Patents Assigned to Stellenbosch University
-
Patent number: 11972535Abstract: A computer-implemented method and a system are provided for visualising colocalised fluorescence signals. The method accesses signal intensity data obtained from a first fluorescence channel and a second fluorescence channel in which the signal intensity data is associated with voxels in an image. A regression factor on the signal intensity data is calculated to generate a regression parameter corresponding to a degree of correlation between the signal intensity data obtained from the first and second fluorescence channels The signal intensity data is mapped to the regression parameter and colourmap values are assigned to each voxel based on the mapped signal intensity data in which colourmap values of voxels embodying poorly correlated signal intensity data are reduced. The method renders the voxels in the image in colours according to their colourmap values to visualise colocalisation in the image.Type: GrantFiled: April 3, 2020Date of Patent: April 30, 2024Assignee: STELLENBOSCH UNIVERSITYInventors: Benjamin Loos, Thomas Richard Niesler, Rensu Petrus Theart
-
Patent number: 11944421Abstract: A needle is provided that has terminals located at or near its tip. The terminals are connectable to an impedance calculating circuit configured to enable the impedance calculating circuit to apply an alternating current input electrical signal to the terminals. The terminals are further configured to enable the impedance calculating circuit to measure a resultant electrical signal and calculate an impedance of biological tissue surrounding the tip. The needle may further include light transmitting media, that extends along the needle, and that is connectable to a light circuit. The light circuit may include an emitter/detector pair for transmitting light from the emitter, along the media, and emitting the light from the tip. A reflection of the emitted light may be transmitted from the tip to the detector and the light circuit may calculate the light absorption of the tissue.Type: GrantFiled: April 3, 2019Date of Patent: April 2, 2024Assignee: STELLENBOSCH UNIVERSITYInventors: Pieter Rousseau Fourie, Tys Van Der Merwe
-
Patent number: 11944102Abstract: The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5? UAAACAAUCGCAAGAAGCUGA 3? (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5? AGCUUCUUGCGAUUGUUUAAG 3? (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.Type: GrantFiled: March 5, 2019Date of Patent: April 2, 2024Assignee: Stellenbosch UniversityInventors: Anna-Maria Botha-Oberholster, Hendrik Willem Swiegers, Nicolaas Francois Visser Burger
-
Patent number: 11852629Abstract: A method, device and system for determining autophagic flux are claimed. The levels of proteins which change with increased or decreased autophagy are determined in a sample. The change in the level of each protein is quantified in order to obtain the autophagic flux. This can be compared to a sample flux range associated with autophagy dysfunction or ageing patterns. Diseases or conditions which may be diagnosed include neurodegenerative conditions such as Alzheimer's disease and dementia, cancer, heart conditions, immune conditions or aging-related conditions. The device for determining autophagic flux comprises a housing, receiving zones configured for receiving a substrate and a biological sample, and a set of electrodes for each receiving zone. The device is connectable to circuitry that determines an electrical property of each substrate and uses this to determine the autophagic flux.Type: GrantFiled: July 1, 2019Date of Patent: December 26, 2023Assignee: Stellenbosch UniversityInventors: Benjamin Loos, Jan Hendrik Servaas Hofmeyr, Willem Jacobus Perold, Andre Du Toit
-
Patent number: 11839335Abstract: A dispenser, a dispensing system and a dispensing method are disclosed. A plurality of dispensers may be implemented. The dispenser includes a flexible container having a top and a bottom and capable of holding a product therein, the flexible container including top and bottom openings. A rigid support structure that supports the flexible container is provided. A moveable dispensing arm that operatively facilitates product dispensing is also provided. The moveable dispensing arm is operable between a dispensing condition and a retaining condition, and it includes a pinching edge which is configured to pinch the flexible container shut in either the dispensing condition or the retaining condition of the dispensing arm.Type: GrantFiled: December 13, 2021Date of Patent: December 12, 2023Assignee: STELLENBOSCH UNIVERSITYInventor: Kimberly Ann Kasper
-
Publication number: 20230392177Abstract: The present invention relates to a method of producing a heterologous polypeptide of interest in a host cell, wherein the method comprises expressing a fusion protein comprising the heterologous polypeptide of interest and a fluorescent fusion partner in a host cell modified to include a nucleic acid encoding a lytic protein operably linked to a promoter, wherein translation of the lytic protein is under control of an RNA thermometer. Also provided are E. coli cells which express the fusion protein and include a nucleic acid encoding a lytic protein operably linked to a promoter, wherein translation of the lytic protein regulated by an RNA thermometer.Type: ApplicationFiled: November 16, 2021Publication date: December 7, 2023Applicant: Stellenbosch UniversityInventors: Anton Du Preez van Staden, Carine Smith, Dominic Nicholas, Leon Milner Theodore Dicks, Ross Rayne Vermeulen
-
Patent number: 11833179Abstract: A probiotic composition comprising Bacillus amyloliquefaciens, Enterococcus faecalis, Lactobacillus salivarius, Lactobacillus johnsonii, Lactobacillus gallinarum and Lactobacillus crispatus is provided. The probiotic composition stimulates the immune response of chickens without negatively affecting growth performance. The probiotic composition can be added to poultry feed to improve the health and performance of chickens, and can be used as a replacement for antibiotic supplementation.Type: GrantFiled: October 15, 2018Date of Patent: December 5, 2023Assignee: Stellenbosch UniversityInventors: Deon Pieter Neveling, Leon Milner Theodore Dicks
-
Publication number: 20230366880Abstract: This invention relates to methods of diagnosing COVID-19 disease, preferably post-acute COVID-19 syndrome, in a subject using a fluorescent or microscopy detection method to detect persistent anomalous (amyloid) clotlets in the sample, wherein the presence of persistent anomalous (or amyloid) clotlets in the sample, particularly clotlets that are resistant to fibrinolysis, is indicative of either acute COVID-19 disease or post-acute COVID-19 syndrome in the subject. The invention also relates to diagnostic kits for diagnosing acute COVID-19 disease, in particular post-acute COVID-19 syndrome, in a subject based on the methods disclosed.Type: ApplicationFiled: April 20, 2022Publication date: November 16, 2023Applicant: Stellenbosch UniversityInventor: Etheresia PRETORIUS
-
Patent number: 11814402Abstract: This invention relates to a series of binuclear palladacycle compounds, and methods for the production of these compounds, that are suitable for use in the treatment of cancer. In particular embodiments, R1 is phenyl substituted with two occurrences of isopropyl, R2 is Cl, and R3 is independently one or more substituents selected from —O(CH2)2O(CH2)2OH, —O(CH2)2O(CH2)2O(CH2)2OH, —O(CH2)2OH, and —O(CH2)2O(CH2)2OCH3.Type: GrantFiled: February 15, 2019Date of Patent: November 14, 2023Assignees: Stellenbosch University, University of Cape TownInventors: Angelique Blanckenberg, Annick Van Niekerk, Selwyn Frank Mapolie, Sharon Prince
-
Publication number: 20230341151Abstract: Systems and methods for calibrating a heliostat (104) are disclosed. An imaging device (100) is positioned and oriented so that a calibration target (130) reflected by the heliostat (103) is visible at the imaging device and an image taken. Multiple features of the reflected calibration target in the image are identified and used to determine a centroid of reflection within the image which is then mapped to a corresponding centroid position on the calibration target. A vector t that extends between the centroid position on the calibration target and a known position of the heliostat, as well as a vectors that extends between the known positions of the imaging device and of the heliostat, are determined. A normal vector nof the heliostat is determined as the vector that bisects s and t and is used to calibrate the heliostat by updating parameters of a heliostat tracking model.Type: ApplicationFiled: October 1, 2021Publication date: October 26, 2023Applicant: Stellenbosch UniversityInventor: Willem Jacobus Smit
-
Publication number: 20230340450Abstract: The present invention relates to a bioreactor for the catalytic conversion of a substrate to a product using an immobilized enzyme. The immobilized enzyme is a histidine tagged enzyme, which binds to a nickel-nanoparticle coated cellulose matrix which is housed within the bioreactor. The invention also relates to methods of producing products by enzymatic catalysis using the bioreactor of the invention.Type: ApplicationFiled: June 22, 2021Publication date: October 26, 2023Applicant: STELLENBOSCH UNIVERSITYInventors: Bianke Loedolff, Dominic Nicholas, Ethan Wade Hunter, Leon Milner Dicks, Nicholas George Enslin, Shaun Wayne Peters
-
Patent number: 11613782Abstract: The invention provides a gene signature for use in determining a likelihood of a latent tuberculosis (TB) infection in a subject transitioning to active TB disease. The gene signature comprises at least SEPT4 and BLK, and optionally also GAS6 and/or CD1C. Expression levels of these genes are detected in a sample from the subject, and the ratios of expression of at least two of the above genes are calculated (e.g. SEPT4:BLK, SEPT4:CD1C, GAS6:BLK and/or GAS6:CD1C). A score is assigned to each ratio, the score being indicative of the likelihood of the latent TB infection transitioning into active TB disease, based on the ratio for the respective gene pair. The subject can be identified as having a latent TB infection that is likely to transition into active TB disease or that is not likely to transition into active TB disease based on the score or on the average of the scores.Type: GrantFiled: March 13, 2019Date of Patent: March 28, 2023Assignees: UNIVERSITY OF CAPE TOWN, STELLENBOSCH UNIVERSITY, SEATTLE CHILDREN'S HOSPITAL, MAX-PLANCK-GESELLSCHAFT ZUR FOERDERUNG DER WISSENSCHAFTEN E.V, UNITED KINGDOM RESEARCH AND INNOVATIONInventors: Sara Suliman, Ethan Greene Thompson, Jayne Suzanne Sutherland, Stefan H. E. Kaufmann, Thomas Jens Scriba, Daniel Edward Zak, Gerhard Walzl
-
Publication number: 20230081546Abstract: A method of determining the location and quantity of mitochondrial fission, fusion and depolarisation events that occur in a cell is provided. Using a three-dimensional time lapse image sequence of a cell, the method identifies which of the mitochondria in a cell had depolarised or undergone fission or fusion in the interval between the acquisition of the earlier and later images, indicates the locations of the fission, fusion and depolarisation events, and generates a count of the number of mitochondrial fission, fusion and/or depolarisation events. The method can be used to diagnose a disease or condition associated with mitochondrial dysfunction, such as neurodegenerative disease, cancer or ischaemic heart disease. The method can further be used to screen a compound or composition for use in preventing or treating a disease or condition associated with mitochondrial dysfunction. The method can be computer-implemented, and a computer program product is provided.Type: ApplicationFiled: February 1, 2021Publication date: March 16, 2023Applicant: Stellenbosch UniversityInventors: Benjamin LOOS, Thomas Richard NIESLER, Rensu Petrus THEART
-
Publication number: 20230081369Abstract: The present invention relates to methods of increasing the cellular concentration of Interferon Induced Protein with Tetratricopeptide repeats (IFIT) polypeptides in a cell infected with a mycobacterium. The method includes the introduction of exogenous IFIT polypeptides or expression vectors encoding the exogenous IFIT polypeptides into the cell, wherein increasing the cellular concentration of the IFIT polypeptide reduces the number of viable mycobacteria in the cell. The invention also relates to methods of treatment and uses of IFIT proteins and uses of vectors encoding IFIT proteins.Type: ApplicationFiled: October 8, 2020Publication date: March 16, 2023Applicant: Stellenbosch UniversityInventors: Abhilasha Madhvi Mishra, Bienyameen Baker
-
Publication number: 20220227694Abstract: The invention provides a method for depolymerising a phenolic polymer, the method comprising reacting the phenolic polymer with dimethylsulphoxide (DMSO) and a hydrogen halide. The phenolic polymer may be selected from the group consisting of lignin and derivatives thereof. The hydrogen halide may be HBr. The quantity of hydrogen halide per gram of phenolic polymer may be from 30 mmoles to 70 mmoles. The quantity of DMSO per gram of phenolic polymer may be from 0.1 mole to 1 mole. The reaction may be performed at a temperature of from 100 to 120° C. The reaction may be carried out for between 10 h and 14 h. The product of the reaction may comprise vanillin.Type: ApplicationFiled: April 23, 2020Publication date: July 21, 2022Applicant: Stellenbosch UniversityInventors: Ndumiso SIBANDA, Harold PASCH, Helen PFUKWA
-
Patent number: 11357822Abstract: A method for treating a subject suffering from Alzheimer's disease is provided. The method includes administering to the subject a therapeutically effective amount of lipopolysaccharide-binding protein (LBP). A composition including a therapeutically effective amount of LBP is also provided.Type: GrantFiled: October 4, 2017Date of Patent: June 14, 2022Assignee: Stellenbosch UniversityInventors: Etheresia Pretorius, Douglas Bruce Kell
-
Publication number: 20210393709Abstract: A probiotic composition comprising Bacillus amyloliquefaciens, Enterococcus faecalis, Lactobacillus salivarius, Lactobacillus johnsonii, Lactobacillus gallinarum and Lactobacillus crispatus is provided. The probiotic composition stimulates the immune response of chickens without negatively affecting growth performance. The probiotic composition can be added to poultry feed to improve the health and performance of chickens, and can be used as a replacement for antibiotic supplementation.Type: ApplicationFiled: October 15, 2018Publication date: December 23, 2021Applicant: Stellenbosch UniversityInventors: Deon Pieter NEVELING, Leon Milner Theodore Dicks
-
Patent number: 11193130Abstract: The present invention is directed to a yeast strain, or strains, secreting a full suite, or any subset of that full suite, of enzymes to hydrolyze corn starch, corn fiber, lignocellulose, (including enzymes that hydrolyze linkages in cellulose, hemicellulose, and between lignin and carbohydrates) and to utilize pentose sugars (xylose and arabinose). The invention is also directed to the set of proteins that are well expressed in yeast for each category of enzymatic activity. The resulting strain, or strains can be used to hydrolyze starch and cellulose simultaneously. The resulting strain, or strains can be also metabolically engineered to produce less glycerol and uptake acetate. The resulting strain, or strains can also be used to produce ethanol from granular starch without liquefaction.Type: GrantFiled: May 30, 2019Date of Patent: December 7, 2021Assignees: Lallemand Hungary Liquidity Management LLC, Stellenbosch UniversityInventors: Elena Brevnova, John E. McBride, Erin Wiswall, Kevin S. Wenger, Nicky Caiazza, Heidi Hau, Aaron Argyros, Frank Agbogbo, Charles F. Rice, Trisha Barrett, John S. Bardsley, Abigail Foster, Anne K. Warner, Mark Mellon, Ryan Skinner, Indraneel Shikhare, Riaan Den Haan, Chhayal V. Gandhi, Alan Belcher, Vineet B. Rajgarhia, Allan C. Froehlich, Kristen M. Deleault, Emily Stonehouse, Shital A. Tripathi, Jennifer Gosselin, Yin-Ying Chiu, Haowen Xu
-
Publication number: 20210325088Abstract: A heat transfer device (100) includes an inner tube (102) mounted within a tubular chamber (104) of a heat exchanger (106). The hollow tubular chamber (104) has a closed end (108) with inwardly sloping inner surfaces (110) and the inner tube (102) has an open end (112) that terminates short of the closed end (108). A diffuser (114) is provided and is shaped such that an operatively front part (116) thereof substantially conforms to a shape of the inner surfaces (110) of the closed end (108) so as to form a narrow flow passageway (118) between the diffuser (114) and the inner surfaces (110) at the closed end (108), and an operatively back part (120) of the diffuser (114) slopes towards the inner tube (102) and away from its open end (112) to form a diffusion zone (122). Heat transfer assemblies utilising the heat transfer device (100) are also disclosed.Type: ApplicationFiled: December 11, 2019Publication date: October 21, 2021Applicant: Stellenbosch UniversityInventors: Derwalt Johannes ERASMUS, Theodor Willem VON BACKSTRÖM, David MCDOUGALL, Matti LUBKOLL
-
Publication number: 20210116446Abstract: A method, device and system for determining autophagic flux are claimed. The levels of proteins which change with increased or decreased autophagy are determined in a sample. The change in the level of each protein is quantified in order to obtain the autophagic flux. This can be compared to a sample flux range associated with autophagy dysfunction or ageing patterns. Diseases M or conditions which may be diagnosed include neurodegenerative conditions such as Alzheimer's disease and dementia, cancer, heart conditions, immune conditions or aging-related conditions. The device for determining autophagic flux comprises a housing, receiving zones configured for receiving a substrate and a biological sample, and a set of electrodes for each receiving zone. The device is connectable to circuitry that determines an electrical property of each substrate and uses this to determine the autophagic flux.Type: ApplicationFiled: July 1, 2019Publication date: April 22, 2021Applicant: Stellenbosch UniversityInventors: Benjamin Loos, Jan Hendrik Servaas Hofmeyr, Willem Jacobus Perold, Andre Du Toit