Multi-targeted RNAi therapeutics for scarless wound healing of skin
The present invention provides small interfering RNA (siRNA) molecules, compositions containing them, and methods of using them for improvement of skin scarless wound healing and other skin conditions, such as psoriasis and lupus-caused cutaneous lesions. The invention includes siRNA molecules and compositions containing them that inhibit the expression of one or more genes that promote pathological or undesired processes in wound healing and methods of using them.
This application is a U.S. national phase application of, and claims priority to and the benefit of, International Patent Application No. PCT/US2008/012498, filed Nov. 6, 2008, and it claims priority to, and the benefit of, U.S. Provisional Patent Application No. 60/985,820, filed Nov. 6, 2007. The disclosures of these applications are expressly incorporated herein by reference in their entireties.
FIELD OF INVENTIONThe present invention relates to compositions and methods for improvement of skin scarless wound healing and other skin conditions, such as psoriasis and lupus-caused cutaneous lesions, using compositions of small interfering RNA (siRNA) molecules with multiple oligonucleotide sequences targeting multiple disease causing genes.
BACKGROUNDSkin, the largest organ of the body, consists of an underlying mesenchymal (dermal) layer and an outer epithelial (epidermal) layer. The primary function of the skin is to serve as a protective barrier against the environment. Loss of the integrity of large portions of the skin as a result of injury or illness may lead to major disability or even death. Every year in the United States more than 1.25 million people have burns and 6.5 million have chronic skin ulcers caused by pressure, venous stasis, or diabetes mellitus. The primary goals of the treatment of wounds are rapid wound closure and a functional and aesthetically satisfactory scar (1). Recent advances in cellular and molecular biology have greatly expanded our understanding of the biologic processes involved in wound repair and tissue regeneration and have led to improvements in wound care (2).
Wound Healing: A Response to Skin Injury
The response to injury is a phylogenetically primitive, yet essential innate host immune response for restoration of tissue integrity. Tissue disruption in higher vertebrates, unlike lower vertebrates, results not in tissue regeneration, but in a rapid repair process leading to a fibrotic scar. Wound healing, whether initiated by trauma, microbes or foreign materials, proceeds via an overlapping pattern of events including coagulation, inflammation, epithelialization, formation of granulation tissue, matrix and tissue remodeling. The process of repair is mediated in large part by interacting molecular signals, primarily cytokines, that motivate and orchestrate the manifold cellular activities which underscore inflammation and healing. Response to injury is frequently modeled in the skin (1), but parallel coordinated and temporally regulated patterns of mediators and cellular events occur in most tissues subsequent to injury. The initial injury triggers coagulation and an acute local inflammatory response followed by mesenchymal cell recruitment, proliferation and matrix synthesis. Failure to resolve the inflammation can lead to chronic nonhealing wounds, whereas uncontrolled matrix accumulation, often involving aberrant cytokine pathways, leads to excess scarring and fibrotic sequelae. Continuing progress in deciphering the role of cytokines in wound healing provides opportunities to explore pathways to inhibit/enhance appropriate cytokines to control or modulate pathologic healing.
Fetal Wounds are Healed Faster without Scar
Wound healing is a dynamic, interactive process involving soluble mediators, blood cells, extracellular matrix, and parenchymal cells. Wound healing has three phases—inflammation, tissue formation, and tissue remodeling—that overlap in time (1,2). During embryonic skin development, keratinocytes originate from a single-cell proliferating basal layer, undergo growth arrest, and migrate upward in a tightly controlled program of differentiation to produce the morphologically distinct layers of the epidermis. Using a similar program, the epidermis is continually renewed during the life of the organism. Adult mammalian skin also has tremendous capacities for repair following injury. However, responses that have been optimized for rapid wound closure and prevention of infection result in an imperfect restoration of the skin as shown by epidermal and dermal scarring.
In contrast to repair of adult skin, mammalian fetal cutaneous wounds made early in gestation heal by a process of regeneration, in which the epidermal and dermal layers are perfectly reconstituted without scar formation (1, 2). There are several notable contrasts in the course of fetal vs. adult wound healing. Fetal wounds close faster, show little or no inflammatory response (3), and exhibit a different profile of cytokine/growth factor expression, with generally lower levels (4).
TGF-β Antibody Partially Reduced the Amount of Scarring
Evidence demonstrates that wound healing is regulated by a group of cytokines, growth factors and their receptors (5-7). They influence cell migration, growth and proliferation in a complex, orchestrated manner and are involved in neutrophil and macrophage infiltration, angiogenesis, fibroplasia, matrix deposition, scarring and reepithelialization. Besides platelets and macrophages, fibroblasts are the major cellular source of cytokines or growth factors during wound healing. The scarless wound healing in fetal skin at early gestation is a result of the unique cytokine or growth factor profile.
Of these, transforming growth factor-beta (TGF-β) has been most widely studied as it is implicated in the transition between scarless healing and repair with scar formation. Called growth factors for historical reasons, their main function is to control cell proliferation and differentiation and to stimulate the synthesis of extracellular matrix such as collagen. TGF-β has been found by immunohistochemistry in unwounded fetal skin, and high levels of TGF-β are expressed at gestational ages associated with scarless repair. Exogenous application of TGF-β to normally scarless fetal wounds resulted in scar formation and an adult-like inflammatory response was observed. The profibrotic nature of TGF-β was confirmed in wounds of adult rats as neutralizing TGF-β antibody partially reduced the amount of scarring. TGF-β stimulates collagen I production, which is the predominant collagen type in adult skin. On the other hand, TGF-β neutralizing antibodies do not entirely prevent scarring in the adult skin, and recent studies question the efficacy of TGF-β as an dominant Scar-forming factor (8-15).
Studies have also found that decreased and rapidly cleared TGF-beta 1 and -beta 2 expression accompanied by increased and prolonged TGF-beta 3 levels in wounded E16 animals correlated with organized collagen deposition. In contrast, increased and prolonged TGF-beta 1 and -beta 2 expression accompanied by decreased and delayed TGF-beta 3 expression in wounded E19 animals correlated with disorganized collagen architecture. This means that increased TGF-beta 1, -beta 2, and decreased TGF-beta 3 expression is responsible for the late gestation fetal scar formation. These observations have broad implications for understanding the role of TGF-β in the endogenous wound healing response, in that an excess of TGF-β may be a normal constituent of the response for rapid and optimal protection of the host. In the absence of infection, however, reduction of this overexuberant recruitment, inflammation and keratinocyte suppression may result in a more cosmetically acceptable scar.
COX-2 Inhibitor Reduces Scar Tissue Formation and Enhances Tensile Strength
While the interleukins IL-6, IL-8, and IL-10 have been studied in fetal wound repair, COX-2 has also received much attention recently as it is involved in diseases associated with dysregulated inflammatory conditions, such as rheumatoid and osteoarthritis, cardiovascular disease, and the carcinogenesis process (16-20). COX-2 undergoes immediate-early up-regulation in response to an inflammatory stimulus (20, 21), such as a wound. It functions by producing prostaglandins that control many aspects of the resulting inflammation, including the induction of vascular permeability and the infiltration and activation of inflammatory cells (22). Interest in the role of the COX-2 pathway and other aspects of inflammation in the adult wound repair process is increasing (35) as these early events have been shown to regulate the outcome of repair. Based on the involvement of COX-2 in inflammation and the recent demonstration that it contributes to several aspects of adult wound repair (23-25), the role of COX-2 in the fetal wound healing process has been examined. These studies demonstrate differential expression of the COX-2 enzyme in early and late gestation fetal wounds.
Furthermore, PGE2, a COX-2 product shown to mediate many processes in the skin, caused a delay in healing and the production of a scar when introduced into early fetal wounds. The involvement of the COX-2 pathway in scar formation is further highlighted by the fact that increasing PGE2 levels in scarless wounds results in the conversion of a scarless healing process into one of repair with the generation of a scar. The introduction of PGE2 induced inflammation in fetal wounds (26), although their effect on collagen deposition or fibrosis was not examined. Whether PGE2 displays immunosuppressive or anti-inflammatory properties or instead acts as a pro-inflammatory molecule most likely results from differences in the expression or activity of the receptors for PGE2. There are several plausible mechanisms by which PGE2 could be inducing scar formation in fetal wounds. PGE2 could be enhancing acute inflammation, already known to interfere with scarless healing, thereby indirectly promoting scar formation through the recruitment and activation of inflammatory cells. PGE2 treatment could be both delaying healing and promoting scar tissue deposition through increases in the pro-fibrotic TGFβ1 (27). Disruption of the TGFβ signaling pathway in smad3-deficient mice has been shown to speed the rate of healing, and extensive data demonstrates restricted TGFβ3 levels are crucial to scarless healing. Lastly, there are data demonstrating increased fibroblast proliferation in response to PGE2 suggests that PGE2 could be directly stimulating fibroblasts to proliferate, amplifying collagen production and scarring. This idea is also supported by previous studies demonstrating an increase in collagen deposition and proliferation by fibroblasts following exposure to PGE2. The substantial data suggested the low levels of COX-2 expression and PGE2 may be necessary for the scarless repair of fetal skin. The fact that PGE2 induces scar formation in fetal skin further supporting a role for the COX-2 pathway in scar formation. Using a COX-2 inhibitor celecoxib to treat incisional wounds, the role of COX-2 in the wound healing process was examined with significant inhibition of several parameters of inflammation in the wound site (28). This decrease in the early inflammatory phase of wound healing had a profound effect on later events in the wound healing process, namely a reduction in scar tissue formation, without disrupting reepithelialization or decreasing tensile strength.
Skin Wounds of HoxB13 KO Mouse Heals Faster with Less Scar Tissue Formation
The evolutionarily conserved families of Hox transcription factors have been considered attractive candidates for regulation of fetal skin regeneration due to their critical roles for directing differentiation during organogenesis. Studies have identified one particular member of the Hox protein family, HoxB13, as the predominate Hox gene expressed in primary fibroblast cultures from second trimester skin (29). Subsequent wound healing studies using second trimester fetal skin (which heals without a scar) and human adult skin demonstrated that HoxB13 is differentially expressed in fetal vs. adult wounds. Interestingly, HoxB13 expression was significantly down-regulated in fetal wounds compared with unwounded controls. In contrast, there was no significant change in HoxB13 expression in adult wounds compared with unwounded controls. Together, these results suggest that down-regulation of HoxB13 expression may be necessary for fetal scarless wound healing. It also raises the possibility that reducing or eliminating HoxB13 from adult skin could improve wound healing.
Studies on cutaneous excisional and incisional wound healing in adult HoxB13 knockout (KO) mice demonstrated that HoxB13 KO wounds exhibit several characteristics of early gestational fetal wounds, including faster closure, increased tensile strength, and less dermal scarring when compared with wounds from their wild-type (WT) counterparts. Biochemical evaluation revealed that levels of epidermal and dermal HA are significantly higher in unwounded adult HoxB13 KO skin compared with WT skin. Using a histological comparison, HoxB13 KO incisional wounds exhibit enhanced healing with better restored dermal integrity of HoxB13 KO wounds than in WT wounds. HoxB13 KO adult excisional wounds also close faster than WT excisional wounds. In the HoxB13 KO wound, the collagen aggregation is looser and more reticulate, resembling that of unwounded skin, indicating that collagen remodeling in HoxB13 KO wounds is reconstituting a more normal dermal architecture. Microarray analysis of gene expression in adult WT and HoxB13 KO whole skin revealed that the expression levels of several epidermal differentiation markers were significantly reduced in unwounded HoxB13 KO adult skin compared with unwounded WT adult skin. Studies on Hoxb 13 KO mouse wound healing further confirmed Hoxb 13 as a potential target for improvement of scarless wound healing (29-31).
Other Factors Involved in the Skin Wound Healing Process
The fetal response to cutaneous injury differs markedly from that of the adult, proceeding with only minimal inflammation, minimal fibroblast proliferation, and only essential collagen deposition. The effect of platelet-derived growth factor (PDGF) on both cellular and extracellular matrix events at a fetal wound site has been investigated because PDGF is known to play an important role in adult wound healing regulation. SILASTIC wound implants were harvested after either 1, 3, or 5 days in utero. The specimens underwent standard histological processing and were evaluated. PDGF-treated implants had a marked increase in acute inflammation, fibroblast recruitment, and collagen and hyaluronic acid deposition. These differences appeared to be largely time- and PDGF dose-dependent, and the data suggest that fetal repair proceeds in the absence of PDGF.
A key feature of scarless fetal healing appears to be a lack of inflammation in response to the wounding event. In contrast, the early phases of wound healing in late fetal and adult skin are characterized by a robust inflammatory response, and eventually a permanent scar in the wound area. While the interleukins IL-6 and IL-8 have been studied in fetal wound repair, the role of other classic inflammatory mediators in scarless healing is not known. Smad3 protein is involved in mediating intracellular signaling by members of the transforming growth factor-beta superfamily and plays a critical role in the cellular proliferation, differentiation, migration, and elaboration of matrix pivotal to cutaneous wound healing. Cross-talk between Smad3 and hormone signaling in vitro has been suggested as an important control mechanism regulating cell activities; however, its relevance in vivo is unknown. Ashcroft G S et al. reported that Smad3 plays a role in androgen-mediated inhibition of wound healing but not in the responses to estrogen modulation in vivo. Both wild-type and Smad3 null female mice exhibited delayed healing following ovariectomy, which could be reversed by estrogen replacement. By contrast, castration accelerated healing in wild-type male mice and was reversible by exogenous androgen treatment. Intriguingly, modulation of androgen levels resulted in no discernible perturbation in the healing response in the Smad3 null mice. Mutant monocytes could be lipopolysaccharide stimulated to produce specific pro-inflammatory agents (macrophage monocyte inhibitory factor) in a fashion similar to wild-type cells, but exhibited a muted response to androgen-mediated stimulation while maintaining a normal response to estrogen-induced macrophage inhibitory factor inhibition. These data suggest that Smad3 plays a role in mediating androgen signaling during the normal wound healing response and implicate Smad3 in the modulation of inflammatory cell activity by androgens.
Fibronectin (FN) is a multi-functional, adhesion protein and involved in multi-steps of the wound healing process. Strong evidence suggests that FN protein diversity is controlled by alternative RNA splicing; a coordinated transcription and RNA processing that is development-, age-, and tissue/cell type-regulated. Expression, regulation, and biological function of the FN gene and various spliced forms in this model are unknown. Airway and skin incisional wounds were made in fetal (gestation days 21-23), weanling (4-6 weeks) and adult (>6 months) rabbits. Expression profiles were obtained using mRNA differential display and cDNAs of interest were cloned, sequenced and validated by real-time PCR. The increased levels of both Fn1 and Sfrs3 transcripts were sustained up to 48 h in weanling airway mucosal wounds. The augmentations of the two genes in postnatal airway mucosal wounds were more prominent than that in skin wounds, indicating that the involvement of Sfrs3 and Fn1 genes in postnatal airway mucosal wounds is tissue-specific. There is evidence that SRp20 is indeed involved in the alternative splicing of FN and that the embryonic FN variants reappear during adult wound healing. A connection between the enhanced molecular activity of Sfrs3 and the regulation of the FN gene expression through alternative splicing during the early events of postnatal airway mucosal wound repair was proposed.
Multi-Targeted siRNA Compositions
RNA interference (RNAi) is a sequence-specific RNA degradation process that provides a relatively easy and direct way to knockdown, or silence, theoretically any gene (33, 34). In naturally occurring RNA interference, a double stranded RNA is cleaved by an RNase III/helicase protein, Dicer, into small interfering RNA (siRNA) molecules, a dsRNA of 19-23 nucleotides (nt) with 2-nt overhangs at the 3′ ends. These siRNAs are incorporated into a multicomponent-ribonuclease called RNA-induced-silencing-complex (RISC). One strand of siRNA remains associated with RISC, and guides the complex towards a cognate RNA that has sequence complementary to the guider ss-siRNA in RISC. This siRNA-directed endonuclease digests the RNA, thereby inactivating it. Studies have revealed that the use of chemically synthesized 21-25-nt siRNAs exhibit RNAi effects in mammalian cells, and the thermodynamic stability of siRNA hybridization (at terminals or in the middle) plays a central role in determining the molecule's function (33, 36, 37).
Importantly, it is presently not possible to predict with a high degree of confidence which of many possible candidate siRNA sequences potentially targeting a mRNA sequence of a disease gene in fact exhibit effective RNAi activity. Instead, individually specific candidate siRNA polynucleotide or oligonucleotide sequences must be generated and tested in the mammalian cell culture to determine whether the intended interference with expression of a targeted gene has occurred. The unique advantage of siRNA makes it possible to be combined with multiple siRNA duplexes to target multiple disease causing genes in the same treatment, since all siRNA duplexes are chemically homogenous with same source of origin and same manufacturing process (33, 36-40).
In summary, the molecular targets involved in scarless wound healing of adult skin are well defined and evaluated. However, there is a pressing need to provide potent siRNA duplexes targeting the pro-inflammatory factor TGF-β, inflammation promoter COX-2 and differentiation regulator HoxB13 There further is a need to formulate such siRNA duplexes into multi-targeted siRNA compositions. There further remains a need to provide a therapeutic approach to improve the healing results of patients suffering cutaneous wounds caused by injury and many diseases. Thus, there is a strong need for multi-targeted RNAi therapeutics in the treatment of wound healing for use in patients suffering from various skin conditions.
SUMMARYThe invention relates to siRNA molecules for use in treating skin wounds. The invention provides a small interfering RNA (siRNA) molecule comprising a double stranded (duplex) oligonucleotide, wherein the oligonucleotide targets a complementary nucleotide sequence in a single stranded (ss) target RNA molecule. The ss target RNA target molecule is an mRNA encoding at least part of a peptide or protein whose activity promotes inflammation, wound healing, or scar formation in skin tissue, or it is a micro RNA (miRNA) functioning as a regulatory molecule whose activity promotes inflammation, wound healing, or scar formation in skin tissue.
The molecules are added to a pharmaceutically acceptable carrier to provide compositions for administering to a subject. In one embodiment, the composition comprises a pharmaceutically acceptable carrier and at least three siRNA molecules, wherein each siRNA molecule binds an mRNA molecule that encodes a gene selected from the group consisting of pro-inflammatory pathway genes, pro-angiogenesis pathway genes, and pro-cell proliferation pathway genes.
The invention also provides a method for treating a dermal or epidermal wound in a subject, wherein the wound is characterized at least in part by inflammation and neovascularization. The method comprises administering to the subject a composition comprising at least one siRNA molecule of the invention and a pharmaceutically acceptable carrier, wherein the molecule inhibits expression of at least one gene that promotes pathological or undesired processes in the healing of the wound.
The methods and compositions of this invention are useful for improvement of skin wound healing and other skin conditions.
The present invention relates to various siRNA molecules, compositions containing the molecules, and their methods of use, which are directed to promoting wound healing in skin.
The invention provides a small interfering RNA (siRNA) molecule comprising a double stranded (duplex) oligonucleotide, wherein the oligonucleotide targets a complementary nucleotide sequence in a single stranded (ss) target RNA molecule. The ss target RNA target molecule is an mRNA encoding at least part of a peptide or protein whose activity promotes inflammation, wound healing, or scar formation in skin tissue, or it is a micro RNA (miRNA) functioning as a regulatory molecule whose activity promotes inflammation, wound healing, or scar formation in skin tissue. In one embodiment, a target mRNA molecule encodes a gene selected from the group of pro-inflammatory pathway genes, pro-angiogenesis pathway genes, and pro-cell proliferation pathway genes. Preferably, the genes are Hoxb13, TGF-β1, TGF-β2, or Cox-2. In another embodiment, the siRNA sequences are prepared in such way that each duplex can target and inhibit the same gene from, at least, both human and mouse, or non-human primates. In certain embodiments, an siRNA molecule binds to an mRNA molecule that encodes at least one protein. In further embodiments, an siRNA molecule binds to a mRNA molecule encodes at least one human protein. In still additional embodiments, an siRNA molecule binds to human mRNA molecule and to a homologous mouse mRNA molecule, i.e., mRNAs in the respective species that encode the same or similar protein. In various embodiments, the siRNA molecule are constructed with reference to the target mRNA coding sequences listed in Tables 2-9.
In one embodiment, the siRNA molecule has a length of 19-27 base pairs. The molecule can have blunt ends at both ends, or sticky ends at both ends, or one of each. The siRNA molecule may include a chemical modification at the individual nucleotide level or at the oligonucleotide backbone level, or it may have no modifications.
The molecules are added to a pharmaceutically acceptable carrier to provide compositions for administering to a subject. Preferably, the subject is a human.
In one embodiment, the composition comprises a pharmaceutically acceptable carrier and at least three siRNA molecules, wherein each siRNA molecule binds an mRNA molecule that encodes a gene selected from the group consisting of pro-inflammatory pathway genes, pro-angiogenesis pathway genes, and pro-cell proliferation pathway genes. In still another embodiment, each siRNA cocktail contains at least three siRNA duplexes that target at least three different gene sequences. Preferably, each gene is selected from a different pathway. A composition that is a mixture of siRNA molecules may be termed a “cocktail.”
In several embodiments of a cocktail having at least three siRNA molecules, a cocktail mixture is chosen from a mixture listed in Tables A, B, C, or D. One particular embodiment is disclosed in Table A, wherein an siRNA (sense: 5′-caaggauaucgaaggcuugcuggga-3′ (SEQ ID NO: 1), antisense: 5′-ucccagcaagccuucgauauccuug-3′ (SEQ ID NO: 2)) binds to mRNA molecules that encode both human and mouse HoxB13 protein, an siRNA molecule (sense: 5′-gucuuuggucuggugccuggucuga-3′ (SEQ ID NO: 3), antisense: 5′-ucagaccaggcaccagaccaaagac-3′ (SEQ ID NO: 4)) binds to mRNA molecules that encode both human and mouse COX-2 protein, and an siRNA molecule (sense: 5′-ccccggaggugauuuccaucuacaa-3′ (SEQ ID NO: 5), antisense: 5′-uuguagauggaaaucaccuccgggg-3′ (SEQ ID NO: 6)) binds to mRNA molecules that encode both human and mouse TGF-β1. In further particular embodiments disclosed in Table A, an siRNA (sense: 5′-GGUGGCUGGAACAGCCAGAUGUGUU-3′ (SEQ ID NO: 7), antisense: 5′-AACACAUCUGGCUGUUCCAGCCACC-3′ (SEQ ID NO: 8)) targets an mRNA molecule that encodes human and mouse both Hoxb13 protein, at least one siRNA molecule (sense: 5′-GGUCUGGUGCCUGGUCUGAUGAUGU-3′ (SEQ ID NO: 9), antisense: 5′-ACAUCAUCAGACCAGGCACCAGACC-3′ (SEQ ID NO: 10)) targets an mRNA molecule that encodes both human and mouse Cox-2 protein, and at least one siRNA molecule (sense: 5′-CCCAAGGGCUACCAUGCCAACUUCU-3′ (SEQ ID NO: 11), antisense: 5′-AGAAGUUGGCAUGGUAGCCCUUGGG-3′ (SEQ ID NO: 12)) targets an mRNA molecule that encodes both human and mouse TGF-β1.
In other particular embodiments disclosed in Table C, an siRNA (sense: 5′-caaggauaucgaaggcuugcuggga-3′ (SEQ ID NO: 1), antisense: 5′-ucccagcaagccuucgauauccuug-3′ (SEQ ID NO: 2)) binds to mRNA molecules that encode both human and mouse HoxB13 protein, an siRNA molecule (sense: 5′-ggucuggugccuggucugaugaugu-3′ (SEQ ID NO: 9), antisense: 5′-acaucaucagaccaggcaccagacc-3′ (SEQ ID NO: 10)) binds to mRNA molecules that encode both human and mouse COX-2 protein, an siRNA molecule (5′-cacgagcccaagggcuaccaugcca-3′ (SEQ ID NO: 13), antisense: 5′-uggcaugguagcccuugggcucgug-3′ (SEQ ID NO: 14)) binds to mRNA molecules that encode both human and mouse TGF-β1 protein, and an siRNA molecule (sense: 5′-ccggaggugauuuccaucuacaaca-3′ (SEQ ID NO: 15), and antisense: 5′-uguuguagauggaaaucaccuccgg-3′ (SEQ ID NO: 16)) binds to mRNA molecules that encode both human and mouse TGF-β2 protein.
In further embodiments, the mRNA molecules encode one or more HoxB13 pathway genes, COX-2 pathway genes, TGF-beta pathway genes, or a combination thereof. In still additional embodiments, the mRNA molecules encode one or more pro-angiogenesis genes, pro-inflammatory genes, or a combination thereof, and in yet further embodiments the mRNA molecules encode one or more pro-inflammation genes, or a combination thereof. In further embodiments of the cocktail, at least three siRNA molecules therein bind to at least two or more different mRNA molecules.
In still additional embodiments, the mixture of siRNA molecules is selected from mixtures presented in Tables E-H.
In yet additional embodiments, the siRNA cocktail inhibits expression of at least one gene selected from the group consisting of a pro-inflammatory pathway gene, a pro-angiogenesis pathway gene, and a pro-cell proliferation pathway gene. In particular embodiments, the siRNA cocktail inhibits expression of multiple genes. In additional embodiments, the siRNA cocktail contains sequences that target those listed in Tables 2, 3, 4 and 5 and that inhibit expression of HoxB13, TGF-beta1, TGF-beta2, and COX-2 in both human and mouse cells. In yet further embodiments, the siRNA cocktail contains sequences presented in Tables 6, 7, and 9 that inhibit expression of PDGFa, VEGFA FGF-2, and Lamin B1 proteins in both human and mouse cells.
In still further embodiments, the siRNA cocktail contains at least three siRNA duplexes at a 1:1:1 ratio, or 1:1.5:0.5 ratio, or 0.5:0.5:2 ratio, or other ratios according to the potency of each siRNA duplex and therapeutic requirements for the application.
The invention further provides pharmaceutically effective carriers for enhancing the siRNA cocktail delivery into the disease tissues and cells.
In various embodiments of the composition, the carrier comprises one or more components selected from the group consisting of a saline solution, a sugar solution, a polymer, a lipid, a cream, a gel, and a micellar material. Further components or carriers include a polycationic binding agent, cationic lipid, cationic micelle, cationic polypeptide, hydrophilic polymer grafted polymer, non-natural cationic polymer, cationic polyacetal, hydrophilic polymer grafted polyacetal, ligand functionalized cationic polymer, and ligand functionalized-hydrophilic polymer grafted polymer, biodegradable polyesters, such as poly(lactic acid) (PLA), poly(glycolic acid) (PGA), and poly(lactic-co-glycolic acid) (PLGA), PEG-PEI (polyethylene glycol and polyethylene imine), Poly-Spermine (Spermidine), and polyamidoamine (PAMAM) dendrimers. In further embodiments of the composition, the carrier is a histidine-lysine copolymer that is believed to form a nanoparticle containing an siRNA molecule, wherein the nanoparticle has a size of about 100-400 nm in diameter formulated with Methylcellulose gel for topical administration.
The siRNA molecules may be identified by the following steps: 1) creating a collection of siRNA duplexes designed to target a complementary nucleotide sequence in the ss target RNA molecule, wherein the targeting strands of said siRNA molecules comprise various sequences of nucleotides; 2) selecting the siRNA molecules that show the highest desired effect against said target molecules in vitro; 3) evaluating the selected siRNA molecules in an animal wound model; and 4) selecting the siRNA molecules that show the greatest efficacy in the model. A pharmaceutically acceptable carrier may be added to each of the siRNA molecules selected by step (2) to form pharmaceutical compositions, each of which is evaluated in the animal wound model. Preferably, the animal wound model is a lip excisional wound model in a Hoxb13 knockout mouse or a back excisional wound model in a Hoxb13 knockout mouse. More preferably, the siRNA molecules are evaluated in both animal models. Since the targeted genes may express in different cell types in the disease tissues, the efficacy of the particular siRNA cocktail is tested and confirmed not only in the cell culture but also in animal disease models. Preferably, the components of the siRNA cocktail are selected so that the therapeutic benefit of the cocktail is better than the therapeutic benefit of a single siRNA component by itself.
The invention also provides methods to prepare the proper ratio of each duplex in order to allow the siRNA cocktail to achieve the most potent synergistic effect. In one embodiment, the ratio is determined by determining the expression level of the target sequence compared to that of the control sequence. A higher expressing target sequence will require a higher ratio of the corresponding siRNA molecules.
The invention also provides a method for treating a dermal or epidermal wound in a subject. The wound may be caused by physical injury, a burn, an allergy, diabetic disease, inflammation, or a tumor. The wound may be characterized at least in part by inflammation and neovascularization. The method comprises administering to the subject a composition comprising at least one siRNA molecule of the invention and a pharmaceutically acceptable carrier, wherein the molecule inhibits expression of at least one gene that promotes pathological or undesired processes in the healing of the wound. The composition may be applied in a salve, spray, transdermal patch, or other ways known to those skilled in the art.
Successful siRNA-mediated therapy not only depends on identification of the targets and sequence of active siRNA molecules, but also on efficient in vivo delivery to the target tissues and into the cytoplasm (41-43). The routes of delivery of siRNA cocktail formulation for treatment of skin wound healing should be local and topical with appropriate clinically validated carriers. In addition to using imiquimod 5% cream as a carrier for siRNA cocktail topical application, three polymer-based carriers, including histidine-lysine polymers (HKP) (44), pegylated PEI (45) and PAMAM dendrimer (46) are particularly useful carriers.
The siRNA cocktail inhibits expression of a pro-angiogenesis gene, a pro-inflammatory gene, a gene that promotes scar formation, or a combination thereof. In still further embodiments of this method, an siRNA is employed against target sequences presented in Tables 2-9. In yet additional embodiments of this method, a cocktail employed in the method is one of the mixtures of siRNA molecules disclosed in Tables A-H.
EXAMPLES Example 1 Lip Surgery Model for Wound Healing AnalysisThere are results from previous studies showing that back skin wounds in HoxB13 KO mice healed with reduced scarring. The possible differences between back and lip skin raised the question whether lip wound in the KO mice would heal with reduced scar formation since muscle and fat layers of lip skin tissue are much less organized than that of upper dorsal back skin. We first compared the structure of the back and lip regions. Unlike the back skin structure, the muscle and fat layers of the lip region are not organized into distinct layers (
Following the establishment of the lip wound model, HoxB13 KO mice (kindly provided by Dr. Mario R. Capecchi) were subjected to the identical surgeries. The KO mice were back crossed with WT, C57BL6 mice for at least 10 generations to ensure that WT and KO mice have the same genetic background. Lip incisional wound biopsies were harvested from day 20, 30 and 60 wounds, and the collagen organization was determined by Masson Trichrome collagen staining (
We next compared WT and KO mouse primary fibroblast activity in vitro. Primary dermal fibroblasts were prepared from 3 day old newborn mice. Mice were euthanized by cervical dislocation and sterilized with 70% ethanol. Skin was harvested and soaked in PBS with 20 μg/ml gentamicin for 45 minutes. The skin was then floated in 25 unit/ml dispase solution (Sigma) overnight at 4° C. The epidermal layer was separated from the dermal layer using a fine tip forceps. The epidermal layer was further processed to isolate keratinocytes. The dermal layer was further processed in 100 unit/ml crude collagenase (Sigma) at 37° C. for one hour. After filtration through cell strainers (Falcon, 70 uM), cells were plated in tissue culture dishes in DMEM high glucose with 10% FBS and subcultured twice prior to being used for assays. For the proliferation assay, cells were seeded at 5000/well in 96 well plates. MTT further assays were performed daily (Molecular Probes, CA) and demonstrated reduced proliferation activity of HoxB13 knockout fibroblasts. This result was confirmed by a manual cell counting method using a hemocytometer (data not shown). It has been reported that HOXB13 is an inhibitor of neuronal cell proliferation activator of apoptotic pathways (Economides et al., 2003). Therefore, the proliferation rate of HoxB13 knockout fibroblasts was expected to be increased, which is in contrast with what we have observed. It is possible that roles of HoxB13 may be cell type specific. In fact, the over expression of HoxB13 has been correlated with prostate cancer and HoxB13 has been proposed to be a biomarker for prostate cancer (Edwards et al., 2005). In addition, we performed an in vitro scratch wound assay to mimic incisional wounds. For this assay, 2×105 primary dermal fibroblasts per well were seeded into six well plates, that were pre-coated with collagen type I, type IV or fibronectin. The cells were then incubated in DMEM high glucose with 0.2% FBS for 24 hours. Then a 1 ml Pipetman™ tip was used to scratch the cell monolayer to create a gap. The percentage of the gap closed after 4 hour and 24 hour incubation in DMEM/0.2% FBS was measured using Olympus Microsuite software. Platelet-derived growth factor B (10 ng/ml) was added to monitor its effect on migration of WT and KO fibroblasts. As demonstrated in
When Rat Epithelial Keratinocytes (REK) cells were raised to air liquid interface as described (Tammi et al. 2000), REK cells differentiate to all layers of epidermis. Using this as an in vitro keratinocyte differentiation model, we investigated the effect of HOXB13 on REK stratification. REK cell clones expressing HOXB13 were obtained by retroviral transduction and clonal selection. HoxB13 cDNA was subcloned into the MLV vector under the control of a CMV promoter. The retroviral particles were produced by three plasmid co-transfection (Li et al., 2001). REK cells were transduced by the retroviral particles with HoxB13 or vector only at MOI˜10 and selected in 2 μg/ml puromycin (Note: 1 μg/ml puromycin is sufficient to kill all un-transduced cells). The puromycin resistant cells were seeded into three 96-well-dishes at one cell per well density. After two week's incubation, the cells in each well were visualized and individual clones were transferred, expanded and maintained in 1 μg/ml puromycin. The expression of HoxB13 or vector was confirmed by RT-PCR using one primer located in the vector and the other primer located in HoxB13 cDNA. REK cell expressing HoxB13 displayed reduced proliferation rate when compared with REK transduced with vector only using the MTT assay (
In order to determine subcellular location of HoxB13, a green fluorescent protein, GFP-HoxB13 fusion protein was generated by the removal of the termination codon of GFP and initiation codon of HoxB13. GFP-HoxB13 expression was driven by a CMV promoter. The plasmid containing GFP-HoxB13 cDNA was transfected into REK or 293T human kidney epithelial cells using Lipofectamine (Invitrogen, CA) and the expression of GFP was monitored under a fluorescent microscope at 24 hour post transfection. In contrast to a previous report that HoxB13 expression is cytoplasmic during fetal skin development (Komuves et al., 2003), we have found that the GFP-HxoB13 is localized to the nucleus, suggesting that HOXB13 is a nuclear protein (
Double-stranded siRNAs were prepared to target the VEGF-pathway factors: mVEGF-A (XM_192823), mVEGFR1 (D88689), and mVEGFR-2 (MN_010612). Two target sequences were picked up from each gene. These sequences are (from 5′ to 3′): mVEGF-A (1. AAGCCGUCCUGUGUGCCGCUG (SEQ ID NO: 19); 2. AACGAUGAAGCCCUGGAGUGC (SEQ ID NO: 20)); mVEGFR1 (1. AAGUUAAAAGUGCCUGAACUG (SEQ ID NO: 21); 2. AAGCAGGCCAGACUCUCUUUC (SEQ ID NO: 22)); mVEGFR2 (1. AAGCUCAGCACACAGAAAGAC (SEQ ID NO: 23); 2. AAUGCGGCGGUGGUGACAGUA (SEQ ID NO: 24)). As for unrelated controls, two siRNA sequences from firefly luciferase (Luc, AF434924) were selected as Luc (1. AAGCUAUGAAACGAUAUGGGC (SEQ ID NO: 25); 2. AACCGCUGGAGAGCAACUGCA (SEQ ID NO: 26)). Blast sequence searching confirmed the specificity of these siRNAs with their targeted sequences, and the mVEGF-A targets were designed to be shared by different mVEGF-A isomers. All siRNAs were custom-prepared as 21-nt double stranded RNA oligonucleotides with 19-nt duplex in the middle and dTdT overhang at the 3′-end of either RNA strand, synthesized by Qiagen. To get better RNAi effect, we routinely used a mixture of two double-stranded 21-nucleotide RNA duplexes targeting two different sequences on a single mRNA molecule. The RT-PCR was performed for detection of mRNA knockdown by siRNAs in vitro. Cytoplasmic RNA was isolated by RNAwiz (Ambion, #9736) according to manufacturer's instruction with additional DNAse treatment, and subjected to RT-PCR with specially prepared primers. The mRNA-specific reverse primers for the RT reaction were all 47-mer oligonucleotides with the 5′-end 30-mer of unique sequence (called “TS1” sequence, indicated in uppercase below) linked to a 17-mer sequence unique for each mRNA molecule (in lower case below). They were (from 5′ to 3′): 1) mVEGFA Dn: GAACATCGATGACAAGCTTAGGTATCGATAcaagctgcctcgccttg (SEQ ID NO: 27); 2): mVEGFR1 Dn: GAACATCGATGACAAGCTTAGGTATCGATAtagattgaagattccgc (SEQ ID NO: 28); 3) mVEGFR2 Dn: GAACATCGATGACAAGCTTAGGTATCGATaggtcactgaca gaggcg (SEQ ID NO: 29). The PCR assays for all the tested genes, that follow the RT assay, used a same reverse primer, TS1: GAACATCGATGACAAGCTTAGGTATCGATA (SEQ ID NO: 30). However, the forward primers for PCR, all were 30-mer oligonucleotides, unique for each gene: VEGFA Up: GATGTCTACCAGCGAAGCTACTGCCGTCCG (SEQ ID NO: 31); 2) mVEGFR1 Up: GTCAGCTGCTGGGACACCGCGGTCTTGCCT (SEQ ID NO: 32); 3) mVEGFR2 Up: GGCGCTGCTAGCTGTCGCTCTGTGGT TCTG (SEQ ID NO: 33). The RT-PCR of housekeeping gene GAPDH was used as control for RNA amount used in RS-PCR. An oligonucleotide dT primer (19-mer) was used for RT assay of GAPDH. The primers used for the followed PCR were 20-mer oligonucleotides: 1) GAPDH Up: CCTGGTCACCAGGGCTGCTT (SEQ ID NO: 34); 2) GAPDH Dn: CCAGCCTTCTCCATGGTGGT (SEQ ID NO: 35). RT-PCR was also used according to the protocol described previously. For the detection of mVEGF-A expression the primers used were 5′-GCGGGCTGCCTCGCAGTC-3′ (SEQ ID NO: 36) (sense) and 5′-TCACCGCCTTGGCTTGTCAC-3′ (SEQ ID NO: 37) (antisense).
A previous study demonstrated that CpG-containing oligonucleotide nucleotide encapsulated in hydron pellets induce dVEGF-mediated angiogenesis when inserted into corneal micropockets. This system was used to measure the inhibitory effect of local administration of siRNA preparations prepared to target VEGF as well as two of its receptors (VEGFR1 and VEGFR2). A single dose of 10 μg of siRNA in with histidine-lysine polymer nanoparticles was used in all cases. This was administered by subconjunctival injection 24 hours after the establishment of micropockets containing CpG ODN. The siRNAs were tested individually as well as a 1:1:1 mixture of all three (siVEGFA, siVEGFR1, and siVEGFR2). New blood vessel formation in the corneal limbus was monitored at both days 4 and 7 after pellet implantation. As shown in
25 mer siRNA sequences are prepared that target homologous sequences of both human and mouse in the orthologous genes. For example, the siRNA duplex sequence targeting HoxB13 is able to target both human HoxB13 and mouse HoxB13 genes. Table 1 provides sequences identified for siRNA therapeutics (36-37). Each sequence targets both human and mouse corresponding gene. Therefore, the potent sequences defined from the mouse cells can be confirmed again using human cells. If the particular siRNA duplex is potent in both tests, the silencing activity revealed in the mouse animal model could be assumed to be active in human. Using this approach, we can address a general concern about the species specificity of this type of inhibitors, such as the monoclonal antibody, have encountered. In addition, for the therapeutic candidates of siRNA duplexes, the efficacy and toxicity data achieved from the study using mouse model can be easily translated into the human setting.
Example 9 HK Polymer Enhances Local siRNA DeliveryThe HK polymer-siRNA nanoparticle mediated local delivery has achieved potent anti-angiogenic activity. In a separate study using HK polymer to enhance siRNA delivery intratumorally, the tumor growth curves have shown significant anti-tumor efficacy with clear down regulation of the target gene expression. At 10 days after the injection of MDA-MB-435 cells into the mammary fat pad, mice with visible tumors were separated into treatment groups. Each group had four mice with eight tumors and tumor size was assessed in two dimensions and calculated. Mice received 4 μg/tumor of siRNA with each intratumoral injection every 5 days. To confirm the antitumor efficacy of siRNA Raf-1 with the optimal polymer in greater detail, mice with tumors were divided into these groups: untreated, b-galactosidase siRNA and Raf-1 siRNA. As seen in
Over the past few decades, biodegradable polyesters, such as poly(lactic acid) (PLA), poly(glycolic acid) (PGA), and poly(lactic-co-glycolic acid) (PLGA), have been extensively studied for a wide variety of pharmaceutical and biomedical applications. The biodegradable polyester family has been regarded as one of the few synthetic biodegradable polymers with controllable biodegradability, excellent biocompatibility, and high safety. The need for a variety of drug formulations for different drugs and delivery pathways resulted in development of various types of block copolymers (e.g., diblock, triblock, multiblock, and star-shaped block) consisting of the biodegradable polyesters and poly(ethylene glycol) (PEG).
PAMAM dendrimers represent an exciting new class of macromolecular architecture called “dense star” polymers. Unlike classical polymers, dendrimers have a high degree of molecular uniformity, narrow molecular weight distribution, specific size and shape characteristics, and a highly functionalized terminal surface. The manufacturing process is a series of repetitive steps starting with a central initiator core. Each subsequent growth step represents a new “generation” of polymer with a larger molecular diameter, twice the number of reactive surface sites, and approximately double the molecular weight of the preceding generation. Polyamidoamine (PAMAM) dendrimers are the most common class of dendrimers suitable for many materials science and biotechnology applications. PAMAM dendrimers consist of alkyl-diamine core and tertiary amine branches.
Example 10 siRNA Cocktails Reduce Expression of Target Genes in Cultured Cells
- 1. siRNA duplexes prepared: Three sequences have been prepared for targeting each of the three mRNAs, with 25-mer blunt end:
- 2. Two control sequences were also prepared and used in the study:
- 3. Six pairs of the PCR primers for Hoxb13, Cox-2 and TGF-beta1 cDNA sequence detection were also prepared and synthesized for both human and mouse sequences:
- 4. Human prostate carcinoma cell-PC3 was used for detection of the gene expression knockdown. A series of standard transfection experiments were carried out using the protocol provided by the vendor (Invitrogen) with the siRNA duplexes identified in step 2 accordingly.
- 5. Total RNA samples were isolated and subjected to RT-PCR analysis using the respective PCR primers identified in step 3 above. The results are shown in
FIGS. 10, 11, 12, and 13 . It is seen that, as detected by RT-PCR, expression of the targeted genes is significantly reduced when the corresponding targeting siRNA is transfected, whereas various control (i.e., nontargeting) siRNAs have no effect on expression.
Table 1 provides 10 siRNA sequences for each of the targeted gene, HoxB13, COX-2 and TGF-β.
Selection of Four siRNA Duplexes for Each Target Gene
The siRNA control sequence was selected targeting a non-related sequence and without homologue in both human and mouse. It is Lu25-a: (sense, 5′-GAGGAGCCUUCAGGAUUACAAGAUU-3′ (SEQ ID NO: 50) and antisense, 5′-AAUCUUGUAAUCCU GAAGGCUCCUC-3′ (SEQ ID NO: 51)). The four siRNA sequences targeting both human and mouse HoxB13 are: hmHX-1: (sense, 5′-GGUGGCUGGAACAGCCAGAUGUGUU-3′ (SEQ ID NO: 7) and anti-sense, 5′-AACACAUCUGGCUGUUCCAGCCACC-3′ (SEQ ID NO: 8)); hmHX-2: (sense, 5′-GCUGGAACAGCCAGAUGUGUUGCCA-3′ (SEQ ID NO: J and antisense, 5′-UGGCAACACAUCUGGCUGUUCCAGC-3′ (SEQ ID NO: 39)); hmHX-3: (sense, 5′-CGCCAGAUUACCAUCUGGUUUCAGA-3′ (SEQ ID NO: 40) and antisense, 5′-UCUGAAACCAGAUGGUAAUCUGGCG-3′ (SEQ ID NO: 41)); and hmHX-4: (sense, 5′-CAAGGAUAUCGAAGGCUUGCUGGGA-3′ (SEQ ID NO: 1) and antisense, 5′-UCCCAGCAAGCCUUCGAUAUCCUUG-3′ (SEQ ID NO: 2)). The four siRNA sequences targeting both human and mouse COX-2 and they are: hmCX-1: (sense, 5′-GGUCUGGUGCCUGGUCUGAUGAUGU-3′ (SEQ ID NO: 9) and antisense, 5′-ACAUCAUCAGACCAGGCACCAGACC-3′ (SEQ ID NO: 10)); hmCX-2: (sense, 5′-GAGCACCAUUCUCCUUGAAAGGACU-3′ (SEQ ID NO: 46) and antisense, 5′-AGUCCUUUCAAGGAGAAUGGUGCUC-3′ (SEQ ID NO: 47)); hmCX-3: (sense, 5′-CCUCAAUU CAGUCUCUCAUCUGCAA-3′ (SEQ ID NO: 48) and antisense, 5′-UUGCAGAUGAGAGACUGAAUUGAGG-3′ (SEQ ID NO: 49)); and hmCX-4: (sense, 5′-GUCUUUGGUCUGGUGCCUGGUCUGA-3′ (SEQ ID NO: 3) and antisense, 5′-UCAGACCAGGCACCAGACCAAAGAC-3′ (SEQ ID NO: 4)). The four siRNA sequences targeting both human and mouse TGF-β1 and they are: hmTF-1: (sense, 5′-GGAUCCACGAGCCCAAGGGCUACCA-3′ (SEQ ID NO: 42) and antisense, 5′-UGGUAGCCCUUGGGCUCGUGGAUCC-3′ (SEQ ID NO: 43)); hmTF-2: (sense, 5′-CCCAAGGGCUACCAUGCCAACUUCU-3′ (SEQ ID NO: 11) and antisense, 5′-AGAAGUUGGCAUGGUAGCCCUUGGG-3′ (SEQ ID NO: 12)); hmTF-3: (sense, 5′-GAGCCCAAGGGCUACCAUGCCAACU-3′ (SEQ ID NO: 44) and antisense, 5′-AGUUGGCAUGGUAGCCCUUGGGCUC-3′ (SEQ ID NO: 45)); and hmTF-4: (sense, 5′-CCCCGGAGGUGAUUUCCAUCUACAA-3′ (SEQ ID NO: 5) and antisense, 5′-UUGUAGAUGGAAAUCACCUCCGGGG-3′ (SEQ ID NO: 6)).
Transfection of siRNA Duplexes into the Specific Cell Cultures
For measuring HoxB13 gene expression knockdown at both mRNA and protein levels using four selected siRNA duplexes, the REK cell expressing HOXB13 were transfected by four siRNA duplexes with LipofectAmine 2000. Similarly, for measurement of COX-2 gene expression knock-down at both mRNA and protein levels using four selected siRNA duplexes, human foreskin fibroblasts (HFF) obtained from American Type Culture Collection (Manassas, Va.) are cultured on 10-cm plates in DMEM supplemented with 10% fetal bovine serum (FBS), 100 μg/ml streptomycin, and 100 U/ml penicillin and transfected with the siRNA duplexes using LipofectAmine 2000. The cells should be washed twice with PBS and incubated in FBS-free medium for 24 h. FBS-free medium was replaced with medium containing 10% FBS to initiate the cell cycle. For measuring TGF-β1 gene expression knockdown at both mRNA and protein levels using four selected siRNA duplexes, the mouse embryonic endothelial cells (MEECs) should be transfected with siRNA-LipofectAmine 2000 followed by RT-PCR analysis. Potential pitfalls: the transfection of those cells with LipofectAmine 2000 may not always works efficiently, the alternative transfection methods should be applied such as electroporation or other transfection agents. The efficient transfection and following RT-PCR analysis may need to work in concert to achieve satisfactory data.
Measurement of mRNA Levels Using RT-PCR
Total RNA from each of those transfected cell lines including HoxB13 (mouse) expressing REK cells, COX-2 (human) expressing cells and mouse embryonic endothelial cells are isolated and purified for RT-PCR analysis. For detection of HoxB13 amplicon (mouse), an RT reaction is followed with a PCR reaction using forward primer, 5′-CTCCAGCTCCTGTGCCTTAT-3′ (SEQ ID NO: 17) and the reverse primer, 5′-ACT GGCCATAGGCTGGTATG-3′ (SEQ ID NO: 18). For detection of COX-2 amplicon (human), an RT reaction is followed with a PCR reaction using forward primer, 5′-CGGGCTGGGCCATGGGGTGGA-3′ (SEQ ID NO: 56) and the reverse primer, 5% CCTATCAGTATTAGCCTGCTT-3′ (SEQ ID NO: 57). For detection of TGF-β1 amplicon (mouse), an RT reaction is followed with a PCR reaction using forward primer, 5′-CTACTGTGTGCTGAGCACCT″T-3′ (SEQ ID NO: 62) and the reverse primer, 5′-CGCTGCTCGGCCACTCTGGCT-3′ (SEQ ID NO: 63). The PCR products should be loaded on a 1% agarose gel and stained with ethidium bromide. The PCR product should exhibit the levels of the knockdown of each particular mRNA using the particular siRNA duplexes. The result from this experiment is to determine the potency of each siRNA duplex and provide the first look if a particular siRNA duplex should be the most potent one. The RT-PCR analysis is closely coordinated with the transfection experiment so that proper conditions are optimized for efficient transfection for particular cell line, in order to achieve sufficient amount of total RNA for the PCR analysis. In addition, the selection of the most potent siRNA duplex for each gene should be based on three repeated experiments.
Measurement of Protein Levels Using ELISA
To measure protein levels of the cells transfected with corresponding siRNA duplexes, the Western blot analysis and ELISA analysis should be sufficient and satisfactory. The cell lysates or cell culture media would be used for the protein detection. Although the ELISA assay for detection of mouse HoxB13 is not commercial available, we can use the a rat polyclonal antibody to mouse HoxB13 (Aviva Systems Biologics, San Diego, Calif.) to detect siRNA-mediated knockdown in the HoxB13 expressing REK cells with a Western blot analysis. Rabbit anti-Hoxb 13 antibody was generated against the N-terminal (amino acids 1-7 9) portion of mouse HoxB13. This antibody should recognize both the WT and knockout HoxB13 protein. The latter is a truncated protein that stops at amino acid 33 of the homeodomain. Before use, the antisera should be positively affinity purified followed by negative affinity purification against mouse Hoxc13 and chicken Hoxd13 to eliminate possible cross-reactivity with the other Hox13 proteins. Staining should be viewed using a Leica DMLB microscope, and images should be captured using an Optronics DEI750D Digital System (Goleta, Calif.). The human COX-2 is analyzed using COX-2 ELISA kit (Zymed, San Francisco, Calif.) which is an enzyme-linked immunosorbent sandwich assay for quantitative detection of human COX-2 in cell culture supernatants and cell lysates. Since Cyclooxygenase (COX) is a membrane-bound enzyme, which has a molecular weight of 71 kDa, the cell lysate should be prepared for the ELISA analysis. The mouse TGF-β1 is analyzed using Human/Mouse TGFb1 (Transforming Growth Factor beta 1, TGF-beta1, TGF-b1) ELISA Ready-SET-Go Kit (with Pre-Coated Plates). The selection of the most potent siRNA duplex for each gene should be based on three repeated experiments. The potential pitfall is that sometime the most potent siRNA duplex selected from the mRNA knockdown is not correlated with the one selected from the protein knockdown. When that situation happens, we should relay on the data from the mRNA level knockdown, since that it is the direct reflection of RNAi mechanism of action. The discrepancy of the protein level knockdown some time may be due to the non-specific or so call “off-target” effect, which is not the result of the RNAi mechanism of action.
Example 12 Selection of the most Efficacious siRNA Cocktail in vivoAfter selection of the most potent siRNA duplex for each of the following three genes, HoxB13, COX-2 and TGF-β1 based on the cell culture studies, they are combined together as the siRNA cocktail with several ratios of the combinations can be used such as 1:1:1, 2:1:1 and 3:1:1, etc. Because of the importance of HoxB13 in the adult skin wound healing, an appropriate ratio change of the siRNA duplex specific to HoxB13 is determined.
The Mouse Model for Evaluation of Multi-Targeted siRNA Cocktail
In order to evaluate the appropriate siRNA cocktail and most suitable formulation, we have access to the HoxB13 knockout (KO) adult mouse. We found that HoxB13 KO wounds exhibit several characteristics of early gestational fetal wounds, including faster closure, increased tensile strength, and less dermal scarring when compared with wounds from their wild-type (WT) counterparts. Biochemical evaluation revealed that levels of epidermal and dermal HA are significantly higher in unwounded adult HoxB13 KO skin compared with WT skin. Based on these results, we postulated that HoxB13 in adult skin promotes differentiation, whereas its absence creates a more fetal-like environment, and that one consequence of this fetal-like state is enhanced wound healing. In addition to a well accepted model using the back skin wounds in HoxB13 KO mice, we have also established a mouse lip surgery model to mimic cleft lip and palate surgery, performed under general anesthesia and sterile conditions. HoxB13 KO and WT adult mice (8-16 week old) are given a single 0.5 cm full thickness skin incisional wound in parallel with their front teeth followed by suturing (6.0 Nylon) the wound, mimicking the cleft lip and palate surgery.
The Formulations Used for Delivery of the Multi-Targeted siRNA Cocktail
To establish a polymer-siRNA nanoparticle, we decided to first test the Histidine-Lysine branched polymer for this formulation. The biopolymer core facility at the University of Maryland synthesizes polymers on a Ranin Voyager synthesizer (PTI, Tucson, Ariz.). The branched HK polymer, effective for in vivo siRNA transfer, was complexed with siRNA duplexes for local administration. The polymer is purified by HPLC (Beckman, Fullerton, Calif.). The second branched H (histidine) and K (Lysine) polymers used in this study should be R-KR-KR-KR, where R=[HHHKHHHKHHHKHHH]2KH4NH4]. H3K4b is a branched polymer with the same core and structure described above except the R branches differ: R=KHHHKHHHKHHHKHHHK (SEQ ID NO: 65). The HKP can be dissolved in aqueous solution and then mixed with siRNA aqueous solution at a ratio of 4:1 by mass, forming nanoparticles of average size of 150-200 nm in diameter. The HKP-siRNA aqueous solutions were semi-transparent without noticeable aggregation of precipitate, and can be stored at 4° C. for at least three months. In addition to HK polymers, we may also test two different types of polymer carriers, pegylated PEI and PAMAM dendrimer, with our siRNA cocktail for efficient delivery into the surrounding areas of the skin wounds. All these siRNA polymer formulations are dissolved in the RNAse free D5W solution.
Administration of the Multi-Targeted siRNA Cocktail in the Skin Wounds
Various formulations are assessed in two different skin wound models, including fixed formulations with three different ratios of three different siRNA duplexes. The three ratios are siRNA duplexes targeting HoxB13, COX-2 and TGF-β1 at 1:1:1, 2:1:1 and 3:1:1 formulated with H3K4b polymer. The study groups are: G1: 20 μg of Control siRNA-HK polymer formulation (50 μL) for each lip surgery wound; G2: 20 μg of HoxB13 siRNA-HK polymer formulation (50 μL) for each lip surgery wound; G3: 20 μg of COX-2 siRNA-HK polymer formulation (50 μL) for each lip surgery wound; G4: 20 μg of TGF-β1 siRNA-HK polymer formulation (50 μL) for each lip surgery wound; G5: 20 μg of ratio one cocktail siRNA-HK polymer formulation (50 μL) for each lip surgery wound; G6: 20 μg of ratio two siRNA-HK polymer formulation (50 μL) for each lip surgery wound; and G7: 20 μg of ratio three siRNA-HK polymer formulation (50 μL) for each lip surgery wound. Four animals are in each group. The same administration is available to both HoxB13 KO and WT mouse. The outcome of this study is to demonstrate the synergistic benefit of the cocktail siRNA formulations comparing to the single siRNA formulation.
The Impacts of Different Formulations on Wound Healing
Three formulations are tested with the siRNA cocktail, using the mouse lip surgery model of HoxB13 WT mouse using a single ratio of siRNA combination such as 1:1:1. The experiment includes G1: 20 μg of control siRNA-HK polymer formulation (50 μL); G2: 20 μg of control siRNA-Pegylated PEI polymer formulation (50 μL); G3: 20 μg of control siRNA-PAMAM dendritic polymer formulation (50 μL); G4: 20 μg of cocktail siRNA-HK polymer formulation (50 μL); G5: 20 μg of cocktail siRNA-pegylated PEI polymer formulation (50 μL), and G6: 20 μg of cocktail siRNA-PAMAM dendritic polymer formulation (50 μL). Each group has four animals. The mRNA and protein level analyses are followed as other in vivo studies. The results provide an optimal formulation of the multi-targeted siRNA cocktail for a clinically viable protocol.
Target Gene Knockdown in vivo at both mRNA and Protein Levels
Skin samples are excised from both HoxB13 KO and WT mouse, either the back skin wound or lip surgery wounds, and immersed in high-glucose DMEM containing 10% FBS and antibiotics/fungizone, surface sterilized in 70% ethanol, dissected into -'5-mm2 sections, and digested in dispase in DMEM (5 mg/ml) overnight at 4° C. Total RNA samples from tissue and cells are reverse transcribed using the RETRO-script kit and protocol (Ambion). For antibody staining, paraformaldehyde-fixed adult WT and HoxB13 KO skin samples should be processed, embedded in paraffin, sectioned (6 μm), and baked overnight at 55°. The similar method of RNA isolation and sample preparation for immunohistochemistry can be used for COX-2 and TGF-β1 detections in vivo. The judgment of the most potent siRNA cocktail formulation should be made in consideration of the skin wound model, the genotype of HoxB13 and the ratio of each siRNA duplex. The same principle should be considered that mRNA level knockdown is the key indication of the potency of the multi-target siRNA cocktail.
The Potential Therapeutic Benefits of the Multi-Targeted siRNA Cocktail
To have an initial evaluation of the potential therapeutic benefits of the siRNA cocktail, we are going to carry out two analyses: Histological and HA analysis. Paraformaldehyde-fixed skin samples are processed, embedded in paraffin, and sectioned (6 μm). Slides should be baked overnight at 55° C. and stained with hematoxylin and eosin or Masson's trichrome for collagen, using standard protocols. For HA detection, skin sections are blocked in 2% FBS, incubated with biotinylated HA binding protein (bHABP, 1 μg/ml in PBS; Associates of Cape Cod, Inc., Falmouth, Mass.) overnight at 4° C., rinsed in PBS, incubated with Cy-3-streptavidin (1:500; Jackson Immunoresearch Laboratories) for 30 min at room temperature, rinsed in PBS, and mounted as previously described. As a negative control, tissue should be incubated in PBS alone. Immunofluoresence should be viewed using a Leica DMLB microscope and images captured using an Optronics DEI-750D Digital System. Histology analysis provides graphic information about the morphological difference between the treated and untreated skin wounds and the intensities of presence of the HA protein.
Example 13 Develop a Clinically Viable Protocol for the Multi-Targeted SiRNAs CocktailA suitable ratio of siRNA duplexes in formulating a cocktail are defined with an optimized polymer formulation, and correlated with a particular mouse model. siRNAs, and cocktails thereof, are tested in the lip surgery model.
The Dose Dependent Curve of the Multi-Targeted siRNA Cocktail Formulation
To define the appropriate dosage of the defined therapeutic candidate siRNA cocktail formulations, 6 different dosages are tested in the mouse lip surgery model. The testing groups are going to be G1: apply 2 μg/50 μL onto the wound; G2: apply 10 μg/50 μL onto the wound; G3: apply 20 μg/50 μL onto the wound; G4: apply 30 μg/50 μL onto the wound, G5: apply 40 μg/50 μL onto the wound and G6: apply 60 μg/50 μL onto the wound. Each group contains four animals. The molecular biological and biochemical readouts should be measured along with the histology and morphology evaluation.
Histological and HA Analysis
Paraformaldehyde-fixed skin samples are processed, embedded in paraffin, and sectioned (6 μm). Slides are baked overnight at 55° C. and stained with hematoxylin and eosin or Masson's trichrome for collagen, using standard protocols. For HA detection, skin sections are blocked in 2% FBS, incubated with biotinylated HA binding protein (bHABP, 1 μg/ml in PBS; Associates of Cape Cod, Inc., Falmouth, Mass.) overnight at 4° C., rinsed in PBS, incubated with Cy-3-streptavidin (1:500; Jackson Immunoresearch Laboratories) for 30 min at room temperature, rinsed in PBS, and mounted as previously described. As a negative control, tissue should be incubated in PBS alone. Immunofluoresence should be viewed using a Leica DMLB microscope and images captured using an Optronics DEI-750D Digital System. The histology analysis provides graphic information about the morphological difference between the treated and untreated skin wounds and the intensities of presence of the HA protein.
Quantification of Collagen Content
Collagen content is determined by measuring hydroxyproline contents of samples. In brief, full-thickness dorsal skin samples (≈16 mg) harvested from 8- to 16-wk-old adult mice (n=6 each for WT and HoxB13 KO) are lyophilized overnight and hydrolyzed in 6 N HCl for 18 h at 110° C. (use enough to cover the tissue), and the pH are then adjusted to between 6 and 7 with NaOH. The samples are diluted to 5 ml with H2O and filtered using Whatman filter paper. The following solutions are added successively to 1.0 ml of each sample: chloramine T solution (1.0 ml, 0.05 M, room temperature for 20 min), perchloric acid (1.0 ml, 3.15 M, room temperature for 5 min), and 20% p-dimethylaminobenzaldehyde (1.0 ml). The samples should be incubated at 60° C. for 20 min and cooled to room temperature. Absorbances are going to be read at a wavelength of 557.5 nm, and hydroxyproline concentrations are going to be determined using a standard curve. The following calculation should be used to determine collagen content: μg of hydroxyproline×7.46=μg of collagen. Values are reported as μg/mg dry weight.
Measurement of Tensiometry
For this study, the incisional wound plus surrounding skin is carefully excised and the tissue is fixed in 4% paraformaldehyde overnight. All tissue need to be fixed for the same time, and tensiometry at all time points is conducted the day after wound collection. Before tensiometric analysis, samples should be carefully cut to a uniform length and width, and the thickness of the skin at the wound site is determined. Tensiometry studies are conducted using an Instron testing system. Results should be reported as Y-modulus and the Y-modulus is derived by calculating stress/strain and is representative of the overall wound strength. Stress is the amount of force required to break the wound apart/cross-sectional area of the wound. Strain is the original length of the sample/length at breaking. The raw strain values and cross-sectional areas will not vary significantly at any time point postwounding between WT and HoxB13 KO wounds (data not shown). Thus, the differences in the Y-modulus values are primarily due to the force component of the stress value.
Example 14 Preparing siRNA InhibitorsThe present invention provides a novel approach to prepare siRNA targeting sequences. There are three important aspects that differ from other approaches:
- (1) the sequences targeted by siRNA duplexes have homology to both human and mouse sequences of the same gene. That means each of the siRNA duplexes knockdown the same gene target in either human or mouse cells. For example, a potent siRNA specific to HoxB13 gene knocks down both human HoxB13 and mouse HoxB13 gene expression.
- (2) the sequences were prepared in three different lengths: 21-mer, 23-mer and 25-mer. Optimal lengths of a given siRNA targeting sequence are identified in various model systems.
- (3) the siRNA oligonucleotides are prepared in either blunt end or sticky end form. As used herein, “oligonucleotides” and similar terms based on this relate to short oligonucleotides composed of naturally occurring nucleotides as well as to oligonucleotides composed of synthetic or modified nucleotides. The terms “polynucleotide” and “oligonucleotide” are used synonymously herein.
An oligonucleotide that is an siRNA may have any number of nucleotides between 19 and 30 nucleotides. In a preferred embodiment, an siRNA may have any number of nucleotides between 19 and 27 nucleotides. The siRNA may have two blunt ends, or two sticky ends, or one blunt end with one sticky end. The overhang nucleotides of a sticky end can range from one to four or more.
In a particularly preferred embodiment, the invention provides siRNA of 21, 23 and 25 base pairs with blunt ends.
This invention provides the therapeutic siRNA cocktail targeting multiple disease controlling genes in the same treatment. This invention provides for RNAi agents, such as siRNA oligonucleotides, that are chemically similar to the same source of supply and the same manufacturing process, and they are comprised of four types of nucleotides with different sequences. The invention provides an siRNA cocktail drug for improvement of scarless wound healing by targeting genes involved in the wound healing process, including TGF-β, COX-2, HoxB13 and others.
In a preferred embodiment, the siRNA cocktail has the following characteristics:
- (1) The siRNA cocktail contains at least three siRNA duplexes targeting at least three different genes (not three sequences of the same gene) at a ratio needed for the therapy.
- (2) The siRNA cocktails for each combination target the roles of each gene in a background of a system biology network, where these genes are functioning either in the same pathway or in a different one.
Designing siRNA Targeting both Human and Mouse mRNA Sequences
One effort we have put into the siRNA design is that all 25 mer siRNA sequences are able to target the homologues sequences of both human and mouse in the same gene. For example, the siRNA duplex sequence targeting Hoxb13 is able to target both human Hoxb13 and mouse Hoxb13 genes. Sequences have been designed in silico using the general rules for siRNA design and a proprietary algorithm to ensure the following characteristics: (1) optimum thermodynamics, (2) enhance RISC binding, (3) eliminate immune stimulation motifs, (4) human-mouse homology, (5) “off-target” potential blasted and (6) multi-targeted siRNA cocktail. Each sequence is able to target both human and mouse corresponding genes. Therefore, the potent sequences defined from the mouse cell study can be further confirmed using human cells.
Potent siRNA Duplexes Targeting TGF-β1, Cox-2, and Hoxb13 mRNA were Identified
Among ten in silico designed 25 mer siRNA sequences, we first pick three for testing. Before testing those siRNA oligos (synthesized by Qiagen) in the corresponding cells, such as human PC-3 cell (a bone metastasis of a grade N prostatic adenocarcinoma), we first use RT-PCR to survey the presence of the target gene expression in the total RNA samples (
Skin Excision Wound Model for Wound Healing Analysis
A paired 5 mm diameter full-thickness excisional skin wounds were created on both sides of the dorsal midline the depilitated dorsum of a mouse (use either C57 mouse or Balb/c mouse,
Histidine-Lysine Polymer for siRNA Delivery In Vivo
Optimized histidine-lysine polymers (HKP) have been applied for siRNA deliveries in vitro and in vivo. A pair of the HK polymer species, H3K4b and PT73, has a Lysine backbone with four branches containing multiple repeats of Histidine, Lysine or Asparagine. When this HKP aqueous solution was mixed with siRNA in aqueous solution at a N/P ratio of 4:1 by mass, the nanoparticles (average size of 100-200 nm in diameter) were self-assembled (
Using Skin Excisional Wound Model for Wound Healing Analysis
The first experiment we did with the skin excisional wound model is to analyze the therapeutic benefit of TGFβ-siRNA with Histidine-Lysine polymer-mediated topical administration. Ten mice were used in the experiment with a paired 5 mm diameter full-thickness excisional skin wounds on both sides of the dorsal midline the depilitated dorsum of the Balb/c mouse). The conventional methylcellulose was used as the topical administration carrier with or without nanoparticle/siRNA. Two wounds on each mouse were either treated with only methylcellulose or methylcellulose plus nanoparticle/siRNA daily for the first 5 days. The observations were taken on day 0, 5, 9 and 15th. When the images were put together (
Quantification of Closures of the Skin Excisional Wound
The second experiment we did was to quantify the wound closure at each time point. At same time, we also asked if the therapeutic benefit is the result of HK polymer or siRNA itself. Four groups of the treatment with 10 samples each were used in the study: 1) Methylcellulose only, 2) Methylcellulose plus nanoparticle/TGFβ-1-siRNA, 3) Methylcellulose plus TGFβ-1-siRNA, and 4) Methylcellulose plus nanoparticle/control-siRNA. By averaging the measurements of the wound samples of each group on day 5th and 9th, we found significant differences (P<0.05) between group 2 and other three groups, even though some effects were seen with group 3. Clearly, The therapeutic benefit for faster skin wound closure is results of nanoparticle-enhanced TGFβ-1-siRNA delivery.
Evidence of Target Gene Knockdown in Samples of the Skin Excisional Wound
As we knew that nanoparticle-enhanced TGFβ-1 was responsible to the therapeutic benefic for the skin wound closure, a key question appears that if the target gene in the surround tissue of the wound was down regulated. For answering such a question, the total RNA was isolated from the representative samples of each group followed by RT-PCR analysis. As shown in
Histopathology Images of Dermal Tissue Structure during Wound Healing Process
Three different magnifications were used to demonstrate the dermal tissue structure surrounding the wounded area as indicated with arrows. Skin samples were harvested 14 days after wounding, paraformaldehyde-fixed and subjected to Masson's trichrom staining to detect collagenous scar tissue. Restoration of the normal tissue architecture can be seen in wounds treated with TGFβ1 siRNA-, Cox-2 siRNA- and Hoxb13 siRNA—nanoplexes. The architecture of the neodermis of wounds treated with TGFβ1 siRNA-, Cox-2 siRNA-, and Hoxb13 siRNA-nanoplexes resembles that of normal dermis with the reticulate collagen fibers loosely arranged in the basket weave pattern. By contrast, the collagen fibers in the neodermis of sham control wounds and control siRNA-nanoplexes treated wounds are densely placed in an abnormal parallel pattern. These events allow collagen fibers to lie closer together (
Nanoparticle-Enhanced Cox-2-siRNA Delivery Resulted in Normal Tissue like Structure
As we knew that nanoparticle-enhanced TGFβ-1 was responsible to the therapeutic benefit for the skin wound closure. We also see that siRNA duplexes targeting Cox-2 and Hoxb13 genes were able to enhance the wound closure. At the same time, we want to confirm that the histopathological changes are the result of nanoparticle/siRNA (
Antifungal Efficacy of Histidine-Lysine Peptides
In our previous studies, it was shown that HK peptides are more effective delivering siRNA into cells than their linear counterparts. To determine whether the branched HK peptides are more effective antifungal agents, HK peptides that varied in their number of branches were studied for inhibition of C. albicans growth (
In summary, based on the intensive studies on the siRNA therapeutics for improving skin scarless wound healing with several mouse models, we are very confident that branched Histidine-Lysine peptides is a very potent delivery agent for siRNA in vivo (dermal).
Example 17 Experimental Design for Future StudiesTo reach the goals of the proposed study: developing a clinically viable RNAi therapeutic protocol for improvement of adult skin wound healing with less scar tissue formation without decreasing tensile strength and disrupting reepithelialization, we have set three specific aims:
Identify the most Potent siRNA Duplexes for Silencing TGF-β, COX-2 and Hoxb13 Expression in vitro
As described in the Table 1, we did design 10 siRNA sequences in silico for each of the targeted genes, Hoxb13, COX-2 and TGF-β1. We then took 3 siRNA duplexes from each of those 10 siRNA sequences and test their potencies for target gene knockdown in the respected cell cultures, human cell PC-3 and mouse cell C166.
Selection of the most Potent siRNA Duplex for each Targeted Gene
To ensure that the most potent siRNA duplex is to be selected for the future therapeutic application, we decided to use those identified siRNA duplexes as a bench mark to further evaluate three additional siRNA duplexes for each of these targeted genes: TGF-β1, Cox-2 and Hoxb13. In terms of the siRNA control sequence, we selected an siRNA duplex targeting a non-related sequence and without any homology to both human and mouse genomes: CT-1: (sense, 5′-GAGGAGCCUUCAGGAUUACAAGAUU-3′ (SEQ ID NO: 50) and antisense, 5′-AAUCUUGUAAUCCUGAAGGCUCCUC-3′ (SEQ ID NO: 51)), which has been validated in several our previous publications (35, 49). The three additional siRNA duplexes targeting both human and mouse Hoxb13 are: hmHX-1: (sense, 5′-CAAGGAUAUCGAAGGCUUGCUGGGA-3′ (SEC) ID NO: 1), antisense, 5′-UCCCAGCAAGCCUUCGAUAUCCUUG-3′ (SEQ ID NO: 2)); hmHX-2: (sense, 5′-GGACAAGAGGCGCAAGAUCUCGGCA-3′ (SEQ ID NO: 69), antisense, 5′-UGCCGAGAUCUUGCG CCUCUUGUCC-3′ (SEQ ID NO: 327)); hmHX-3: (sense, 5′-GCAAGAUCUCGGCAGCCACCAGCCU-3′ (SEQ ID NO: 68), antisense, 5′-AGGCUGGUGGCUGCCGAGAUCUUGC-3′ (SEQ ID NO: 328)). The three additional siRNA duplexes targeting both human and mouse Cox-2 are: hmCX-1: (sense, 5′-CAUCAGUUUUUCAAGACAGAUCAUA-3′ (SEQ ID NO: 73), antisense, 5′-UAUGAUCUGUCUUGAAAAACUGAUG-3′ (SEQ ID NO: 329)); hmCX-2: (sense, 5′-GUCUUUGGUCUGGUGCCUGGUCUGA-3′ (SEQ ID NO: 3), antisense, 5′-UCAGACCAGGCACCAGACCAAAGAC-3′ (SEQ ID NO: 4)); hmCX-3: (sense, 5′-GUGCCUGGUCU GAUGAUGUAUGCCA-3′ (SEQ ID NO: 75), antisense, 5′-UGGCAUACAUCAUCAGACCAGGCAC-3′ (SEQ ID NO: 330)). The three additional siRNA duplexes targeting both human and mouse TGF-β1 are: hmTF-1: (sense, 5′-GAUCCACGAGCCCAAGGGCUACCAU-3′ (SEQ ID NO: 331), antisense, 5′-AUGGUAGCCCUUGGGCUCGUGGAUC-3′ (SEQ ID NO: 332)); hmTF-2: (sense, 5′-CACGAGCCCAAGGGCUACCAUGCCA-3′ (SEQ ID NO: 13), antisense, 5′-UGGCAUGGUAGCCCUUGGGCUCGUG-3′ (SEQ ID NO: 14)); hmTF-3: (sense, 5′-GGCGCCGCCUCCCCCAUGCCGCCCU-3′ (SEQ ID NO: 333), antisense, 5′-AGGGCGGC AUGGGGGAGGCGGCGCC-3′ (SEQ ID NO: 64)). A series of transfection experiments are going to be conducted followed by RNA isolation and RT-PCR analyses, to determine if any these additional siRNA duplexes is any better then those already identified.
Transfection of siRNA Duplexes into the Specific Cell Cultures
Since we have found out that human PC-3 cells are very well suited for the siRNA-mediated gene silencing tests for all three gene targets, we will stay with the PC-3 cells for in vitro studies of the gene expression knockdown at both mRNA and protein levels, using three additional siRNA duplexes to compare with the identified siRNA duplexes. Similarly, the mouse C166 cell can also be useful for these siRNA duplexes testing for silencing all three genes. These two cell lines will be cultured on 10-cm plates in DMEM supplemented with 10% fetal bovine serum (FBS), 100 μg/ml streptomycin, and 100 U/ml penicillin and transfected with the siRNA duplexes using Lipofectamin 2000. The cells should be washed twice with PBS and incubated in FBS-free medium for 24 h. FBS-free medium was replaced with medium containing 10% FBS to initiate the cell cycle. The transfection experiments will have reagent control group, non-specific siRNA control group, three different dosages for transfecting the specific siRNA duplexes: 0.5, 1.0 and 2.0 ug per well on 6 well plate. Potential pitfalls: the transfection of those cells with Lipofectamin 2000 may not always work efficiently. Alternative transfection methods can be used, such as electroporation or other transfection agents. The efficient transfection and following RT-PCR analysis may need to work in concert to achieve satisfactory data.
Measurement of mRNA Levels Using RT-PCR
Total RNA from each of those transfected cell lines: PC-3 and C166. For detection of Hoxb13 amplicon (mouse), an RT reaction will be followed with a PCR reaction using forward primer, 5′-CTCCAGCTCCTGTGCCTTAT-3′ (SEQ ID NO: 17) and the reverse primer, 5′-ACT GGCCATAGGCTGGTATG-3′ (SEQ ID NO: 18). For detection of Cox-2 amplicon (human), an RT reaction will be followed with a PCR reaction using forward primer, 5′-CGGGCTGGGCCATGGGGTGGA-3′ (SEQ ID NO: 56) and the reverse primer, 5′-CCTATCAGTATTAGCCTGCTT-3′ (SEQ ID NO: 57). For detection of TGF-β1 amplicon (mouse), an RT reaction will be followed with a PCR reaction using forward primer, 5′-CTACTGTGTGCTGAGCACCTT-3′ (SEQ ID NO: 62) and the reverse primer, 5′-CGCTGCTCGG CCACTCTGGCT-3′ (SEQ ID NO: 63). The PCR products should be loaded on a 1% agarose gel and stained with ethidium bromide. The PCR product should exhibit the levels of the knockdown of each particular mRNA using the particular siRNA duplexes. The result from this experiment will determine the potency of each siRNA duplex and provide the first look if a particular siRNA duplex should be the most potent one. The RT-PCR analysis may need to work closely with the transfection experiment so that a proper condition can be optimized for efficient transfection for particular cell line, in order to achieve sufficient amount of total RNA for the PCR analysis. In addition, the selection of the most potent siRNA duplex for each gene will be based on three repeated experiments. The silencing efficacies will be compared between the additional three siRNA duplexes and the previously identified siRNA duplexes.
Measurement of Protein Levels Using ELISA
To measure protein levels of the cells transfected with corresponding siRNA duplexes, the Western blot analysis and ELISA analysis should be sufficient and satisfactory. The cell lysates or cell culture media would be used for the protein detection. Although the ELISA assay for detection of mouse Hoxb13 is not commercially available, we can use the a rat polycolonal antibody to mouse Hoxb13 (Aviva Systems Biologics, San Diego, Calif.) to detect siRNA-mediated knockdown in the Hoxb13 expressing REK cells with a Western blot analysis. Rabbit anti-Hoxb13 antibody was generated against the N-terminal (amino acids 1-7 9) portion of mouse Hoxb13. This antibody should recognize both the WT and knockout Hoxb13 protein. The latter is a truncated protein that stops at amino acid 33 of the homeodomain. Before use, the antisera should be positively affinity purified followed by negative affinity purification against mouse Hoxc13 and chicken Hoxd13 to eliminate possible cross-reactivity with the other Hox13 proteins. Staining should be viewed using a Leica DMLB microscope, and images should be captured using an Optronics DEI750D Digital System (Goleta, Calif.). The human COX-2 will be analyzed using COX-2 ELISA kit (Zymed, San Francisco, Calif.) which is an enzyme-linked immunosorbent sandwich assay for quantitative detection of human COX-2 in cell culture supernatants and cell lysates. Since Cyclooxygenase (COX) is a membrane-bound enzyme, which has a molecular weight of 71 kDa, the cell lysate should be prepared for the ELISA analysis. The mouse TGF-β1 will be analyzed using Human/Mouse TGF-β1 (Transforming Growth Factor beta 1, TGF-β1/TGF-β1) ELISA Ready-SET-Go Kit (with Pre-Coated Plates). The selection of the most potent siRNA duplex for each gene should be based on three repeated experiments.
The potential pitfall is that sometime the most potent siRNA duplex selected from the mRNA knockdown is not correlated with the one selected from the protein knockdown. When that situation happens, we will rely on the data from the mRNA level knockdown, since that it is the direct reflection of RNAi mechanism of action. The discrepancy of the protein level knockdown some time may be due to the non-specific or so call “off-target” effect, which is not the result of the RNAi mechanism of action.
Select the most Efficacious siRNA Cocktail in vivo
After selection of the most potent siRNA duplex for each of the following three genes, Hoxb13, COX-2 and TGF-β1 based on the cell culture studies, we will combine them together as the siRNA cocktail with several ratios. The combinations can be used as 1:1:1, 2:1:1 and 3:1:1, etc. Because of the importance of Hoxb13 in the adult skin wound healing, we will focus on the ratio change of the siRNA duplex specific to Hoxb13. In addition, we will evaluate the appropriate mouse models and siRNA nanoparticle formulations, so that we can define the most suitable siRNA-nanoparticle formulation for potential therapeutic protocol.
The Mouse Model for Evaluation of Multi-Targeted siRNA Cocktails
In order to evaluate the appropriate siRNA cocktail and most suitable formulation, we will obtain the Hoxb13 knockout (KO) adult mouse from Dr. Ling Li's lab, since Hoxb13 KO wounds exhibit several characteristics of early gestational fetal wounds, including faster closure, increased tensile strength, and less dermal scarring when compared with wounds from their wild-type (WT) counterparts. Biochemical evaluation revealed that levels of epidermal and dermal hyaluronic acid (HA) are significantly higher in unwounded adult Hoxb13 KO skin compared with WT skin. Based on these results, we postulate that Hoxb13 in adult skin promotes differentiation, whereas its absence creates a more fetal-like environment, and that one consequence of this fetal-like state is enhanced wound healing. In addition to a well accepted model using the back skin wounds in Hoxb13 KO mice, we have also established a mouse lip surgery model to mimic cleft lip and palate surgery. In our study, under general anesthesia and sterile conditions, Hoxb13 KO and WT adult mice (8-16 week old) will be given a single 0.5 cm full thickness skin incisional wound in parallel with their front teeth followed by suturing (6.0 Nylon) the wound, mimicking the cleft lip and palate surgery.
The Formulations Used for Delivery of the Multi-Targeted siRNA Cocktail
To establish a polymer-siRNA nanoparticle, we decided to first test the Histidine-Lysine branched polymer for this formulation. The biopolymer core facility at the University of Maryland will synthesize polymers on a Ranin Voyager synthesizer (PTI, Tucson, Ariz.). The branched HK polymer, effective for in vivo siRNA transfer, was complexed with siRNA duplexes for local administration. The polymer will be purified by HPLC (Beckman, Fullerton, Calif.). The second branched H (histidine) and K (Lysine) polymers used in this study should be R-KR-KR-KR, where R=[HHHKHHHKHHHKHHH]2 KH4NH4]. H3K4b is a branched polymer with the same core and structure described above except the R branches differ: R=KHHHKHHHKHHHKHHHK (SEQ ID NO: 65). The HKP can be dissolved in aqueous solution and then mixed with siRNA aqueous solution at a ratio of 4:1 by mass, forming nanoparticles of average size of 150-200 nm in diameter. The HKP-siRNA aqueous solutions were semi-transparent without noticeable aggregation of precipitate, and can be stored at 4° C. for at least three months (50). In addition to HK polymers, we may also test two different types of polymer carriers, pegylated PEI and PAMAM dendrimer, with our siRNA cocktail for efficient delivery into the areas of the skin wounds. All these siRNA polymer formulations will be dissolved in the RNAse free D5W solution and then incorporated into 2% Methylcellulose (1:1) or 2% Methylcellulose:PBS (1:1). The formulation will be applied onto the wound beds and either covered or not with transparent Tegaderm dressing.
Administration of the Multi-Targeted siRNA Cocktail in the Skin Wounds
To test the various formulations in two different skin wound models, we will first test the fixed formulations with three different ratios of three different siRNA duplexes. The three ratios will be siRNA duplexes targeting Hoxb13, Cox-2 and TGF-β1 at 1:1:1, 2:1:1 and 3:1:1 formulated with H3K4b polymer. The study groups are going to be: G1: 20 μg of Control siRNA-HK polymer formulation (50 μL) for each lip surgery wound; G2: 20 μg of Hoxb13 siRNA-HK polymer formulation (50 μL) for each lip surgery wound; G3: 20 μg of Cox-2 siRNA-HK polymer formulation (50 μL) for each lip surgery wound; G4: 20 μg of TGF-β1 siRNA-HK polymer formulation (50 μL) for each lip surgery wound; G5: 20 μg of ratio one cocktail siRNA-HK polymer formulation (50 μL) for each lip surgery wound; G6: 20 μg of ratio two siRNA-HK polymer formulation (50 μL) for each lip surgery wound; and G7: 20 μg of ratio three siRNA-HK polymer formulation (50 μL) for each lip surgery wound. Four animals are in each group. The same administration will be available to both Hoxb13 KO and WT mouse. The outcome of this study is to demonstrate the synergistic benefit of the cocktail siRNA formulations comparing to the single siRNA formulation. The comparison between the results from either KO animal and WT animal will provide an insight how different testing models will response to the novel therapeutic formulations.
The Impacts of Different Formulations on the Wound Healing
Since three formulations are going to be tested with the siRNA cocktail, we plan to only test the three formulations with mouse lip surgery model of Hoxb13 WT mouse. The experiment will focus on one ratio of siRNA combination such as 1:1:1. The experiment will include G1: 20 μg of control siRNA-HK polymer formulation (50 μL); G2: 20 μg of control siRNA-Pegylated PEI polymer formulation (50 μL); G3: 20 μg of control siRNA-PAMAM dendritic polymer formulation (50 μL); G4: 20 μg of cocktail siRNA-HK polymer formulation (50 μL); G5: 20 μg of cocktail siRNA-pegylated PEI polymer formulation (50 μL), and G6: 20 μg of cocktail siRNA-PAMAM dendritic polymer formulation (50 μL). Each group will have four animals. The mRNA and protein level analyses will be followed as other in vivo studies. This study will help us to determine the best formulation of the multi-targeted siRNA cocktail for a clinical protocol.
Target Gene Knockdown in vivo at both mRNA and Protein Levels
Skin samples will be excised from both Hoxb13 KO and WT mouse, either the back skin wound or lip surgery wounds, and immersed in high-glucose DMEM containing 10% FBS and antibiotics/fungizone, surface sterilized in 70% ethanol, dissected into -'5-mm2 sections, and digested in dispase in DMEM (5 mg/ml) overnight at 4° C. Total RNA samples from tissue and cells will be reverse transcribed using the RETRO-script kit and protocol (Ambion). For antibody staining, paraformaldehyde-fixed adult WT and Hoxb13 KO skin samples should be processed, embedded in paraffin, sectioned (6 μm), and baked overnight at 55°. The similar method of RNA isolation and sample preparation for immunohistochemistry can be used for Cox-2 and TGF-β1 detections in vivo. The judgment of the most potent siRNA cocktail formulation should be made in consideration of the skin wound model, the genotype of Hoxb13 and the ratio of each siRNA duplex. The same principle should be considered that mRNA level knockdown is the key indication of the potency of the multi-target siRNA cocktail.
The Potential Therapeutic Benefits of the Multi-Targeted siRNA Cocktail
To have an initial evaluation of the potential therapeutic benefits of the siRNA cocktail, we are going to carry out two analyses: Histological and HA analysis. Paraformaldehyde-fixed skin samples will be processed, embedded in paraffin, and sectioned (6 μm). Slides should be baked overnight at 55° C. and stained with hematoxylin and eosin or Masson's trichrome for collagen, using standard protocols. For HA detection, skin sections will be blocked in 2% FBS, incubated with biotinylated HA binding protein (bHABP, 1 μg/ml in PBS; Associates of Cape Cod, Inc., Falmouth, Mass.) overnight at 4° C., rinsed in PBS, incubated with Cy-3-streptavidin (1:500; Jackson Immunoresearch Laboratories) for 30 min at room temperature, rinsed in PBS, and mounted as previously described. As a negative control, tissue should be incubated in PBS alone. Immunofluoresence should be viewed using a Leica DMLB microscope and images captured using an Optronics DEI-750D Digital System. The histology analysis will provide graphic information about the morphological difference between the treated and untreated skin wounds and the intensities of presence of the HA protein.
Develop Clinical Protocol for Multi-Targeted siRNA Cocktail
A proper ratio of siRNA cocktail will be defined with an optimized polymer formulation, and correlated with a particular mouse model. We will design the experiments to test this candidate therapeutic protocol for the pharmacological characteristics and any visible toxicity or adverse effect. In order to present a clear picture, we just assume that the lip surgery model is going to be the one we select at the time (although the real result can only be reached when we complete the first two studies).
The Dose Dependent Curve of the Multi-Targeted siRNA Cocktail Formulation
To define the appropriate dosage of the defined therapeutic candidate siRNA cocktail formulations, we will have 6 different dosage being tested in the mouse lip surgery model. The testing groups are going to be G1: apply 2 μg/50 μL onto the wound; G2: apply 10 μg/50 μL onto the wound; G3: apply 20 μg/50 μL onto the wound; G4: apply 30 μg/50 μL onto the wound, G5: apply 40 μg/50 μL onto the wound and G6: apply 60 μg/50 μL onto the wound. Each group will contain four animals. The molecular biological and biochemical readouts should be measured along with the histology and morphology evaluation.
Histological and HA Analysis
Paraformaldehyde-fixed skin samples will be processed, embedded in paraffin, and sectioned (6 μm). Slides will be baked overnight at 55° C. and stained with hematoxylin and eosin or Masson's trichrome for collagen, using standard protocols. For HA detection, skin sections will be blocked in 2% FBS, incubated with biotinylated HA binding protein (bHABP, 1 μg/ml in PBS; Associates of Cape Cod, Inc., Falmouth, Mass.) overnight at 4° C., rinsed in PBS, incubated with Cy-3-streptavidin (1:500; Jackson Immunoresearch Laboratories) for 30 min at room temperature, rinsed in PBS, and mounted as previously described. As a negative control, tissue should be incubated in PBS alone. Immunofluoresence should be viewed using a Leica DMLB microscope and images captured using an Optronics DEI-750D Digital System. The histology analysis will provide graphic information about the morphological difference between the treated and untreated skin wounds and the intensities of presence of the HA protein.
Quantification of Collagen Content
Collagen content will be determined by measuring hydroxyproline contents of samples. In brief, full-thickness dorsal skin samples (≈16 mg) harvested from 8- to 16-wk-old adult mice (n=6 each for WT and Hoxb13 KO) will be lyophilized overnight and hydrolyzed in 6 N HCl for 18 h at 110° C. (use enough to cover the tissue), and the pH are then adjusted to between 6 and 7 with NaOH. The samples will be diluted to 5 ml with H2O and filtered using Whatman filter paper. The following solutions will be added successively to 1.0 ml of each sample: chloramine T solution (1.0 ml, 0.05 M, room temperature for 20 min), perchloric acid (1.0 ml, 3.15 M, room temperature for 5 min), and 20% p-dimethylaminobenzaldehyde (1.0 ml). The samples should be incubated at 60° C. for 20 min and cooled to room temperature. Absorbances are going to be read at a wavelength of 557.5 nm, and hydroxyproline concentrations are going to be determined using a standard curve. The following calculation should be used to determine collagen content: μg of hydroxyproline×7.46=μg of collagen. Values are reported as μg/mg dry weight.
Measurement of Tensiometry
For this study, the incisional wound plus surrounding skin will be carefully excised and the tissue will be fixed in 4% paraformaldehyde overnight. All tissue need to be fixed for the same time, and tensiometry at all time points will be conducted the day after wound collection. Before tensiometric analysis, samples should be carefully cut to a uniform length and width, and the thickness of the skin at the wound site will be determined. Tensiometry studies will be conducted using an Instron testing system. Results should be reported as Y-modulus and the Y-modulus is derived by calculating stress/strain and is representative of the overall wound strength. Stress is the amount of force required to break the wound apart/cross-sectional area of the wound. Strain is the original length of the sample/length at breaking. The raw strain values and cross-sectional areas will not vary significantly at any time point postwounding between WT and Hoxb13 KO wounds (data not shown). Thus, the differences in the Y-modulus values are primarily due to the force component of the stress value.
In conclusion, we believe that the abundant data set from the proposed study will provide us substantial information for understanding the characteristics of the multi-targeted siRNA cocktail formulation and therefore, define a clinical protocol for improvement of adult skin wound healing with less scar tissue formation. stronger tensile strength, and faster closure. The multi-targeted siRNA cocktail represents a novel therapeutic approach to treat various skin wounds and will be very valuable for both pharmaceutical and cosmaceutical markets.
REFERENCES
- 1. Singer A J, Clark R A: Cutaneous wound healing. N Engl J Med 1999, 341:738-746.
- 2. Martin P: Wound healing: aiming for perfect skin regeneration. Science 1997, 276:75-81.
- 3. Rowlatt U: Intrauterine wound healing in a 20 week human fetus. Virchows Arch A Pathol Anat Histol 1979, 381:353-361.
- 4. Lin R Y, et al. Exogenous transforming growth factor-beta amplifies its own expression and induces scar formation in a model of human fetal skin repair. Ann Surg 1995, 222: 146-154.
- 5. Cowin A J, et al. Expression of TGF-beta and its receptors in murine fetal and adult dermal wounds. Eur J Dermatol 2001, 11:424-431.
- 6. Krummel T M, et al. Transforming growth factor beta (TGF-beta) induces fibrosis in a fetal wound model. J Pediatr Surg 1988, 23:647-652.
- 7. Lanning D A, et al. TGF-beta1 alters the healing of cutaneous fetal excisional wounds. J Pediatr Surg 1999, 34:695-700.
- 8. Soo C, et al. Ontogenetic transition in fetal wound transforming growth factor-beta regulation correlates with collagen organization. Am J Pathol 2003, 163:2459-2476.
- 9. Sullivan K M, et al. A model of scarless human fetal wound repair is deficient in transforming growth factor beta. J Pediatr Surg 1995, 30:198-202202-193.
- 10. Stelnicki E J, et al. A new in vivo model for the study of fetal wound healing. Ann Plast Surg 1997, 39:374-380.
- 11. Whitby D J and Ferguson M W: Immunohistochemical localization of growth factors in fetal wound healing. Dev Biol 1991, 147:207-215.
- 12. Roberts A B, et al. Transforming growth factor type beta: rapid induction of fibrosis and angiogenesis in vivo and stimulation of collagen formation in vitro. Proc Natl Acad Sci USA 1986, 83:4167-4171.
- 13. Shah M, et al. Neutralising antibody to TGF-beta 1, 2 reduces cutaneous scarring in adult rodents. J Cell Sci 1994, 107:1137-1157.
- 14. Shah M, et al. Control of scarring in adult wounds by neutralising antibody to transforming growth factor beta. Lancet 1992, 339:213-214.
- 15. Choi B M, et al. Control of scarring in adult wounds using antisense transforming growth factor-beta 1 oligodeoxynucleotides. Immunol Cell Biol 1996, 74:144-150.
- 16. Wu K K: Cyclooxygenase 2 induction: molecular mechanism and pathophysiologic roles. J Lab Clin Med 1996, 128:242-245.
- 20. Wilgus T A, et al. Topical application of a selective cyclooxygenase inhibitor suppresses UVB mediated cutaneous inflammation. Prostaglandins Other Lipid Mediat 2000, 62:367-384.
- 21. Sun W H, et al. Cyclooxygenase-2 inhibitors suppress epithelial cell kinetics and delay gastric wound healing in rats. J Gastroenterol Hepatol 2000, 15:752-761.
- 22. Guo J S, et al. Antiangiogenic effect of a highly selective cyclooxygenase-2 inhibitor on gastric ulcer healing in rats. Toxicol Appl Pharmacol 2002, 183:41-45.
- 23. Simon A M, et al. Cyclooxygenase 2 function is essential for bone fracture healing. J Bone Miner Res 2002, 17:963-976.
- 24. Blomme E A, et al. Selective cyclooxygenase-2 inhibition does not affect the healing of cutaneous full-thickness incisional wounds in SKH-1 mice. Br J Dermatol 2003, 148: 211-223.
- 25. Muller-Decker K, et al. The effects of cyclooxygenase isozyme inhibition on incisional wound healing in mouse skin. J Invest Dermatol 2002, 119:1189-1195.
- 26. Muscara M N, et al. Wound collagen deposition in rats: effects of an NO-NSAID and a selective COX-2 inhibitor. Br J Pharmacol 2000, 129:681-686.
- 27. Futagami A, et al. Wound healing involves induction of cyclooxygenase-2 expression in rat skin. Lab Invest 2002, 82:1503-1513.
- 28. Wilgus T A, et al. Reduction of scar formation in full-thickness wounds with topical celecoxib treatment. Wound Repair Regen 2003, 11:25-34.
- 29. Mack, J. A. et al. HoxB13 knockout adult skin exhibits high levels of hyaluronan and enhanced wound healing. FASEB J. 2003 July; 17(10):1352-4. Epub 2003 May 20.
- 30. Mack, J. A. et al. HoxB13 up-regulates transglutaminase activity and drives terminal differentiation in an epidermal organotypic model. J Biol Chem. 2005 Aug. 19; 280(33): 29904-11. Epub 2005 Jun. 17.
- 31. Stelnicki, E. J. et al. Modulation of the human homeobox genes PRX-2 and HOXB13 in scarless fetal wounds. J Invest Dermatol. 1998 July; 111(1):57-63.
- 32. Wilgus, T. A. et al. Reduction of scar formation in full-thickness wounds with topical celecoxib treatment. Wound Repair Regen. 2003 January-February; 11(1):25-34.
- 33. Manus, M. T. and P. A. Sharp (2002) Gene silencing in mammals by small interfering RNAs. Nature Review, Genetics. 3(10):737-747.
- 34. Lu, P. Y. et al. (2003) siRNA-mediated antitumorigenesis for drug target validation and therapeutics. Current Opinion in Molecular Therapeutics. 5(3):225-234.
- 35. Kim, B. et al. (2004) Inhibition of ocular angiogenesis by siRNA targeting vascular endothelial growth factor-pathway genes; therapeutic strategy for herpetic stromal keratitis. Am. J Pathol. 165 (6): 2177-85.
- 36. Tuschl, Zamore, Lehmann, Bartel and Sharp (1999), Genes & Dev. 13: 3191-3197.
- 37. Elbashir, Lendeckel and Tuschl (2001). Genes & Dev. 15: 188-200.
- 38. Kim, D H, J. J. Rossi et al. Synthetic dsRNA Dicer substrates enhance RNAi potency and efficacy, Nat Biotechnol. 2005 February; 23(2):222-6.
- 39. Reynolds A, et al. Induction of the interferon response by siRNA is cell type- and duplex length-dependent. RNA. 2006, 12(6):988-93.
- 40. Fedorov Y, et al. Off-target effects by siRNA can induce toxic phenotype. RNA. 2006, 12(7):1188-96.
- 41. Lu, P. Y. and M. Woodle (2005) Delivering siRNA in vivo For functional genomics can novel therapeutics. In RNA Interference Technology. Cambridge University Press. P 303-317.
- 42. Lu, P. Y. et al. (2005) Modulation of angiogenesis with siRNA inhibitors for novel therapeutics. TRENDS in Molecular Medicine. 11(3), 104-13.
- 43. Lu P Y, Xie F, Woodle M C. (2005) In vivo application of RNA interference: from functional genomics to therapeutics. Adv Genet. 54:117-42.
- 44. Leng, Q. J. and Mixson A. J. Small interfering RNA targeting Raf-1 inhibits tumor growth in vitro and in vivo. Cancer Gene Therapy. (2005), 1-9. See also [http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=29747; Nucleic Acids Res. 2001 Mar. 15; 29(6): 1334-1340. Copyright© 2001 Oxford University Press Branched co-polymers of histidine and lysine are efficient carriers of plasmids, Qing-Rong Chen, Lei Zhang, Sanford A. Stass, and A. James Mixson]
- 45. Sutton D. et al. Efficient suppression of secretory clusterin levels by polymer-siRNA nanocomplexes enhances ionizing radiation lethality in human MCF-7 breast cancer cells in vitro. International Journal of Nanomedicine 2006:1(2) 155-162
- 46. Braun C., et al. Structure/Function Relationships of Polyamidoamine/DNA Dendrimers as Gene Delivery Vehicles, J. of Pharm. Sci., 94(2) (2005).
- 47. Woodle, M C and P Y Lu, Nanoparticles for RNAi Therapy. Nanotoday, August 2005, 34-41.
- 48. Xie, Y. F., M. Woodle and P Y Lu. Harnessing in vivo siRNA delivery for functional genomics and novel therapeutics. Drug Discovery Today, 2006 January; 11(1-2):67-73.
- 49. Li B. J. et al, Using siRNA in prophylactic and therapeutic regimens against SARS coronavirus in Rhesus macaque. 2005, Nature Medicine, 11, 944-951.
All publications, including issued patents and published applications, and database entries identified by accession numbers are incorporated herein by reference in their entirety.
Claims
1. A composition comprising at least three siRNA molecules and a pharmaceutically acceptable carrier, wherein each siRNA molecule binds an mRNA molecule that is encoded by a gene selected from the group consisting of TGF-β1, Cox-2, and Hoxb13, wherein said molecules inhibit expression of said genes in both human and mouse cells, wherein said composition comprises a nanoparticle, and wherein said siRNA molecules comprise the following oligonucleotides: (1) hmTF-2: sense, 5′-CCCAAGGGCUACCAUGCCAACUUCU-3′ (SEQ ID NO: 11) antisense, 5′AGAAGUUGGCAUGGUAGCCCUUGGG-3′; (SEQ ID NO: 12) (2) hmCX-1: sense, 5′-GGUCUGGUGCCUGGUCUGAUGAUGU-3′, (SEQ ID NO: 9) antisense, 5′-ACAUCAUCAGACCAGGCACCAGACC-3′; (SEQ ID NO: 10) and (3) hmHX-1: sense, 5′-GGUGGCUGGAACAGCCAGAUGUGUU-3′ (SEQ ID NO: 7 antisense, 5′-AACACAUCUGGCUGUUCCAGCCACC-3′ (SEQ ID NO: 8).
2. The composition of claim 1, wherein said pharmaceutically acceptable carrier comprises a branched histidine polypeptide or a branched lysine polypeptide.
3. A method for treating a dermal or epidermal wound in a subject, wherein said wound is characterized at least in part by inflammation and neovascularization, said method comprising administering to said subject a pharmaceutically effective amount of the composition of claim 1.
4. The method of claim 3 wherein said subject is a mammal.
5. The method of claim 3 wherein said subject is a human.
6. A composition comprising at least three siRNA molecules, wherein each siRNA molecule binds an mRNA molecule that is encoded by a gene selected from the group consisting of TGF-β1, Cox-2, and Hoxb13, and a pharmaceutically acceptable carrier, wherein said siRNA molecules comprise the following oligonucleotides: (1) hmTF-2: sense, 5′-CCCAAGGGCUACCAUGCCAACUUCU-3′ (SEQ ID NO: 11) antisense, 5′AGAAGUUGGCAUGGUAGCCCUUGGG-3′; (SEQ ID NO: 12) (2) hmCX-1: sense, 5′-GGUCUGGUGCCUGGUCUGAUGAUGU-3′, (SEQ ID NO: 9) antisense, 5′-ACAUCAUCAGACCAGGCACCAGACC-3′; (SEQ ID NO: 10) and (3) hmHX-1: sense, 5′-GGUGGCUGGAACAGCCAGAUGUGUU-3′ (SEQ ID NO: 7) antisense, 5′-AACACAUCUGGCUGUUCCAGCCACC-3′ (SEQ ID NO: 8).
7. The composition of claim 1, wherein said pharmaceutically acceptable carrier comprises a branched histidine-lysine peptide.
8. The composition of claim 6, wherein said pharmaceutically acceptable carrier comprises a branched histidine polypeptide or a branched lysine polypeptide.
9. The composition of claim 6, wherein said pharmaceutically acceptable carrier comprises a branched histidine-lysine peptide.
10. The composition of claim 6, wherein said composition comprises a nanoparticle.
11. The composition of claim 8, wherein said composition comprises a nanoparticle.
12. The composition of claim 9, wherein said composition comprises a nanoparticle.
13. A composition comprising at least two siRNA molecules and a pharmaceutically acceptable carrier, wherein said siRNA molecules comprise the following oligonucleotides: (1) hmTF-2: sense, 5′-CCCAAGGGCUACCAUGCCAACUUCU-3′ (SEQ ID NO: 11) antisense, 5′AGAAGUUGGCAUGGUAGCCCU UGGG-3′ (SEQ ID NO: 12), and (2) hmCX-1: sense, 5′-GGUCUGGUGCCUGGUCUGAUGAUGU-3′ (SEQ ID NO: 9) antisense, 5′-ACAUCAUCAGACCAGGCACC AGACC-3′ (SEQ ID NO: 10).
14. The composition of claim 13, wherein said pharmaceutically acceptable carrier comprises a branched histidine polypeptide or a branched lysine polypeptide.
15. The composition of claim 13, wherein said pharmaceutically acceptable carrier comprises a branched histidine-lysine polymer.
16. The composition of claim 13, wherein said composition comprises a nanoparticle.
17. The composition of claim 14, wherein said composition comprises a nanoparticle.
18. The composition of claim 15, wherein said composition comprises a nanoparticle.
19. A method for treating a dermal or epidermal wound in a mammal, wherein said wound is characterized at least in part by inflammation and neovascularization, said method comprising administering to said mammal a pharmaceutically effective amount of the composition of claim 13.
20. The method of claim 19 wherein said mammal is a human.
21. A method for treating a dermal or epidermal wound in a human, wherein said wound is characterized at least in part by inflammation and neovascularization, said method comprising administering to said human a pharmaceutically effective amount of the composition of claim 18.
| 7070807 | July 4, 2006 | Mixson |
| 7163695 | January 16, 2007 | Mixson |
| 7465708 | December 16, 2008 | Mixson |
| 7772201 | August 10, 2010 | Mixson |
| 8541568 | September 24, 2013 | Yan et al. |
| 9012622 | April 21, 2015 | Lu et al. |
| 9642873 | May 9, 2017 | Lu et al. |
| 20050176024 | August 11, 2005 | McSwiggen et al. |
| 20060121514 | June 8, 2006 | Young et al. |
| 20060134787 | June 22, 2006 | Zamore et al. |
| 20060265765 | November 23, 2006 | Agatsuma et al. |
| 20070003519 | January 4, 2007 | Lu et al. |
| 20080015161 | January 17, 2008 | Vornlocker et al. |
| 20080241198 | October 2, 2008 | Liu et al. |
| 20080279920 | November 13, 2008 | Tang et al. |
| 20100319074 | December 16, 2010 | Lu et al. |
| 20110165227 | July 7, 2011 | Yan et al. |
| 20120071540 | March 22, 2012 | Lu et al. |
| 20130225655 | August 29, 2013 | Lu et al. |
| WO 0147496 | July 2001 | WO |
| WO 03040399 | May 2003 | WO |
| WO 03070918 | August 2003 | WO |
| WO 03090719 | November 2003 | WO |
| WO 2005076999 | August 2005 | WO |
| WO 2006/060182 | June 2006 | WO |
| WO 2007079224 | July 2007 | WO |
| WO 2008/154482 | December 2008 | WO |
| WO 2009061417 | May 2009 | WO |
- International Search Report and Written Opinion of the International Searching Authority on International App. No. PCT/US2008/12498 (WO 2009/061417) of Sirnaomics, Inc., dated Feb. 23, 2009.
- European Patent Office Search Report and Opinion for App. No. 08846548.9-2107 of Sirnaomics, Inc., dated Sep. 26, 2011.
- Choi, Byung-Min, et al., “Control of Scarring in Adult Wounds Using Antisense Transforming Growth Factor-Beta1 Oligodeoxynucleotides”, Immunology and Cell Biology, vol. 74, 1996, pp. 144-150.
- Whitmore, Mark, et al., “Synergistic Activation of Innate Immunity by Double-Stranded RNA and CpG DNA Promotes Enhanced Antitumor Activity,” Cancer Research 64, 5850-5860, Aug. 15, 2004.
- Kim, et al., “The Anti-Fibrotic Effect of TGF-Beta1 SiRNA's in Murine Model of Liver Cirrhosis,” Biochemical and Biophysical Research Communications 343 (2008) 1072-1078.
- Kim et al. (Biochemical and Biophysical Research Communications 343 (2006) 1072-1078).
- Barik, Sailen, “Control of nonsegmented negative-strand RNA virus replication by siRNA,” Virus Research, vol. 102, 2004, pp. 27-35.
- Bitko, Vira, et al., “Phenotypic silencing of cytoplasmic genes using sequence-specific double-stranded short interfering RNA and its application in the reverse genetics of wild type negative-strand RNA viruses,” BMC Microbiology, vol. 1, No. 34, Dec. 20, 2001, pp. 1-11.
- Cheema, Sangeeta, et al., “Regulation and Guidance of Cell Behavior for Tissue Regeneration Via the Sirna Mechanism”, Wound Repair and Regeneration, vol. 15, No. 3, 2007, pp. 286-295.
- De Wolf, Holger, et al., “Effect of Cationic Carriers on the Pharmacokinetics and Tumor Localization of Nucleic Acids after Intravenous Administration,” International Journal of Pharmaceutics, 331, 2007, pp. 167-175.
- Leng, Qixin, et al., “Highly Branched HK Peptides Are Effective Carriers of siRNA,” The Journal of Gene Medicine, 2005, 7, pp. 977-986.
- Mack, Judith, et al., “Hoxb13 Knockout Adult Skin Exhibits High Levels of Hyaluronan and Enhanced Wound Healing”, FASEB Journal, vol. 17, Jul. 2003, pp. 1352-1354.
- Michels, Stephan, et al., “Promising New Treatments for Neovascular Age-Related Macular Degeneration,” Expert Opin. Investig. Drugs, 2006, 15(7), pp. 779-793.
- Pickering, Lulu, “Progress in RNA-based therapeutics,” Spectrum Drug Discovery and Design, Decision Resources, Inc., Waltham, Massachusetts, Aug. 4, 2005, pp. 6-1 to 6-20.
- Stelnicki, Eric, et al., “Modulation of the Human Homeobox Genes PRX-2 and HOXB13 in Scarless Fetal Wounds”, Journal of Investigative Dermatology, vol. 111, 1998, pp. 57-63.
- Wilgus, Traci, et al, “Reduction of Scar Formation in Full-Thickness Wounds With Topical Celecoxib Treatment”, Wound Repair and Regeneration, Mosby-Year Book, St. Louis, Mo, US, vol. 11, 2003, pp. 25-34.
Type: Grant
Filed: May 26, 2016
Date of Patent: May 29, 2018
Assignee: Sirnaomics, Inc. (Gaithersburg, MD)
Inventors: Patrick Y. Lu (Gaithersburg, MD), Ling Li (Port St. Lucie, FL), Vera Simonenko (Gaithersburg, MD)
Primary Examiner: Shri Ponnaluri
Application Number: 15/166,223
International Classification: C07H 21/04 (20060101); A61K 48/00 (20060101); A61K 31/7105 (20060101); C12N 15/113 (20100101);