Patents Assigned to Consiglio Nazionale Delle Ricerche
-
Publication number: 20140093731Abstract: The invention relates to a conductive fiber material comprising a base fiber material (1) including a textile fiber, a plurality of nanoparticles (20) deposited on an external surface (10) of said base fiber material, said nanoparticles including one or more metals or metal oxides and a conductive polymer layer deposited on said external surface including nanoparticles.Type: ApplicationFiled: March 6, 2012Publication date: April 3, 2014Applicants: ALMA MATER STUDIORUM - UNIVERSITA` DI BOLOGNA, CNR - CONSIGLIO NAZIONALE DELLE RICERCHEInventors: Annalisa Bonfiglio, Beatrice Fraboni, Giorgio Mattana
-
Publication number: 20140066836Abstract: Electroporation devices are provided which include a forceps-type member carrying first and second electrodes and a grip member carrying a third electrode. The third electrode is independently movable with respect to the first and second electrodes in order to vary the spatial configuration of the electrical field generated by the device and thus enable an improved range of action and efficacy. Methods for carrying out electroporation with such devices are also provided.Type: ApplicationFiled: May 10, 2012Publication date: March 6, 2014Applicants: Consiglio Nazionale delle Ricerche, Fondazione Istituto Italiano di TecnologiaInventors: Laura Cancedda, Gian Michele Ratto
-
Publication number: 20140038884Abstract: The present invention relates to selected proline-rich peptides of salivary derivation with a strong antiviral activity and also an anti-reservoir activity with respect to the HIV virus, said peptides as medicaments for the treatment, prevention and eradication of HIV on human beings, pharmaceutical compositions comprising at least one of said peptides, pharmaceutical kits comprising at least one of said peptides and therapeutic methods for the treatment, prevention and eradication of HIV on human beings.Type: ApplicationFiled: January 30, 2012Publication date: February 6, 2014Applicants: UNIVERSITA 'DEGLI STUDI DI CAGLIARI, UNVERSITA' CATTOLICA DEL SACRO CUORE, CONSIGLIO NAZIONALE DELLE RICERCHE, UNVERSITA' DEGLI STUDI DI MILANOInventors: Tiziana Cabras, Claudio Casoli, Massimo Castagnola, Rosanna Inzitari, Renato Longhi, Irene Messana, Paola Ronzi, Alberto Vitali
-
Publication number: 20140009937Abstract: The present invention relates to a lighting device (1) that comprises a first light source (2) comprising one or more LED devices (21). At least a deformable reflective element (3) is optically coupled to said first light source, so as to receive light from said first light source, said reflective structure comprising at least a first portion (31) having a reflective surface (310) that reflects at least partially the light (L1) received from said first light source, and a second portion (32) that is solidly coupled to said first portion. Driving means (4) are operatively coupled to said second portion (32), which induce a deformation of said second portion that in turn causes a deformation of the reflective surface (310) of said first portion. The position of the focus point (F) of the light (L2) reflected by said reflective surface can thus be varied in a controlled manner.Type: ApplicationFiled: March 22, 2012Publication date: January 9, 2014Applicants: SOLVAY SPECIALITY POLMERS ITALY S.P.A., CONSIGLIO NAZIONALE DELLE RICERCHE, UNIVERSITA DEGLI STUDI DI PADOVAInventors: Stefano Bonora, Enrico Zanoni, Matteo Meneghini, Giovanna Brusatin, Alessio Marrani, Mattia Bassi, Ivan Falco
-
Publication number: 20130333749Abstract: Thermionic solar converter with a linear arrangement of the components, suitable for the direct conversion of solar energy into electrical energy and the combined generation of heat and energy, in the form of an elongated transparent vacuum tube comprising: a cathode (5) and at least one anode (6), said cathode and anode being arranged longitudinally alongside each other along the tube: grid electrodes (10, 11, 13, 14, 15, 16) for generating electric fields; means (18) for directly cooling the at least one anode; means (7) for electrically connecting the electrodes from the inside to the outside; an optical access window (4) along the surface area of the tube; wherein: the cathode is made of conductive refractory material, is suspended centrally inside the tube with an elongated form and forms the element for capturing the solar energy, on which the sunlight is directly focused in order to perform the thermionic conversion, without any intermediate heat transfer means; the electrical connection means form a lType: ApplicationFiled: February 24, 2012Publication date: December 19, 2013Applicant: CONSIGLIO NAZIONALE DELLE RICERCHEInventor: Massimo Adriani
-
Publication number: 20130329228Abstract: A phase-locked delay device, including: an input port configured to receive an input electromagnetic radiation pulse; said input pulse being to be propagated along a propagation direction and having a first linear polarization different from both a first direction, which is orthogonal to the propagation direction, and a second direction, which is orthogonal to the first direction and the propagation direction; an adjustable Babinet-Soleil module optically coupled to said input port, having a first polarization direction parallel to said first direction. The adjustable Babinet-Soleil module is structured to: provide from the input pulse a first pulse polarized along the first direction and a second pulse collinear to said first pulse and polarized along the second direction, and introduce an adjustable group delay between the first pulse and the second pulse ranging from a minim value ?Tm and a maximum value ?TM; the maximum value ?TM being a value greater than 10 fs.Type: ApplicationFiled: June 7, 2012Publication date: December 12, 2013Applicants: CONSIGLIO NAZIONALE DELLE RICERCHE, POLITECNICO DI MILANOInventors: Cristian Angelo MANZONI, Daniele BRIDA, Giulio Nicola Felice CERULLO
-
Patent number: 8601958Abstract: The invention relates to a plant and a process for the looping-type combustion of solid carbon-containing fuels with a carbon dioxide (CO2) flow output. Said process carries out the conversion of carbon without the help of solid carriers of the MyOx type, or of sulphate/sulphide type, and comprises the steps of: (i) Oxidation, wherein the carbon-containing solids are contacted with a gaseous flow comprising oxygen, for a time period and at a temperature sufficient to allow formation of a surface oxidized complex; (ii) Desorption, wherein the surface oxidized complexes generated by adsorption of oxygen in item (i) are released in a gaseous form by decomposition in the absence of O2.Type: GrantFiled: September 8, 2009Date of Patent: December 10, 2013Assignee: Consiglio Nazionale delle RicercheInventors: Piero Salatino, Osvalda Seneca
-
Patent number: 8552398Abstract: An apparatus for spin polarizing a particle beam is adapted to process an input particle beam in such a way as to generate an at least partially spin polarized output particle beam. A vortex beam generator for imparting orbital angular momentum to the input particle beam. An electromagnetic field generator generates a transverse magnetic field, space-variant and symmetric with respect to the axis of the input particle beam, in such a way as to change the spin of the particles and attach thereto different values of orbital angular momentum in dependence on their input spin values. A beam component separating group spatially separates the particles in dependence on their orbital angular momentum values, in such a way as to obtain the at least partially spin polarized output particle beam.Type: GrantFiled: December 14, 2012Date of Patent: October 8, 2013Assignee: Consiglio Nazionale Delle RicercheInventors: Vincenzo Grillo, Lorenzo Marrucci, Ebrahim Karimi, Enrico Santamato
-
Patent number: 8535680Abstract: The present invention falls within the field of molecular biology, and in particular it refers to peptides, polypeptides, protein molecules, uses, methods, processes, systems and compositions for minimizing the presence of molecules in a material and/or interfering with effects associated to such molecules. In particular, the present invention can appear in the form of anti-septic shock pharmacological composition and systems of purification from bacterial endotoxins.Type: GrantFiled: March 19, 2009Date of Patent: September 17, 2013Assignee: Consiglio Nazionale Delle RicercheInventors: Paolo Colombo, Angela Bonura, Francesco Di Blasi
-
Publication number: 20130217634Abstract: The present disclosure concerns peptides able to interfere and in particular impair the inhibiting activity of MDM2/MDM4 heterodimer towards p53 and maintain the association between MDM4 and p53 so to restore the p53 oncosuppressive function in cancer cells harboring wild type p53 protein, directing its function specifically towards an apoptotic outcome.Type: ApplicationFiled: February 21, 2013Publication date: August 22, 2013Applicants: UNIVERSITA' DEGLI STUDI DI PERUGIA, CONSIGLIO NAZIONALE DELLE RICERCHEInventors: CONSIGLIO NAZIONALE DELLE RICERCHE, UNIVERSITA' DEGLI STUDI DI PERUGIA
-
Publication number: 20130210042Abstract: The present invention relates to a method for the diagnosis and/or prognosis of tauopathies, in particular Alzeimer's disease. The method is based on the detection and quantification of a 20-22 kDa NH2-tau fragment.Type: ApplicationFiled: June 3, 2011Publication date: August 15, 2013Applicant: CONSIGLIO NAZIONALE DELLE RICERCHEInventors: Giuseppina Amadoro, Pietro Calissano, Veronica Corsetti
-
Publication number: 20130203685Abstract: Peptides having the ability to block the activity of acyl-aminoacid releasing enzymes such as AARE or APEH are disclosed. Derivatives of the peptides include oligomers or multimers of the peptide linked to a common scaffold moiety such as a tri-functional amino acid and peptides linked to PEG and fatty acids. Pharmaceutical compositions that include the peptide are also disclosed and can be used to treat various diseases such as cardiovascular diseases, cancer, inflammation, hematological diseases, neurological diseases and urological diseases.Type: ApplicationFiled: February 27, 2013Publication date: August 8, 2013Applicant: CONSIGLIO NAZIONALE DELLE RICERCHEInventor: Consiglio Nazionale delle Ricerche
-
Publication number: 20130197070Abstract: The present invention concerns a nucleotide aptamer having the sequence: 5?-AUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCAC-3?(SEQ ID NO: 1) for use in the treatment and/or prevention and/or diagnosis of an Axl receptor tyrosine kinase induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of an Axl receptor tyrosine kinase induced disorder in a patient from which a sample is obtained and related diagnostic kit.Type: ApplicationFiled: October 10, 2011Publication date: August 1, 2013Applicant: CNR - CONSIGLIO NAZIONALE DELLE RICERCHEInventors: Vittorio De Franciscis, Laura Cerchia
-
Publication number: 20130190592Abstract: Methods and systems are provided for determining the volume of epicardial fat of a heart, which include acquiring a plurality of volumetric image data representing the heart; morphologically characterizing a volume of interest represented by the volumetric image data, including identifying a predetermined number of reference contours of the heart; estimating the epicardial surface, ?, according to a three-dimensional series expansion of vector spherical harmonic functions based on the reference contours; and determining the volume of epicardial fat based on the voxels which are located inside the estimated epicardial surface, ?, and which have a grey level within a predetermined range, characteristic of fatty tissue.Type: ApplicationFiled: January 16, 2013Publication date: July 25, 2013Applicant: CONSIGLIO NAZIONALE DELLE RICERCHEInventor: CONSIGLIO NAZIONALE DELLE RICERCHE
-
Publication number: 20130177556Abstract: The present invention concerns a nucleotide aptamer having the sequence 5? GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC3? (SEQ ID No. 1) for use in the treatment and/or prevention and/or diagnosis of an EGFR induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of a EGFR induced disorder in a patient from which a sample is obtained and relative diagnostic kit.Type: ApplicationFiled: October 10, 2011Publication date: July 11, 2013Applicant: CNR - CONSIGLIO NAZIONALE DELLE RICERCHEInventors: Vittorio De Franciscis, Laura Cerchia
-
Publication number: 20130170709Abstract: The present invention relates to a visual inspection system and method for the maintenance of infrastructures, in particular railway infrastructures. It is a system able to operate in real time, wholly automatically, for the automatic detection of the presence/absence of characterizing members of the infrastructure itself, for example the coupling locks fastening the rails to the sleepers.Type: ApplicationFiled: August 1, 2012Publication date: July 4, 2013Applicant: CONSIGLIO NAZIONALE DELLE RICERCHEInventors: Arcangelo DISTANTE, Francescomaria MARINO, Pier Luigi MAZZEO, Nassimiliano NITTI, Ettore STELLA
-
Publication number: 20130168577Abstract: An apparatus for spin polarizing a particle beam is adapted to process an input particle beam in such a way as to generate an at least partially spin polarized output particle beam. A vortex beam generator for imparting orbital angular momentum to the input particle beam. An electromagnetic field generator generates a transverse magnetic field, space-variant and symmetric with respect to the axis of the input particle beam, in such a way as to change the spin of the particles and attach thereto different values of orbital angular momentum in dependence on their input spin values. A beam component separating group spatially separates the particles in dependence on their orbital angular momentum values, in such a way as to obtain the at least partially spin polarized output particle beam.Type: ApplicationFiled: December 14, 2012Publication date: July 4, 2013Applicant: CONSIGLIO NAZIONALE DELLE RICERCHEInventor: CONSIGLIO NAZIONALE DELLE RICERCHE
-
Publication number: 20130163942Abstract: A waveguide is provided on which an electromagnetic wave impinges, the electromagnetic wave having a wavelength ? included in a given interval ?? of interest centered on a ?centr. The waveguide comprises a film defining a surface on a plane on which the electromagnetic waves are apt to impinge, having a thickness in a direction substantially perpendicular to the surface, the film being realized in a material having a first refractive index; a plurality of scatterers being randomly distributed in two directions in at least a portion of the surface of the film, the scatterers having a substantially constant cross section along said substantially perpendicular direction. The scatterers are realized in a material having a second refractive index lower than the first refractive index, wherein the wavelength of the incident electromagnetic waves is comprised between 0.Type: ApplicationFiled: September 2, 2010Publication date: June 27, 2013Applicant: CNR - CONSIGLIO NAZIONALE DELLE RICERCHEInventors: Diederik Sybolt Wiersma, Francesco Riboli, Kevin Vynck, Matteo Burresi
-
Publication number: 20130144286Abstract: A microwave surgical device with high energy efficiency produces, at an antenna, an asymmetric heating pattern directed towards the side and it comprises: a plain curved portion extending from the distal end of said external conductor; and an inflection point at said distal end of the external conductor, so that said curved portion has a single cavity directed towards the axis of the coaxial end part.Type: ApplicationFiled: May 16, 2011Publication date: June 6, 2013Applicant: CONSIGLIO NAZIONALE DELLE RICERCHEInventor: Iginio Longo
-
Publication number: 20130129634Abstract: The present invention relates to hydroxyapatite doped with Fe2+ ions and Fe3+ ions which partially substitute the calcium ions in the crystal lattice. The hydroxyapatite is characterized by an intrinsic magnetism of 0.05 to 8 emu/g, measured by applying a magnetic field of 34 Oe, due to the presence of magnetic nano-domains in the crystal lattice of HA, given the limited amount of magnetic secondary phases present, less than about 3% by volume. The intrinsically magnetic hydroxyapatite can be loaded with biological substances selected in the group consisting of proteins, genes, stem cells, growth factors, vascularization factors, active substances and drugs, under the control of an external magnetic field, as a carrier and release agent for biological substances or drugs, as a contrast agent in diagnostics or for bone or osteocartilage regeneration.Type: ApplicationFiled: July 28, 2011Publication date: May 23, 2013Applicants: CONSIGLIO NAZIONALE DELLE RICERCHE, UNIVERSIDADE DE SANTIAGO DE COMPOSTELA, FIN-CERAMICA FAENZA S.P.A.Inventors: Anna Tampieri, Elena Landi, Monica Sandri, Daniele Pressato, José Rivas Rey, Manuel Banobre Lopez, Maurilio Marcacci