Abstract: The present invention relates to the use of R—OH alcohols as phagodeterrents, and to a method for treating plants infested with aphids which comprises the administration of these R—OH alcohols.

Abstract: Production and the distribution of pico and nano-drops, which are extracted by the effect of a strong electric field generated by pyroelectric effect, in particular, but not exclusively, from a sessile drop (a drop placed on a surface assumes a form termed “sessile”) or by a liquid film, and distributed on a dielectric substrate. The electric field is advantageously generated applying a heat source on the dielectric substrate or utilizing a laser source emitting in the infrared region. In this new approach, it is not necessary to use fixed electrodes, circuits, high tension generators or to design intentionally, and therefore to realize, pico- and nano-nozzles.

Abstract: The present invention relates to the use of sensitising dyes of natural origin in photoelectrochemical solar cells and to the process for obtaining such vegetal extracts from fruits and vegetables.

Abstract: The present invention relates to a method and an apparatus to perform frequency comb spectroscopy.

Abstract: A phase-locked delay device, including: an input port configured to receive an input electromagnetic radiation pulse; said input pulse being to be propagated along a propagation direction and having a first linear polarization different from both a first direction, which is orthogonal to the propagation direction, and a second direction, which is orthogonal to the first direction and the propagation direction; an adjustable Babinet-Soleil module optically coupled to said input port, having a first polarization direction parallel to said first direction. The adjustable Babinet-Soleil module is structured to: provide from the input pulse a first pulse polarized along the first direction and a second pulse collinear to said first pulse and polarized along the second direction, and introduce an adjustable group delay between the first pulse and the second pulse ranging from a minim value ?Tm and a maximum value ?TM; the maximum value ?TM being a value greater than 10 fs.

Abstract: A liquid crystal elastomer actuator to move in a fluid is described herein. The actuator includes a body with dimensions between 100 nm and 800 ?m having a low Reynolds number. The body includes a first and a second spatially separated volume, each comprising a liquid crystal elastomer. The first volume is doped with a first photoactive doping substance to absorb electromagnetic radiation at a first wavelength and the second volume is doped with a second photoactive doping substance to absorb electromagnetic radiation at a second wavelength. The first and second volumes change shape as a consequence of light absorption at the first or second wavelength, defining a first and a second joint. A first absorbance of the first volume at a given wavelength is different than a second absorbance of the second volume at a given wavelength, the first and second absorbance are measured in the same time interval.

Abstract: The present invention relates to the use of a bacterium having an high indole-3-acetic acid (IAA) content for solubilizing phosphate rock (PR) in the ground, wherein said bacterium is obtained by transformation with a gene encoding an agent able to increase the IAA content.

Abstract: An absorption spectroscopy instrument with a light source for providing a beam of light, a modulator to produce a modulated beam of light, a high finesse optical cavity, means for injecting the modulated beam of light off-axis into the high finesse optical cavity and a detector positioned to receive and measure light exiting through said optical cavity. The detector may be a highly sensitive and high bandwidth detector. The modulator may be a one or two-tone modulator having means, such as a plurality of RF synthesizers, for modulating the light source by one or two tones. If one tone of applied modulation is used, the frequency is larger than the absorption bandwidth of the target chemical. In the case where two tones are used, the first frequency is larger than the absorption bandwidth of the target chemical and the second frequency is small relative to the first frequency.

Abstract: The present invention concerns a nucleotide aptamer having the sequence 5? GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC3? (SEQ ID No. 1) for use in the treatment and/or prevention and/or diagnosis of an EGFR induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of a EGFR induced disorder in a patient from which a sample is obtained and relative diagnostic kit.

Abstract: The invention relates to filtering systems comprising filters consisting of fibers of silanized siliceous material for environmental sampling, in particular of pollutants.

Abstract: The method for preventing and delaying inherited retinal degenerations using serine palmitoyltransferase inhibitors, and compositions which contain them.

Abstract: Thermionic converter with a linear arrangement of the components, suitable for the direct conversion of solar energy into electrical energy and the combined generation of heat and energy, including an elongated vacuum tube which houses a cathode and at least one anode, the cathode and the at least one anode being arranged longitudinally alongside each other along the vacuum tube, wherein the cathode is suspended centrally inside the vacuum tube at at least one end which forms a corresponding current output of the cathode, wherein the cathode is a cathode in the form of a spiral.

Abstract: The present invention relates in general terms to a variously substituted 1,2,4-oxadiazol derivative, a process for their preparation, and use thereof as an intermediate in the preparation of indolic alkaloids, including phidianidine B and A.

Abstract: Method for fabricating a structure comprising a monatomic layer of crystalline silicon upon an electrically insulating layer of crystalline silicon nitride in the ? structural form, comprising the following steps: A. providing a standalone Si (111) substrate, said substrate comprising a first face and a second main face; B. thermally treating the substrate so that the Si (111) surface is clean, i.e. non contaminated at an atomic level; C. thermally growing a crystalline silicon nitride layer in the 13 structural form on at least one face of said Si (111) substrate; D. thermally growing a crystalline silicon monatomic layer on the crystalline silicon nitride layer.

Abstract: A UV lamp includes a UV lamp unit including a tubular bulb and an antenna inserted in the tubular bulb, and an antenna lead for supplying microwave energy from a microwave energy source to the UV lamp unit. The antenna lead includes a bent portion, one end of which is connected to the antenna and the other end is connectable to the microwave energy source.

Abstract: It is disclosed a system for reconstructing an image of an object hidden by a flame. The system comprises a laser source emitting an infrared radiation and a lensless, off-axis interferometric arrangement that divides the infrared radiation into an object beam and a reference beam. The object beam is enlarged and then irradiates the object, that scatters it. The reference beam is enlarged and then interferes with the scattered object beam, so as to create a hologram. The system comprises an infrared detector which detects the hologram and a processing unit which reconstructs the image of the object by numerically processing the hologram. The system therefore provides the object image based on digital holography at infrared wavelengths. Differently from known thermographic acquisition techniques, even if large portions of the object are hidden by the flame, the system allows to reconstruct an image of the whole object, with no blind areas.

Abstract: A method of generating 2D or 3D maps of MRI T1 and T2 relaxation times by acquiring 2D or 3D MRI gradient-echo images and extracting the T1 and T2 values from the images, wherein MRI images are acquired using a combination of gradient-echo sequences, including a first MRI image acquired using a SSFP-FID (Steady State Free Precession-Free Induction Decay) acquisition sequence; two further images acquired using a Dual-Echo SSFP acquisition sequence; and the T1 and T2 values are extracted for each image pixel or voxel from the corresponding MRI signals.

Abstract: A logic gate (1) comprising a spintronic memristor device (2), which has two spin-polarized magnetic electrodes (3, 4) for injecting and/or receiving a spin-polarized current and a layer of material (5) interposed between the two electrodes (3, 4) for transporting the spin-polarized current from one electrode to the other. The layer of material (5) is composed of a layer of organic semiconductor that is able to endow the spintronic memristor device (2) with at least two non-volatile electrical resistance states (RH, RL), each of which can be selected by applying a voltage to the electrodes (3, 4) that reaches or exceeds a respective voltage threshold (VT1, VT2) and, in at least a first resistance state (RH) of which, the spintronic memristor device (2) does not present a magnetoresistive effect.

Abstract: Lighting devices are provided including those which have an array of spatially distributed optoelectronic sources, each source being adapted to emit a respective incident optical beam; a first reflector having an optical axis, and having a first reflective surface that is concave and facing the array of sources to intercept said incident optical beams and to produce corresponding reflected optical beams; a second reflector having a second reflective surface interposed along said optical axis between said array of optoelectronic sources and the first reflector adapted to intercept and deflect said reflected optical beams producing corresponding deflected optical beams, the first reflector being adapted to concentrate the reflected optical beams on the second reflective surface.

Abstract: The present invention relates to a method for the diagnostic and/or prognostic of a neurological disease characterized by an inflammation process in a subject comprising measuring the amount of myeloid derived microvesicles in a cerebrospinal fluid sample obtained from the subject. The invention further relates to a method for predicting and/or monitoring the efficacy of a treatment for a neurological pathology or for monitoring a neurological disease progression.