Mammal Patents (Class 800/14)
  • Patent number: 10961525
    Abstract: The present invention includes mutant AID, APOBEC, and Tet enzymes with improved functions. In one aspect the invention provides APOBEC fusion proteins comprising hyperactive deamination activity. In another aspect, the invention provides AID mutant proteins comprising hyperactive deamination activity. In yet another aspect, the invention provides mutant Tet proteins capable of stalling oxidation at a 5-hydroxymethylcytosine (hmC).
    Type: Grant
    Filed: July 2, 2018
    Date of Patent: March 30, 2021
    Assignee: THE TRUSTEES OF THE UNIVERSITY OF PENNSYLVANIA
    Inventors: Rahul M. Kohli, Emily Schutsky, Monica Yun Liu
  • Patent number: 10960085
    Abstract: Described herein are compositions and methods for modulation of gene expression in the liver including modulation of PCSK9, TTR, SERPINA1, KLKB1 and/or HAO1.
    Type: Grant
    Filed: September 7, 2017
    Date of Patent: March 30, 2021
    Assignee: Sangamo Therapeutics, Inc.
    Inventors: Anthony Conway, Gary K. Lee, David Paschon, Lei Zhang
  • Patent number: 10890587
    Abstract: Methods and kits for detecting alternating spatial expression of PTEN and, optionally, SMAD4, CD44, and/or TP53 in colonic tumors are described. The methods and kits are useful for identifying a cancer stem cell (CSC)-like zone within a colonic tumor, identifying an adenoma-adenocarcinoma (Ad-ACA) transition zone in a colorectal cancer (CRC) tumor, identifying a CRC tumor that contains high-grade adenoma and/or early adenocarcinoma regions, identifying CSCs in a CRC tumor, diagnosing a subject with high-grade colon adenoma and/or early adenocarcinoma, and determining the likelihood that a colonic tumor in a subject will undergo invasive transformation if left untreated.
    Type: Grant
    Filed: January 27, 2015
    Date of Patent: January 12, 2021
    Assignee: Quest Diagnostics Investments Incorporated
    Inventors: Daniel Jones, Kevin J. Arvai, Ya-Hsuan Hsu
  • Patent number: 10881683
    Abstract: The present invention is directed to provide nucleic acid molecules that promote proliferation of pancreatic islet ?-cells. A proliferation promoting agent for promoting proliferation of pancreatic islet ?-cells according to the present invention contains at least one of a nucleic acid molecule having SEQ ID NO: 1 or a nucleic acid molecule having SEQ ID NO: 2: (SEQ?ID?NO:?1) UAAAGUGCUGACAGUGCAGAU (SEQ?ID?NO:?2) AGCUACAUCUGGCUACUGGGUCUC.
    Type: Grant
    Filed: September 16, 2016
    Date of Patent: January 5, 2021
    Assignee: TOHOKU UNIVERSITY
    Inventors: Tetsuya Yamada, Hideki Katagiri, Sohei Tsukita
  • Patent number: 10799614
    Abstract: A biological product for clinical xenotransplantation into a human and a method of preparing biological product for clinical xenotransplantation into a human involving producing a non-wild type, biologically engineered swine having a biologically engineered genome such that the swine does not express one or more extracellular surface glycan epitopes, is free of certain pathogens, is reared according to a bioburden-reducing procedure in a closed designated pathogen free herd, wherein the biological product is harvested following the swine being euthanized and the product is aseptically removed from the swine, the biological product is processed involving sterilization and storing the product in a sterile container, and the product does not contain one or more extracellular surface glycans, is free of certain designated pathogens, is biologically active and comprises live cells and tissues capable of vascularizing after xenotransplantation.
    Type: Grant
    Filed: October 4, 2019
    Date of Patent: October 13, 2020
    Assignees: XENOTHERAPEUTICS, INC., XENOTHERAPEUTICS CORPORATION
    Inventors: Paul W. Holzer, Jon Adkins, Rodney L. Monroy, Elizabeth J. Chang
  • Patent number: 10575504
    Abstract: The invention provides knock-in non-human cells and mammals having a genome encoding chimeric antibodies and methods of producing knock-in cells and mammals. Certain aspects of the invention include chimeric antibodies, humanized antibodies, pharmaceutical compositions and kits. Certain aspects of the invention also relate to diagnostic and treatment methods using the antibodies of the invention.
    Type: Grant
    Filed: April 11, 2016
    Date of Patent: March 3, 2020
    Assignee: ABLEXIS, LLC
    Inventors: Larry Green, Hiroaki Shizuya
  • Patent number: 10472611
    Abstract: The present invention relates in part to nucleic acids encoding proteins, nucleic acids containing non-canonical nucleotides, therapeutics comprising nucleic acids, methods, kits, and devices for inducing cells to express proteins, methods, kits, and devices for transfecting, gene editing, and reprogramming cells, and cells, organisms, and therapeutics produced using these methods, kits, and devices. Methods for inducing cells to express proteins and for reprogramming and gene-editing cells using RNA are disclosed. Methods for producing cells from patient samples, cells produced using these methods, and therapeutics comprising cells produced using these methods are also disclosed.
    Type: Grant
    Filed: May 2, 2019
    Date of Patent: November 12, 2019
    Assignee: Factor Bioscience Inc.
    Inventors: Matthew Angel, Christopher Rohde
  • Patent number: 10349639
    Abstract: A method is provided of targeted genome editing of an animal using site specific homologous integration. A composition comprising a single stranded oligonucleotide or double stranded nucleic acid molecule comprising a nucleic acid molecule of interest and sequences flanking a target locus cleavage site is injected into the zygote of an animal along with a nuclease and a guide nucleic acid molecule that targets the nuclease to a target locus. The composition is injected into the zygote after fertilization and prior to formation of a nucleus. The nucleic acid molecule of interest is recombined into the genome with high efficiency. The process allows for integration of nucleic acid molecules into the genome of animals in which the pronuclei cannot be visually observed during injection.
    Type: Grant
    Filed: March 26, 2015
    Date of Patent: July 16, 2019
    Assignee: University of Maryland, College Park
    Inventors: Bhanu Prakash V. L. Telugu, Ki-Eun Park
  • Patent number: 10227577
    Abstract: Methods for the production, capturing and purification of recombinant human lysosomal proteins are described. Such recombinant human lysosomal proteins can have high content of mannose-6-phosphate residues. Also described are pharmaceutical compositions comprising such recombinant human lysosomal proteins, as well as methods of treatment and uses of such recombinant human lysosomal proteins.
    Type: Grant
    Filed: March 30, 2017
    Date of Patent: March 12, 2019
    Assignee: Amicus Therapeutics, Inc.
    Inventors: Hung V. Do, Russell Gotschall
  • Patent number: 10196606
    Abstract: The present invention provides a method of producing a multipotent stem cell, said method comprising culturing at least one fibroblast cell in the presence of an effective amount of at least one small molecule reprogramming factor(s) that induces the cell to de-differentiate into a multipotent stem cell, wherein the method excludes the use of reprogramming factor(s) that are not small molecules. The small molecule reprogramming factor(s) may include a G9a HMTase inhibitor(s) and/or a MEK inhibitor(s) optionally in combination with other small molecule reprogramming factor(s). The invention also includes methods of differentiating the multipotent stem cells, cells produced by the methods, assays using the cells and kits for use in the methods.
    Type: Grant
    Filed: December 13, 2012
    Date of Patent: February 5, 2019
    Assignee: UNISA VENTURES PTY LTD
    Inventors: Xin-Fu Zhou, Yanchuang Han
  • Patent number: 10189887
    Abstract: The present invention relates to polypeptides and uses thereof for reducing CD95-meditated cell motility. In particular, the present invention relates to a polypeptide having an amino acid sequence having at least 70% of identity with the amino acid sequence ranging from the amino-acid residue at position 175 to the amino-acid residue at position 191 in SEQ ID NO:1.
    Type: Grant
    Filed: April 16, 2015
    Date of Patent: January 29, 2019
    Assignees: INSERM (INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE), UNIVERSITE DE BORDEAUX, UNIVERSITE DE RENNES, ECOLE DES HAUTES ETUDES EN SANTE PUBLIQUE (EHESP), UNIVERSITE DES ANTILLES ET DE LA GUYANE, INSTITUTE BERGONIE, UNIVERSITY OF NOTTINGHAM
    Inventors: Patrick Legembre, Pierre Vacher, Doriane Sanseau, Aubin Penna, Robin Flynn
  • Patent number: 10137188
    Abstract: Provided herein are engineered cell lines. In some embodiments, cells of an engineered cell line have altered expression of a gene and/or altered expression of an miRNA, wherein the altered expression results in increased or decreased production of a virus. The virus is a picornavirus, such as a poliovirus or Enterovirus 71. Also provided herein are methods for using the engineered cells to produce virus, and methods for treating a subject having or at risk of having a viral infection.
    Type: Grant
    Filed: February 5, 2014
    Date of Patent: November 27, 2018
    Assignees: University of Georgia Research Foundation, Inc., The United States of America, as represented by the Secretary, Dept. of Health and Human Services, Thermo Fisher Scientific, Inc.
    Inventors: Jon Michael Karpilow, Mark Steven Oberste, Ralph A. Tripp, Stephen M. Tompkins
  • Patent number: 9908940
    Abstract: The invention provides methods for identifying immunobinders, such as scFv antibodies, capable of specifically binding to cell surface antigens, and compositions identified according to said methods.
    Type: Grant
    Filed: November 20, 2015
    Date of Patent: March 6, 2018
    Assignee: Esbatech, An Alcon Biomedical Research Unit LLC
    Inventors: David Urech, Valerie Hulmann-Cottier
  • Patent number: 9822396
    Abstract: Methods compositions and kits are provided for performing a chromatin or chromosome conformation capture assay in partitions.
    Type: Grant
    Filed: February 13, 2015
    Date of Patent: November 21, 2017
    Inventors: Claudia Litterst, Svilen Tzonev, Jeremy Agresti
  • Patent number: 9816077
    Abstract: There are provided methods and compositions for activating the expression of an exogenous gene by an exogenous integrase specifically in cells in which the exogenous integrase is expressed. The invention further relates to uses of the compositions in treatment of various conditions and disorders, as exemplified by selectively activating expression of a toxin only in target cell populations.
    Type: Grant
    Filed: August 1, 2012
    Date of Patent: November 14, 2017
    Assignee: RAMOT AT TEL-AVIV UNIVERSITY LTD.
    Inventors: Mikhail Kolot, Ezra Yagil, Natalia Malchin
  • Patent number: 9790489
    Abstract: The present invention provides a method and components thereof of performing genetic modification under a drug-free environment. The method comprises the steps of generating a trapped mammalian cell library by trapper constructs (including the element of piggyBac terminal inverted repeats (TIRs)), reporter constructs, and helper constructs (including a sequence of an internal ribosomal entry site (IRES)). The present art allows: (1) to target & identify the silenced loci; (2) to separate genes with low-level expression at certain differentiation stages; (3) to evaluate the efficiency of gene targeting in the silent or repressed loci. The present invention avoids the biased gene targeting observed in the prior arts, and eliminates the needs of introducing antibiotic genes into the host genome which may lead to a potential threat of drifting antibiotic resistant genes into environment.
    Type: Grant
    Filed: October 26, 2009
    Date of Patent: October 17, 2017
    Assignee: CHANG GUNG UNIVERSITY
    Inventors: Yaa-Jyuhn James Meir, Chiung-Yuan Sareina Wu, Herng-Shing Yang
  • Patent number: 9750205
    Abstract: The invention relates to a method for the production of a set of seeds which are genetically identical to the male gametes from which they arise, which may comprise placing a limited number of paternal gametes that have the form of tetrads or dyads on the stigma of a flower to fertilize maternal egg cells to obtain a number of zygotes; and inducing the loss of maternal chromosomes from the zygotes to obtain a seed set containing a limited number of seeds in which the maternal chromosomes are absent. In a preferred embodiment the father plant exhibits suppression of chromosome recombination or second division restitution (SDR) during meiosis.
    Type: Grant
    Filed: February 22, 2013
    Date of Patent: September 5, 2017
    Assignee: RIJK ZWAAN ZAADTEELT EN ZAADHANDEL B.V.
    Inventor: Cornelis Maria Petrus van Dun
  • Patent number: 9708629
    Abstract: Genetically engineered mice having a corrected Crb1rd8 mutation and methods for correcting the Crb1rd8 mutation to produce the genetically engineered mice are provided according to aspects of the present invention. Kits, expression vectors and fusion proteins according to aspects of the invention are provided for use to produce the genetically engineered mice characterized by a corrected Crb1rd8 mutation.
    Type: Grant
    Filed: June 3, 2014
    Date of Patent: July 18, 2017
    Assignee: The Jackson Laboratory
    Inventors: Michael V. Wiles, Benjamin E. Low
  • Patent number: 9701971
    Abstract: Provided herein are methods of integrating one or more exogenous nucleic acids into one or more selected target sites of a host cell genome. In certain embodiments, the methods comprise contacting the host cell genome with one or more integration polynucleotides comprising an exogenous nucleic acid to be integrated into a genomic target site, and a nuclease capable of causing a double-strand break near or within the genomic target site.
    Type: Grant
    Filed: February 11, 2014
    Date of Patent: July 11, 2017
    Assignee: AMYRIS, INC.
    Inventors: Zach Serber, Andrew Horwitz
  • Patent number: 9677070
    Abstract: The disclosure relates generally to the targeting of genes to, and their integration into, an immunoglobulin (antibody) heavy chain locus. In particular, the methods described herein contemplate replacing the single rearranged heavy chain V, D, and J genes of a B cell lymphoma such as DT40 with independently rearranged VH-D-JH genes of chicken, in a system for generating immunoglobulin diversity. Also contemplated is replacement of the chicken VH-D-JH with rearranged VH-D-JH genes of other vertebrates including human in a system for generating immunoglobulin diversity, with the exception of any substitution disclosed and claimed in PCT application WO 2009/029315 A2. Also described is construction of a diverse chicken immunoglobulin heavy chain VDJ library in DT40 by homologous gene replacement of the single endogenous rearranged VDJ gene with a chicken VDJ repertoire using the described targeting vectors.
    Type: Grant
    Filed: March 13, 2013
    Date of Patent: June 13, 2017
    Assignees: Omeros Corporation, University of Washington Through Its Center for Commercialization
    Inventors: Daniel S. Allison, W. Jason Cummings, John B. Leppard, Nancy Maizels, Larry W. Tjoelker, Christi L. Wood, Munehisa Yabuki
  • Patent number: 9629930
    Abstract: Disclosed herein are methods and compositions for insertion of Factor IX (FIX) sequences into the genome of a cell for treating hemophilia B.
    Type: Grant
    Filed: October 8, 2015
    Date of Patent: April 25, 2017
    Assignees: Sangamo Biosciences, Inc., The Children's Hospital of Philadelphia
    Inventors: Philip D. Gregory, Katherine A. High, Michael C. Holmes, Hojun Li
  • Patent number: 9591835
    Abstract: The invention provides genetically modified non-human animals that express chimeric human/non-human MHC I polypeptide and/or human or humanized ?2 microglobulin polypeptide, as well as embryos, cells, and tissues comprising the same. Also provided are constructs for making said genetically modified animals and methods of making the same. Methods of using the genetically modified animals to study various aspects of human immune system are provided.
    Type: Grant
    Filed: March 11, 2013
    Date of Patent: March 14, 2017
    Assignee: Regeneron Pharmaceuticals, Inc.
    Inventors: Lynn MacDonald, Andrew J. Murphy, Cagan Gurer, John McWhirter, Vera Voronina, Faith Harris, Sean Stevens, Yingzi Xue
  • Patent number: 9574199
    Abstract: The invention relates to a method for the simultaneous integration of two or more copies of a polynucleotide of interest into the chromosome of a fungal host cell comprising at least two pairs of recognition sequences of a site-specific recombinase, each pair flanking a resident negative selection marker; transformation of the cell with a construct carrying a gene of interest also flanked by the recognition sequences to ensure double-crossover events after transient expression of the recombinase, followed by selection for excision of all negative selection markers from the cell.
    Type: Grant
    Filed: May 23, 2012
    Date of Patent: February 21, 2017
    Assignee: Novozymes A/S
    Inventor: Hiroaki Udagawa
  • Patent number: 9567608
    Abstract: The present invention relates to genetic techniques employing the direct ligatation of an external DNA fragment generated in situ by the same ZFNs that target the genome. ObLiGaRe, i.e., the obligated ligation-gated recombination, is a new method for genetic engineering using custom designed nucleases, and a strategy of site-specific gene insertion utilizing the NHEJ pathway. It applies a similar logic to the one used in unidirectional loxP sites (Oberdoerffer et al., 2003) but maintains all the advantages and flexibility of CDNs.
    Type: Grant
    Filed: February 26, 2015
    Date of Patent: February 14, 2017
    Assignee: Novartis AG
    Inventors: Yi Yang, Marcello Maresca
  • Patent number: 9557323
    Abstract: Provided is a transgenic animal model for testing immunogenicity and protective efficacy of human vaccines and the method for generating such a multitransgenic animal. Also disclosed are methods for screening compositions for human vaccine development. More specifically, a mouse model capable of expressing human leukocyte antigen DR4, and human costimulatory molecules (CD80) upon infusion of human HLA-matched hematopoietic stem cells, which can develop into a functional human immune system is provided.
    Type: Grant
    Filed: September 26, 2011
    Date of Patent: January 31, 2017
    Assignee: The United States of America as Represented by the Secretary of the Navy
    Inventors: Sofia A. Casares, Teodor D. Brumeanu, Thomas L. Richie
  • Patent number: 9550974
    Abstract: This present invention provides novel methods for deriving embryonic stem cells, those cells and cell lines, and the use of the cells for therapeutic and research purposes without the destruction of the embryo. It also relates to novel methods of establishing and storing an autologous stem cell line prior to implantation of an embryo, e.g., in conjunction with reproductive therapies such as IVF.
    Type: Grant
    Filed: January 13, 2014
    Date of Patent: January 24, 2017
    Assignee: Astellas Institute for Regenerative Medicine
    Inventors: Robert P. Lanza, Young Gie Chung
  • Patent number: 9534226
    Abstract: The invention pertains to an expression vector or a combination of at least two expression vectors comprising at least (a) a polynucleotide encoding a product of interest or an insertion site for incorporating a polynucleotide encoding a product of interest; (b) a polynucleotide encoding a first selectable marker (sm I); (c) a polynucleotide encoding a second selectable marker (sm II), which is different from the first selectable marker (sm I), wherein the activity of the selectable marker (sm I) or (sm II) is at least partially influenced by the activity of the other selectable marker and wherein the selectable markers (sm I) and (sm II) are involved in the folate metabolism. Also provided are suitable host cells, selection methods and methods for producing polypeptides with high yield.
    Type: Grant
    Filed: February 26, 2010
    Date of Patent: January 3, 2017
    Assignee: Novartis AG
    Inventors: Thomas Jostock, Hans-Peter Knopf
  • Patent number: 9474254
    Abstract: A spermatogonial stem cell line that is derived from testes of rats characterized by a desirable genetic background can serve as a source for cells to transplant into male-sterile recipient animals that are immuno-compatible with the spermatogonial line. Rat cells thus transplanted readily develop into fertilization-competent, haploid male gametes, with little or no endogenous sperm competition generated by the testes of the male-sterile recipient. This approach, constituting the first vector system for the use of rat spermatogonial lines from in vitro culture in generating mutant rats on a desired genetic background, effects maximal germline transmission of donor haplotypes from the transplanted spermatogonial cells.
    Type: Grant
    Filed: May 23, 2014
    Date of Patent: October 25, 2016
    Assignee: Board of Regents of the University of Texas System
    Inventor: Franklin Kent Hamra
  • Patent number: 9475859
    Abstract: The invention relates to polynucleotides, particularly chimeric polynucleotides useful for optimal production of functional immunoglobulins with human idiotypes in rodents. The invention further relates to rodents comprising such polynucleotides.
    Type: Grant
    Filed: October 17, 2014
    Date of Patent: October 25, 2016
    Assignee: OMT, Inc.
    Inventors: Marianne Bruggemann, Roland Buelow, Michael J. Osborn, Biao Ma
  • Patent number: 9452226
    Abstract: The present disclosure describes an animal model of central neuropathic pain relevant to spinal cord injury, as well as methods of using the model to screen for therapeutic agents and to test existing therapies.
    Type: Grant
    Filed: August 6, 2013
    Date of Patent: September 27, 2016
    Inventor: Scott P. Falci
  • Patent number: 9354232
    Abstract: There is provided a method for determining whether a mammalian subject having a bladder cancer belongs to a first or a second group, wherein the prognosis of subjects of the second group is worse than the prognosis of subjects of the first group, comprising the steps of: a) evaluating an amount of PODXL in at least part of a sample earlier obtained from the subject and determining a sample value corresponding to the evaluated amount; b) comparing said sample value with a predetermined reference value; and if said sample value is higher than said reference value, c1) concluding that the subject belongs to the second group; and if said sample value is lower than or equal to said reference value, c2) concluding that the subject belongs to the first group.
    Type: Grant
    Filed: December 11, 2013
    Date of Patent: May 31, 2016
    Assignee: Atlas Antibodies AB
    Inventor: Karin Jirstrom
  • Patent number: 9353368
    Abstract: The present disclosure provides a non-naturally occurring miRNA having a stem-loop structure comprising a scaffold derived from a first endogenous miRNA (e.g., miR-196a-2 or miR-204), a mature strand derived from a second endogenous miRNA, and a star strand sequence that is at least partially complementary to the mature strand sequence. The present disclosure also provides a non-naturally occurring miRNA having a stem-loop structure comprising a scaffold derived from an endogenous miRNA (e.g., miR-196a-2 or miR-204), a mature strand designed t be at least partially complementary to a target RNA, and a star strand sequence that is at least partially complementary to the mature strand sequence. The methods and compositions of the disclosure may be used to mediate gene silencing via the RNAi pathway.
    Type: Grant
    Filed: May 22, 2008
    Date of Patent: May 31, 2016
    Assignee: GE Healthcare Dharmacon, Inc.
    Inventors: Melissa Kelley, Amanda Birmingham, Jon Karpilow, Anastasia Khvorova, Kevin Sullivan
  • Patent number: 9221905
    Abstract: The invention provides methods for identifying immunobinders, such as scFv antibodies, capable of specifically binding to cell surface antigens, and compositions identified according to said methods.
    Type: Grant
    Filed: May 8, 2014
    Date of Patent: December 29, 2015
    Assignee: ESBATech, an Alcon Biomedical Research Unit LLC
    Inventors: David Urech, Valerie Hulmann-Cottier
  • Patent number: 9193952
    Abstract: Methods of producing populations of predominantly astrocytes, neurons or oligodendrocytes are provided. In addition, methods of treating mammals having astroglial tumors, oligodendrocyte tumors, or neuronal tumors are provided.
    Type: Grant
    Filed: January 13, 2014
    Date of Patent: November 24, 2015
    Assignee: The Regents of the University of Michigan
    Inventors: Kathy Sue O'Shea, Maria Morell, Yao-Chang Tsan
  • Patent number: 9187749
    Abstract: Disclosed herein are methods for decreasing Factor 12 and treating or preventing inflammatory conditions in an individual in need thereof. Examples of disease conditions that can be ameliorated with the administration of antisense compounds targeted to Factor 12 include hereditary angioedema (HAE). Methods for inhibiting Factor 12 can also be used as a prophylactic treatment to prevent individuals at risk for developing an inflammatory condition, such as, hereditary angioedema.
    Type: Grant
    Filed: June 8, 2012
    Date of Patent: November 17, 2015
    Assignee: Isis Pharmaceuticals, Inc.
    Inventors: Gourab Bhattacharjee, Alexey Revenko, Robert A. MacLeod
  • Patent number: 9175034
    Abstract: A method for purifying or detecting a target protein present in a solution, includes, before carrying out the actual detection or purification step, a step of contacting the solution with an aptamer binding specifically to the target protein, where the aptamer does not bind to a protein homologous to the target protein that could also be present in the solution.
    Type: Grant
    Filed: August 13, 2008
    Date of Patent: November 3, 2015
    Assignee: LABORATOIRE FRANCAIS DU FRACTIONNEMENT ET DES BIOTECHNOLOGIES
    Inventors: Laurent Siret, Abdessatar Chtourou, Frédéric Dhainaut, Gérald Perret
  • Patent number: 9109253
    Abstract: A method for detecting a genetic polymorphism associated with Lavender Foal Syndrome or a predisposition thereto in a subject, the method including screening a genomic material sample from the subject for the presence of at least one polymorphism in a MYO5A gene.
    Type: Grant
    Filed: December 1, 2010
    Date of Patent: August 18, 2015
    Assignee: University of Pretoria
    Inventors: Alan John Guthrie, Cindy Kim Harper, Anandi Bierman
  • Patent number: 9102971
    Abstract: The present invention relates to a method for integrating a gene fragment inserted between a pair of transposon sequences into a chromosome of a mammalian cell, comprising introducing at least one expression vector which comprises a gene fragment comprising a DNA encoding a protein of interest and also comprises a pair of transposon sequences at both terminals of the gene fragment, into a suspension mammalian cell; and a method for producing the protein of interest comprising suspension-culturing a suspension mammalian cell which produces the protein of interest; and an a suspension mammalian cell which expresses the protein of interest.
    Type: Grant
    Filed: December 15, 2011
    Date of Patent: August 11, 2015
    Assignees: Inter-University Research Institute Corporation Research Organization of Information and Systems, KYOWA HAKKO KIRIN CO., LTD
    Inventors: Megumi Kurokawa, Keina Yamaguchi, Risa Ogawa, Masayoshi Tsukahara, Koichi Kawakami, Yoko Hayashi
  • Patent number: 9074222
    Abstract: Isolated polynucleotides comprising a DCX mini-promoters are provided. The mini-promoter may be operably linked to an expressible sequence, e.g. reporter genes, genes encoding a polypeptide of interest, regulatory RNA sequences such as miRNA, siRNA, anti-sense RNA, etc., and the like. In some embodiments a cell comprising a stable integrant of an expression vector is provided, which may be integrated in the genome of the cell. The promoter may also be provided in a vector, for example in combination with an expressible sequence. The polynucleotides find use in a method of expressing a sequence of interest, e.g. for identifying or labeling cells, monitoring or tracking the expression of cells, gene therapy, etc.
    Type: Grant
    Filed: January 23, 2014
    Date of Patent: July 7, 2015
    Assignee: THE UNIVERSITY OF BRITISH COLUMBIA
    Inventors: Elizabeth M. Simpson, Wyeth W. Wasserman, Robert A. Holt, Steven J. Jones, Daniel Goldowitz, Elodie Portales-Casamar, Cletus D'Souza, Vikramjit Chopra, Charles de Leeuw
  • Patent number: 9066930
    Abstract: Disclosed herein are methods and compositions for treating disorders associated with angiogenesis or lymphangiogenesis using ALK-1 antagonists.
    Type: Grant
    Filed: May 20, 2011
    Date of Patent: June 30, 2015
    Assignee: Genentech, Inc.
    Inventors: Minhong Yan, Gu Zhang
  • Publication number: 20150150153
    Abstract: The present invention provides novel methods for improving the efficiency of artificial activation of unfertilized mammalian oocytes by reducing the intracellular concentration of Zn2+ in the oocyte. The methods of the invention may additionally comprise a preceding step of increasing the intracellular concentration of Ca2+ in the oocyte prior to reduction of the intracellular Zn2+ concentration. The invention further provides unfertilized oocytes activated by the disclosed methods and viable mammalian animals produced from unfertilized oocytes activated by the disclosed methods.
    Type: Application
    Filed: November 26, 2014
    Publication date: May 28, 2015
    Applicant: The Curators of The University of Missouri
    Inventors: Kiho Lee, Randall S. Prather
  • Patent number: 9040771
    Abstract: Provided herein are mitochondrial-nuclear exchanged cells and animals comprising mitochondrial DNA (mtDNA) from one subject and nuclear DNA (nDNA) from a different subject. Methods for producing a mitochondrial-nuclear exchanged animal and animals made by the methods are provided. Also provided are methods of screening for agents useful for treating a disease or disorder using mitochondrial-nuclear exchanged animals or cells, tissues or organs thereof.
    Type: Grant
    Filed: January 27, 2012
    Date of Patent: May 26, 2015
    Assignee: The UAB Research Foundation
    Inventors: Scott Webster Ballinger, Danny R. Welch, Robert Allen Kesterson, Larry W. Johnson
  • Publication number: 20150128300
    Abstract: The disclosure provides methods and compositions for generating conditional knock-out alleles using donor constructs together with sequence-specific nucleases to generate conditional knock-out alleles. Specifically, the donor construct comprises a 5? homology region, a 5? recombinase recognition site, a donor sequence, a 3? recombinase recognition site, and a 3? homology region. Further disclosed are the donor sequences each comprises a target sequence having at least one neutral mutation. Different sequence-specific nucleases can be used with the donor constructs are further disclosed.
    Type: Application
    Filed: June 12, 2013
    Publication date: May 7, 2015
    Inventors: Soren Warming, Keith R. Anderson
  • Publication number: 20150113668
    Abstract: The invention relates to polynucleotides, particularly chimeric polynucleotides useful for optimal production of functional immunoglobulins with human idiotypes in rodents. The invention further relates to rodents comprising such polynucleotides.
    Type: Application
    Filed: October 17, 2014
    Publication date: April 23, 2015
    Inventors: Marianne BRUGGEMANN, Roland BUELOW, Michael J. OSBORN, Biao MA
  • Publication number: 20150096066
    Abstract: The invention provides systems to control gene expression or activity using target molecules.
    Type: Application
    Filed: September 29, 2014
    Publication date: April 2, 2015
    Inventors: Chung Yiu Jonathan Tang, Constance L. Cepko
  • Publication number: 20150082466
    Abstract: The present invention relates to humanisation of antibodies in vivo. The invention provides non-human vertebrates, cells, populations and methods useful for humanising chimaeric antibodies in vivo. Using the present invention it is possible straightforwardly and rapidly to obtain antigen-specific antibodies that are fully human (ie, comprising human variable and constant regions) and have undergone recombination, junctional diversification, affinity maturation and isotype switching in vivo in a non-human vertebrate system. Furthermore, such antibodies are humanised (eg, totally human)—and selected—totally in vivo, and as such the present invention harnesses in vivo filtering for expressibility, affinity and biophysical characteristics in the context of the desired human variable and constant region pairings. This is avoids problems of down-grading antibody characteristics when humanising the constant region of chimaeric antibodies in vitro.
    Type: Application
    Filed: September 26, 2014
    Publication date: March 19, 2015
    Inventor: Jasper Clube
  • Publication number: 20150082469
    Abstract: Genetically modified non-human animals comprising a human or humanized interleukin-7 (IL-7) gene. Cells, embryos, and non-human animals comprising a human or humanized IL-7 gene. Rodents that express human or humanized IL-7 protein. Genetically modified mice that comprise a human or humanized IL-7-encoding gene in their germline, wherein the human or humanized IL-7-encoding gene is under control of endogenous mouse IL-7 regulatory sequences.
    Type: Application
    Filed: November 24, 2014
    Publication date: March 19, 2015
    Applicant: Regeneron Pharmaceuticals, Inc.
    Inventor: Andrew J. Murphy
  • Publication number: 20150082470
    Abstract: Methods and compositions are provided for translational profiling and molecular phenotyping of specific tissues, cells and cell subtypes of interest. The methods provided herein facilitate the analysis of gene expression in the selected subset present within a heterogeneous sample.
    Type: Application
    Filed: November 25, 2014
    Publication date: March 19, 2015
    Inventors: Nathaniel HEINTZ, Paul GREENGARD, Myriam HEIMAN, Anne SCHAEFER, Joseph P. DOYLE, Joseph D. DOUGHERTY
  • Publication number: 20150052626
    Abstract: The invention provides cells or populations of cells, including non-human animals or non-human mammals having these cells, where the cells or populations of cells are stably tagged, uniquely identified and genetically barcoded by one or more detectable, e.g., fluorescent, proteins; and methods of making and using them. In alternative embodiments, the invention provides methods for tagging, uniquely identifying or genetically barcoding a cell, a population of cells, or a culture of cells by stably transferring, transfecting, transducing, infecting or implanting one or more nucleic acids encoding readable or detectable, e.g., fluorescent, moieties into the cells. In alternative embodiments, the nucleic acids are stably inserted into the cells such that the readable or detectable, e.g., fluorescent, genetic barcoding becomes a stable, heritable characteristic of the cell.
    Type: Application
    Filed: August 18, 2014
    Publication date: February 19, 2015
    Inventor: Roland WOLKOWICZ
  • Publication number: 20150040252
    Abstract: The invention relates to isolation of novel ?-actin and ribosomal protein S21 (rpS21) promoters and uses thereof. In particular, this invention features nucleotide sequences for rodent ?-actin promoters including, hamster, rat, and mouse, and hamster rpS21 promoter.
    Type: Application
    Filed: August 1, 2014
    Publication date: February 5, 2015
    Applicant: GENZYME CORPORATION
    Inventors: Scott D. ESTES, Weiqun ZHANG