Abstract: A blind assembly and setup configurations for the blind assembly are disclosed. The blind assembly contains two sheets wound together into a roll that are configured for separate outstretching at an angle relative to each other, for being maintained under tension in an outstretched form, and for retraction back into the roll. The end of each sheet contains a handle rod used for handling the sheets and for anchoring to the ground by means of attaching to stakes inserted into the ground using ropes. The roll end of the assembly structure is likewise attached to a stake in the course of setting up the blind assembly. A tie rod provides added support for the structure and is set up at a distance from the sheet rolls to prevent uncontrolled wraparounds of the sheets when the sheets are retracted.

Abstract: Presented herein are ready to administer (RTA) retinal pigment epithelium (RPE) cell therapy compositions for the treatment of retinal degenerative diseases and injuries. A method of formulating human RPE cells for administration to a subject directly after thawing and of formulating RPE cell therapy compositions for cryopreservation and administration of the cryopreserved composition to a subject subsequent to thawing are also presented. In another aspect, the RTA composition may be formulated as a thaw and inject (TAI) composition, whereby the composition is administered by injection subsequent to thawing.

Abstract: The present invention relates to the stabilization of one or more metabolically-active cell in a blood sample at ambient temperatures. In particular, formulations, compositions, articles of manufacture, kits and methods for substantially stable storage of one or more metabolically-active cell in a blood sample at ambient temperatures are provided.

Abstract: This invention uses low temperature and elevated pressure to induce suspended animation by depressing the freezing and melting temperature of water and aqueous solutions, including but not limited to biological materials, soluble molecules, organic and inorganic compounds. Increasing the pressure to ˜210 MPa in a container depresses the freezing and melting temperature of water, biological matter, and materials in aqueous solution, to ˜?22° C. Storage at low temperature under high pressure suspends metabolic activity and induces cryostasis. This invention can be used for cryo-banking biological materials that cannot be frozen or vitrified, or otherwise preserved, including, but not limited to, cells, tissues, human organs for transplantation or entire organisms.

Abstract: Nanosilver particles, a porous material composite containing same, and a method of producing same are introduced. The method includes the steps of (a) mixing silver salts-containing precursor and protecting agent to form a first liquid mixture; (b) introducing organic reductant into a first reactant to form a second reactant, wherein the silver salts-containing precursor is reduced by the organic reductant to form nanosilver particles; introducing organic reductant into the first liquid mixture to form a second liquid mixture, wherein the silver salts-containing precursor is reduced by the organic reductant to form nanosilver particles; and (c) introducing alkalinizing agent into the nanosilver particles-containing second liquid mixture. The porous material composite includes a porous material and nanosilver particles attached to outer and inner surfaces of the porous material.

Abstract: The strip containing acaricide, is formed by a variety of compartments, placed in parallel and joined to each other, that serve to house an acaricide substance in semi-solid state, characterized in that the tube-shaped compartments, by their internal part will be: square, rectangular, cylindrical, hexagonal, or any geometrical shape and the inlet open at both ends, the inlet passage of less than 5 mm, within it, an acaricide substance is deposited, that acts by contact, the sizes of the containing strip, are ranging from 10 mm to 500 mm long, from 10 mm to 400 mm wide, from 1 mm to 5 mm high, the said limits included.

Abstract: The present disclosure generally describes an antimicrobial composition comprising: a water solution comprising a chlorite salt and/or chlorine dioxide having a concentration ranging from about 2,000 parts per million to about 8,000 parts per million, and at least one quaternary ammonium salt having a concentration ranging from about 5,000 parts per million to about 10,000 parts per million. The present compositions are advantageously effective against a variety of bacteria, viruses, molds, and fungi, and may be used in a variety applications. Such applications include, without limitation, healthcare setting and equipment disinfection, food surface disinfection, agricultural disinfection, and personal hand care disinfection.

Abstract: Embodiments of the present disclosure describe diapocarotenoid plant growth regulators represented by formula (I): R-A-R (I) or a precursor, salt, solvate, stereoisomer or polymorph thereof; wherein R is a monovalent carbonyl moiety selected from the group consisting of aldehydes, ethers, diethers, carboxylic acids, alcohols, and ester carboxylates and A is a bivalent polyene represented by the bivalent moiety —(CRa?CRb)x—, wherein x is the number of double bonds in polyene moiety A, and Ra and Rb are, independently, hydrogen, a hydrocarbon, or an alkoxy group, and composition of the diapocarotenoid plant growth regulators in an agronomically acceptable carrier.

Abstract: The present invention relates to an aqueous composition comprising at least an auxin herbicide and a drift control agent. It relates more particularly to a concentrated blend of at least one water-soluble salt of an auxin herbicide and of a drift control agent.

Abstract: The present invention relates to an aqueous composition comprising at least an auxin herbicide and a drift control agent. It relates more particularly to a concentrated blend of at least one water-soluble salt of an auxin herbicide and of a drift control agent.

Abstract: An amide compound represented by the general formula [I]: or a salt thereof, an agricultural and horticultural microbicide comprising the compound or the salt as an active ingredient, and a method for using the agricultural and horticultural microbicide.

Abstract: Provided is a plant disease control composition having a broad spectrum against various plant pathogens, and shows excellent controlling effects (synergistic controlling effects) which cannot be expected from a single component alone. The plant disease control composition includes (Group a) at least one quinoline compound represented by the formula: (wherein R1, R2: an alkyl which may be substituted, an aryl which may be substituted, etc.; R3, R4: H, an alkyl which may be substituted, etc.; X: halogen, an alkyl which may be substituted, etc.; Y: halogen, alkyl, etc.; n: 0 to 4; m: 0 to 6) or a salt thereof, and at least one of fungicidal compounds selected from the group consisting of a Strobilurin series compound, a triazole series compound, etc., as effective ingredients.

Abstract: The present invention relates to compounds of Formula (I), wherein R1, R2, R3, R4 and G are as defined herein. The invention further relates to herbicidal compositions which comprise a compound of Formula (I), to their use for controlling weeds, in particular in crops of useful plants.

Abstract: The present invention is generally related to an agricultural formulation comprising 3-(difluoromethyl)-1-methyl-N-[(3R)-1,1,3-trimethyl-2,3-dihydroinden-4-yl]pyrazole-4-carboxamide and sodium salt of naphthalene sulfonate condensate and polyoxyethylene tristyrylphenol phosphate, potassium salt. The present invention is further related to an agricultural formulation comprising 3-(difluoromethyl)-1-methyl-N-[(3R)-1,1,3-trimethyl-2,3-dihydroinden-4-yl]pyrazole-4-carboxamide, ethaboxam, metalaxyl, mandestrobin, methyloxirane polymer, sodium salt of naphthalene sulfonate condensate, a mixture of sodium salt of alkyl vinyl ether/maleic acid half-ester copolymer and polyvinyl pyrrolidone and polyoxyethylene tristyrylphenol phosphate, potassium salt. The present invention is further directed to a process for preparing the agricultural formulations and methods of use thereof.

Abstract: The present invention relates to nitrification inhibitors of formula (I), which are alkoxypyrazole compounds. Moreover, the invention relates to the use of compounds of formula (I) as nitrification inhibitors, i.e. for reducing nitrification, as well as agro-chemical mixtures and compositions comprising the nitrification inhibitors of formula (I).

Abstract: The present invention relates to pesticidal mixtures comprising one fungicidal compound I selected from the group consisting of 1-[3-chloro-2-[[1-(4-chlorophenyl)pyrazol-3-yl]oxymethyl]phenyl]-4-methyl-tetrazol-5-one (I-1), 1-[3-bromo-2-[[1-(4-chlorophenyl)pyrazol-3-yl]oxymethyllphenyl]-4- methyl-tetrazol-5-one (I-2), 1-[2-[[-1(4-chlorophenyl)pyrazol-3-yl]oxymethyl]-3-methyl-phenyl]-4-methyl-tetrazol-5-one (I-3), 1-[2-[[1(4-chlorophenyl)pyrazol-3-yl]oxymethyl]-3-fluoro-phenyl]-4- methyl-tetrazol-5-one (I-4), 1-[2-[[1-(2,4-dichlorophenyl)pyrazol-3-yl]oxymethyl]-3-fluoro- phenyl]-4-methyl-tetrazol-5-one (I-5), 1-[2-[[4-(4-chlorophenyl)thiazol-2-yl]oxymethyl]3-methyl-phenyl]-4-methyl-tetrazol-5-one (I-6), 1-[3-chloro-2-[[4-(p-tolyl)thiazol-2-yl]oxymethyl]phenyl]-4-methyl-tetrazol-5-one (I-7), 1-[3- cyclopropyl-2-[[2-methyl-4-(1-methylpyrazol-3-yl)phenoxy]methyl]phenyl]-4-methyl-tetrazol-5-one (I-8), 1-[3-(difluoromethoxy)-2-[[2-methyl-4-(1-methylpyrazol-3-yl)phenoxy]methyl]phenyl]-4-methyl-tetrazol-5-one (I-9),

Abstract: The present invention relates to pesticidal mixtures comprising one fungicidal compound I selected from the group consisting of 1-[3-chloro-2-[[1-(4-chlorophenyl)pyrazol-3-yl]oxymethyl]phenyl]-4-methyl-tetrazol-5-one (I-1), 1-[3-bromo-2-[[1-(4-chlorophenyl)pyrazol-3-yl]oxymethyl]phenyl]-4-methyl-tetrazol-5-one (I-2), 1-[[2-(4-chlorophenyl)pyrazol-3-yl]oxymethyl]-3-methyl-phenyl]-4-methyl-tetrazol-5-one (I-3), 1-[2-[[1-(4-chlorophenyl)pyrazol-3-yl]oxymethyl]-3-fluoro-phenyl]-4-methyl-tetrazol-5-one (I-4), 1-[2-[[1-(2,4-dichlorophenyl)pyrazol-3-yl]oxymethyl]-3-fluoro-phenyl]-4-methyl-tetrazol-5-one (I-5), 1-[2-[[4-(4-chlorophenyl)thiazol-2-yl]oxymethyl]-3-methyl-phenyl]-4-methyl-tetrazol-5-one (I-6), 1-[3-chloro-2-[[4-(p-tolypthiazol-2-yl]oxymethyl]phenyl]-4-methyl-tetrazol-5-one (I-7), 1-[3-cyclopropyl-2-[[2-methyl-4-(1-methylpyrazol-3-yl)phenoxy]methyl]phenyl]-4-methyl-tetrazol-5-one (I-8), 1-[3-(difluoromethoxy)-2-[[2-methyl-4-(1-methylpyrazol-3-yl)phenoxy]methyl]phenyl]-4-methyl-tetrazol-5-one (I-9), 1-meth

Abstract: Pesticidal mixtures including a pesticidally active anthranilamide compound of formula (I) and at least one further pesticidal active ingredient. The pesticidal mixtures are useful for combating and controlling insects, acarids or nematodes in and on plants, and for protecting such plants being infested with pests.

Abstract: Described herein are compounds of Formula (I): and salts, tautomers, and stereoisomers thereof. Methods of making the compounds, salts, tautomers, and stereoisomers are also described. Further described herein are composition, kits, methods, and uses involving the compounds, salts, tautomers, and stereoisomers. The methods include methods of treating and preventing diseases (e.g., cancers) in subjects (e.g., humans).

Abstract: The present invention provides a method for controlling the degradation of emamectin and cartap, the method comprising formulating a composition which comprises an amount of water less than 0.5% by weight based on the total weight of the stable composition and at least one pH adjuster for maintaining the pH at 25° C. after dilution in water at less than 5.5. The present invention further provides a stable solid insecticidal composition comprising: (1) an effective amount of emamectin; (2) an effective amount of cartap; and (3) at least one pH adjuster; wherein the composition is substantially free of water and the pH at 25° C. after dilution with water is less than 5.5.

Abstract: Endophytic bacteria, compositions comprising the same, and methods of use thereof are disclosed which increase the root and shoot growth of grass hosts, suppress growth of soil borne fungal pathogens of host plants, increase resistance of the grass to diseases and reduce competitiveness of distantly related competitor weeds of the crop.

Abstract: Provided is a type of rhizobium with the classified nomenclature of Bradyrhizobium sp. KTMS 0001 or Bradyrhizobium sp. KTMS 0002, and the deposit number of CCTCC No. M2017580 or CCTCC No. M2017581. Also provided are a bacterial preparation containing the rhizobium, a method for restoring rare-earth tailings soil and a use of the rhizobium.

Abstract: The invention relates to anti-parasitic agents, and particularly, although not exclusively, to the use of Chryseobacterium nematophagum for the control of nematode parasites.

Abstract: The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5? UAAACAAUCGCAAGAAGCUGA 3? (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5? AGCUUCUUGCGAUUGUUUAAG 3? (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.

Abstract: A pressing device for pressing meat products, in particular frozen and/or partly frozen meat products, preferably fresh meat products and/or bacon, comprises a pressing chamber which extends along a longitudinal axis and into which a product to be pressed can be inserted, wherein the pressing chamber comprises at least one counter-element and at least one contact element, which is movable in the direction of the counter-element, that cooperate such that the product inserted into the pressing chamber can be compressed between the at least one counter-element and the at least one contact element; and wherein the pressing device comprises at least one servomotor that is configured to move the at least one contact element.

Abstract: A movable contact element for a pressing device for pressing meat products, in particular frozen and/or partly frozen meat products, preferably fresh meat products and/or bacon, comprises a base part; an attachment part; a transverse sliding part; and a height part that are connected to one another at respective connection points and that form a contact surface for a product at one side of the contact element during the pressing. The contact surface has an effective length along a first direction of extent and an effective width along a second direction of extent perpendicular to the first direction of extent, with the effective length and the effective width of the contact surface being variable.

Abstract: An apparatus for treating the atmosphere of a storage space for vegetable products with a volume greater than 200 m3, includes a contacting device having a packing; an injector configured to inject a liquid flow into the contacting device; and a circulator configured to circulate the storage atmosphere in the contacting device. The contacting device is configured such that the storage atmosphere is brought into contact with the liquid flow by circulation in the packing.

Abstract: Systems and apparatus are provided for maintaining an ultra low oxygen concentration in a shipping container for the purpose of preventing spoilage of perishable food products. The system and apparatus may contain a composition of a mixture of gases including one or more of nitrogen, carbon dioxide, and another inert gas, wherein the mixture of gases positively pressurizes the shipping container with an ultra low oxygen concentration. The system and apparatus may use one or more sensors to monitor the composition of the mixture of gases, and may use one or more controllers to release the compressed gases into the interior of the container. The controller may release the compressed gases at a variable rate of release sufficient to maintain the ultra low oxygen concentration and to ensure consistent concentrations of the mixture of gases with the container.

Abstract: Provided is a composition for lowering blood pressure and/or reducing neutral fat, which composition has few side effects and high safety. The composition for lowering blood pressure and/or reducing neutral fat includes a casein hydrolysate and an indigestible dextrin. Preferably, the casein hydrolysate includes a peptide composed of Met-Lys-Pro. Preferably, the casein hydrolysate includes a peptide composed of Met-Lys-Pro, and a content of the indigestible dextrin is at 5,000 to 100,000 parts by mass with respect to 1 part by mass of the peptide.

Abstract: A method for producing a first milk product having a first fat content and a second milk product having a second fat content. The method includes separating raw milk into cream and skim milk, diverting a first part of the cream into a first cream pipe, and a second part of the cream into a second cream pipe, dividing the skim milk in the main skim milk pipe, such that a first part of the skim milk flows into a first skim milk pipe and a second part of the skim milk flows into a second skim milk pipe. Flow rates for the two cream parts and the skim milk parts are determined, and valves are adjusted based on the determined flow rates, such that the milk products are obtained when mixing the cream and skim milk parts.

Abstract: Disclosed is the process for preparation of a multicoloured hard candy with at least one white portion, not containing titanium dioxide.

Abstract: A heat exchanger includes an inner tube extending longitudinally along a central axis and having an inner surface bounding a product chamber and an outer surface having a plurality of channels disposed at circumferentially spaced intervals in alternating relationship with a plurality of fins about the circumference of the outer surface of the inner tube; and a longitudinally extending outer tube disposed coaxially about and circumscribing the inner tube in radially spaced relationship, the outer tube having an inner surface contacting the plurality of fins of the inner cylinder, the outer surface being welded to the fins at a plurality of weld locations.

Abstract: The present invention relates to a unique helical design for scraper blades (1) and a driver-disc (2) that allows for optimum performance when preparing single-serve portions (100-300 ml) of freshly-made frozen and/or chilled confections on demand directly in a packaging container. The present invention improves upon the prior art by not only shortening the time it takes (less than 180 seconds) to prepare portionable volumes of freshly made frozen/chilled confections with optimal microstructure inside a conically shaped container packaging, but also minimises cross-contamination and reduces the need for cleaning in-between portions/batches.

Abstract: A device for preparing a gelatin-based product may comprise a mix tank, a mix pod that is fluidly coupled to the mix tank via a pod spike, and a hot water tank, where the hot water tank is coupled to the mix pod via the pod spike. In at least one example, the pod spike may comprise an outer tube and an inner tube. In one or more examples, the pod spike of the device may comprise a hub, where a first end of the outer tube is coupled to the hub. Further, in some examples, a first end of the inner tube may also be coupled to the hub.

Abstract: Provided are a protein powder capable of increasing the amount of protein ingested, a protein-containing composition, a method for producing a food, a method for producing a protein powder, a method for producing a protein-containing composition, a method for evaluating a protein powder, and a method for evaluating a protein-containing composition. A water droplet is adhered to the surface of the protein powder which was in a leveled state to measure a contact angle. The contact angle is measured from the time point when the water droplet contacts with the protein powder, and it is determined whether or not the contact angle is 90° or less within 60 seconds. The protein powder having a contact angle of 90° or less within 60 seconds is evaluated as a protein powder that is easy to eat without water.

Abstract: The present invention relates to the use of turbine mixing during enzymatic hydrolysis of aquatic protein from species such as fish, aquatic mammals, crustaceans and/or mollusks, to obtain high quality aquatic protein hydrolysates, having very low oxidation, improved organoleptic profile and improved biological activity of interest, for human consumption and cosmetics. The turbine mixing can inhibit oxidation during hydrolysis, contribute to an increase in the bio-activity and decrease the bitter taste of the final product. The process can vary in starting material, pre-treatment, type and amount of enzyme, hydrolysis conditions, time, degree of hydrolysis and post-treatment.

Abstract: The invention relates to a method for producing a solid transformation product of a substrate comprising the following steps: • preparing a substrate of biomass comprising carbohydrates and proteinaceous matter that originates from soya bean, rape seed, or mixtures thereof, optionally in further mixture with carbohydrates and proteinaceous matter originating from fava beans, peas, sunflower seeds, lupine, cereals, and/or grasses, • mixing said substrate with a live microorganism or a combination of live microorganisms, which live microorganism or mixture of live microorganisms is not live yeast, and adding water in an amount which provides an initial incubation mixture having a water content from 30 to 70% by weight, and a ratio of wet bulk density to dry bulk density from 0.60 to 1.45 in the resulting mixture; • incubating said initial incubation mixture for 1-240 hours at a temperature of 15-70° C.

Abstract: A method of treating a disorder in a veterinary subject is provided. The method comprises administering an effective amount of a preparation comprising ammonia oxidizing microorganisms to the veterinary subject, thereby treating the disorder. Methods of introducing ammonia oxidizing microorganisms in a veterinary subject, treating skin of a veterinary subject, and treating a systemic condition in a veterinary subject are also provided. Related preparations, kits, and devices are also provided.

Abstract: The present invention provides a coated-type feed additive composition for improving body weight gain of livestock or feed conversion ratio for livestock comprising: a core containing a polysaccharide having a property of aggregating gram-negative bacteria; and a core coating agent.

Abstract: The present disclosure relates to disrupting algae cell walls, in order to obtain protoplast with high nutrient digestibility for use as a food ingredient and/or as feed for farmed fish and shellfish species, which leads to the production of added value sea food items and to more sustainable and better performing food chains. The present disclosure described a method for obtaining proteins or a rich-protein extract from algae, comprising the steps of: disrupting a cell wall of algae by physical-mechanical means using a vibratory grinding mill with rings; submitting the disrupted algae to an enzymatic hydrolysis carried out with a mixture of enzymes; wherein the enzyme mixture is a mixture of at least two enzymes selected from the following list: lipase, pectinase, cellulase, hemicellullase, endo exo-arabanase, amylase, or mixtures thereof; provided that at least one of the enzymes is lipase, pectinase, amylase.

Abstract: The present invention pertains to a fruit juice composition wherein the content of an aroma component is reduced but the content of a nutritional functional component and the content of a saccharide are not substantially reduced, a method for producing the composition, and a food or beverage containing the composition.

Abstract: The invention concerns a zinc enriched drinking water composition to be packed in a lightweight container having wall width being locally below 150 ?m, said zinc enriched drinking water being based on a water matrix comprising drinking water to which are added minerals: calcium in a range from 0 to 400 mg/l; magnesium in a range from 0 to 300 mg/l; zinc in a range from 2 to 25 mg/l; and sodium in a range from 0 to 300 mg/l and in which the amount of bicarbonates in the water matrix does not exceed 10 mg/l. The invention also relates to a packaged zinc enriched drinking water composition ant to a method for preparing such a composition and such packaged water composition.

Abstract: System and method for thermally treating a flowable product includes an apparatus comprising a waveguide for providing electromagnetic energy, a conduit for receiving a flowable material, and an applicator for delivering electromagnetic energy from a generator to the waveguide. The waveguide includes first and second arms that each comprise an output that is isolated from the output of the other arm by a phase shift, such that any reflected electromagnetic energy exits the arm through the input port and does not flow into the opposing arm.

Abstract: A system for agitating products in a retort includes a clamping assembly configured to selectively impose a first clamping force on a first end of at least one product carrier and a second opposing clamping force on a second end of the at least one product carrier, and a reciprocating assembly configured to apply linear forces on the product carriers for reciprocal movement of the product carriers along the retort. A method of processing products in a retort includes arranging products in at least one product carrier for movement along a retort and reciprocating the at least one product carrier along the retort in a non-sinusoidal pattern of movement.

Abstract: A device(s) and method for pasteurizing and/or sterilizing particulate material using an electron beam. The device (10) includes at least one electron source (20) for generating an electron beam, a treatment zone (19) in which the material, particularly a freely falling material, can be pasteurized and/or sterilized by the electron beam, and a material channel (21) arranged in the region of the treatment zone (19) in which the material can be pasteurized and/or sterilized by the electron beam. A planar protective element (23), which is at least partially permeable by the electron beam, is arranged between the electron source (20) and the material channel (21). The device (10) includes a holding frame (120) which holds the protective element (23) and which has a cavity (121) through which a cooling fluid can flow.

Abstract: A system and method for food sterilization utilizing microwave-generated plasma. The plasma is used to irradiate food to destroy pathogens on the food, whereby the food is sterilized. The plasma may be a low-temperature, high-pressure plasma.

Abstract: A method for controlling foam comprising providing a food composition comprising a foam control agent and a foodstuff, the foam control agent; and processing the food composition. A food composition comprising a foodstuff and a foam control agent.

Abstract: The present invention provides a spread type processed food using foie gras (duck liver, goose liver) and chicken breasts, a composition thereof and a method for manufacturing the same, and more particularly, a spread type processed food using foie gras and chicken breasts, which is manufactured using foie gras and chicken breasts in a spread form such as butter or jam that can be simply spread on a preferred food such as bread and easily eaten, wherein fishy smell and peculiar smell (odor) of foie gras are effectively removed to allow people of all ages and both sexes to easily eat without repulsion, and the processed food is rich in protein and contains diverse vitamins to promote brain development of growing children and protect various diseases, thereby planning promotion of public health, as well as a composition thereof and a method for manufacturing the same.

Abstract: Treated egg products are provided for imparting the flavor of egg to foods that include egg yolk treated simultaneously with protease and phospholipase. Food flavoring composition are also provided for imparting the flavor egg that can be used in lower amounts than whole egg or egg yolk. Additionally, methods are provided for preparing the egg flavored food compositions. Such egg yolk compositions are prepared by the simultaneous application of phospholipase enzyme and protease enzyme. The method further includes egg flavored food products, such as mayonnaise and salad dressings, which are prepared with the food flavoring composition. The egg flavor compositions can be used in a variety of food products to provide egg flavor and enhanced functionality.

Abstract: A method for creating a fruit jelly food product having a viscous consistency, including weighing and proportioning initial ingredients, modulating the size, texture, or temperature of the initial ingredients, combining the initial ingredients into a fruit mixture and heating, adding a gelling agent to the fruit mixture to obtain a gel-enhanced mixture, adding citric acid and lemon juice to the gel-enhanced mixture to obtain a citrus-enhanced mixture and heating, allowing the citrus-enhanced mixture to achieve thermodynamic equilibrium, and confirming the pH of the citrus-enhanced mixture is less than or equal to about 3.6 and sugar content of about 25 degrees Brix.