Patents Assigned to Stellenbosch University
-
Patent number: 12275697Abstract: The invention provides a method for depolymerising a phenolic polymer, the method comprising reacting the phenolic polymer with dimethylsulphoxide (DMSO) and a hydrogen halide. The phenolic polymer may be selected from the group consisting of lignin and derivatives thereof. The hydrogen halide may be HBr. The quantity of hydrogen halide per gram of phenolic polymer may be from 30 mmoles to 70 mmoles. The quantity of DMSO per gram of phenolic polymer may be from 0.1 mole to 1 mole. The reaction may be performed at a temperature of from 100 to 120° C. The reaction may be carried out for between 10 h and 14 h. The product of the reaction may comprise vanillin.Type: GrantFiled: April 23, 2020Date of Patent: April 15, 2025Assignee: Stellenbosch UniversityInventors: Ndumiso Sibanda, Harold Pasch, Helen Pfukwa
-
Patent number: 12241658Abstract: Systems and methods for calibrating a heliostat (104) are disclosed. An imaging device (100) is positioned and oriented so that a calibration target (130) reflected by the heliostat (103) is visible at the imaging device and an image taken. Multiple features of the reflected calibration target in the image are identified and used to determine a centroid of reflection within the image which is then mapped to a corresponding centroid position on the calibration target. A vector t that extends between the centroid position on the calibration target and a known position of the heliostat, as well as a vectors that extends between the known positions of the imaging device and of the heliostat, are determined. A normal vector n of the heliostat is determined as the vector that bisects s and t and is used to calibrate the heliostat by updating parameters of a heliostat tracking model.Type: GrantFiled: October 1, 2021Date of Patent: March 4, 2025Assignee: Stellenbosch UniversityInventor: Willem Jacobus Smit
-
Publication number: 20240425621Abstract: Terpolymers comprising optionally at least partially substituted styrene repeat units, N-alkylmaleimide repeat units and repeat units selected from the group consisting of maleic anhydride repeat units, maleic acid repeat units or maleic anhydride derivative repeat units and having a narrow molecular weight distribution are provided. The terpolymers may be used to solubilize lipid bilayers to form lipid nanodiscs and isolate membrane proteins.Type: ApplicationFiled: December 14, 2022Publication date: December 26, 2024Applicant: Stellenbosch UniversityInventors: Lubertus Klumperman, Gestél Christine Kuyler
-
Patent number: 12173344Abstract: The present invention relates to a method of producing a heterologous polypeptide of interest in a host cell, wherein the method comprises expressing a fusion protein comprising the heterologous polypeptide of interest and a fluorescent fusion partner in a host cell modified to include a nucleic acid encoding a lytic protein operably linked to a promoter, wherein translation of the lytic protein is under control of an RNA thermometer. Also provided are E. coli cells which express the fusion protein and include a nucleic acid encoding a lytic protein operably linked to a promoter, wherein translation of the lytic protein regulated by an RNA thermometer.Type: GrantFiled: November 16, 2021Date of Patent: December 24, 2024Assignee: Stellenbosch UniversityInventors: Anton Du Preez van Staden, Carine Smith, Dominic Nicholas, Leon Milner Theodore Dicks, Ross Rayne Vermeulen
-
Patent number: 11944102Abstract: The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5? UAAACAAUCGCAAGAAGCUGA 3? (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5? AGCUUCUUGCGAUUGUUUAAG 3? (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.Type: GrantFiled: March 5, 2019Date of Patent: April 2, 2024Assignee: Stellenbosch UniversityInventors: Anna-Maria Botha-Oberholster, Hendrik Willem Swiegers, Nicolaas Francois Visser Burger
-
Patent number: 11852629Abstract: A method, device and system for determining autophagic flux are claimed. The levels of proteins which change with increased or decreased autophagy are determined in a sample. The change in the level of each protein is quantified in order to obtain the autophagic flux. This can be compared to a sample flux range associated with autophagy dysfunction or ageing patterns. Diseases or conditions which may be diagnosed include neurodegenerative conditions such as Alzheimer's disease and dementia, cancer, heart conditions, immune conditions or aging-related conditions. The device for determining autophagic flux comprises a housing, receiving zones configured for receiving a substrate and a biological sample, and a set of electrodes for each receiving zone. The device is connectable to circuitry that determines an electrical property of each substrate and uses this to determine the autophagic flux.Type: GrantFiled: July 1, 2019Date of Patent: December 26, 2023Assignee: Stellenbosch UniversityInventors: Benjamin Loos, Jan Hendrik Servaas Hofmeyr, Willem Jacobus Perold, Andre Du Toit
-
Publication number: 20230392177Abstract: The present invention relates to a method of producing a heterologous polypeptide of interest in a host cell, wherein the method comprises expressing a fusion protein comprising the heterologous polypeptide of interest and a fluorescent fusion partner in a host cell modified to include a nucleic acid encoding a lytic protein operably linked to a promoter, wherein translation of the lytic protein is under control of an RNA thermometer. Also provided are E. coli cells which express the fusion protein and include a nucleic acid encoding a lytic protein operably linked to a promoter, wherein translation of the lytic protein regulated by an RNA thermometer.Type: ApplicationFiled: November 16, 2021Publication date: December 7, 2023Applicant: Stellenbosch UniversityInventors: Anton Du Preez van Staden, Carine Smith, Dominic Nicholas, Leon Milner Theodore Dicks, Ross Rayne Vermeulen
-
Patent number: 11833179Abstract: A probiotic composition comprising Bacillus amyloliquefaciens, Enterococcus faecalis, Lactobacillus salivarius, Lactobacillus johnsonii, Lactobacillus gallinarum and Lactobacillus crispatus is provided. The probiotic composition stimulates the immune response of chickens without negatively affecting growth performance. The probiotic composition can be added to poultry feed to improve the health and performance of chickens, and can be used as a replacement for antibiotic supplementation.Type: GrantFiled: October 15, 2018Date of Patent: December 5, 2023Assignee: Stellenbosch UniversityInventors: Deon Pieter Neveling, Leon Milner Theodore Dicks
-
Publication number: 20230366880Abstract: This invention relates to methods of diagnosing COVID-19 disease, preferably post-acute COVID-19 syndrome, in a subject using a fluorescent or microscopy detection method to detect persistent anomalous (amyloid) clotlets in the sample, wherein the presence of persistent anomalous (or amyloid) clotlets in the sample, particularly clotlets that are resistant to fibrinolysis, is indicative of either acute COVID-19 disease or post-acute COVID-19 syndrome in the subject. The invention also relates to diagnostic kits for diagnosing acute COVID-19 disease, in particular post-acute COVID-19 syndrome, in a subject based on the methods disclosed.Type: ApplicationFiled: April 20, 2022Publication date: November 16, 2023Applicant: Stellenbosch UniversityInventor: Etheresia PRETORIUS
-
Patent number: 11814402Abstract: This invention relates to a series of binuclear palladacycle compounds, and methods for the production of these compounds, that are suitable for use in the treatment of cancer. In particular embodiments, R1 is phenyl substituted with two occurrences of isopropyl, R2 is Cl, and R3 is independently one or more substituents selected from —O(CH2)2O(CH2)2OH, —O(CH2)2O(CH2)2O(CH2)2OH, —O(CH2)2OH, and —O(CH2)2O(CH2)2OCH3.Type: GrantFiled: February 15, 2019Date of Patent: November 14, 2023Assignees: Stellenbosch University, University of Cape TownInventors: Angelique Blanckenberg, Annick Van Niekerk, Selwyn Frank Mapolie, Sharon Prince
-
Publication number: 20230341151Abstract: Systems and methods for calibrating a heliostat (104) are disclosed. An imaging device (100) is positioned and oriented so that a calibration target (130) reflected by the heliostat (103) is visible at the imaging device and an image taken. Multiple features of the reflected calibration target in the image are identified and used to determine a centroid of reflection within the image which is then mapped to a corresponding centroid position on the calibration target. A vector t that extends between the centroid position on the calibration target and a known position of the heliostat, as well as a vectors that extends between the known positions of the imaging device and of the heliostat, are determined. A normal vector nof the heliostat is determined as the vector that bisects s and t and is used to calibrate the heliostat by updating parameters of a heliostat tracking model.Type: ApplicationFiled: October 1, 2021Publication date: October 26, 2023Applicant: Stellenbosch UniversityInventor: Willem Jacobus Smit
-
Publication number: 20230081546Abstract: A method of determining the location and quantity of mitochondrial fission, fusion and depolarisation events that occur in a cell is provided. Using a three-dimensional time lapse image sequence of a cell, the method identifies which of the mitochondria in a cell had depolarised or undergone fission or fusion in the interval between the acquisition of the earlier and later images, indicates the locations of the fission, fusion and depolarisation events, and generates a count of the number of mitochondrial fission, fusion and/or depolarisation events. The method can be used to diagnose a disease or condition associated with mitochondrial dysfunction, such as neurodegenerative disease, cancer or ischaemic heart disease. The method can further be used to screen a compound or composition for use in preventing or treating a disease or condition associated with mitochondrial dysfunction. The method can be computer-implemented, and a computer program product is provided.Type: ApplicationFiled: February 1, 2021Publication date: March 16, 2023Applicant: Stellenbosch UniversityInventors: Benjamin LOOS, Thomas Richard NIESLER, Rensu Petrus THEART
-
Publication number: 20230081369Abstract: The present invention relates to methods of increasing the cellular concentration of Interferon Induced Protein with Tetratricopeptide repeats (IFIT) polypeptides in a cell infected with a mycobacterium. The method includes the introduction of exogenous IFIT polypeptides or expression vectors encoding the exogenous IFIT polypeptides into the cell, wherein increasing the cellular concentration of the IFIT polypeptide reduces the number of viable mycobacteria in the cell. The invention also relates to methods of treatment and uses of IFIT proteins and uses of vectors encoding IFIT proteins.Type: ApplicationFiled: October 8, 2020Publication date: March 16, 2023Applicant: Stellenbosch UniversityInventors: Abhilasha Madhvi Mishra, Bienyameen Baker
-
Publication number: 20220227694Abstract: The invention provides a method for depolymerising a phenolic polymer, the method comprising reacting the phenolic polymer with dimethylsulphoxide (DMSO) and a hydrogen halide. The phenolic polymer may be selected from the group consisting of lignin and derivatives thereof. The hydrogen halide may be HBr. The quantity of hydrogen halide per gram of phenolic polymer may be from 30 mmoles to 70 mmoles. The quantity of DMSO per gram of phenolic polymer may be from 0.1 mole to 1 mole. The reaction may be performed at a temperature of from 100 to 120° C. The reaction may be carried out for between 10 h and 14 h. The product of the reaction may comprise vanillin.Type: ApplicationFiled: April 23, 2020Publication date: July 21, 2022Applicant: Stellenbosch UniversityInventors: Ndumiso SIBANDA, Harold PASCH, Helen PFUKWA
-
Patent number: 11357822Abstract: A method for treating a subject suffering from Alzheimer's disease is provided. The method includes administering to the subject a therapeutically effective amount of lipopolysaccharide-binding protein (LBP). A composition including a therapeutically effective amount of LBP is also provided.Type: GrantFiled: October 4, 2017Date of Patent: June 14, 2022Assignee: Stellenbosch UniversityInventors: Etheresia Pretorius, Douglas Bruce Kell
-
Publication number: 20210393709Abstract: A probiotic composition comprising Bacillus amyloliquefaciens, Enterococcus faecalis, Lactobacillus salivarius, Lactobacillus johnsonii, Lactobacillus gallinarum and Lactobacillus crispatus is provided. The probiotic composition stimulates the immune response of chickens without negatively affecting growth performance. The probiotic composition can be added to poultry feed to improve the health and performance of chickens, and can be used as a replacement for antibiotic supplementation.Type: ApplicationFiled: October 15, 2018Publication date: December 23, 2021Applicant: Stellenbosch UniversityInventors: Deon Pieter NEVELING, Leon Milner Theodore Dicks
-
Patent number: 11193130Abstract: The present invention is directed to a yeast strain, or strains, secreting a full suite, or any subset of that full suite, of enzymes to hydrolyze corn starch, corn fiber, lignocellulose, (including enzymes that hydrolyze linkages in cellulose, hemicellulose, and between lignin and carbohydrates) and to utilize pentose sugars (xylose and arabinose). The invention is also directed to the set of proteins that are well expressed in yeast for each category of enzymatic activity. The resulting strain, or strains can be used to hydrolyze starch and cellulose simultaneously. The resulting strain, or strains can be also metabolically engineered to produce less glycerol and uptake acetate. The resulting strain, or strains can also be used to produce ethanol from granular starch without liquefaction.Type: GrantFiled: May 30, 2019Date of Patent: December 7, 2021Assignees: Lallemand Hungary Liquidity Management LLC, Stellenbosch UniversityInventors: Elena Brevnova, John E. McBride, Erin Wiswall, Kevin S. Wenger, Nicky Caiazza, Heidi Hau, Aaron Argyros, Frank Agbogbo, Charles F. Rice, Trisha Barrett, John S. Bardsley, Abigail Foster, Anne K. Warner, Mark Mellon, Ryan Skinner, Indraneel Shikhare, Riaan Den Haan, Chhayal V. Gandhi, Alan Belcher, Vineet B. Rajgarhia, Allan C. Froehlich, Kristen M. Deleault, Emily Stonehouse, Shital A. Tripathi, Jennifer Gosselin, Yin-Ying Chiu, Haowen Xu
-
Publication number: 20210325088Abstract: A heat transfer device (100) includes an inner tube (102) mounted within a tubular chamber (104) of a heat exchanger (106). The hollow tubular chamber (104) has a closed end (108) with inwardly sloping inner surfaces (110) and the inner tube (102) has an open end (112) that terminates short of the closed end (108). A diffuser (114) is provided and is shaped such that an operatively front part (116) thereof substantially conforms to a shape of the inner surfaces (110) of the closed end (108) so as to form a narrow flow passageway (118) between the diffuser (114) and the inner surfaces (110) at the closed end (108), and an operatively back part (120) of the diffuser (114) slopes towards the inner tube (102) and away from its open end (112) to form a diffusion zone (122). Heat transfer assemblies utilising the heat transfer device (100) are also disclosed.Type: ApplicationFiled: December 11, 2019Publication date: October 21, 2021Applicant: Stellenbosch UniversityInventors: Derwalt Johannes ERASMUS, Theodor Willem VON BACKSTRÖM, David MCDOUGALL, Matti LUBKOLL
-
Publication number: 20210116446Abstract: A method, device and system for determining autophagic flux are claimed. The levels of proteins which change with increased or decreased autophagy are determined in a sample. The change in the level of each protein is quantified in order to obtain the autophagic flux. This can be compared to a sample flux range associated with autophagy dysfunction or ageing patterns. Diseases M or conditions which may be diagnosed include neurodegenerative conditions such as Alzheimer's disease and dementia, cancer, heart conditions, immune conditions or aging-related conditions. The device for determining autophagic flux comprises a housing, receiving zones configured for receiving a substrate and a biological sample, and a set of electrodes for each receiving zone. The device is connectable to circuitry that determines an electrical property of each substrate and uses this to determine the autophagic flux.Type: ApplicationFiled: July 1, 2019Publication date: April 22, 2021Applicant: Stellenbosch UniversityInventors: Benjamin Loos, Jan Hendrik Servaas Hofmeyr, Willem Jacobus Perold, Andre Du Toit
-
Publication number: 20210000124Abstract: The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5? UAAACAAUCGCAAGAAGCUGA 3? (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5? AGCUUCUUGCGAUUGUUUAAG 3? (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.Type: ApplicationFiled: March 5, 2019Publication date: January 7, 2021Applicant: Stellenbosch UniversityInventors: Anna-Maria BOTHA-OBERHOLSTER, Hendrik Willem SWIEGERS, Nicolaas Francois Visser BURGER