Abstract: The in-loop filtering method performed by a video decoding apparatus includes: classifying reconstructed samples according to an absolute classification standard or relative classification standard; acquiring offset data on the basis of results of classifying the reconstructed samples; adding an offset value to the reconstructed samples by referencing the acquired offset data; and outputting the offset value-added reconstructed samples. Accordingly, W errors in the reconstructed image can be corrected.
Type:
Grant
Filed:
December 8, 2022
Date of Patent:
May 21, 2024
Assignee:
Industry-University Cooperation Foundation Hanyang University
Abstract: A system and method for authoring and implementing context-aware applications (CAPs) are disclosed. The system and method enables users to record their daily activities and then build and deploy customized CAPs onto augmented reality platforms in which automated actions are performed in response to user-defined human actions. The system and method utilizes an integrated augmented reality platform composed of multiple camera systems, which allows for non-intrusive recording of end-users' activities and context detection while authoring and implementing CAPs. The system and method provides an augmented reality authoring interface for browsing, selecting, and editing recorded activities, and creating flexible CAPs through spatial interaction and visual programming.
Abstract: The present invention relates to a metabolome sampling and analysis method for analyzing metabolome during synthetic gas fermentation of a synthetic gas fermentation microorganisms, the method establishing an optimal condition for metabolome sampling and enabling a glucose culture and a synthetic gas culture of the synthetic gas fermentation microorganisms to be distinguished by using a selected metabolomic biomarker.
Type:
Grant
Filed:
February 21, 2019
Date of Patent:
May 21, 2024
Assignees:
Korea University Research and Business Foundation, Korea Institute of Science and Technology
Inventors:
Kyoung Heon Kim, Young Soon Um, Jung Yeon Kim, Joongsuk Kim
Abstract: Provided herein are systems and methods for an iterative approach to topic modeling and the use of web mapping technology to implement advanced spatial operators for interactive high-dimensional visualization and inference.
Type:
Grant
Filed:
October 10, 2015
Date of Patent:
May 21, 2024
Assignee:
San Diego State University Research Foundation
Abstract: The present disclosure features compositions and methods related to the detection and molecular profiling of extracellular vesicles using fluorescent probes. These compositions and methods leverage the unique optoelectrical properties of quantum dots and fluorescently labeled nanoparticles, which allows reliable, real-time detection of extracellular vesicles and vesicle surface bound or lumenal molecules.
Type:
Grant
Filed:
December 18, 2019
Date of Patent:
May 21, 2024
Assignee:
The University of Memphis Research Foundation
Abstract: Disclosed are small molecule PTPRD inhibitors and uses thereof. Methods of using the PTPRD inhibitors include methods of treating, preventing, or delaying the progression of a disorder responsive to PTPRD inhibition, including for example nicotine dependence, addiction, obesity, metabolic syndrome, and substance-use disorders such as stimulant-use disorders and opioid-use disorders.
Type:
Grant
Filed:
May 2, 2022
Date of Patent:
May 21, 2024
Assignees:
Arizona Board of Regents on Behalf of the University of Arizona, The United States Government as respresented by the Department of Veterans Affairs, The University of Kentucky Research Foundation
Inventors:
George Richard Uhl, Ian M. Henderson, Wei Wang, Thomas Prisinzano
Abstract: A low temperature sinterable copper nanoparticle or nanowire, comprising gold, zinc, nickel, tin, or aluminum as an alloying metal, and a capping agent. The nanoparticles or nanowires may be deposited on porous or fibrous substrates, the capping agent desorbed, and sintered at low temperature to form conductive traces or sensing elements. The nanoparticles or nanowires may be deposited by aerosol jet, inkjet or dispenser printers, for example.
Type:
Grant
Filed:
July 9, 2021
Date of Patent:
May 21, 2024
Assignee:
The Research Foundation for The State University of New York
Inventors:
Chuan-Jian Zhong, Shan Yan, Shiyao Shan, Ning He, Ning Kang, Jin Luo
Abstract: Methods of treating or reducing risk of aneurysm, reducing cardiovascular risk, reducing serum cholesterol, reducing serum triglycerides, and/or reducing atherosclerotic plague in a subject involve administering to the subject an effective amount of a 5HT3R antagonist.
Type:
Grant
Filed:
May 2, 2022
Date of Patent:
May 21, 2024
Assignee:
University of Kentucky Research Foundation
Inventors:
Lisa Cassis, Sean Thatcher, Yasir Alsiraj, Mark Ensor, Eric Blalock
Abstract: A device for diagnosing a turn-short fault of an induction motor, the device including an induction motor; and a fault detecting unit to detect a current flowing in a supply line that supplies power to an input terminal of the induction motor and diagnose whether the induction motor has a fault, in which the fault detecting unit diagnoses whether the induction motor has the fault by applying a dynamic model. A method thereof is also disclosed.
Type:
Grant
Filed:
November 29, 2021
Date of Patent:
May 21, 2024
Assignee:
Kyungpook National University Industry-Academic Cooperation Foundation
Abstract: A composition for the treatment of bladder fibrosis in a patient in need that includes a miR-29 mimic is disclosed. The miR-29 mimic may include a working RNA strand with the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO 4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO 5). The passenger RNA strand includes a 2?-O-methylation modification to increase stability. Cholesterol is conjugated to the 3?-end of the passenger RNA strand to enhance cellular uptake. The composition may further include a carrier molecule including, but not limited to, branched polyethylenimine at an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands. In some aspects, the composition may be an injectable composition that includes a polyplex dissolved in a 0.5% glucose solution, where the polyplex is formed from the working and passenger RNA strands and the carrier molecule.
Type:
Grant
Filed:
May 3, 2021
Date of Patent:
May 21, 2024
Assignees:
Washington University, Wisconsin Alumni Research Foundation
Inventors:
Jianghui Hou, Dale Bjorling, Zunyi Wang
Abstract: The present invention relates to a wearable device using a flexible non-powered variable impedance mechanism, wherein the device can induce a user to have a correct posture during a squat exercise or lifting work, and can assist the user's muscular strength. According to the present invention, an angle between a (1-1)th lower string and a (1-2)th lower string and an angle between a (24)th lower string and a (2-2)th lower string change according to a knee angle depending on the user's posture, whereby an impedance mechanism that the user feels through the body changes.
Type:
Grant
Filed:
October 30, 2019
Date of Patent:
May 21, 2024
Assignee:
Seoul National University R&DB Foundation
Abstract: An electrical rotating machine provides an integrated capacitive encoder for control of the stator field and enabling any of reduced size, reduced rotational inertia, and lower cost. The same structure may also support capacitive plates for capacitive power transfer to the rotor.
Abstract: A device for storage and transport of biological samples. Multiple trays are assembled into a stack with sample tubes constrained between adjacent trays. The surface of each tray has radial grooves sized to hold the sample tubes. Each tray is secured to an adjacent tray with a bolt or snap-fit connector.
Type:
Grant
Filed:
January 27, 2021
Date of Patent:
May 21, 2024
Assignee:
Research Foundation of the City University of New York
Abstract: This application relates to a composition for diagnosis of leptospirosis and a method for diagnosis of leptospirosis by real-time PCR. For example, the application relates to a pair of primers of SEQ ID NOS: 1 and 2 and a probe of SEQ ID NO: 3, a kit for diagnosis of leptospirosis, comprising the diagnostic composition, and a method for providing information for diagnosis of leptospirosis are provided. The composition and the method can specifically detect L. interrogans IS 1500 gene and exhibit excellent accuracy and sensitivity, compared to conventional well-known detection methods. Thus, the simple method through real-time PCR using the composition allows the quick and accurate diagnosis of leptospirosis.
Type:
Grant
Filed:
November 15, 2021
Date of Patent:
May 21, 2024
Assignee:
Industry-Academic Cooperation Foundation, Chosun University
Inventors:
Dong Min Kim, You Mi Lee, Choon Mee Kim
Abstract: Provided are isolated TCRs, TCR-like molecules, and portions thereof that bind to phosphopeptide-HLA-A2 complexes. The isolated TCRs, TCR-like molecules, or portions are optionally soluble TCRs, TCR-like molecules, or portions. Also provided are isolated nucleic acids encoding the disclosed TCRs, TCR-like molecules, or portions; host cells that contain the disclosed TCRs, TCR-like molecules, or portions; pharmaceutical compositions that include the disclosed TCRs, TCR-like molecules, portions, nucleic acids, and/or T cells; kits; and methods of using the same.
Type:
Grant
Filed:
May 18, 2020
Date of Patent:
May 21, 2024
Assignee:
University of Virginia Patent Foundation
Inventors:
Angela L. Ambakhutwala, Victor H. Engelhard, Kara L. Cummings, Rebecca C. Obeng
Abstract: A power management apparatus, includes an artificial intelligence (AI) controller configured to monitor a user pattern, based on frequency band selection information of all users using a base station, to predict the user pattern, and a DC-DC converter configured to output a supply voltage based on the predicted user pattern.
Type:
Grant
Filed:
October 22, 2021
Date of Patent:
May 21, 2024
Assignees:
SKAICHIPS CO., LTD., Research & Business Foundation Sungkyunkwan University
Inventors:
Kang Yoon Lee, Jong Wan Jo, Young Gun Pu, Dong Soo Park, Joon Hong Park, Jae Bin Kim, Yun Gwan Kim
Abstract: Methods of treating acute heart failure in a patient in need thereof. Methods include inserting a therapy delivery device into a pulmonary artery of the patient and applying a therapy signal to autonomic cardiopulmonary fibers surrounding the pulmonary artery. The therapy signal affects heart contractility more than heart rate. Specifically, the application of the therapy signal increases heart contractility and treats the acute heart failure in the patient. The therapy signal can include electrical or chemical modulation.
Type:
Grant
Filed:
February 1, 2021
Date of Patent:
May 21, 2024
Assignee:
The Cleveland Clinic Foundation
Inventors:
Sandra Machado, Marc Penn, Ali R. Rezai
Abstract: Human pluripotent stem cells (hPSCs) are promising cell source to produce therapeutic endocrine cells for diabetes treatment. A gel solution made by decellularized tissue-specific extracellular matrix (dpECM) significantly promotes three-dimensional (3D) islet-like organogenesis during induced hPSC differentiation into endocrine lineages. Islet organoids are self-organized even in a two-dimensional (2D) culture mode. Cells derived from hPSCs differentiated on such ECM coated substrates exhibit similar cellular composition to native pancreatic islets. These cells express islet signature markers insulin, PDX-1, C-peptide, MafA, glucagon, somatostatin, and pancreatic polypeptide, and secrete more insulin in response to glucose level compared to a traditional matrix substrate (Matrigel). The dpECM facilitates generating more C-peptide+/glucagon? cells rather than C-peptide+/glucagon+ cells. Remarkably, dpECM also facilitated intra-organoid vascularity by generating endothelial cells and pericytes.
Type:
Grant
Filed:
September 7, 2020
Date of Patent:
May 21, 2024
Assignee:
The Research Foundation for The Sate University of New York
Abstract: In general, embodiments of the present disclosure provide methods, apparatus, systems, computer program products, computing devices, computing entities, and/or the like for setting up biometric access for a legitimate user to a design. In accordance with various embodiments, a biometric template is received originating from the user and is inputted to a first secure sketch generator configured to use first transformation parameters comprising a hash function to generate a protected biometric template by hashing the biometric template. The protected biometric template is inputted to a second secure sketch generator configured to use second transformation parameters comprising a physical unclonable function serving as a fingerprint of the design to generate an original obfuscation key from the protected biometric template.
Type:
Grant
Filed:
December 7, 2021
Date of Patent:
May 21, 2024
Assignee:
University of Florida Research Foundation, Incorporated
Inventors:
Domenic J. Forte, Damon Woodard, Fatemeh Ganji, Sumaiya Shomaji
Abstract: Methods, devices, and systems for treating spasticity, hypertonia or dystonia are disclosed. Treatment involves applying a source of direct current to one or more locations in a subject (animal, human, or other sentient being). Locations for application of direct current include the spinal column, peripheral nerves, and the cranium. The delivery of direct current is adjusted to change biological activity of or level of gene expression and/or protein expression of target molecule NKCC1.
Type:
Grant
Filed:
March 22, 2019
Date of Patent:
May 21, 2024
Assignee:
Research Foundation of the City University of New York