Abstract: The present invention relates to an inhibitor of the P2Y2 receptor or an inhibitor of the P2Y2 receptor signaling pathway for use in preventing the metastasis of tumours or as a lead compound for developing a drug for preventing the metastasis of tumours.

Abstract: Disclosed are methods and compositions for siRNA-mediated therapy of mammalian diseases. In particular, compositions and methods are disclosed for treatment of therapy-resistant human breast cancers. In exemplary embodiments, siRNA molecules are presented that effectively knock down gene expression of one or more polynucleotides in breast cancer tumor initiating cells.

Abstract: Modified oligonucleotides comprising CpG sites, wherein the cytosine is replaced by cytosine analogs are provided as well as methods of making the oligonucleotides and their use in treating cancer, tumorigenesis and hyper-proliferative disorders.

Abstract: The invention provides compositions and methods for reducing expression of a target gene in a cell, involving contacting a cell with an isolated double stranded nucleic acid (dsNA) in an amount effective to reduce expression of a target gene in a cell. The dsNAs of the invention possess a single stranded extension (in most embodiments, the single stranded extension comprises at least one modified nucleotide and/or phosphate back bone modification). Such single stranded extended Dicer-substrate siRNAs (DsiRNAs) were demonstrated to be effective RNA inhibitory agents compared to corresponding double stranded DsiRNAs.

Abstract: The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Atonal homolog 1 (ATOH1), in particular, by targeting natural antisense polynucleotides of Atonal homolog 1 (ATOH1). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of ATOH1.

Abstract: The application describes methods for accurately evaluating whether thyroid test samples, especially indeterminate thyroid samples, are benign or malignant.

Abstract: RNA interference using small interfering RNAs which are specific for the vascular endothelial growth factor (VEGF) gene and the VEGF receptor genes Flt-1 and Flk-1/KDR inhibit expression of these genes. Diseases which involve angiogenesis stimulated by overexpression of VEGF, such as diabetic retinopathy, age related macular degeneration and many types of cancer, can be treated by administering the small interfering RNAs.

Abstract: The present invention discloses the discovery that miR-21 targets and down-regulates the core mismatch repair (MMR) recognition protein complex hMSH2 and hMSH6. Anti-sense miR-21 is therefore proven as therapeutic herein. Therefore, compositions, kits, therapies and other methods, including methods of treatment/amelioration of symptoms, are disclosed in the present invention.

Abstract: The present invention relates methods of treating pouchitis by administering a pharmaceutical formulation suitable for rectal use, such as an enema or suppository, comprising an antisense oligonucleotide targeted to ICAM-1 to an individual

Abstract: The subject matters of this invention are a sequence of double-stranded RNA: ATN-RNA, intervention using interference RNA (iRNAi), use of a sequence of double-stranded RNA: ATN-RNA, a method of treating a brain tumor and a method of inhibiting a brain tumor cells which express tenascin, a kit for inhibiting cancer cell which expresses tenascin and a method for a kit preparation in a brain tumor therapy. Malignant gliomas preferentially express a number of surface markers that may be exploited as therapeutic targets, including tenascin-C, an extracellular matrix glycoprotein that is ubiquitously expressed by malignant gliomas and probably contributes to tumor cell adhesion, invasion, migration and proliferation. For tenascin-C inhibition, RNA interference intervention (iRNAi) approach have been applied.

Abstract: Disclosed herein are compounds, compositions and methods for modulating splicing of SMN2 mRNA in a cell, tissue or animal. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders, including spinal muscular atrophy.

Abstract: This invention discloses novel microRNAs and their precursors, and recombinant DNA constructs including such novel miRNAs, miRNA precursors, miRNA promoters, and miRNA recognition sites corresponding to the miRNAs. Included are novel miRNA and miRNA precursors that exhibit nutrient-responsive expression. Also disclosed are miRNA decoy sequences. Further provided are non-natural transgenic plant cells, plants, and seeds containing in their genome a recombinant DNA construct of this invention and methods of controlling gene expression using recombinant DNA constructs of this invention.

Abstract: This invention provides a method for reducing hypertropic scarring resulting from dermal wound healing in a subject in need which comprises administering to the subject an antisense oligonucleotide which inhibits expression of connective tissue growth factor (CTGF) in an amount effective to inhibit expression of CTGF and thereby reduce hypertrophic scarring.

Abstract: Provided are methods for the treatment of disorders of the central nervous system (CNS) and the eye. In particular, use of compositions comprising a compound capable of modulating a target gene or gene product is described for the preparation of a pharmaceutical composition for the treatment of disorders of the CNS and/or the eye, wherein the composition is designed to be administered outside the blood-CNS and the blood-retina barriers. Furthermore, methods are provided for identifying and obtaining nucleic acid molecules encoding polypeptides involved in CNS disorders or of the eye, methods for diagnosing said disorders as well as transgenic animal deficient in the expression of target genes identified in accordance with the described method. In addition, methods of identifying and isolating drugs that are particularly useful for the treatment of disorders related to the CNS and/or the eye are disclosed.

Abstract: Methods for inhibition of hairless protein mRNA using RNA interference is described, in particular methods for hair removal. Also described are nucleic acid constructs for RNAi-mediated inhibition of hairless protein mRNA and compositions including such constructs.

Abstract: The present invention relates to novel short interfering RNA (siRNA) molecules that are multi-targeted. More specifically, the present invention relates to siRNA molecules that target two or more sequences. In one embodiment, multi-targeting siRNA molecules are designed to incorporate features of siRNA molecules and features of micro-RNA (miRNA) molecules. In another embodiment, multi-targeting siRNA molecules are designed so that each strand is directed to separate targets.

Abstract: A method of determining the Crohn's disease status of a subject comprising the steps of determining the level of miR-29 in a sample from said subject; and comparing the level of miR-29 determined in step (a) with one or more reference values.

Abstract: Disclosed herein are antisense compounds and methods for decreasing Factor VII and treating, preventing, or slowing progression of thromboembolic complications, hyperproliferative disorders, or inflammatory conditions in an individual in need thereof.

Abstract: The present invention provides compositions and methods for transforming primary mammalian cells using an oncogenic form of ALK wherein the transformed cells display features of that of a corresponding tumor cell isolated from a cancer subject. The invention also provides a method for immortalizing normal CD4+ T lymphocytes with a lymphoma-characteristic form of ALK such as NPM-ALK.

Abstract: Disclosed herein are methods and kits useful for providing neuroprotection to neurons in the inner ear and to methods of treating inner ear diseases and disorders, including tinnitus and Mnire's disease.

Abstract: An isolated RNA comprising an intron RNA that is released in a cell, thereby modulating the function of a target gene. Also disclosed are a composition comprising a chemokine and an isolated RNA of the invention or a DNA template for the isolated RNA, a composition comprising one or more agents that induce RNA-mediated modulation of the functions of two or more target genes in a cell, and methods of using these compositions for modulating the functions of genes in a cell.

Abstract: The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Brain derived neurotrophic factor (BDNF), in particular, by targeting natural antisense polynucleotides of Brain derived neurotrophic factor (BDNF). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of BDNF.

Abstract: The invention encompasses polypeptides, polynucleotides, and antibodies, for Artemin and related ligands, including Persephin (PSPN). The invention also encompasses expression vectors and host cells for producing these polypeptides, polynucleotides, or antibodies. The invention further encompasses diagnostics and therapeutics, especially for cancer, and particularly breast cancer, colon cancer, prostate cancer, endometrial cancer, lung cancer, stomach cancer, liver cancer, and others, comprising one or more of the disclosed polypeptides, polynucleotides, antibodies, expression vectors, host cells, or compositions thereof. Particularly encompasses are inhibitors of Artemin and/or related ligands, and uses for these inhibitors.

Abstract: The present invention relates to an aptamer which includes a nucleic acid including or made up of: the sequence GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCA GGACGC (SEQ ID NO: 1), or the sequence AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACC CGAUCGC (SEQ ID NO: 2), or a sequence including or made up of at least 25 consecutive nucleotides of a sequence that is at least 80% identical to SEQ ID NO: 1 or to SEQ ID NO: 2, with the condition that a nucleic acid made up of said sequence is bonded to annexin 2.

Abstract: RNA interference is provided for inhibition of HIF1A mRNA expression for treating patients with ocular angiogenesis, particularly for treating retinal edema, diabetic retinopathy, sequela associated with retinal ischemia, posterior segment neovascularization (PSNV), and neovascular glaucoma, and for treating patients at risk of developing such conditions.

Abstract: The present invention discloses a method of providing anti-oncogenic effects in a subject suffered from colorectal cancer. The present invention also discloses a method for screening an anti-colorectal cancer agent. The present invention further discloses a method of determining the prognosis of a subject with colorectal cancer.

Abstract: A delivery-enhancing peptide comprising the amino acid sequence of SEQ ID NO:11 or salt thereof. This invention is directed towards methods and compositions to administer a double-stranded ribonucleic acid to a mammal so as to effectuate transfection of the double-stranded RNA into a desired tissue of the mammal.

Abstract: The invention provides methods and compositions for modulating the expression, processing, post-translational modification, stability and/or activity of XBP-1 protein, or a protein in a signal transduction pathway involving XBP-I to treat dyslipidemias and steatosis disorders. The present invention also pertains to methods for identifying compounds that modulate the expression, processing, post-translational modification, and/or activity of XBP-I protein or a molecule in a signal transduction pathway involving XBP-1.

Abstract: The present invention provides a method of generating a nucleic acid, which specifically binds to an extracellular surface protein expressed by a cell of interest, and which nucleic acid comprises a compound of interest to be delivered to the cell of interest.

Abstract: There is provided a heptamer-type small guide nucleic acid that comprises any of the 7-base sequences of SEQ ID NOS: 1 to 15, and induces apoptosis of human leukemia cells. A leukemia therapeutic agent containing the heptamer-type small guide nucleic acid as an active ingredient is also provided. The novel heptamer-type sg nucleic acid can induce apoptosis of human leukemia cells.

Abstract: Disclosed are compounds, compositions, and methods relating to fluoride aptamers, fluoride-responsive riboswitches, fluoride-regulated expression constructs, fluoride transporters, nucleic acids encoding fluoride transporters, expression constructs encoding fluoride transporters, and cells containing or including any combination of these.

Abstract: An isolated DNA molecule comprising a fragment of the gene encoding the feline NIS is disclosed as well as methods of use thereof. Also provided are methods for rational diet design of food composition suitable for administration to feline companion animals afflicted with hyperthyroidism, comprising (a) accessing at least one database that comprises a first data set relating functional gene profile of a biofluid or tissue sample from an animal to physiological condition of the animal, where the functional gene profile is that of the feline NIS gene; (b) accessing at least one database that comprises a second data set relating effects of bioactive dietary components on the functional gene profile; (c) using an algorithm drawing on these data sets, processing input data defining physiological condition to derive a nutritional formula promoting wellness of a feline companion animal afflicted with hyperthyroidism; and (d) preparing a food composition based on the nutritional formula.

Abstract: Efficient sequence specific gene silencing is possible through the use of siRNA technology. By selecting particular siRNAs by rational design, one can maximize the generation of an effective gene silencing reagent, as well as methods for silencing genes. Methods, compositions, and kits generated through rational design of siRNAs are disclosed including those directed to nucleotide sequences for CTNNB1.

Abstract: The invention relates to isolated anti-microRNA molecules. In another embodiment, the invention relates to an isolated microRNA molecule. In yet another embodiment, the invention provides a method for inhibiting microRNP activity in a cell.

Abstract: The invention provides interfering RNA molecule-ligand conjugates useful as a delivery system for delivering interfering RNA molecules to a cell in vitro or in vivo. The conjugates comprise a ligand that can bind to a low density lipoprotein receptor (LDLR) or LDLR family member. Therapeutic uses for the conjugates are also provided.

Abstract: Isolated nucleic acid fragments comprising precursor miRNAs, and artificial miRNAs and their use in down-regulating gene expression are described.

Abstract: What is described is a modified miRNA molecule for producing an artificial siRNA/mature small RNA molecule that inhibits the expression of a target transcript of a host cell, comprising a stem region modified to comprise a sequence encoding the artificial siRNA molecule, consisting of a guide and a passenger strand; a conserved region having specific sequences; and a nonconserved region modified to include a recognition site for a restriction enzyme while preserving the native secondary structure of the miRNA. The modified miRNA molecule produced with these elements substantially inhibits the expression of the target transcript when expressed from an endogenous or exogenous promoter in the host cell.

Abstract: PROBLEM The object is to provide a prevention/treatment means for cancer, by controlling expression/function of a target molecule different from a conventional one, as a novel method in the molecularly-targeted treatment method for a cancer. In addition, provided is a screening means for a substance having prevention/treatment activity for a cancer, using the above target molecule. Moreover, provided is a simple and rapid means for examining a cancer using the detection of the above target molecule. SOLUTION According to one aspect of the present invention, there is provided a cell proliferation inhibitor or a cell adhesion inhibitor for a cancer cell, containing an antibody to a protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID No: 2 or a partial peptide thereof.

Abstract: The present application relates to double stranded nucleic acid compounds, compositions comprising same and methods of use thereof for the treatment of hearing loss in a subject in need thereof. The compounds are preferably chemically synthesized and modified dsRNA molecules which inhibit expression of a gene expressed selected from the group consisting of HES1, HES5, HEY1, HEY2, ID1, ID2, ID3, CDKN1B, and NOTCH1.

Abstract: Oligonucleotides, chemically-modified oligonucleotides, and oligonucleotide-conjugate compl in research, diagnostics, and/or therapeutics are described herein.

Abstract: The present invention relates to a method of inhibiting metastasis comprising the administration of an inhibitor of protease nexin-1 (PN-1), characterized in that said inhibitor is administered at a therapeutical dosage that does not completely inhibit the expression and/or activity of PN-1.

Abstract: A method and compound for suppressing an immune response in a mammalian subject, for the treatment or prevention of an autoimmune condition or transplantation rejection are disclosed. The compound is an antisense oligonucleotide analog compound having a targeting sequence complementary to a preprocessed CTLA-4 mRNA region identified by SEQ ID NO: 22 in SEQ ID NO: 1, spanning the splice junction between intron 1 and exon 2 of the preprocessed mRNA of the subject. The compound is effective, when administered to a subject, to form within host cells, a heteroduplex structure (i) composed of the preprocessed CTLA-4 mRNA and the oligonucleotide compound, (ii) characterized by a Tm of dissociation of at least 45° C., and (iii) resulting in an increased ratio of processed mRNA encoding ligand-independent CTLA-4 to processed mRNA encoding full-length CTLA-4.

Abstract: The invention provides Nicotiana benthamiana mutant plants which are incapable of forming xylosyl-structures on glycoproteins. In addition, the invention provides methods for the production of heterologous glycoproteins in said mutant plants.

Abstract: Provided herein are methods, compounds, and compositions for reducing expression of fibroblast growth factor receptor 4 (FGFR4) mRNA and protein in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate a metabolic disease, or a symptom thereof.

Abstract: The present invention is directed to the identification of a novel repressor located between ˜1.2 kb to ˜1.6 kb from the translation start site of the IFN-?1 promoter. The present invention provides a method of using siRNAs against ZEB1 (binds to the repressor region) and BLIMP-1 (binds outside the repressor region) and increases the promoter activity of IFN-?1 (i.e., increases the production of IFN-?1 protein). siRNAs against ZEB1 mRNA or BLIMP-1 mRNA increase IFN-?1 gene activity. There is provided a therapeutic application of siRNAs against ZEB1 and BLIMP-1 mRNAs in treating a mammal (including a human) by increasing the production of IFN-?1 protein that promotes an anti-viral response as well as treats asthma diseases and colon diseases.

Abstract: The present invention relates to novel phosphoramidites, A-n-bz, C-n-bz, C-n-ac, G-n-ac and U are produced with an HPLC purity of greater than 98% and 31P NMR purity greater than 99%. A novel process of reverse 5??3? directed synthesis of RNA oligomers has been developed and disclosed. Using that method demonstrated high quality RNA synthesis with coupling efficiency approaching 99%.

Abstract: The present invention relates to methods for controlling pest infestation using double stranded RNA molecules. The invention provides methods for producing transgenic cells expressing the double stranded RNA molecules, as well as compositions and commodity products containing or treated with such molecules.

Abstract: The invention relates to microRNA-34a and related microRNAs for use in the treatment of B-cell lymphoma. Likewise it relates to microRNA-34a for use in the preparation of a medicament for the treatment of B-cell lymphoma, and for a method of treatment of B-cell lymphoma comprising administering microRNA-34a. These claims are based on the observation that microRNA-34a shows strong anti-proliferative effects when overexpressed in diffuse large B-cell lymphoma (gDLBCL) cell lines, or when delivered intratumorally or systemically in xenograft models of DLBCL.

Abstract: Double-stranded RNA (dsRNA) induces sequence-specific post-transcriptional gene silencing in many organisms by a process known as RNA interference (RNAi). Using a Drosophila in vitro system, we demonstrate that 19-23 nt short RNA fragments are the sequence-specific mediators of RNAi. The short interfering RNAs (siRNAs) are generated by an RNase III-like processing reaction from long dsRNA. Chemically synthesized siRNA duplexes with overhanging 3? ends mediate efficient target RNA cleavage in the lysate, and the cleavage site is located near the center of the region spanned by the guiding siRNA. Furthermore, we provide evidence that the direction of dsRNA processing determines whether sense or antisense target RNA can be cleaved by the produced siRNP complex.

Abstract: The present invention is related to a ribonucleic acid comprising a double stranded structure whereby the double-stranded structure comprises a first strand and a second strand, whereby the first strand comprises a first stretch of contiguous nucleotides and whereby said first stretch is at least partially complementary to a target nucleic acid, and the second strand comprises a second stretch of contiguous nucleotides whereby said second stretch is at least partially identical to a target nucleic acid, and whereby the double stranded structure is blunt ended.