Abstract: The present invention provides compounds of formula (4), and their pharmaceutically acceptable salts and solvates, which are useful as inhibitors of the Hepatitis C virus (HCV) polymerase enzyme and are also useful for the treatment of HCV infections in HCV-infected mammals. The present invention also provides pharmaceutical compositions comprising compounds of formula (4), their pharmaceutically acceptable salts and solvates. Furthermore, the present invention provides intermediate compounds and methods useful in the preparation of compounds of formula (4).

Abstract: The invention recites spirocyclic isoxazoline derivatives of Formula (V.1), Formula (V.2), Formula (V.1.1), and Formula (1) stereoisomers thereof, veterinarily acceptable salts thereof, compositions thereof, processes for making, and their use as a parasiticide in an animal. The variables A, V, Z, W1, W2, W3, W, Y, X, R1a, R1b, R1c, R2, R3, R4, n, and “” are as described herein.

Abstract: This invention relates to the hydrochloride salt of 5-[3-{3-hydroxyphenoxy)azetidin-1-yl]-5-methyl-2,2-diphenyl-hexanamide or derived form thereof and its use as a medicament.

Abstract: The invention relates to compounds of formula (1) and to processes for the preparation of, intermediates used in the preparation of, compositions containing and the uses of, such derivatives. The compounds according to the present invention are useful in numerous diseases, disorders and conditions, in particular inflammatory, allergic and respiratory diseases, disorders and conditions.

Abstract: The present invention provides Formula (1A) compounds that act as glucokinase activators; pharmaceutical compositions thereof; and methods of treating diseases, disorders, or conditions mediated by glucokinase. X, Y, Z, R1, R2, R3, and R4 areas described herein.

Abstract: The present invention relates to antibodies and antigen-binding portions thereof that specifically bind to CD40, preferably human CD40, and that function as CD40 agonists. The invention also relates to human anti-CD40 antibodies and antigen-binding portions thereof. The invention also relates to antibodies that are chimeric, bispecific, derivatized, single chain antibodies or portions of fusion proteins. The invention also relates to isolated heavy and light chain immunoglobulins derived from human anti-CD40 antibodies and nucleic acid molecules encoding such immunoglobulins. The present invention also relates to methods of making human anti-CD40 antibodies, compositions comprising these antibodies and methods of using the antibodies and compositions for diagnosis and treatment. The invention also provides gene therapy methods using nucleic acid molecules encoding the heavy and/or light immunoglobulin molecules that comprise the human anti-CD40 antibodies.

Abstract: The invention provides a compound of Formula (I) or a pharmaceutically acceptable salt of said compound, wherein R1, R2, R3 and R4 are as described herein; pharmaceutical compositions thereof; and the use thereof in treating diseases, conditions or disorders modulated by the inhibition of an acetyl-CoA carboxylase enzyme(s) in an animal.

Abstract: A process for forming amorphous atorvastatin comprising the steps of dissolving atorvastatin in a non-hydroxylic solvent and removing the solvent by freeze-drying, as well as processes of dissolving atorvastatin in a hydroxylic solvent with a solubilizing agent or an alkalizing agent or an antioxidant and removing the solvent by freeze-drying to afford amorphous atorvastatin.

Abstract: A device for dispensing individual doses of powder from respective pockets of a disc-shaped carrier by outwardly rupturing a lidding foil by means of pressure on an opposite side surface, the device providing individual respective deaggregation flow paths for each pocket, split airstreams allowing improved entrainment of powder, a cam mechanism for outwardly rupturing the pockets, an indexing mechanism linked to the cam mechanism and a dose counter.

Abstract: Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5? TCGTCGTTTTCGGCGCGCGCCGT 3? (SEQ ID NO: 1), in which each C is unmethylated and 3? refers to the 3? end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-?. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.

Abstract: The invention relates to compounds of formula (I): wherein R1, R2, R3, R4, R5, and R6 as defined herein. The invention also relates to pharmaceutical compositions and methods of treating bacterial infections using compounds of formula (I).

Abstract: The present invention relates to methods of treating cancer, such as melanoma, by administering a CTLA4 antagonist to a subject with a serum C-Reactive Protein (CRP) concentration that is less than or equal to some amount. The invention further relates to methods of treating cancer by determining the level of serum CRP concentration in a subject, and then administering a CTLA4 antagonist if the CRP concentration is less than or equal to a certain amount. The invention further relates to, among other things, the use of serum CRP concentration as a predictive factor for a subjects response to a cancer treatment.

Abstract: The invention comprises (1) anhydrous crystalline forms of N-[1-(2-ethoxyethyl)-5-(N-ethyl-N-methylamino)-7-(4-methylpyridin-2-yl-amino)-1H-pyrazolo[4,3-d]pyrimidine-3-carbonyl]methanesulfonamide, (2) pharmaceutical compositions comprising at least one such form, (3) methods for the treatment of a phosphodiesterase-5-mediated condition using at least one such form, and (4) methods for preparing such forms. The compound N-[1-(2-ethoxyethyl)-5-(N-ethyl-N-methylamino)-7-(4-methylpyridin-2-yl-amino)-1H-pyrazolo[4,3-d]pyrimidine-3-carbonyl]methanesulfonamide has the following structure (I).

Abstract: The present invention relates to a compound of the formula I wherein R1 to R6, A, B, n and m are as defined herein. Such novel sulfonyl amide derivatives are useful in the treatment of abnormal cell growth, such as cancer, in mammals. This invention also relates to a method of using such compounds in the treatment of abnormal cell growth in mammals, especially humans, and to pharmaceutical compositions containing such compounds.

Abstract: The invention comprises (1) anhydrous crystalline forms of N-[1-(2-ethoxyethyl)-5-(N-ethyl-N-methylamino)-7-(4-methylpyridin-2-yl-amino)-1H-pyrazolo[4,3-d]pyrimidine-3-carbonyl]methanesulfonamide, (2) pharmaceutical compositions comprising at least one such form, (3) methods for the treatment of a phosphodiesterase-5-mediated condition using at least one such form, and (4) methods for preparing such forms. The compound N-[1-(2-ethoxyethyl)-5-(N-ethyl-N-methylamino)-7-(4-methylpyridin-2-yl-amino)-1H-pyrazolo[4,3-d]pyrimidine-3-carbonyl]methanesulfonamide has the following structure (I).

Abstract: The present invention relates to compositions comprising probiotic and prebiotic components, mineral salts, lactoferrin, and possibly saccharomycetes, which perform correct, effective colonisation of the probiotic components administered, with enteric consequences which involve maintaining and/or restoring intestinal health and preventing the consequences of common dysbioses of the digestive tract caused by stress, incorrect dietary habits and antibiotic treatments. Said compositions also have a concomitant anti-inflammatory and immunomodulating action.

Abstract: The present invention provides a compound of Formula (I) or a pharmaceutically acceptable salt thereof wherein R1, R2, R3, A1, A2, A3, A4, L, B1, B2, B3 and B4 are as defined herein. The compounds of Formula I have been found to act as glucagon antagonists or inverse agonists. Consequently, the compounds of Formula I and the pharmaceutical compositions thereof are useful for the treatment of diseases, disorders, or conditions mediated by glucagon.

Abstract: Antibodies and antigen-binding portions thereof that bind to human IL-6 are provided. Also provided are nucleic acids encoding such antibodies and antigen binding portions, methods of making such antibodies and antigen binding portions, compositions comprising such antibodies or antigen binding portions, and uses of such antibodies or antigen binding portions.

Abstract: The present disclosure provides isolated binding molecules that bind to the human OX40R, nucleic acid molecules encoding an amino acid sequence of the binding molecules, vectors comprising the nucleic acid molecules, host cells containing the vectors, methods of making the binding molecules, pharmaceutical compositions containing the binding molecules, and methods of using the binding molecules or compositions.

Abstract: Novel salt forms of [R—(R*,R*)]-2-(4-fluorophenyl)-?,?-dihydroxy-5-(1-methylethyl)-3-phenyl-4-[(phenylamino)carbonyl]-1H-pyrrole-1-heptanoic acid characterized by their X-ray powder diffraction pattern and solid-state NMR spectra are described, as well as methods for the preparation and pharmaceutical composition of the same, which are useful as agents for treating hyperlipidemia, hypercholesterolemia, osteoporosis, benign prostatic hyperplasia, and Alzheimer's Disease.