Patents Assigned to Research Foundation of The City University of New York
  • Patent number: 10725135
    Abstract: A method of inducing spin polarization in an analyte is provided. The method exposes 14N spin defect centers embedded within 25 nm of a diamond surface to a magnetic field while an analyte is near the surface. The 14N spin defect centers are polarized by treatment with an electromagnetic wave protocol having a visible light pulse (p0); a microwave pulse (mw1), a radio frequency pulse (rf1), a microwave pulse (mw2) and a radio frequency pulse (rf2) resulting in polarization of the nuclear spins of the 14N spin defect centers. Polarized spins in the 14N spin defect centers induce spin polarization in the analyte.
    Type: Grant
    Filed: January 4, 2019
    Date of Patent: July 28, 2020
    Assignee: Research Foundation of the City University of New York
    Inventors: Carlos A. Meriles, Daniela Pagliero, Abdelghani Laraoui
  • Patent number: 10688556
    Abstract: Nanocages are formed by etching nancubes. The nanocubes are added to an aqueous system having an amphiphilic lipid dissolved in an organic solvent (e.g. a hydrophobic alcohol) to form reverse micelles. As the water evaporates the micelles shrink as etching of the flat surface of the nanocubes occurs. In this fashion hollow nanocages are produced. In one embodiment, the nanocage is covalently attached to a polymer shell (e.g. a dextran shell).
    Type: Grant
    Filed: April 3, 2017
    Date of Patent: June 23, 2020
    Assignee: Research Foundation of the City University of New York
    Inventors: Hiroshi Matsui, Zengyan Wei, Justin Fang
  • Patent number: 10609057
    Abstract: A method for detecting intrusion is provided using a combination of two AIS algorithms: Negative Selection Algorithm (NSA) and Dendritic Cell Algorithm (DCA). The method includes the following steps, or some functional subset of these steps: periodic monitoring of a data processing system for anomalous behavior that may indicate the presence of an intruder or an undesirable software; using the NSA for the generation of a population of detectors that are used for detecting anomalies in the monitored system via a matching criterion; using the DCA (which runs in parallel to the NSA) to sample traffic and signals coming in or out of the data processing system; using an aggregation system to combine the individual decisions of the NSA and the DCA to form a single final decision.
    Type: Grant
    Filed: June 26, 2017
    Date of Patent: March 31, 2020
    Assignee: Research Foundation of the City University of New York
    Inventors: Obinna Igbe, Tarek Saadawi, Ihab Darwish
  • Patent number: 10585043
    Abstract: Technologies are described for methods to fabricate lasers to amplify light. The methods may comprise depositing nanoparticles on a substrate. The length, width, and height of the nanoparticles may be less than 100 nm. The methods may further comprise distributing the nanoparticles on the substrate to produce a film. The nanoparticles in the film may be coupled nanoparticles. The coupled nanoparticles may be in disordered contact with each other within the film. The distribution may be performed such that constructive interference of the light occurs by multiple scattering at the boundaries of the coupled nanoparticles within the film. The methods may comprise exposing the film to a power source.
    Type: Grant
    Filed: May 4, 2017
    Date of Patent: March 10, 2020
    Assignees: Brookhaven Science Associates, LCC, Research Foundation of The City University of New York
    Inventors: Matthew Y. Sfeir, Kannatassen Appavoo, Xiaoze Liu, Vinod M. Menon
  • Patent number: 10532781
    Abstract: A robotic device for providing vertical mobility has a payload is disposed inside a central compartment and supported by a skid. The skid can move up and down through latch and hook pairs to keep intimate contact with the surface and cross over bumps. The apparatus uses a flexible seal to create a reliable vacuum chamber. The flexible seal comprises a foam ring inside fabric pocket. A plurality of rod and spring strips are configured to apply a downward force to the flexible seal to conform with surface curvatures. The fabric pocket fills in the gaps or seams to maintain a vacuum. The air flows inside a manifold and passes through a filter to avoid debris from damaging the vacuum motor assembly.
    Type: Grant
    Filed: July 3, 2017
    Date of Patent: January 14, 2020
    Assignees: InnovBot, LLC, Research Foundation of the City University of New York
    Inventors: Jizhong Xiao, Kenshin Ushiroda, SaiadiVishnu Sanigepalli, Guoyong Yang
  • Patent number: 10512253
    Abstract: A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.
    Type: Grant
    Filed: August 3, 2016
    Date of Patent: December 24, 2019
    Assignee: Research Foundation of the City University of New York
    Inventors: Paul Feinstein, Charlotte D'Hulst
  • Patent number: 10507178
    Abstract: An injectable carboxymethylcellulose (CMC) and methylcellulose (MC) hydrogel derived from the plant-based polysaccharide, cellulose, is provided which gels in situ and repairs the intervertebral disc in the spinal column or other cartilaginous tissues. One specific application is for replacement of the nucleus pulposus (NP), the central gelatinous region of the intervertebral disc, following injury or degeneration.
    Type: Grant
    Filed: May 6, 2016
    Date of Patent: December 17, 2019
    Assignee: Research Foundation of the City University of New York
    Inventors: Steven B. Nicoll, Devika Varma
  • Patent number: 10493270
    Abstract: Improved neuromodulation control of neurological abnormalities associated with effector organs in vertebrate beings using direct current stimulation for modulating spinal cord excitability, having a peripheral-current supplying component for providing direct current peripheral nerve stimulation and a spinal-current supplying component providing direct current for spinal stimulation, and a controller managing such functions.
    Type: Grant
    Filed: November 2, 2017
    Date of Patent: December 3, 2019
    Assignee: The Research Foundation of the City University of New York
    Inventor: Zaghloul Ahmed
  • Patent number: 10450260
    Abstract: This disclosure relates to compounds containing both an NO-releasing moiety and an H2S-releasing moiety and the use of such compounds in treating inflammatory diseases, including cancers.
    Type: Grant
    Filed: May 25, 2017
    Date of Patent: October 22, 2019
    Assignee: Research Foundation of The City University of New York
    Inventors: Khosrow Kashfi, Ravinder Kodela
  • Publication number: 20190298864
    Abstract: Described herein is a chelator for radiolabels (e.g., 89Zr) for targeted PET imaging that is an alternative to DFO. In certain embodiments, the chelator for 89Zr is the ligand, 3,4,3-(LI-1,2-HOPO) (“HOPO”), which exhibits equal or superior stability compared to DFO in chemical and biological assays across a period of several days in vivo. As shown in FIG. 1, the HOPO is an octadentate chelator that stabilizes chelation of radiolabels (e.g., 89Zr). A bifunctional ligand comprising p-SCN-Bn-HOPO is shown in FIG. 4 and FIG. 5. Such a bifunctional ligand can eliminate (e.g., 89Zr) loss from the chelate in vivo and reduce uptake in bone and non-target tissue. Therefore, the bifunctional HOPO ligand can facilitate safer and improved PET imaging with radiolabeled antibodies.
    Type: Application
    Filed: September 9, 2016
    Publication date: October 3, 2019
    Applicants: Memorial Sloan Kettering Cancer Center, Research Foundation of the City University of New York
    Inventors: Jason S. Lewis, Melissa Deri, Lynn Francesconi, Shashikanth Ponnala
  • Patent number: 10420471
    Abstract: A method is provided for deep tissue imaging using multi-photon excitation of a fluorescent agent. The fluorescent agent is irradiated with an ultrafast laser to produce an excited singlet state (Sn) which subsequently undergoes non-radiative relaxation to a first singlet state (S1). The S1 state undergoes fluorescence to the ground state S0 to produce an emission wavelength. Both the excitation and emission wavelengths are within the near infrared optical window, thereby permitting deep tissue penetration for both the incoming and outgoing signals.
    Type: Grant
    Filed: June 9, 2014
    Date of Patent: September 24, 2019
    Assignee: Research Foundation of the City University of New York
    Inventors: Robert R. Alfano, Yang Pu, Lingyan Shi, Sebastião Pratavieira
  • Patent number: 10396976
    Abstract: A system for producing a public ring that is fully homomorphically encrypted. The system comprises a processor which generates a first presentation G of a ring, wherein G=x, y|x2=0, y2=0, xy+(p+1)yx=1, where x and y are generators and p is a first private prime number. The system further generates a second presentation H of the ring. H is defined as follows: H=x, y, t|x2=0, y2=0, t=m1yx, xy+m2yx+t=1. In addition, m1 and m2 are positive integers and p+1=m1+m2, wherein t is a generator and the first presentation G and the second presentation H are isomorphic. The system further produces a public ring ? that is fully homomorphically encrypted, where: H ^ = ? x , y , t ? N · 1 = 1 , x 2 = 1 , y 2 = 0 , xyx = x , yxy = y , tx = 0 , yt = 0 , t 2 = t + m 2 2 - m 2 m 1 ? tyx ? , N=pq and further, q is a second private prime number, and the public ring ? is further, publically available. A corresponding method is also disclosed.
    Type: Grant
    Filed: February 14, 2018
    Date of Patent: August 27, 2019
    Assignee: Research Foundation of The City University of New York
    Inventors: Delaram Kahrobaei, Ha T. Lam, Vladimir Shpilrain
  • Patent number: 10393685
    Abstract: An impedance spectroscopy biosensor is provided that is fabricated on a stretchable substrate. The stretchable substrate is integrated with an impedance biosensor that undergoes cyclic strain without cracking. The biosensor is formed by curing an elastomer precursor while on a pre-tensioned membrane that includes a conductive electrode. The resulting elastomeric material is released from the support after curing which releases the pre-tensioned state to produce the biosensor.
    Type: Grant
    Filed: August 19, 2016
    Date of Patent: August 27, 2019
    Assignee: Research Foundation of the City University of New York
    Inventors: Ioana Voiculescu, Xudong Zhang
  • Patent number: 10378845
    Abstract: A smart gun is provided that maintains a default locked state. The smart gun can be selectively unlocked for a predetermined period of time using a predetermined gesture that is detected by a gyrosensor locked in the smart gun.
    Type: Grant
    Filed: November 20, 2018
    Date of Patent: August 13, 2019
    Assignee: Research Foundation of the City University of New York
    Inventor: Masato Nakamura
  • Patent number: 10344283
    Abstract: PVT1 exon 9 is overexpressed in aggressively tumorigenic prostate cancer cell lines and prostate tumor tissues. This exon provides a diagnostic tool for the detection and monitoring of aggressive prostate cancer. Several small interfering ribonucleic acids (siRNAs) are disclosed that are useful for treating prostate cancer.
    Type: Grant
    Filed: December 1, 2017
    Date of Patent: July 9, 2019
    Assignee: Research Foundation of the City University of New York
    Inventors: Olorunseun O. Ogunwobi, Adeodat Ilboudo, Chunxiao Ying
  • Publication number: 20190201687
    Abstract: Methods, systems and devices are disclosed for treating a spinal disorder by applying a source of direct current to a spinal cord in animals, including humans. Trans-spinal direct current stimulation (tsDCS) uses direct current via cathodal and/or anodal stimulation to induce cell proliferation, cell differentiation, and/or cell migration at or near the area of the spinal cord being treated, and up-regulates or down-regulates protein expression by cells at or near the area of the spinal cord being treated.
    Type: Application
    Filed: January 31, 2019
    Publication date: July 4, 2019
    Applicant: THE RESEARCH FOUNDATION OF THE CITY UNIVERSITY OF NEW YORK
    Inventor: Zaghloul Ahmed
  • Patent number: 10330750
    Abstract: A method and apparatus for polarizing nuclear or electronic spins is disclosed. An analyte is passed near a surface that has a plurality of spin defect centers implanted within 10 nm of the surface. The spin defect centers are exposed to a magnetic field and illumination to produce polarized spins. The polarized spins then induce spin polarization in the analyte.
    Type: Grant
    Filed: April 7, 2014
    Date of Patent: June 25, 2019
    Assignee: Research Foundation of the City University of New York
    Inventor: Carlos A. Meriles
  • Publication number: 20190142276
    Abstract: An electroactive photonic polymer sensing device includes an imaging component that uses photonic energy to generate a photocurrent that represents a molecular parameter, wherein the imaging component includes a photosensitive material and at least one of a laser diode and/or photodiode; and a memory component that stores a representation of the molecular parameter, wherein the memory component includes at least one of a protein, vitamin, lipid, carbon allotrope, carbon tetra fluoride.
    Type: Application
    Filed: December 28, 2016
    Publication date: May 16, 2019
    Applicant: RESEARCH FOUNDATION OF THE CITY UNIVERSITY OF NEW YORK
    Inventor: Patricia A. Broderick
  • Publication number: 20190144867
    Abstract: A method for inhibiting metastasis of cancer cells is provided. Inhibitors of heparan sulfate (HS) or hyaluronic acid (HA) are applied to a tumor or a surgical location after removal of the bulk of the tumor. The inhibitors enzymatically cleave surface HS or HA; genetically modify cancer cells to decrease HS or HA production or interfere with the signaling pathway between HS or HA and a MMP or syndecan.
    Type: Application
    Filed: September 19, 2016
    Publication date: May 16, 2019
    Applicants: Research Foundation of the City University of New York, Memorial Sloan Kettering Cancer Center, The General Hospital Corporation D/B/A Massachusetts General Hospital
    Inventors: John M. TARBELL, Lance L. MUNN, Henry QAZI, Zhongdong SHI
  • Patent number: 10281160
    Abstract: A method to use high temperature thermal storage for integration into building heating/cooling systems and to meet building's peak power demand. The method can be used to store the thermal energy at any desirable rate and then discharge this stored energy to meet the demand for short or long time intervals. Input energy stored with this method is thermal energy, however, output can be thermal or electric based upon the requirement.
    Type: Grant
    Filed: October 21, 2014
    Date of Patent: May 7, 2019
    Assignee: The Research Foundation of the City University of New York
    Inventors: Masahiro Kawaji, Hitesh Bindra