Abstract: A coke plant includes multiple coke ovens where each coke oven is adapted to produce exhaust gases, a common tunnel fluidly connected to the plurality of coke ovens and configured to receive the exhaust gases from each of the coke ovens, multiple standard heat recovery steam generators fluidly connected to the common tunnel where the ratio of coke ovens to standard heat recovery steam generators is at least 20:1, and a redundant heat recovery steam generator fluidly connected to the common tunnel where any one of the plurality of standard heat recovery steam generators and the redundant heat recovery steam generator is adapted to receive the exhaust gases from the plurality of ovens and extract heat from the exhaust gases and where the standard heat recovery steam generators and the redundant heat recovery steam generator are all connected in parallel with each other.

Abstract: Systems and methods are provided for co-processing of biomass oil with mineral coker feeds in a coking environment. The coking can correspond to any convenient type of coking, such as delayed coking or fluidized coking. The biomass oil can correspond to biomass oil with a molar ratio of oxygen to carbon of 0.24 or less on a dry basis. Such types of biomass oil can be formed from pyrolysis methods such as hydrothermal pyrolysis, and are in contrast to biomass oils formed from pyrolysis methods such as fast pyrolysis. By using a biomass oil with a molar ratio of oxygen to carbon of 0.24 or less, improved yields of light coker gas oil can be achieved in conjunction with a reduction in the yield of heavy coker gas oil.

Abstract: Favorable isomerization conditions for producing normal paraffins can produce olefins. The process for separating normal paraffins from non-normal paraffins by adsorption has a limit on olefin concentration, so the olefins must be removed. We propose to remove olefins from the isomerization effluent stream that is recycled to the adsorption separation process.

Abstract: The present invention is based on the use of a two-step hydrocracking process comprising a step of hydrogenation placed upstream of the second hydrocracking step, the hydrogenation step treating the unconverted liquid fraction separated in the distillation step in the presence of a specific hydrogenation catalyst. Furthermore, the hydrogenation step and second hydrocracking step are carried out under specific operating conditions and in particular under very specific temperature conditions.

Abstract: Methods of refining a whole crude oil stream. The methods involve first processing the crude either through a hydrotreating reactor comprising a dewaxing reactor bed or a flash evaporation separator. The treated streams are then further processed through a demetalization reactor bed, a hydroprocessing reactor bed, or both. The stream can then be still further processed via additional hydrotreating, distillation, or both.

Abstract: For the shipping industry, these fuels provide solutions to long outstanding technical problems that heretofore hindered supply of low sulfur marine fuels in quantities needed to meet worldwide sulfur reduction goals. When ships on the open seas burn cheap low grade heavy bunker oils high in sulfur, nitrogen and metals, the SOx, NOx, and metal oxides go to the environment. This invention converts essentially all of each barrel of crude feed to a single ultraclean fuel versus conventional refining where crude feed is cut into many pieces, and each piece is sent down a separate market path meeting various different product specifications. When in port, ships can generate and sell electricity to land based electrical grids to offset fuel cost in an environment-friendly manner.

Abstract: For the shipping industry, these fuels provide solutions to long outstanding technical problems that heretofore hindered supply of low sulfur marine fuels in quantities needed to meet worldwide sulfur reduction goals. Marine shipping use of high sulfur bunker oils is reported as largest source of world-wide transportation SOx emissions. When ships on the open seas burn cheap low grade heavy bunker oils high in sulfur, nitrogen and metals, the SOx, NOx, and metal oxides go to the environment. This invention converts essentially all of each barrel of crude feed to a single ultraclean fuel versus conventional refining where crude feed is cut into many pieces, and each piece is sent down a separate market path meeting various different product specifications. When in port, ships can use these fuels to generate and sell electricity to land based electrical grids to offset fuel cost in an environment-friendly manner.

Abstract: A method and apparatus for production of cellulose based fuel pellets from wood logs includes steps of comminuting the wood logs to particulate wood material. The particulate material heat treated in a reactor and the pressure is reduced in a manner causing defibration of the particulate material. The material is pelletized using the softened lignin at least partially as a binder for the pellets. The comminution of the wood logs is effected as a single-step operation in which the wood logs are charged to a comminution station where at least one rotating drum provided with cutting teeth is arranged in a manner to fully comminute the wood logs. The particulate material may be fractioned and a selected size fraction used for the further treatment.

Abstract: A process for converting light paraffins and/or light hydrocarbons to a high octane gasoline composition is disclosed. The process involves: (1) oxidation of iso-paraffins to alkyl hydroperoxides and alcohol; (2) conversion of the alkyl hydroperoxides and alcohol to dialkyl peroxides; and (3) radical coupling of one or more iso-paraffins and/or iso-hydrocarbons using the dialkyl peroxides as radical initiators, thereby forming a gasoline composition comprising gasoline-range molecules including a C7 enriched gasoline composition having a road octane number (RON) greater than 100.

Abstract: This disclosure relates to base stocks comprising a C28-C32 hydrocarbon fraction and optionally a C42-C48 hydrocarbon fraction produced by dimerization and trimerization of a linear C14 mono-olefin, a linear C16 mono-olefin, or a mixture thereof, in the presence of a Lewis acid, oil compositions comprising such base stock(s), and processes for making such base stocks.

Abstract: New ashless TBN molecules are synthesized, and lubricant compositions containing them, boost the total base number. The lubricant compositions further tested for ASTM D6594 copper corrosion test meets ASTM limits.

Abstract: The present invention provides a method for washing a hard article, the method including: the contact step of bringing a detergent liquid obtained by mixing (a) a potassium internal olefin sulfonate and (b) water having a hardness of 5° DH or more, into contact with the hard article, and the step of rinsing the hard article after the contact step with water having a hardness of 5° DH or more, wherein the detergent liquid at 30° C. or more is brought into contact with the hard article in at least a part of the contact step.

Abstract: Solid laundry softening compositions and applications of use are disclosed. Solid laundry softening compositions combine quaternary ammonium compounds with an inorganic carrier to provide a flowable powder for solidification in a pressed or extruded solid composition. A high loading of quaternary ammonium compound in the inorganic carrier, including an inorganic salt, can be further combined with softening boosters, processing aids, surfactants, and/or additional functional ingredients to provide stable solid compositions.

Abstract: The present disclosure relates to detergent compositions comprising subtilase variants exhibiting improved stability and/or improved wash performance in liquid detergent and methods for obtaining such detergent compositions. The variants are suitable for use in e.g. cleaning or detergent compositions, such as laundry detergent compositions and dish wash compositions, including automatic dish wash compositions.

Abstract: The present invention relates primarily to fragrance substance mixtures, preferably perfume oils, comprising or consisting of (a) 8,8-dimethyl-6,10-dioxaspiro[4,5]decane, i.e. a compound of formula (I) as described herein, and additionally (b) one or more fragrance substance(s) selected from the group consisting of esters, lactones, oximes and sulphur compounds with a molar mass of 240 g/mol or less and/or (c) one or more fragrance substance(s) selected from the group consisting of acetals, ketones and ethers with a molar mass in the range of 126-240 g/mol.

Abstract: The present invention relates to a cleaning liquid containing a component (A): a compound represented by the following formula (1), component (B): alkylamine, component (C): polycarboxylic acid, and component (D): ascorbic acid, in which a mass ratio of the component (A) to a total mass of the component (B) and the component (C) is 1 to 15, and in the formula (1), R1, R2, and R3 each have a definition same as the definition described in the description,

Abstract: Water-soluble film and unit dose articles made therefrom, where the water-soluble film includes a water-soluble polymer, where the water-soluble polymer includes a blend of a caseinate polymer and a polyvinyl alcohol homopolymer.

Abstract: A number analyzing method, a number analyzing device, and a storage medium for number analysis are disclosed, which enable, with high accuracy, analysis of the number or number distribution of particulate or molecular analytes according to the kinds of the analytes. A computer control program is executed on the basis of a data group of particle-passage detection signals which are detected by a nanopore device in accordance with passage of subject particles through a through-hole. Also, a particle type distribution estimating program is executed, to estimate probability density on the basis of a data group based on feature values indicating feature of the waveforms of pulse signals which correspond to the passage of particles and which are obtained as the particle-passage detection signals. Thus, the number of particles can be derived for each particle type.

Abstract: The devices, methods and systems are described for providing controlled amounts of gas, gas pressure and vacuum to microfluidic devices the culturing of cells under flow conditions. The devices, methods, and systems contemplated here may also be used to control the environment surrounding the microfluidic devices; offer user control over experiments comprising microfluidic devices, such as the ability to directly or remotely control experiment conditions; and comprise information aggregation and transmission, such that experimental data may be collected, stored, aggregated and transmitted to users.

Abstract: A variable diameter bioreactor vessel is provided that includes a first vessel section having a first diameter configured to hold a liquid media and biologic material, and a second vessel section having a second diameter that is greater than the first diameter such that the liquid media can be increased from a first volume to a second volume within the vessel.

Abstract: Disclosed herein is a sterilizable adapter for a cell culture vessel comprising a body, an upper connection and/or a lid, at least one port, a ventilation passage, a lower internal connection suitable for connection to a cell culture vessel and a cell retention device and/or a cell separation device as well as a device comprising said sterilizable adapter and a method for cell cultivation using said sterilizable adapter.

Abstract: An assembly includes a housing with opposite first and second layers. The first and second layers are spaced apart to define a confined interior space. A semi-permeable membrane is attached to the first layer, the semi-permeable membrane covering a porous area portion of the first layer. An outlet port and an inlet port are in fluid communication with the interior space. The assembly includes a first circulator for circulating a first fluid between the outlet port and the inlet port, and a second circulator for circulating a second fluid along an exterior surface of the semi-permeable membrane. The second circulator includes a fluid duct attached to or integrated within the housing. The fluid duct is isolated from the interior space and is porous to provide fluid access to an exterior surface of the semi-permeable membrane. The semi-permeable membrane forms a barrier allowing exchange of compounds across the membrane.

Abstract: Methods of protein production in continuous perfusion mammalian cell culture bioreactors are provided. Methods for continuous perfusion culture by allowing cells to self-regulate the rate of addition of perfusion medium to the bioreactor via a pH change are presented. Compositions comprising the perfusion medium as well as the process advantages of using hi-end pH control of perfusion or HIPCOP are also presented.

Abstract: A liquid filtration system according to the present invention comprises a bioreactor; a filter configured to filter liquid passing therethrough; a perfusion pump configured to move liquid between the bioreactor and the filter; a liquid line providing fluidic communication between the bioreactor, perfusion pump and filter; and a bleed outlet provided on the liquid line, the bleed outlet configured to provide means to remove liquid selectively from the system under the action of the perfusion pump. With the liquid filtration system according to the present invention, both the filtering and bleed functions may be performed under the action of a single pump, thereby significantly reducing the complexity and cost of the components required.

Abstract: An automated cell culture and tissue engineering system comprising defined and separate environmental zones provide for increased control and maintenance of the internal environment of the system such that the temperature, air flow and gases surrounding the bioreactor module form one zone that is maintained separately to a second zone formed surrounding the reagent fluid reservoir. The system further comprises means for elimination and/or management of condensation within the second zone of the system.

Abstract: Protein-rich nutrient supplements and animal feed supplements derived from an anaerobic bacterial process are generated through a myriad of cell rupturing and protein fractionation/purification processes. Bacterial fermentation systems and methods of obtaining one or more protein-containing portions from a fermentation process using carbon monoxide-containing gaseous substrates are provided. The invention further provides compositions of protein-rich nutrient supplements with useful applications for intake by a variety of different animals and humans.

Abstract: The invention is directed to Haematococcus sp. KAU-01 as well as to a culture medium for Haematococcus sp. KAU-01, and to methods for using this strain to process environmental pollutants such as gases generated by coal-fired plants.

Abstract: Freeze-resistant baker's yeast (Saccharomyces cerevisiae) strains and uses thereof. For example, for the preparation of fresh or frozen dough products, e.g., bread. The freeze-resistant baker's yeast strains, which are, e.g., obtainable from specific deposited strains, e.g., by breeding these strains with each other or with other Saccharomyces cerevisiae strains. Methods of using said strains or methods of preparing a dough or a dough product or a yeast product are also provided.

Abstract: The invention relates to a method for the formation of renal tubules by embedding individual renal cells into a synthetic hydrogel, which is based on polyethylene glycol as a component, and the culturing of the cells until tubule structures are formed. The culturing can be continued until the obtained tubule structures correspond in terms of size, structure, morphology and functionality to adult human renal tubules or are at least similar thereto.

Abstract: Medical instrument includes a substrate, in which cells are in contact with or held on a surface of the substrate, and at least the surface of the substrate which holds the cells is formed of a fluorine-containing cyclic olefin polymer which contains a repeating structure unit represented by Formula (1), wherein in Formula (1), at least one of R1 to R4 is fluorine, an alkyl with 1 to 10 carbon atoms which contains fluorine, an alkoxy with 1 to 10 carbon atoms which contains fluorine, or an alkoxyalkyl with 2 to 10 carbon atoms which contains fluorine, R1 to R4 are selected from hydrogen and certain non-fluorinated groups when R1 to R4 do not contain fluorine, R1 to R4 may be the same as or different from each other, and R1 to R4 may be bonded to each other to form a cyclic structure.

Abstract: This invention relates, inter alia, to compositions of low serum or serum free media and methods for the expansion of T cell populations and methods for using such populations of cells. In some aspects, the invention relates to compositions and methods for the selective expansion of T cell subpopulations.

Abstract: The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method.

Abstract: In some aspects and embodiments, the invention provides methods for making hematopoietic stem cells, including for HSCT. The method comprises providing a cell population comprising hemogenic endothelial (HE) or endothelial cells, and increasing activity or expression of DNA (cytosine-5-)-methyltransferase 3 beta (Dnmt3b) and/or GTPase IMAP Family Member 6 (Gimap6) in the HE and/or endothelial cells under conditions sufficient for stimulating formation of HSCs.

Abstract: The present invention relates to a composition for the differentiation of dental pulp stem cells into odontoblasts and an IgG or IgM type monoclonal antibody that specifically binds to the surface of odontoblasts differentiated from the stem cells. According to the present invention, BMP2 and BMP4 are optimally combined to significantly increase the differentiation efficiency of dental pulp stem cells into odontoblasts, to induce the mineralization of the matrix, and to improve the differentiation ability of odontoblasts into dentin. Further, the IgG or IgM monoclonal antibody that specifically binds to the surface of odontoblasts of the present invention is used to effectively isolate and purify odontoblasts, which can be useful for tissue regeneration and differentiation.

Abstract: A printable composition for the manufacture of cell-receiving scaffolds comprising about 0.3 wt % to about 3.0 wt % of one or more collagens; about 5.0 wt % to about 40.0 wt % of one or more monomers; about 0.5 wt % to about 2.0 wt % of a photo initiator; and 0 wt % to about 75 wt % of a vehicle comprising a protic solvent, by weight of the printable composition; wherein the printable composition has a resolution of about 100 microns or less when printed, a photo speed (Dp/Ec) of about 0.1-5 mm (Dp) and about 10-100 mJ/cm2 (Ec) when printed, and a green strength of at least about 5 kPa after drying. The present technology further includes methods of manufacturing a three-dimensional cell-receiving scaffold using the printable composition.

Abstract: Described are nicotine-degrading enzyme variants that exhibit increased nicotine-degrading activity and/or decreased immunogenicity relative to the wild-type NicA2 and NOX enzymes, compositions comprising the variants, and methods using them.

Abstract: The present invention is related to a dual promoter lentiviral vector and methods of use for the treatment of diseases and disorders, specifically lysosomal storage disorders.

Abstract: The present disclosure relates to transaminase polypeptides capable of aminating a dicarbonyl substrate, and polynucleotides, vectors, host cells, and methods of making and using the transaminase polypeptides.

Abstract: The invention provides for systems, methods, and compositions for altering expression of target gene sequences and related gene products. Provided are structural information on the Cas protein of the CRISPR-Cas system, use of this information in generating modified components of the CRISPR complex, vectors and vector systems which encode one or more components or modified components of a CRISPR complex, as well as methods for the design and use of such vectors and components. Also provided are methods of directing CRISPR complex formation in eukaryotic cells and methods for utilizing the CRISPR-Cas system. In particular the present invention comprehends optimized functional CRISPR-Cas enzyme systems.

Abstract: The subject application pertains to compositions and methods for enhancing reverse transcriptase (RT) activity and/or reducing the inhibition of RT by inhibitors, such as formalin, tannic acid and/or heparin. In some embodiments, RT inhibition is reduced by the addition of potassium glutamate, histidine hydrochloride monohydrate, poloxamer 188, or any combination thereof to a reaction mixture comprising a polymerase. In other embodiments, RT is enhanced through the addition of a polyvinyl sulfonic acid sodium salt (PVSA) to a reaction mixture. The subject application also provides oligonucleotide primers for use in the reverse transcription of target sequences and its enhancement. These primers have high GC content or low GC content. Methods of using a RT inhibition reducer or a RT enhancer in a composition with an RNA template and RT improves RT yield, RT sensitivity, or RT tolerance to various chemicals are also provided.

Abstract: In an illustrative embodiment, automated multi-module cell editing instruments are provided to automate multiple edits into nucleic acid sequences inside one or more cells.

Abstract: The present invention provides a method for analyzing impurities of an oligonucleotide sequence based on high-throughput sequencing. The method of the present invention comprises the following steps: constructing a high-throughput sequencing library for analysis of impurities of an oligonucleotide sequence; subjecting the high-throughput sequencing library to high-throughput sequencing, and analyzing the nucleotide sequence components according to the sequencing results; the sequence of the extension primer used in the construction of the high-throughput sequencing library consisting of the DNA molecule set forth in positions 1-22 of SEQ ID NO: 2 and N bases (A, T, C or G) in sequence; and N being an integer greater than or equal to 6.

Abstract: The present disclosure relates to compositions, methods, modules and automated integrated instrumentation for multiplex delivery of “landing pad” edits into the genomes of a population of live cells. The landing pads then may be leveraged to insert very large DNA sequences into the genomes of the population of live cells.

Abstract: The application provides improved methods of genome editing. The genome editing systems described herein comprise a RNA-guided nuclease molecule and a Repair-Modulating Enzyme Molecule (RMEM).

Abstract: The disclosure is directed to conjugates, e.g. PNA conjugates, as well as methods of employing the conjugates for detecting one or more targets in a biological sample, e.g. a tissue sample.

Abstract: The present invention relates to a compound of formula (II) or (IIb) Wherein X, Y, Rx, Ry, R5 and Nu are as defined in the description and in the claims. The compound of formula (II) can be used in the manufacture of oligonucleotides.

Abstract: Among other things, the present disclosure provides designed PNPLA3 oligonucleotides, compositions, and methods thereof. In some embodiments, provided oligonucleotide compositions provide improved single-stranded RNA interference and/or RNase H-mediated knockdown. Among other things, the present disclosure encompasses the recognition that structural elements of oligonucleotides, such as base sequence, chemical modifications (e.g., modifications of sugar, base, and/or internucleotidic linkages) or N patterns thereof, conjugation with additional chemical moieties, and/or stereochemistry [e.g., stereochemistry of backbone chiral centers (chiral internucleotidic linkages)], and/or patterns thereof, can have significant impact on oligonucleotide properties and activities, e.g., RNA interference (RNAi) activity, stability, delivery, etc.

Abstract: Developed and provided is: a nucleic acid agent that is efficiently delivered to the central nervous system, to which drug delivery is inhibited by the blood brain barrier mechanism, and that provides an antisense effect to a target transcription product at the delivery site; and a composition containing such a nucleic acid agent. Provided is a double-stranded nucleic acid complex consisting of a first nucleic acid strand and a second nucleic acid strand that are annealed to each other; wherein the first nucleic acid strand hybridizes with part of a target transcription product and has an antisense effect on the target transcription product; and wherein the second nucleic acid strand includes a base sequence complementary to the first nucleic acid strand and is conjugated to a phosphatidylethanolamine or an analog thereof.

Abstract: The invention provides compositions and methods for reducing expression of a target gene in a cell, involving contacting a cell with an isolated double stranded nucleic acid (dsNA) in an amount effective to reduce expression of a target gene in a cell. The dsNAs of the invention possess a single stranded extension (in most embodiments, the single stranded extension comprises at least one modified nucleotide and/or phosphate back bone modification). Such single stranded extended Dicer-substrate siRNAs (DsiRNAs) were demonstrated to be effective RNA inhibitory agents compared to corresponding double stranded DsiRNAs.

Abstract: Disclosed herein are engineered oligonucleotides for selective inhibition of polypeptide expression and activity. Also disclosed herein are methods of selectively inhibiting polypeptide expression and activity contacting an engineered oligonucleotide with a polynucleotide encoding the polypeptide.