivar was also asexually propagated by whip grafting in 2004 in Corvallis, Oreg. The unique features of this new Corylus are stable and reproduced true-to-type in successive generations of asexual reproduction.

SUMMARY OF THE INVENTION

The following traits have been repeatedly observed and are determined to be the unique characteristics of ‘Dorris’. These characteristics in combination distinguish ‘Dorris’ as a new and distinct cultivar:

    • 1. Spreading plant habit and low vigor.
    • 2. Yellowish-green developing and fully expanded leaves during the spring and summer.
    • 3. Resistance to eastern filbert blight caused by the fungus Anisogramma anomala (Peck) E. Müller.
    • 4. Presence of random amplified polymorphic DNA markers 152-800 and 268-580 in DNA of ‘Dorris’ amplified by the polymerase chain reaction. These two markers are linked to a dominant allele for resistance to eastern filbert blight from the cultivar Gasaway (unpatented).
    • 5. Expression of incompatibility alleles S1 and S12 in the styles,
    • 6. DNA fingerprints at 14 of 24 microsatellite marker loci differ from both parents OSU 309.074 and ‘Delta’, and from one parent at an additional 9 marker loci. The microsatellite primers are shown in Table 1, and allele sizes are shown in Table 2. DNA fingerprints of grandparent ‘Tonda Gentile delle Langhe’ and great-grandparents ‘Barcelona’ and ‘Extra Ghiaghli’ are also shown in attached Table 2.

In comparisons in two replicated trials conducted in Corvallis, Oreg., plants of the new Corylus differed from plants of the Corylus avellana cultivar Barcelona (unpatented), and other cultivars and selections of Corylus avellana known to the Inventors primarily in nut size, nut shape, kernel percentage (ratio of kernel weight to nut weight), frequency of blank nuts (nuts lacking kernels), time of pollen shed, time of nut maturity, length of the husk or involucre, and plant size.

BRIEF DESCRIPTION OF THE DRAWINGS

The accompanying colored photographs illustrate the overall appearance of the new cultivar, showing the colors as true as it is reasonably possible to obtain in colored reproductions of this type. Foliage colors in the photographs may differ slightly from the color values cited in the detailed botanical description which accurately describe the colors of the new Corylus.

FIG. 1 shows a tree of the new cultivar ‘Dorris’ growing in a field in the summer, in Corvallis, Oreg.

FIG. 2 shows the tree of the new cultivar ‘Dorris’ growing in a field in January, in Corvallis, Oreg.

FIG. 3 shows typical nuts, raw kernels, and blanched kernels of ‘Dorris’ hazelnut compared to those of ‘Jefferson’ hazelnut.

FIG. 4 shows husks of ‘Dorris’ hazelnut tree.

FIG. 5 shows the typical nuts, raw kernels, and blanched kernels of ‘Dorris’ hazelnut compared to those of ‘Barcelona’ hazelnut and other hazelnut cultivars.

 DETAILED PLANT DESCRIPTION

The cultivar Dorris has not been observed under all possible environmental conditions. The phenotype may vary somewhat with variations in environment such as temperature and light intensity, without, however, any variance in genotype. The aforementioned photographs and following observations and measurements describe plants grown in Corvallis, Oreg. under commercial practice outdoors in the field during the fall, winter and spring. Plants used for the photographs and description were propagated by tie-off layerage and growing on their own roots, and about seven years old. In the following description, color references are made to The Royal Horticultural Society Colour Chart, 1966 Edition, except where general terms of ordinary dictionary significance are used.

  • Botanical classification: Corylus avellana cultivar Dorris.
  • Parentage:
      • Female, or seed, parent.—Corylus avellana selection 309.074 (unpatented).
      • Male, or pollen, parent.—Corylus avellana cultivar Delta (unpatented).
  • Propagation (type rooted suckers):
      • Time to initiate roots.—About 30 days at 20° C.
      • Time to produce a rooted young plant.—About six months at 22° C.
      • Root description.—Fine to thick; freely branching; creamy white in color.
  • Propagation (type whip grafting):
      • Time to budbreak on the scions.—Bout 14 days at 25° C.
      • Time to produce a grafted plant.—About six months at 25° C.
  • Plant description:
      • General appearance.—Perennial shrub. Spreading plant habit.
      • Growth and branching habit.—Freely branching; about 15 lateral branches develop per plant. Pinching, i.e., removal of the terminal apices, enhances branching with lateral branches potentially forming at every node.
      • Size.—Plant height is about 4 meters; plant diameter or spread is about 5 meters.
      • Vigor.—low vigor growth habit.
      • Lenticels.—8 circular within 1 square centimeter (counted on dormant scions).
  • Lateral branch description:
      • Length.—About 32 cm.
      • Diameter.—About 6 mm.
      • Internode length.—About 3.0 cm.
      • Texture.—Smooth, glabrous.
      • Strength.—Strong.
      • Color.—Immature — 152B; mature — 152B.
  • Foliage description:
      • Arrangement.—Alternate, simple.
      • Length.—About 10.2 cm.
      • Width.—About 9.1 cm.
      • Shape.—Oblong to ovate.
      • Apex.—Obtuse to acute.
      • Base.—Cordate.
      • Margin.—Serrate.
      • Texture.—Upper and lower surfaces — slightly pubescent.
      • Venation pattern.—Pinnate.
      • Leaf bud shape.—Globular.
      • Time of leaf bud burst.—Midseason, 11 days after ‘Barcelona’.
      • Color.—Developing foliage, upper surface 144A, lower surfaces: 187A. Fully expanded foliage, upper surface: Spring and summer, 143A; late summer and fall, 143A. Fully expanded foliage, lower surface: Spring and summer, 139C; late summer and fall, 139C. Venation, upper surface: Spring and summer, 139C; late summer and fall, 139C. Venation, lower surface: Spring and summer, 139D; late summer and fall, 139D. Leaf bud, 179C.
  • Petiole description:
      • Length.—About 2.7 cm.
      • Diameter.—About 1.8 mm.
      • Texture.—Upper and lower surfaces — pubescent.
      • Color.—Upper surface: Spring and summer, 139D; late summer and fall, 139D. lower surface: Spring and summer, 139D; late summer and fall, 139D.
  • Flower description:
      • Male inflorescences.—Catkins, color prior to elongation 194C.
      • Female inflorescence.—Style color 048B.
      • Stigma coloration.—048B.
      • Time of female flowering.—Midseason, 2 weeks after ‘Barcelona’.
      • Time of pollen shed.—Midseason, around the same time as ‘Daviana’ (unpatented).
  • Involcure description:
      • Involucre constriction.—Absent.
      • Involucre length.—25% longer than nuts.
      • Strength of serration of indentation.—Moderate.
      • Pubescence.—Little.
      • Thickness of callus at base.—Moderate callus at base similar to ‘Barcelona’.
      • Description of jointing of bracts.—Involucre slit to the base on one side. Involucre does not adhere to nut after drop. 90% of nuts fall free of the husk. A few nuts are in tubular husks.
  • Nut description:
      • Length.—About 19.1 mm.
      • Width.—About 20.7 mm.
      • Depth.—About 18.2 mm.
      • Nut shape.—Round.
      • Nut shape index [(width+depth)/2*length].—1.02.
      • Nut compression index (width/depth).—1.14.
      • Nut shell color.—164B.
      • Nut weight.—About 3.35 grams to 3.39 grams.
      • Predominant number of fruits per cluster.—2-3 nuts per cluster.
      • Stripes on shell.—None.
      • Fruit apex.—Slight (not prominent).
      • Size of the fruit pistil scar.—Small (˜1 mm×2 mm).
      • Nut curvature of the basal scar.—Flat (plane).
      • Frequency of blank nuts.—7%.
      • Time of nut maturity.—About same time as ‘Barcelona’ (unpatented).
      • Husk length.—About 25% longer than the nuts.
      • Kernel weight.—About 1.40 grams.
      • Kernel percentage (kernel weight/nut weight).—About 43%.
      • Kernel shape.—Round-oblate.
      • Kernel cross section shape.—Circular.
      • Kernel base shape.—Flat.
      • Lateral grooves.—Rare and not prominent in the kernel.
  • Disease/pest resistance: Plants of the new Corylus are highly resistant to eastern filbert blight caused by the fungus Anisogramma anomala (Peck) E. Müller. Plants of the new Corylus are highly resistant to bud mites (Phytoptus avellanae Nal.), while plants of ‘Tonda Gentile delle Langhe’ are highly susceptible, and plants of ‘Barcelona’ are highly resistant.
  • Temperature tolerance: Tolerates temperatures from −10 to 38° C. in the field in Corvallis, Oreg.

TABLE 1 Primers and annealing temperatures for the 24 microsatellite marker loci used to fingerprint ‘Dorris’ and other hazelnut cultivars. Repeat Locus motif Size Ta n He Ho A613 (TC)13(CA)12 149-177 60 14 0.85 0.85 A614 (TC)17(CA)10 125-156 60 14 0.85 0.85 NNN(CA)6 A616 (AC)11 136-162 60 13 0.85 0.85 A640 (CT)15 354-378 67 11 0.80 0.73 (CA)13 B107 (CT)14 112-151 55 14 0.85 0.80 B617 (GA)15 280-298 60 9 0.80 0.78 B619 (TC)21 146-180 60 14 0.88 0.88 B634 (AG)15 218-238 60 9 0.76 0.76 B657 (AG)15 210-228 60 8 0.84 0.98 B671 (AG)6NN 221-249 60 13 0.86 0.88 (GA)17 B709 (GA)21 219-233 60 8 0.74 0.76 B733 (TC)15 161-183 60 8 0.68 0.68 B741 (GT)5(GA)12 176-194 60 10 0.77 0.78 B749 (TC)12 200-210 60 6 0.60 0.64 B751 (GA)15 141-153 60 7 0.80 0.80 B774 (AG)15 195-213 60 8 0.80 0.80 B776 (GA)17 134-148 60 7 0.71 0.60 B795 (TC)8Ns(CT)7 296-332 60 12 0.76 0.74 Ns(CT)10 Ns(TC)5 C115 (TAA)5 167-226 60 14 0.80 0.80 (GAA)12 KG809 (AGG)6 333-345 55 5 0.66 0.64 KG811 (GA)17 240-278 58 12 0.83 0.82 KG827 (CT)13AA 264-282 67 9 0.78 0.84 (CA)7 KG830 (CT)14 279-311 67 9 0.79 0.78 GTATT (CA)8 Soman- (AAT)5 54 3 0.60 0.98 G Locus PIC r  LG Primers 5′-3′ A613 0.85 0.00 11 Ned-CACACGCCTTGTCACTCT TT (SEQ ID NO: 1) A614 0.84 0.00 6 Hex-TGGCAGAGCTTTGTCAGC TT (SEQ ID NO: 3) A616 0.83 0.00 8 Fam-CACTCATACCGCAAACTC CA (SEQ ID NO: 5) A640 0.7 0.04 10 F-TGCCTCTGCAGTTAGTCATC AAATGTAGG (SEQ ID NO: 7) B107 0.83 0.02 10 Ned-GTAGGTGCACTTGATGTG CTTTAC (SEQ ID NO: 9) B617 0.78 0.01 8 Fam-TCCGTGTTGAGTATGGAC GA (SEQ ID NO: 11) B619 0.7 0.00 3 Fam-AGTCGGCTCCCCTTTTCT C (SEQ ID NO: 13) B634 0.73 0.00 4 Hex-CCTGCATCCAGGACTCAT TA 60 (SEQ ID NO: 15) B657 0.82 −0.08 11 Ned-GAGAGTGCGTCTTCCTCT GG (SEQ ID NO: 17) B671 0.84 −0.01 9 Hex-TTGCCAGTGCATACTCTG AT G (SEQ ID NO: 19) B709 0.70 −0.01 5 Ned-CCAAGCACGAATGAACTC AA (SEQ ID NO: 21) B733 0.63 0.00 7.2 Ned-CACCCTCTTCACCACCTC AT (SEQ ID NO: 23) B741 0.74 0.00 5 Fam-GTTCACAGGCTGTTGGGT TT (SEQ ID NO: 25) B749 0.51 −0.03 1 Hex-GGCTGACAACACAGCAGA AA (SEQ ID NO: 27) B751 0.77 0.01 7.2 Fam-AGCTGGTTCTTCGACATT CC (SEQ ID NO: 29) B774 0.77 0.01 5 Ned-GTTTTGCGAGCTCATTGT CA (SEQ ID NO: 31) B776 0.67 0.07 6 Fam-TGTATGTACACACGGAGA GAGAGA (SEQ ID NO: 33) B795 0.74 0.01 NA Fam-GACCCACAAACAATAACC TATCTC (SEQ ID NO: 35) C115 0.77 0.00 4 Fam-ATTTTCCGCAGATAATAC AGG (SEQ ID NO: 37) KG809 0.60 0.01 4 Hex-AGGCATCAGTTCATCCAA (SEQ ID NO: 39) KG811 0.81 0.01 2 Ned-AAGGCGGCACTCGCTCAC (SEQ ID NO: 41) KG827 0.75 −0.04 9 Fam-AGAACTCCGACTAATAAT CCTAACCCTTGC (SEQ ID NO: 43) KG830 0.76 0.00 9 Ned-TGGAGGAAGTTTTGAATG GTAGTAGAGGA (SEQ ID NO: 45) Soman-G 0.51 −0.27 NA Hex-TGGCGTTGCAACATATTC TC (SEQ ID NO: 47) Locus Primers 5′-3′ Reference A613 R-CCCCTTTCACATGTTTGCTT Gurcan et al. (SEQ ID NO: 2) 2010 A614 R-GCAGTGGAGGATTGCTGACT Gurcan et al. (SEQ ID NO: 4) 2010 A616 R-ATGGCTTTTGCTTCGTTTTG Gurcan et al. (SEQ ID NO: 6) 2010 A640 Fam-CGCCATATAATTGGGATG Gurcan et al. CTTGTTG (SEQ ID NO: 8)  2010 B107 R-AACACCATATTGAGTCTTTC Boccacci et al. AAAGC (SEQ ID NO: 10) 2005; Gokirmak et al. 2009 B617 R TGTTTTTGGTGGAGCGATG Gurcan et al. (SEQ ID NO: 12) 2010 B619 R-GCGATCTGACCTCATTTTTG Gurcan et al. (SEQ ID NO: 14) 2010 B634 R-GTGCAGAGGTTGCACTCAAA Gurcan et al. (SEQ ID NO: 16) 2010 B657 R-AGCCTCACCTCCAACGAAC Gurcan et al. (SEQ ID NO: 18) 2010 B671 R-ACCAGCTCTGGGCTTAACAC Gurcan et al. (SEQ ID NO: 20) 2010 B709 R-GCGGGTTCTCGTTGTACACT Gurcan et al. (SEQ ID NO: 22) 2010 B733 R-CATCCCCTGTTGGAGTTTTC Gurcan et al. (SEQ ID NO: 24) 2010 B741 R-CGTGTTGCTCATGTGTTGTG Gurcan et al. (SEQ ID NO: 26) 2010 B749 R-TCGGCTAGGGTTAGGGTTTT Gurcan et al. (SEQ ID NO: 28 2010 B751 R-AAACTCAAATAAAACCCCTG Gurcan et al. CTC (SEQ ID NO: 30) 2010 B774 R-TGTGTGTGGTCTGTAGGCACT Gurcan et al. (SEQ ID NO: 32) 2010 B776 R-TGAGGGGAAGAGGTTTGATG Gurcan et al. (SEQ ID NO: 34) 2010 B795 R-TGGGCATCATCCAGGTCTA Gurcan et al. (SEQ ID NO: 36) 2010 C115 GTTTCCAGATCTGCCTCCATATAA Bassil et al. T (SEQ ID NO: 38) 2005b,  Gokirmak et al. 2009 KG809 F-GGAAGGTGAGAGAAATCAAGT Gurcan and (SEQ ID NO: 40) Mehlenbacher 2010 KG811 F-GAACAACTGAAGACAGCAAAG Gurcan and (SEQ ID NO: 42) Mehlenbacher 2010 KG827 GAGGGAGCAAQTCAAAGTTGAGA Gurcan and AGAAA (SEQ ID NO: 44) Mehlenbacher 2010 KG830 AAAGCAACTCATAGCTGAAGTCCA Gurcan and ATCA (SEQ ID NO: 46) Mehlenbacher 2010 Soman-G R-GCCATCTTTAGAAAGTTCGATA unpublished CAG (SEQ ID NO: 48) Primer fluorescent tags are FAM, HEX, and NED. Ta: annealing temperature (° C.) N: number of alleles He: expected heterozygosity Ho: observed heterozygosity PIC: polymorphism information content r: estimated null allele frequency LG: linkage group

TABLE 2 Allele sizes in ‘Dorris’ and other hazelnut cultivars at 24 microsatellite loci. ‘Tonda Gentile Tag Locus ‘Dorris’ ‘309.074’ ‘Delta’ delle Langhe’ NED A613 149/167 157/167 149/177 151/157 HEX A614 132/158 125/132 143/158 125/135 FAM A616 148/150 148/158 150/150 148/150 FAM A640 372/374 368/374 362/372 354/368 NED B107 112/122 112/152 122/130 134/152 FAM B617 286/296 294/296 286/286 286/296 FAM B619 156/164 164/174 156/164 148/164 HEX B634 226/226 226/226 226/234 226/226 NED B657 210/226 210/226 222/226 218/226 HEX B671 227/247 227/237 235/247 237/241 NED B709 227/227 227/227 227/227 227/227 NED B733 171/179 171/173 173/179 171/173 FAM B741 177/186 177/177 177/186 177/184 HEX B749 206/206 206/208 206/208 206/208 FAM B751 143/151 143/153 143/151 149/153 NED B774 203/207 203/203 207/213 203/211 FAM B776 137/137 137/137 137/150 137/137 FAM B795 330/330 330/330 314/330 312/330 FAM C115 194/215 173/194 197/215 173/173 HEX KG809 336/345 336/339 345/345 336/339 NED KG811 254/264 242/254 254/264 254/264 FAM KG827 270/282 268/282 270/270 266/268 NED KG830 295/297 291/295 291/297 291/295 HEX SM NG 196/200 196/200 196/196 196/200 Tag Locus ‘Barcelona’ ‘Extra Ghiaghli’ ‘Gasaway’ NED A613 151/159 167/169 159/161 HEX A614 125/131 125/150 143/158 FAM A616 142/150 150/158 148/148 FAM A640 354/374 374/374 362/368 NED B107 112/134 116/116 122/128 FAM B617 286/290 294/296 292/296 FAM B619 156/170 164/174 170/174 HEX B634 226/226 226/226 220/232 NED B657 218/222 210/222 224/228 HEX B671 223/227 227/247 235/247 NED B709 225/233 225/227 227/227 NED B733 171/173 171/171 173/173 FAM B741 177/186 177/184 186/188 HEX B749 208/208 208/208 206/208 FAM B751 143/153 143/147 143/143 NED B774 203/207 195/203 203/209 FAM B776 135/137 135/137 146/150 FAM B795 330/330 296/310 314/316 FAM C115 173/194 182/194 215/218 HEX KG809 336/336 336/339 336/345 NED KG811 258/264 240/242 254/258 FAM KG827 280/282 276/282 270/280 NED KG830 291/295 291/295 291/305 HEX SM NG 196/200 196/200 196/196

REFERENCES

  • Bassil N. V., Botta R., Mehlenbacher S. A. 2005a. Microsatellite markers in hazelnut: Isolation, characterization and cross-species amplification. J. Amer. Soc. Hort. Sci. 130:543-549.
  • Bassil N. V., Botta R., Mehlenbacher S. A. 2005b. Additional microsatellite markers of the European hazelnut. Acta Hort. 686:105-110.
  • Boccacci P., Akkak A., Bassil N. V., Mehlenbacher S. A., Botta R. 2005. Characterization and evaluation of microsatellite loci in European hazelnut (C. avellana) and their transferability to other Corylus species. Molec. Ecol. Notes 5:934-937.
  • Boccacci P., Akkak, A. and Botta, R. 2006. DNA typing and genetic relations among European hazelnut (Corylus avellana L.) cultivars using microsatellite markers. Genome 49:598-611.
  • Gökirmak T., Mehlenbacher S. A., Bassil N. V. 2009. Characterization of European hazelnut (Corylus avellana) cultivars using SSR markers. Genetic Resources and Crop Evolution 56:147-172.
  • Gürcan, K., S. A. Mehlenbacher and V. Erdogan. 2010a. Genetic diversity in hazelnut cultivars from Black Sea countries assessed using SSR markers. Plant Breeding (available on-line doi:10.1111/j.1439-0523.2009.01753.x).
  • Gürcan, K., S. A. Mehlenbacher, N. V. Bassil, P. Boccacci, A. Akkak and R. Botta. 2010b. New microsatellite markers for Corylus avellana from enriched libraries. Tree Genetics and Genomes (available on-line as DOI 10.1007/s11295-010-0269-y).
  • Gürcan, K. and S. A. Mehlenbacher. 2010. Development of microsatellite marker loci for European hazelnut (Corylus avellana L.) from ISSR fragments. Molecular Breeding (available on-line).

Claims

1. A new and distinct cultivar of Corylus plant named ‘Dorris’, as illustrated and described.

Patent History
Patent number: PP25022
Type: Grant
Filed: Dec 24, 2012
Date of Patent: Nov 4, 2014
Patent Publication Number: 20140189912
Assignee: State of Oregon Acting by and Through the State Board of Higher Education on Behalf of Oregon State University (Corvallis, OR)
Inventors: Shawn A. Mehlenbacher (Corvallis, OR), David C. Smith (Corvallis, OR), Rebecca L. McCluskey (Corvallis, OR)
Primary Examiner: Anne Grunberg
Application Number: 13/694,675
Classifications
Current U.S. Class: Nut (including Ornamental Variety) (PLT/152)
International Classification: A01H 5/00 (20060101);