Abstract: A compound of Formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein, R1 and R2 each independently represent H, halogen, CF3, C1-3 alkyl or C1-3 alkoxy; R3 represents C1-6 alkyl, C3-6 cycloalkyl, phenyl (optionally substituted by one or more substituents each independently selected from Ra) or Het (optionally substituted by one or more substituents each independently selected from OH, oxo, or C1-4 alkyl); R4 represents H or C1-3 alkyl; R5 represents C1-6 alkyl (optionally substituted by one or more substituents each independently selected from Rb), C3-6 cycloalkyl (optionally substituted by one or more substituents each independently selected from oxo or OH), or Het2 (optionally substituted by one or more substituents each independently selected from Rd); oxygen atom or 1 sulphur atom, or (c) 1 oxygen atom or 1 sulphur atom, (optionally substituted by one or more substituents each independently selected from OH, oxo or C1-4 alkyl); and R6 represents C1-3 alkyl (optionally substitu

Abstract: This invention relates to methods and intermediates useful for the synthesis of pyrrolo[2,3-d]pyrimidine compounds. Specifically novel synthetic methods and intermediates for the synthesis of 3-{(3R,4R)-4-methyl-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-amino}-piperidin-1-yl)-3-oxo-propionitrile and its corresponding citrate salt are disclosed.

Abstract: The invention features methods and compositions for preventing or treating bone cancer pain including cancer pain associated with bone metastasis by administering an antagonist of nerve growth factor (NGF). The NGF antagonist may be an anti-NGF (such as anti-hNGF) antibody that is capable of binding hNGF.

Abstract: The present disclosure provides engineered ketoreductase enzymes having improved properties as compared to a naturally occurring wild-type ketoreductase enzyme. Also provided are polynucleotides encoding the engineered ketoreductase enzymes, host cells capable of expressing the engineered ketoreductase enzymes, and methods of using the engineered ketoreductase enzymes to synthesize chiral compounds.

Abstract: The invention comprises (1) anhydrous crystalline forms of N-[1-(2-ethoxyethyl)-5-(N-ethyl-N-methylamino)-7-(4-methylpyridin-2-yl-amino)-1H-pyrazolo[4,3-d]pyrimidine-3-carbonyl]methanesulfonamide, (2) pharmaceutical compositions comprising at least one such form, (3) methods for the treatment of a phosphodiesterase-5-mediated condition using at least one such form, and (4) methods for preparing such forms. The compound N-[1-(2-ethoxyethyl)-5-(N-ethyl-N-methylamino)-7-(4-methylpyridin-2-yl-amino)-1H-pyrazolo[4,3-d]pyrimidine-3-carbonyl]methanesulfonamide has the following structure (I).

Abstract: The present invention relates to a polymorphic form B of ?/-[3-tert-butyl-1-(3-chloro-4-hydroxyphenyl)-1H-pyrazol-5-yl]-N-{2-[(3-{2-[(2-hydroxyethyl)sulfanyl]phenyl}[1,2,4]triazolo[4,3-a]pyridin-6-yl)sulfanyl]benzyl}urea (I) as de-fined herein. This polymorph is useful in the treatment of various conditions, particularly in the treatment of inflammatory conditions such as chronic obstructive pulmonary disease.

Abstract: This invention relates to polymorphs of (R)-3-[1-(2,6-Dichloro-3-fluoro-phenyl)-ethoxy]-5-(1-piperidin-4-yl-1H-pyrazol-4-yl)-pyridin-2-ylamine that are useful in the treatment of abnormal cell growth, such as cancer, in mammals. This invention also relates to compositions including such salts and polymorphs, and to methods of using such compositions in the treatment of abnormal cell growth in mammals, especially humans.

Abstract: The present invention provides a compound of Formula (I) or a pharmaceutically acceptable salt thereof wherein R1, R2, R3, A1, A2, A3, A4, L, B1, B2, B3 and B4 are as defined herein. The compounds of Formula I have been found to act as glucagon antagonists or inverse agonists. Consequently, the compounds of Formula I and the pharmaceutical compositions thereof are useful for the treatment of diseases, disorders, or conditions mediated by glucagon.

Abstract: The present invention relates to substituted triazoles of formula (I), uses thereof, processes for the preparation thereof and compositions containing said compounds. These inhibitors have utility in a variety of therapeutic areas including sexual dysfunction.

Abstract: The present invention is directed to compounds of Formula I: or salt thereof, which are modulators of the glucocorticoid receptor. The compounds and salts of the invention are useful in the treatment of conditions mediated by glucocorticoid receptor activity.

Abstract: The present invention relates to a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R1A, R1B, R1C, R2, R3, R4, R5, RA, RB, RC and X are as defined herein. These novel benzimidazole derivatives are useful in therapy, in particular for treating diseases or conditions mediated by SMO, including the treatment of abnormal cell growth, such as cancer, in mammals. This invention also relates to a method of using such compounds in the treatment of abnormal cell growth in mammals, especially humans, and to pharmaceutical compositions containing such compounds.

Abstract: A method and apparatus for filling with powder (4) a container (8) having an open end, including positioning an outlet of a hopper (2) containing powder above the open end of the container (8), mechanically agitating the hopper so as to cause powder (4) to be transferred from the hopper to the container and mechanically agitating the container, wherein the steps of mechanically agitating are conducted by at least a predetermined amount sufficient to ensure that the container is filled with powder at a predetermined density.

Abstract: In accordance with the present invention, there are provided fully human monoclonal antibodies against human cytotoxic T-lymphocyte antigen 4 (CTLA-4). Nucleotide sequences encoding and amino acid sequences comprising heavy and light chain immunoglobulin molecules, particularly contiguous heavy and light chain sequences spanning the complementarity determining regions (CDRs), specifically from within FR1 and/or CDR1 through CDR3 and/or within FR4, are provided. Further provided are antibodies having similar binding properties and antibodies (or other antagonists) having similar functionality as antibodies disclosed herein.

Abstract: Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5? TCGTCGTTTTCGGCGCGCGCCGT 3? (SEQ ID NO: 1), in which each C is unmethylated and 3? refers to the 3? end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-?. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.

Abstract: Compounds which are pyrrolo[2,3-b]pyridine derivatives or pharmaceutically acceptable salts thereof, their preparation process and pharmaceutical compositions comprising them are disclosed; these compounds are useful in the treatment of diseases caused by and/or associated with an altered protein kinase activity such as cancer, cell proliferative disorders, Alzheimer's disease, viral infections, auto-immune diseases and neurodegenerative disorders; also disclosed is a process under SPS conditions for preparing the compounds of the invention and chemical libraries comprising a plurality of them.

Abstract: The present invention relates to solid salt forms of the 3-pyrrole substituted 2-indolinone compound 5-[5-fluoro-2-oxo-1, 2-dihydro-indol-(3Z)-ylidenemethyl]-2,4-dimethyl-1H-pyrrole-3-carboxylic acid (2-pirrolidin-1-yl-ethyl)-amide. It also relates to polymorphs of the phosphate salt of the amide. The invention further relates to the use of the salts and polymorphs in the treatment of protein kinase related disorders.

Abstract: Antibodies and antigen-binding portions thereof that bind to human IL-6 are provided. Also provided are nucleic acids encoding such antibodies and antigen binding portions, methods of making such antibodies and antigen binding portions, compositions comprising such antibodies or antigen binding portions, and uses of such antibodies or antigen binding portions.

Abstract: The present invention relates to compounds and pharmaceutically acceptable salts of Formulas A and B: (A) and (B) wherein A, B, R1, R2, R3, R4, R5, R6, R7, R8, R9 and R10 are as defined above. The invention further relates to pharmaceutical compositions comprising the compounds and pharmaceutically acceptable salts and to methods of treating diabetes mellitus and its complications, cancer, ischemia, inflammation, central nervous system disorders, cardiovascular disease, Alzheimer's disease and dermatological disease pression, virus diseases, inflammatory disorders, or diseases in which the liver is a target organ.

Abstract: Compounds of Formula X: wherein A, X, Y, Z, R5, R6a, and R6b are as defined herein, and pharmaceutically acceptable salts thereof, are described as useful for the treatment of cognitive deficits associated with schizophrenia and other neurodegenerative and/or neurological disorders in mammals, including humans.

Abstract: The present invention is directed to pharmaceutical compositions containing a therapeutically effective amount of an Active Pharmaceutical Ingredient (“API”), a pharmaceutically acceptable cyclodextrin and a pharmaceutically acceptable preservative. The invention is also directed to pharmaceutical compositions of the compounds of Formula (I) wherein R2 is selected from the group consisting of methyl, ethyl, isopropyl, sec-butyl and tert-butyl and a pharmaceutically acceptable cyclodextrin and preservative. Formula (I): In particular, the invention is directed to pharmaceutical compositions of the compound of Formula 1a, and a pharmaceutically acceptable cyclodextrin and a preservative.