Abstract: Methods of treating amyotrophic lateral sclerosis (ALS) or preventing the progression of ALS. Compounds useful in these therapeutic methods include anti-retroviral compounds and RNA interference (RNAi) constructs.

Abstract: The present invention relates to the treatment and/or prevention of a retinal disease by using a polynucleotide promoter wherein the polynucleotide or a variant thereof consists of the sequence (hRHOs-wt;?SEQ?ID?NO.?1) TCCTCCTAGTGTCACCTTGGCCCCTCTTAGAAGCCAATTAGGCCCTCAG TTTCTGCAGCGGGGATTAATATGATTATGAACACCCCCAATCTCCCAGA TGCTGATTCAGCCAGGAGCTTAGGAGGGGGAGGTCACTTTATAAGGGTC TGGGGGGGTCAGAACCCAGAGTCATCCAGCTGGAGCCCTGAGTGGCTGA GCTCAGGCCTTCGCAGCATTCTTGGGTGGGAGCAGCCACGGGTCAGCCA CAAGGGCCACAGCC wherein the fragment TGAACACCCCCAATCTCCCAGATGCT which is the sequence from nucleotide 77 to nucleotide 102 of SEQ ID NO. 1, is substituted. The invention is also directed to the use of relative vector, vector systems, host cells and pharmaceutical compositions.

Abstract: There is provided a pharmaceutical composition comprising cellulose obtained from algae, or a derivative of said cellulose, and an active pharmaceutical ingredient (e.g. from Type 2 and 4 BCS class), wherein the active pharmaceutical ingredient is in a predominantly amorphous form. Compositions of the invention find particularly utility as formulations comprising BCS Type 2 and 4 drugs, including NSAIDs or other drugs, that may be employed in the treatment of migraine or dysmenorrhea, as well as formulations comprising other poorly soluble active ingredients where rapid release in vivo is advantageous.

Abstract: This disclosure provides mixtures of beta-cyclodextrin molecules substituted at one or more hydroxyl positions by hydroxypropyl groups, the mixture optionally including unsubstituted beta-cyclodextrin molecules, for use as a pharmaceutically active ingredient; methods of making such mixtures; methods of qualifying such mixtures for use in a pharmaceutical composition suitable for intrathecal or intracerebroventricular administration; pharmaceutical compositions suitable for intrathecal or intracerebroventricular administration comprising such mixtures; and methods of using the pharmaceutical compositions for treatment of Niemann-Pick disease Type C.

Abstract: The disclosure relates to decarboxylated cannabis resins and methods of making the decarboxylated cannabis resins by extraction and decarboxylation of cannabinoids from Cannabis species using microwaves and solvents. The disclosure also relates to use of the decarboxylated cannabis resins for making pharmaceutical products comprising same.

Abstract: One solid preparation of the present invention mainly includes silicon fine particles, and has a capability of generating hydrogen. In addition, one specific example of the solid preparation mainly includes silicon fine particles having a crystallite diameter principally of 1 nm or more and 100 nm or less, and exhibits a capability of generating hydrogen in an amount of 3 ml/g or more when brought into contact with a water-containing liquid having a pH value of 7 or more. In this solid preparation, hydrogen is generated when the silicon fine particles are brought into contact with a water-containing liquid having a pH value of 7 or more. Therefore, taking advantage of the characteristics of the solid preparation, generation of hydrogen is promoted in, for example, a gastrointestinal tract where the pH value is 7 or more due to secretion of pancreatic fluid after passage through the stomach after oral ingestion.

Abstract: A composition including a plant medium and a poly-oxygenated metal hydroxide that comprises a clathrate containing oxygen gas molecules. The poly-oxygenated metal hydroxide may comprise of a poly-oxygenated aluminum hydroxide. The composition may include one or more nutrients. The composition may be in a solid form, a fluid form, or a combination thereof. The poly-oxygenated aluminum hydroxide is soluble in a fluid. In one embodiment, the poly-oxygenated metal hydroxide composition may have particles having a diameter of 212 ?m or less, and which may be homogeneous.

Abstract: The present invention provides compositions of therapeutic agents and methods of use for reducing and/or treating gastrointestinal inflammation. In particular aspects, the tungstate salts described herein and pharmaceutical compositions thereof inhibit the activity of one or a plurality of anaerobic respiratory enzymes in facultative anaerobic bacteria such as, for example, Enterobacteriaceae, that can exacerbate inflammation. In particular embodiments, the present invention provides compositions of therapeutic agents for treating gastrointestinal inflammation, as well as methods for treating or preventing gut microbial imbalance due to an increase in the abundance of intestinal Enterobacteriaceae.

Abstract: Provided is an application of a fullerene/metal-fullerene micro/nanomaterial for preparing a pharmaceutical product. The pharmaceutical product has at least one of the following properties: 1) treats a bone marrow suppression; 2) treats at least one of the following conditions caused by the bone marrow suppression: white blood cell count reduction, platelet count reduction, hemo-globin count reduction, and monocyte count reduction; 3) protects a bone marrow cell and/or a hematopoietic cell; 4) able to build up in a bone marrow; 5)protects the liver, spleen, and kidneys; 6) removes a free radical; and 7) improves the performance of an antioxidant system in an organism.

Abstract: An application of a fullerene structure in the preparation of medications for treating Parkinson's disease. The fullerene structure comprises at least one of the following active ingredient groups: a fullerene, a metallofullerene, and a composition of the fullerene and the metallofullerene; an oil-soluble fullerene, an oil-soluble metallofullerene, and a composition of the oil-soluble fullerene and the oil-soluble metallofullerene; a water-soluble fullerene, a water-soluble metallofullerene, and a composition of the water-soluble fullerene and the water-soluble metal-lofullerene; the medicinal esters of the nine elements, or the medicinal salts of the nine elements.

Abstract: It provides antibodies and chimeric antigen receptors (CARs) that specifically bind to an epitope containing N-acetyl-glucosamine and/or N-acetyl-galactosamine, e.g., expressed by a cancer cell or an inflammatory cell. Also provided are compositions including these antibodies and/or CARs, as well as polynucleotides, vectors, host cells, methods, and kits related thereto. Further provided are methods and kits for treating or preventing cancer in an individual by administering to the individual an antibody that specifically binds to an epitope containing N-acetylglucosamine or N-acetyl-galactosamine, or a T cell comprising a CAR that specifically binds to an epitope containing N-acetylglucosamine or N-acetyl-galactosamine, optionally in combination with another anti-cancer agent.

Abstract: The present invention provides a method of generating a population of tumour-infiltrating T cells, said method comprising administering to a subject a positively charged amphipathic amino acid derivative, peptide or peptidomimetic which is able to lyse tumour cell membranes and then collecting a cellular sample from a tumour within said subject and separating T cells therefrom. The present invention further provides a method of generating a population of tumour-infiltrating T cells, said method comprising separating T cells from a cellular tumour sample taken from a subject treated with a positively charged amphipathic amino acid derivative, peptide or peptidomimetic which is able to lyse tumour cell membranes and optionally culturing said T cells. The present invention also provides the tumour-infiltrating T cells described above for use in treating tumour cells or preventing or reducing the growth, establishment, spread, or metastasis of a tumour.

Abstract: The present invention provides a cell-based platform for controllable, regionalized, and cost-effective delivery of immunomodulator and other therapeutic proteins, which is widely applicable in cancer immunotherapy.

Abstract: The present invention provides a cell which co-expresses a first chimeric antigen receptor (CAR) and second CAR at the cell surface, each CAR comprising: (i) an antigen-binding domain; (ii) a spacer (iii) a trans-membrane domain; and (iv) an endodomain wherein the antigen binding domains of the first and second CARs bind to different antigens, and wherein each of the first and second CARs is an activating CAR comprising an activating endodomain.

Abstract: An in vitro assay is provided for determining the effect of an immune cell on a cell from an infectious or neoplastic disease. Also provided is an in vitro assay for determining the effect of an activated CD8+ T-cell on a sensitized melanoma cell. A method for improving the specific cytolytic activity (SCA) of an immune cell comprising contacting an immune cell with an antigen and an antigen-independent pro-inflammatory agent is provided. A method for ex vivo expansion of antigen-specific CD8+ T-cells with enhanced specific cytolytic activity (SCA) comprising culturing the antigen-specific CD8+ T-cells in a suitable culture media comprising an amino acid. An in vitro assay is provided for determining the effect of an immune cell on a cell from an infectious or neoplastic disease. A method of treating a subject suffering from an infectious or neoplastic disease with immuno therapy is described.

Abstract: This invention relates to a formulation for the treatment of diabetes including 56 mg to 224 mg cow urine powder and 44 mg to 176 mg skim milk powder per kg body weight of the patient.

Abstract: The present invention offers a solution to the lack of an effective alternative method to those already known to treat angiogenesis. In particular, the present invention is the first to show that a substantially pure population of exosomes derived from MenSCs have capacity to reduce tumor angiogenesis in diseases such as prostate cancer, breast cancer and pancreatic cancer. In this sense, the present invention shows that a substantially pure population of MenSCs-derived exosomes reduce the endogenous levels of reactive oxygen species (ROS) in cancer cells and the expression of pro-angiogenic factors such as VEGF, NF-KB, FGF and HIF? in the treated tumors. Overall, the invention offers a promising alternative method to treat angiogenesis. Since it is principally composed of exosomes produced by the Stem cells present in menstrual fluid, the invention provides an ease access and repeated sampling in a non-invasive manner. Such attributes allow the rapid production of the treatment.

Abstract: The present invention relates to: a recombinant lentiviral vector comprising a gene encoding a TRAIL protein and a CD protein; and a cell that is transfected with the lentivirus produced by using the vector. A host cell transfected with the recombinant lentivirus of the present invention maintains a high cell proliferation rate and overexpresses a TRAIL protein and a CD protein. Thus, a mesenchymal stem cell transfected with the lentivirus may be usefully employed as a cell therapeutic agent.

Abstract: A medicament is useful for prevention or treatment of muscle injury. A novel medical use of an extract from inflamed tissues inoculated with vaccinia virus, and more particularly, a preventing or therapeutic agent for muscle injury containing the extract as an active ingredient. The preventing or therapeutic agent for muscle injury contains the extract as an active ingredient is extremely useful as a highly effective and highly safe medicament.

Abstract: A method for preventing and/or treating vitamin B12 deficiency is taught. The method comprises administering a composition comprising pseudovitamin B12-producing bacteria, optionally in conjunction with mucin-degrading and/or propionate-producing bacteria, to a subject in need thereof. The method is particularly suitable for administration to subjects suffering from vitamin B12 deficiency due to metformin treatment for type-2 diabetes, and to subjects having undergone bariatric surgery.

Abstract: Described herein are compositions and methods relating to engineered bacteria which have a modified Type 3 Secretion System (T3SS) which permits them to deliver proteins to the extracellular space (e.g., as opposed to the intracellular space of a target cell as done with a wild-type T3SS). In some embodiments, the engineered bacteria comprise a transgenic T3SS. In some embodiments, the delivered protein is non-native or transgenic with respect to the engineered bacteria.

Abstract: Compositions, systems and methods of improving the health of the microbiome of an individual's skin relate to the provision of skin contacting formulations containing beneficial bacteria and other microbe components to foster the growth and maintenance of a healthy skin microbiome.

Abstract: The present invention relates to a method of selecting or identifying probiotic strains capable of acting on the absorption of water in the colon, and use thereof as medicinal products in the treatment and/or prevention of diarrhea. The invention relates in particular to the strain of Bacillus subtilis CU1 for use in the treatment and/or prevention of diarrhea.

Abstract: The present invention relates to the use of bacterial strains belonging to the species Lactobacillus kefiri in paediatrics to generate and/or maintain the state of homeostasis. The present invention further relates to bacterial strains belonging to the species Lactobacillus kefiri having a high capacity to adhere to the intestinal epithelium; in particular, the present invention relates to the bacterial strains Lactobacillus kefiri LKF01 DSM 32079 LKEF and Lactobacillus kefiri LKF02 DSM 32080 for use in paediatrics.

Abstract: The present invention concerns a lactic composition useful for the prevention or treatment of diarrhea such as antibiotic associated diarrhea or “tourists.” The composition according to the invention contains at least a bacterial strain selected from the group consisting of Lactobacillus acidophilus, Lactobacillus acidophilus I-1492, Lactobacillus casei and a mixture of thereof.

Abstract: An equol-producing lactic acid bacteria-containing composition comprises, as an essential component thereof, a lactic acid bacterial strain belonging to the genus Lactococcus having an ability to utilize at least one daidzein compound selected from the group consisting of daidzein glycosides, daidzein, and dihydrodaidzein to produce equol. Such a composition is effective for the prevention and alleviation of malaise inclusive of climacteric disturbance in middle-aged and elderly women for which no effective prophylactic method or alleviating means has heretofore been available.

Abstract: CD24-positive malignant and benign tumors are treated by administration of a naturally occurring or modified oncolytic Zika virus. Diseases associated with abnormal T cell activation or T cell-mediated autoimmunity, wherein CD24 expression is increased, are also expected to be treated by administration of a naturally occurring or modified oncolytic Zika virus. Also contemplated are compounds and methods for treating and/or preventing Zika virus infection in a subject.

Abstract: A medicament for use in treating uremia and proteinuria, the medicament being a glycoprotein, a mixture of polysaccharide and protein,a polypeptide or a protein.

Abstract: The present invention provides nutritional compositions that are employed as oral supplementation to the human diet. The compositions of the present invention provide for supplementation to the diet of the cancer patient, as well as preventative dietary supplementation aimed at supporting the human immune system for those not currently suffering from cancer. The present invention is comprised of specific combinations of selected forms of unique sets of certain vitamins, minerals, protein, carbohydrates and phytochemicals.

Abstract: The present disclosure provides compositions which contain 5-hydroxytryptophan (5-HTP), omega-3 fatty acids, St. John's Wort (hypericum perforatum, 3% hyperacin), Inositol Hexaphospate, Inositol Bitartrate, and Ginkgo biloba in combination with magnesium citrate, 5-Methylfolate, L-Theanine, and zinc picolinate in therapeutically effective amounts for providing mood stabilization or a decrease in depression in patients, as well as methods of using and manufacturing such compositions.

Abstract: The present invention relates generally to methods of use and compositions useful for treating skin. The composition includes a combination of saccharide isomerate extract, Myrothamnus flabellifolia extract, algae extract, mugwort (Artemisia vulgaris) extract, and [6]-paradol. This combination can be used to create topical skin compositions that reduces erythema, cools the skin, inhibits nitric oxide synthase, decreases TNF-? production, and increases the production of occludin-1.

Abstract: The present invention relates to a method for preparing an herbal composition with increased fat-soluble polyphenols, an herbal composition prepared by the method, and a use of the composition. The herbal composition with increased fat-soluble polyphenols of the present invention is characterized by the significantly increased content of fat-soluble polyphenols including decursin, compared with the herbal composition of comparative example, and also demonstrates a significant anti-oxidative activity, immune cell activating effect, and cancer cell growth inhibitory effect, significantly reduces renal toxicity and liver toxicity induced by the anticancer agent cisplatin back so as to be almost normal condition, and significantly inhibits the intestinal crypt loss caused by irradiation, compared with the herbal composition of comparative example.

Abstract: Provided is a method for conversion and extraction of beneficial components, the method including: a vacuum step for feeding ginseng into a vacuum chamber and applying a vacuum pressure thereinto; and a treatment step for heating and drying the ginseng under the vacuum pressure, so that the loss of beneficial components can be minimized and the treatment cost can be lowered by simplifying the treatment procedure and shortening the treatment time, and the saponin conversion and extraction efficiencies can be effectively increased through a simple treatment procedure.

Abstract: Disclosed is a method for treating dry or erythemic skin in a subject in need thereof, the method comprising topically applying to the skin a composition that includes effective amounts of an extract from Echinacea purpurea and an extract from Silybum marianum, wherein topical application of the composition activates human cannabinoid receptor type 2 and inhibits fatty acid amide hydrolase activity in the skin and treats the skin.

Abstract: A method and formulation for delivering a PDE-5 inhibitor in a vaporized state using low temperatures to vaporize the formulation. The formulation contains an inert non-reactive compound that lowers the heat of vaporization of the formulation, and the PDE-5 inhibitor. The formulation may optionally contain glycerin, alcohol, and/or water. Examples of inert non-reactive compounds that can sufficiently lower the heat of vaporization of the formulation include propylene glycol, vegetable glycerin and polysorbate. The formulation can be vaporized using a hand-held low temperature vaporizer or atomizer.

Abstract: Provided is a method for preparing a broccoli protein peptide. The method uses a broccoli protein as the raw material, and obtains a broccoli protein peptide powder through the steps of preprocessing, enzymatic hydrolysis, terminating enzymatic hydrolysis, separation, and drying and the like. Also provided is the use of the prepared broccoli protein peptide in resisting oxidation, reducing cholesterol and lowering blood lipids.

Abstract: The present invention provides a traditional Chinese medicine (TCM) composition for the treatment of diabetic retinopathy, wherein the active pharmaceutical ingredients (APIs) of the said TCM composition are: Astragali Radix 10-80 parts by weight, Pseudostellariae Radix 5-30 parts by weight, Cinnamomi Ramulus 3-25 parts by weight, Angelicae Sinensis Radix 8-60 parts by weight, Notoginseng Radix ET Rhizoma 2-15 parts by weight, Dioscoreae Rhizoma 10-80 parts by weight, Salviae Miltiorrhizae Radix ET Rhizoma 10-80 parts by weight, Pheretima 2-15 parts by weight, Rehmanniae Radix 8-60 parts by weight, and Atractylodis Macrocephalae Rhizoma 8-60 parts by weight. It has been shown by clinical experiments that, the invented TCM composition has an exact efficacy in patients with macular edema and can effectively improve the patients' visual acuity and visual field and relieve ocular fundus diseases, playing an active role in alleviating macular edema.

Abstract: It is disclosed a pharmaceutical and/or phytosanitary composition comprising an aqueous extract of Chelidonium majus root and an acceptable pharmaceutical or phytosanitary excipient, for the prevention or treatment of plant infections and/or for the prevention or treatment of nail 5 infections. The composition may further comprise an aqueous extract of Thuja occidentalis leaf; and from about 1 to 5% of at least one natural phenolic compound. The composition is efficient in the treatment of plant infection (mildew fungus, blight fungus, etc); the treatment of intumescence of a plant; the treatment of potatoes (powdery or common scab, Rhizoctonia etc), and also allows a higher crop yield: without the use of a chemical fungicide. The composition also allows rapid treatment of fungus infection of nails.

Abstract: A method of reducing inflammation in skin is disclosed. The method can include topically applying to skin in need thereof a composition comprising 0.001 wt. % to 5 wt. % of a kakadu plum fruit extract to reduce TNF-? production in human epidermal keratinocytes of the skin, and 0.001 wt. % to 5 wt. % of an acai berry fruit extract to reduce TNF-? production in human epidermal keratinocytes of the skin, wherein topical application of the composition reduces inflammation in the skin.

Abstract: The present invention is directed to a method for treating malignant pleural effusion comprising administering a first herbal medicine composition to a subject in need; wherein the first chinese herbal medicine is an extract of a first mixture comprising Poria, Grifola, Rhizoma Atractylodis, Rhizoma Alismatis, Semen Lepidii, Rhizoma Atractylodis Macrocephalae, Herba Ephedrae, Fructus Jujubae, Fructus Crataegi, dried Langan, Radix Stephaniae Tetrandrae, and Rhizoma Gastrodiae; Ginseng powder; and a second mixture comprising Radix Kansui, Euphorbia pekinensis, Flos Genkwa.

Abstract: The present invention relates to a seven-star tea without excipient. The seven-star tea comprises the following: Coicis Semen, Oryzae Fructus Germinatus, Triticum Aestivum, Herba Lophatheri, Fructus Crataegi, Ramulus Uncariae Cum Uncis, Periostracum Cicadae and Radix Et Rhizoma Glycyrrhizae, wherein the Triticum Aestivum is used as a forming agent in the seven-star tea. The method of preparing the seven-star tea comprises the following: weighing the medicinal materials according to the formula of seven-star tea; mixing the medicinal materials except for Triticum Aestivum together, decocting the resulting mixture with water 1-3 time(s), each time lasting for 0.5-2 hours, then combining the decoctions obtained from each time, filtering, and concentrating the resulting filtrate into a concentrated solution with relative density of 1.0-1.

Abstract: The present disclosure provides nicotine free anti-smoking compositions comprising synergistic combination of herbal ingredients. In a preferred embodiment of the present disclosure, the anti-smoking composition can include combination of at least two herbs selected from the group consisting of Kapikachu, Ashwagandha, Tulsi, Haridra, Amla, Gokshura, Brahmi, Yashtimadhu, Sunthi, Lavang, Bala, Vidarikand, Jatanamsi, Shatavari, and Musli. In another preferred embodiment of the disclosure, the anti-smoking composition can further include one or more additional herbs selected from the group consisting of Guduchi, Draksha, Sirish, Arjuna, Mandukparni, Vasa, Karpoor, Kankol, Kantakari and Shigru. The formulation(s) in accordance with embodiments of the present disclosure not only provides anti-smoking effect but also treat side-effects and/or ailments arising from smoking.

Abstract: Provided are methods for disrupting biofilms and/or preventing the formation of biofilms. Further provided are random-sequence peptide mixtures for use in disrupting bacterial biofilms. The random-sequence peptides include hydrophobic and/or cationic amino acids, and the ratio of the total hydrophobic and cationic amino acids in the mixture is predefined.

Abstract: Two peptides that can selectively bind to SEVI and block the enhanced infectivity that results from the interaction of SEVI with HIV. The two peptides comprise the amino acid sequences FEEIVQEIEDFLENLV (SEQ. ID NO: 1) and GIGAVLEVLTTGLPALISWIEEEEQQ (SEQ. ID. NO: 2). The peptides may be administered topically, either alone or in combination with other prophylactics, agents, etc.

Abstract: There is provided a method of treating acute myeloid leukemia (AML). The method includes the step of administering to a patient having AML with a FMS-like tyrosine kinase 3 (FLT3)-mutation a therapeutically effective amount of a CXCR4-antagonistic peptide.

Abstract: The present specification discloses APY cyclic peptides having EphA4 antagonistic activity, pharmaceutical compositions containing such EphA4 antagonists, and methods and uses of treating an EphA4-based disease, disorder or pathology in an individual using such APY cyclic peptides or pharmaceutical compositions.

Abstract: Stimulation of target cells using light, e.g., in vivo or in vitro, is implemented using a variety of methods and devices. One example involves a vector for delivering a light-activated molecule comprising a nucleic acid sequence that codes for light-activated molecule. The light-activated molecule includes a modification to a location near the all- trans retinal Schiff base, e.g., to extends the duration time of the open state. Other aspects and embodiments are directed to systems, methods, kits, compositions of matter and molecules for ion channels or pumps or for controlling currents in a cell (e.g., in in vivo and in vitro environments).

Abstract: A medicament for use in treating gout, the medicament being a glycoprotein, a mixture of polysaccharide and protein, a polypeptide or a protein.

Abstract: Disclosed are methods and compositions for treating a subject having a neurological disorder such as major depressive disorder (MDD). The methods and compositions may be utilized in order to inhibit trafficking of hyperpolarization-activated cyclic nucleotide gated (HCN) channels or subunits thereof, in some embodiments, by inhibiting an interaction between the HCN channels or the subunits thereof and an auxiliary protein or a chaperone protein for the HCN channels or the subunits thereof such as tetratricopeptide repeat (TPR)-containing Rab8b interacting (TRIP8b) protein or a variant thereof. The HCN channels of the disclosed methods may comprise, for example, HCN1 subunits, HCN2 subunits, or a combination thereof. In the disclosed methods, trafficking of the HCN channels or subunits preferably results in inhibiting distal dendritic enrichment of HCN1 and HCN2 in pyramidal neurons of hippocampal area CA1.

Abstract: A medicament for use in treating fatty liver, hepatitis and cirrhosis, the medicament includes a marine algal glycoprotein.