Patents Assigned to Stellenbosch University
-
Patent number: 12275697Abstract: The invention provides a method for depolymerising a phenolic polymer, the method comprising reacting the phenolic polymer with dimethylsulphoxide (DMSO) and a hydrogen halide. The phenolic polymer may be selected from the group consisting of lignin and derivatives thereof. The hydrogen halide may be HBr. The quantity of hydrogen halide per gram of phenolic polymer may be from 30 mmoles to 70 mmoles. The quantity of DMSO per gram of phenolic polymer may be from 0.1 mole to 1 mole. The reaction may be performed at a temperature of from 100 to 120° C. The reaction may be carried out for between 10 h and 14 h. The product of the reaction may comprise vanillin.Type: GrantFiled: April 23, 2020Date of Patent: April 15, 2025Assignee: Stellenbosch UniversityInventors: Ndumiso Sibanda, Harold Pasch, Helen Pfukwa
-
Patent number: 12241658Abstract: Systems and methods for calibrating a heliostat (104) are disclosed. An imaging device (100) is positioned and oriented so that a calibration target (130) reflected by the heliostat (103) is visible at the imaging device and an image taken. Multiple features of the reflected calibration target in the image are identified and used to determine a centroid of reflection within the image which is then mapped to a corresponding centroid position on the calibration target. A vector t that extends between the centroid position on the calibration target and a known position of the heliostat, as well as a vectors that extends between the known positions of the imaging device and of the heliostat, are determined. A normal vector n of the heliostat is determined as the vector that bisects s and t and is used to calibrate the heliostat by updating parameters of a heliostat tracking model.Type: GrantFiled: October 1, 2021Date of Patent: March 4, 2025Assignee: Stellenbosch UniversityInventor: Willem Jacobus Smit
-
Patent number: 12241887Abstract: An apparatus and system for measuring and monitoring fouling parameters in a fluid are provided. The apparatus includes a conduit within a housing, wherein at least a portion of the conduit provides a carbon dioxide permeable membrane through which carbon dioxide in the fluid can permeate in use. A carbon dioxide sensor within the housing is configured to measure carbon dioxide levels at the sensor. The housing further includes a light source that irradiates a portion of the conduit and a light sensor that is configured to measure light transmitted through or reflected by the irradiated portion of the conduit to measure the amount of fouling material within the fluid and attached to the irradiated portion of the conduit in use.Type: GrantFiled: June 23, 2022Date of Patent: March 4, 2025Assignee: STELLENBOSCH UNIVERSITYInventors: Gideon Wolfaardt, Kyle Brent Klopper
-
Publication number: 20250009257Abstract: An anthropometric growth apparatus (101, 201, 501) for measuring the anthropometry of an infant is provided. The apparatus comprises a base (103, 203, 503) with a digital scale assembly (105, 205, 505) mounted to the base and configured to measure a weight of the infant. A digital length measurement assembly (107, 207, 507) is mounted to the base and configured to measure a length of the infant. A head circumference measurement assembly (109, 209, 509) is mounted to the base and includes an array of distance sensors (111, 211, 511) provided on a support (113, 213, 513) configured to position the array of distance sensors at a selected distance from the head of the infant for non-invasive measurement of the head circumference in use. The apparatus may further be used for body composition and gestational age determination.Type: ApplicationFiled: November 17, 2022Publication date: January 9, 2025Applicant: STELLENBOSCH UNIVERSITYInventors: Klara McCLUNAN, Evette VAN NIEKERK
-
Patent number: 12188946Abstract: Methods, devices, kits and computer-implemented methods for diagnosing (and optionally treating) tuberculous meningitis (TBM) are provided. In one embodiment, the method comprises testing a cerebrospinal fluid (CSF) sample from a subject suspected of having TBM for the presence of MPO and at least two other biomarkers, at least one of the other biomarkers being selected from the group consisting of IFN-?, sICAM-1, VEGF-A and CXCL8. For example, the method can comprise testing the sample for MPO, IFN-? and VEGF-A or for MPO, IFN-?, sICAM-1 and CXCL8. In another embodiment, the method comprises testing a blood sample from a subject suspected of having TBM for the presence of at least one biomarker selected from the group consisting of adipsin (complement factor D), Ab42 and IL-10, and at least two other biomarkers. In one example, the method comprises testing the sample for the presence of adipsin (complement factor D), Ab42 and EL-10.Type: GrantFiled: May 23, 2019Date of Patent: January 7, 2025Assignee: STELLENBOSCH UNIVERSITYInventors: Novel Njweipi Chegou, Regan Shane Solomons, Gerhard Walzl, Masilo Charles Manyelo
-
Publication number: 20240425621Abstract: Terpolymers comprising optionally at least partially substituted styrene repeat units, N-alkylmaleimide repeat units and repeat units selected from the group consisting of maleic anhydride repeat units, maleic acid repeat units or maleic anhydride derivative repeat units and having a narrow molecular weight distribution are provided. The terpolymers may be used to solubilize lipid bilayers to form lipid nanodiscs and isolate membrane proteins.Type: ApplicationFiled: December 14, 2022Publication date: December 26, 2024Applicant: Stellenbosch UniversityInventors: Lubertus Klumperman, Gestél Christine Kuyler
-
Patent number: 12173344Abstract: The present invention relates to a method of producing a heterologous polypeptide of interest in a host cell, wherein the method comprises expressing a fusion protein comprising the heterologous polypeptide of interest and a fluorescent fusion partner in a host cell modified to include a nucleic acid encoding a lytic protein operably linked to a promoter, wherein translation of the lytic protein is under control of an RNA thermometer. Also provided are E. coli cells which express the fusion protein and include a nucleic acid encoding a lytic protein operably linked to a promoter, wherein translation of the lytic protein regulated by an RNA thermometer.Type: GrantFiled: November 16, 2021Date of Patent: December 24, 2024Assignee: Stellenbosch UniversityInventors: Anton Du Preez van Staden, Carine Smith, Dominic Nicholas, Leon Milner Theodore Dicks, Ross Rayne Vermeulen
-
Patent number: 12168768Abstract: The present invention is directed to a yeast strain, or strains, secreting a full suite, or any subset of that full suite, of enzymes to hydrolyze corn starch, corn fiber, lignocellulose, (including enzymes that hydrolyze linkages in cellulose, hemicellulose, and between lignin and carbohydrates) and to utilize pentose sugars (xylose and arabinose). The invention is also directed to the set of proteins that are well expressed in yeast for each category of enzymatic activity. The resulting strain, or strains can be used to hydrolyze starch and cellulose simultaneously. The resulting strain, or strains can be also metabolically engineered to produce less glycerol and uptake acetate. The resulting strain, or strains can also be used to produce ethanol from granular starch without liquefaction.Type: GrantFiled: October 13, 2021Date of Patent: December 17, 2024Assignees: DANSTAR FERMENT AG, STELLENBOSCH UNIVERSITYInventors: Elena Brevnova, John E. McBride, Erin Wiswall, Kevin S. Wenger, Nicky Caiazza, Heidi Hau, Aaron Argyros, Frank Agbogbo, Charles F. Rice, Trisha Barrett, John S. Bardsley, Abigail Foster, Anne K. Warner, Mark Mellon, Ryan Skinner, Indraneel Shikhare, Riaan Den Haan, Chhayal V. Gandhi, Alan Belcher, Vineet B. Rajgarhia, Allan C. Froehlich, Kristen M. Deleault, Emily Stonehouse, Shital A. Tripathi, Jennifer Gosselin, Yin-Ying Chiu, Haowen Xu
-
Publication number: 20240378518Abstract: A system and method for operations management in a workplace environment incorporating human resources in an automated environment. The system includes a network of a plurality of modular shell components with each shell component configured to include data stores and plugin software components to autonomously manage data and decisions related to the operations of a resource or an activity in an automated environment. In the network, at least one of the shell components is configured for a human resource; at least one of the shell components is configured for a non-human resource; and at least one of the shell components is configured for an activity to be carried out by a human resource or a non-human resource. Each shell component includes a communication component to communicate with one or more other shell components to provide a scalable architecture.Type: ApplicationFiled: May 25, 2022Publication date: November 14, 2024Applicant: STELLENBOSCH UNIVERSITYInventors: Dale Eric Sparrow, Karel Kruger
-
Patent number: 11972535Abstract: A computer-implemented method and a system are provided for visualising colocalised fluorescence signals. The method accesses signal intensity data obtained from a first fluorescence channel and a second fluorescence channel in which the signal intensity data is associated with voxels in an image. A regression factor on the signal intensity data is calculated to generate a regression parameter corresponding to a degree of correlation between the signal intensity data obtained from the first and second fluorescence channels The signal intensity data is mapped to the regression parameter and colourmap values are assigned to each voxel based on the mapped signal intensity data in which colourmap values of voxels embodying poorly correlated signal intensity data are reduced. The method renders the voxels in the image in colours according to their colourmap values to visualise colocalisation in the image.Type: GrantFiled: April 3, 2020Date of Patent: April 30, 2024Assignee: STELLENBOSCH UNIVERSITYInventors: Benjamin Loos, Thomas Richard Niesler, Rensu Petrus Theart
-
Patent number: 11944421Abstract: A needle is provided that has terminals located at or near its tip. The terminals are connectable to an impedance calculating circuit configured to enable the impedance calculating circuit to apply an alternating current input electrical signal to the terminals. The terminals are further configured to enable the impedance calculating circuit to measure a resultant electrical signal and calculate an impedance of biological tissue surrounding the tip. The needle may further include light transmitting media, that extends along the needle, and that is connectable to a light circuit. The light circuit may include an emitter/detector pair for transmitting light from the emitter, along the media, and emitting the light from the tip. A reflection of the emitted light may be transmitted from the tip to the detector and the light circuit may calculate the light absorption of the tissue.Type: GrantFiled: April 3, 2019Date of Patent: April 2, 2024Assignee: STELLENBOSCH UNIVERSITYInventors: Pieter Rousseau Fourie, Tys Van Der Merwe
-
Patent number: 11944102Abstract: The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5? UAAACAAUCGCAAGAAGCUGA 3? (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5? AGCUUCUUGCGAUUGUUUAAG 3? (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.Type: GrantFiled: March 5, 2019Date of Patent: April 2, 2024Assignee: Stellenbosch UniversityInventors: Anna-Maria Botha-Oberholster, Hendrik Willem Swiegers, Nicolaas Francois Visser Burger
-
Patent number: 11852629Abstract: A method, device and system for determining autophagic flux are claimed. The levels of proteins which change with increased or decreased autophagy are determined in a sample. The change in the level of each protein is quantified in order to obtain the autophagic flux. This can be compared to a sample flux range associated with autophagy dysfunction or ageing patterns. Diseases or conditions which may be diagnosed include neurodegenerative conditions such as Alzheimer's disease and dementia, cancer, heart conditions, immune conditions or aging-related conditions. The device for determining autophagic flux comprises a housing, receiving zones configured for receiving a substrate and a biological sample, and a set of electrodes for each receiving zone. The device is connectable to circuitry that determines an electrical property of each substrate and uses this to determine the autophagic flux.Type: GrantFiled: July 1, 2019Date of Patent: December 26, 2023Assignee: Stellenbosch UniversityInventors: Benjamin Loos, Jan Hendrik Servaas Hofmeyr, Willem Jacobus Perold, Andre Du Toit
-
Patent number: 11839335Abstract: A dispenser, a dispensing system and a dispensing method are disclosed. A plurality of dispensers may be implemented. The dispenser includes a flexible container having a top and a bottom and capable of holding a product therein, the flexible container including top and bottom openings. A rigid support structure that supports the flexible container is provided. A moveable dispensing arm that operatively facilitates product dispensing is also provided. The moveable dispensing arm is operable between a dispensing condition and a retaining condition, and it includes a pinching edge which is configured to pinch the flexible container shut in either the dispensing condition or the retaining condition of the dispensing arm.Type: GrantFiled: December 13, 2021Date of Patent: December 12, 2023Assignee: STELLENBOSCH UNIVERSITYInventor: Kimberly Ann Kasper
-
Publication number: 20230392177Abstract: The present invention relates to a method of producing a heterologous polypeptide of interest in a host cell, wherein the method comprises expressing a fusion protein comprising the heterologous polypeptide of interest and a fluorescent fusion partner in a host cell modified to include a nucleic acid encoding a lytic protein operably linked to a promoter, wherein translation of the lytic protein is under control of an RNA thermometer. Also provided are E. coli cells which express the fusion protein and include a nucleic acid encoding a lytic protein operably linked to a promoter, wherein translation of the lytic protein regulated by an RNA thermometer.Type: ApplicationFiled: November 16, 2021Publication date: December 7, 2023Applicant: Stellenbosch UniversityInventors: Anton Du Preez van Staden, Carine Smith, Dominic Nicholas, Leon Milner Theodore Dicks, Ross Rayne Vermeulen
-
Patent number: 11833179Abstract: A probiotic composition comprising Bacillus amyloliquefaciens, Enterococcus faecalis, Lactobacillus salivarius, Lactobacillus johnsonii, Lactobacillus gallinarum and Lactobacillus crispatus is provided. The probiotic composition stimulates the immune response of chickens without negatively affecting growth performance. The probiotic composition can be added to poultry feed to improve the health and performance of chickens, and can be used as a replacement for antibiotic supplementation.Type: GrantFiled: October 15, 2018Date of Patent: December 5, 2023Assignee: Stellenbosch UniversityInventors: Deon Pieter Neveling, Leon Milner Theodore Dicks
-
Publication number: 20230366880Abstract: This invention relates to methods of diagnosing COVID-19 disease, preferably post-acute COVID-19 syndrome, in a subject using a fluorescent or microscopy detection method to detect persistent anomalous (amyloid) clotlets in the sample, wherein the presence of persistent anomalous (or amyloid) clotlets in the sample, particularly clotlets that are resistant to fibrinolysis, is indicative of either acute COVID-19 disease or post-acute COVID-19 syndrome in the subject. The invention also relates to diagnostic kits for diagnosing acute COVID-19 disease, in particular post-acute COVID-19 syndrome, in a subject based on the methods disclosed.Type: ApplicationFiled: April 20, 2022Publication date: November 16, 2023Applicant: Stellenbosch UniversityInventor: Etheresia PRETORIUS
-
Patent number: 11814402Abstract: This invention relates to a series of binuclear palladacycle compounds, and methods for the production of these compounds, that are suitable for use in the treatment of cancer. In particular embodiments, R1 is phenyl substituted with two occurrences of isopropyl, R2 is Cl, and R3 is independently one or more substituents selected from —O(CH2)2O(CH2)2OH, —O(CH2)2O(CH2)2O(CH2)2OH, —O(CH2)2OH, and —O(CH2)2O(CH2)2OCH3.Type: GrantFiled: February 15, 2019Date of Patent: November 14, 2023Assignees: Stellenbosch University, University of Cape TownInventors: Angelique Blanckenberg, Annick Van Niekerk, Selwyn Frank Mapolie, Sharon Prince
-
Publication number: 20230340450Abstract: The present invention relates to a bioreactor for the catalytic conversion of a substrate to a product using an immobilized enzyme. The immobilized enzyme is a histidine tagged enzyme, which binds to a nickel-nanoparticle coated cellulose matrix which is housed within the bioreactor. The invention also relates to methods of producing products by enzymatic catalysis using the bioreactor of the invention.Type: ApplicationFiled: June 22, 2021Publication date: October 26, 2023Applicant: STELLENBOSCH UNIVERSITYInventors: Bianke Loedolff, Dominic Nicholas, Ethan Wade Hunter, Leon Milner Dicks, Nicholas George Enslin, Shaun Wayne Peters
-
Publication number: 20230341151Abstract: Systems and methods for calibrating a heliostat (104) are disclosed. An imaging device (100) is positioned and oriented so that a calibration target (130) reflected by the heliostat (103) is visible at the imaging device and an image taken. Multiple features of the reflected calibration target in the image are identified and used to determine a centroid of reflection within the image which is then mapped to a corresponding centroid position on the calibration target. A vector t that extends between the centroid position on the calibration target and a known position of the heliostat, as well as a vectors that extends between the known positions of the imaging device and of the heliostat, are determined. A normal vector nof the heliostat is determined as the vector that bisects s and t and is used to calibrate the heliostat by updating parameters of a heliostat tracking model.Type: ApplicationFiled: October 1, 2021Publication date: October 26, 2023Applicant: Stellenbosch UniversityInventor: Willem Jacobus Smit