Patents Assigned to Stellenbosch University
  • Publication number: 20210393709
    Abstract: A probiotic composition comprising Bacillus amyloliquefaciens, Enterococcus faecalis, Lactobacillus salivarius, Lactobacillus johnsonii, Lactobacillus gallinarum and Lactobacillus crispatus is provided. The probiotic composition stimulates the immune response of chickens without negatively affecting growth performance. The probiotic composition can be added to poultry feed to improve the health and performance of chickens, and can be used as a replacement for antibiotic supplementation.
    Type: Application
    Filed: October 15, 2018
    Publication date: December 23, 2021
    Applicant: Stellenbosch University
    Inventors: Deon Pieter NEVELING, Leon Milner Theodore Dicks
  • Patent number: 11193130
    Abstract: The present invention is directed to a yeast strain, or strains, secreting a full suite, or any subset of that full suite, of enzymes to hydrolyze corn starch, corn fiber, lignocellulose, (including enzymes that hydrolyze linkages in cellulose, hemicellulose, and between lignin and carbohydrates) and to utilize pentose sugars (xylose and arabinose). The invention is also directed to the set of proteins that are well expressed in yeast for each category of enzymatic activity. The resulting strain, or strains can be used to hydrolyze starch and cellulose simultaneously. The resulting strain, or strains can be also metabolically engineered to produce less glycerol and uptake acetate. The resulting strain, or strains can also be used to produce ethanol from granular starch without liquefaction.
    Type: Grant
    Filed: May 30, 2019
    Date of Patent: December 7, 2021
    Assignees: Lallemand Hungary Liquidity Management LLC, Stellenbosch University
    Inventors: Elena Brevnova, John E. McBride, Erin Wiswall, Kevin S. Wenger, Nicky Caiazza, Heidi Hau, Aaron Argyros, Frank Agbogbo, Charles F. Rice, Trisha Barrett, John S. Bardsley, Abigail Foster, Anne K. Warner, Mark Mellon, Ryan Skinner, Indraneel Shikhare, Riaan Den Haan, Chhayal V. Gandhi, Alan Belcher, Vineet B. Rajgarhia, Allan C. Froehlich, Kristen M. Deleault, Emily Stonehouse, Shital A. Tripathi, Jennifer Gosselin, Yin-Ying Chiu, Haowen Xu
  • Publication number: 20210325088
    Abstract: A heat transfer device (100) includes an inner tube (102) mounted within a tubular chamber (104) of a heat exchanger (106). The hollow tubular chamber (104) has a closed end (108) with inwardly sloping inner surfaces (110) and the inner tube (102) has an open end (112) that terminates short of the closed end (108). A diffuser (114) is provided and is shaped such that an operatively front part (116) thereof substantially conforms to a shape of the inner surfaces (110) of the closed end (108) so as to form a narrow flow passageway (118) between the diffuser (114) and the inner surfaces (110) at the closed end (108), and an operatively back part (120) of the diffuser (114) slopes towards the inner tube (102) and away from its open end (112) to form a diffusion zone (122). Heat transfer assemblies utilising the heat transfer device (100) are also disclosed.
    Type: Application
    Filed: December 11, 2019
    Publication date: October 21, 2021
    Applicant: Stellenbosch University
    Inventors: Derwalt Johannes ERASMUS, Theodor Willem VON BACKSTRÖM, David MCDOUGALL, Matti LUBKOLL
  • Publication number: 20210116446
    Abstract: A method, device and system for determining autophagic flux are claimed. The levels of proteins which change with increased or decreased autophagy are determined in a sample. The change in the level of each protein is quantified in order to obtain the autophagic flux. This can be compared to a sample flux range associated with autophagy dysfunction or ageing patterns. Diseases M or conditions which may be diagnosed include neurodegenerative conditions such as Alzheimer's disease and dementia, cancer, heart conditions, immune conditions or aging-related conditions. The device for determining autophagic flux comprises a housing, receiving zones configured for receiving a substrate and a biological sample, and a set of electrodes for each receiving zone. The device is connectable to circuitry that determines an electrical property of each substrate and uses this to determine the autophagic flux.
    Type: Application
    Filed: July 1, 2019
    Publication date: April 22, 2021
    Applicant: Stellenbosch University
    Inventors: Benjamin Loos, Jan Hendrik Servaas Hofmeyr, Willem Jacobus Perold, Andre Du Toit
  • Publication number: 20210000124
    Abstract: The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5? UAAACAAUCGCAAGAAGCUGA 3? (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5? AGCUUCUUGCGAUUGUUUAAG 3? (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.
    Type: Application
    Filed: March 5, 2019
    Publication date: January 7, 2021
    Applicant: Stellenbosch University
    Inventors: Anna-Maria BOTHA-OBERHOLSTER, Hendrik Willem SWIEGERS, Nicolaas Francois Visser BURGER
  • Patent number: 10883239
    Abstract: A shark barrier that comprises an anchoring assembly having a pair of anchors (9) with a flexible connecting element (11) extending between the anchors. The shark barriers also includes multiple spaced apart buoyant resiliently flexible elongate members (15) that are secured at one end along a length of the connecting element of the anchoring assembly to operatively extend generally upwardly from the connecting element. The buoyant members comprise an elongate flexible spine (32) that extends through a series of tubular members (38).
    Type: Grant
    Filed: March 24, 2017
    Date of Patent: January 5, 2021
    Assignee: Stellenbosch University
    Inventors: Michael Rutzen, Sara Andreotti, Pierre Becker, Laurie Barwell
  • Patent number: 10663463
    Abstract: A system and method for the detection and quantification of biomolecules by measuring a piezoelectric signal is described. The system comprises a plurality of elongate zinc oxide nanowires mounted generally parallel to each another on a semi conductive silicon substrate. The free ends of the nanowires are provided with biomolecules that are capable of associating with complementary biomolecules within a biological or water sample. Following incubation of the system in a sample, the association of molecules of interest with the immobilised biomolecules on the system results in the displacement of the zinc oxide nanowires. The displacement of the nanowires produces a piezoelectric voltage signal that is useful in diagnosing a pathogenic infection or the contamination of a sample.
    Type: Grant
    Filed: November 3, 2014
    Date of Patent: May 26, 2020
    Assignee: Stellenbosch University
    Inventors: Leon Milner Theodore Dicks, Willem Jacobus Perold, Deon Nevwling, Thomas Stanley Van Den Heever
  • Patent number: 10633551
    Abstract: A solution including an antimicrobial polymer in a polar solvent and a method of producing the solution. The polymer has the structure of Formula (I). The antimicrobial solution may be coated onto a substrate and cured to provide an antimicrobial substrate in which the polymer is covalently bonded to the substrate so that it cannot leach from the substrate.
    Type: Grant
    Filed: February 20, 2018
    Date of Patent: April 28, 2020
    Assignee: Stellenbosch University
    Inventors: William Cloete, Lubertus Klumperman
  • Patent number: 10517558
    Abstract: An ankle imaging accessory is provided by the present invention, particularly an ankle positioning device to facilitate the taking of X-ray views of a patient who had sustained an ankle fracture. The ankle imaging accessory is made from an X-ray translucent material and includes heel supports on which heels of a patient can locate. A pair of spaced apart stops defines the limits of an arc on which a foot pivoting on the heel support can move.
    Type: Grant
    Filed: May 31, 2017
    Date of Patent: December 31, 2019
    Assignee: Stellenbosch University
    Inventor: De la Rey Hertzog Scheepers Badenhorst
  • Patent number: 10512271
    Abstract: The invention provides a method for preventing or treating microbial growth on a manufactured material or product. A composition comprising a cyclic decapeptide which is a tyrocidine, trypocidine, phenycidine or gramicidin S having an amino acid sequence of cyclo(valine-X1-leucine-D-phenylalanine-proline-X2-X3-X4-X5-X6) (SEQ ID NO: 1) is applied to the product and the cyclic decapeptides are adsorbed onto the product. Suitable products include medical devices (e.g. a catheter), wound dressings, food packaging, containers, wrappings, surfaces or devices used in the processing, transport or storage of food, filters, composites, paper, wrapping materials, walls, work surfaces, floors, pipes or the like. The composition could be used to disinfect or sterilise a material, surface or product or to inhibit formation of biofilms and/or biofouling on the surface of the product to which it is applied.
    Type: Grant
    Filed: June 2, 2015
    Date of Patent: December 24, 2019
    Assignee: STELLENBOSCH UNIVERSITY
    Inventors: Marina Rautenbach, Wilma Van Rensburg
  • Patent number: 10479854
    Abstract: A peptide-polymer conjugate is provided for use in treating malaria infections, and in particular terminal or drug resistant malaria infections. The conjugate is formed from a polymer to which a peptide having activity against a malaria parasite is co-valently attached. The peptide is a cyclic decapeptide from the closely-related group of tyrocidines, tryptocidines, phenycidines and gramicidin S, and the polymer is a hydrophilic and biocompatible polymer with a terminal thiol, such as poly(N-vinylpyrrolidone) (PVP). The polymer chains can be decorated with a hydrophilic targeting ligand that specifically targets an epitope on red blood cells, and in particular red blood cells infected with a plasmodial parasite. A method for synthesising the peptide-polymer conjugate is also provided.
    Type: Grant
    Filed: August 12, 2015
    Date of Patent: November 19, 2019
    Assignee: Stellenbosch University
    Inventors: Lubertus Klumperman, Paul William Reader, Marina Rautenbach
  • Patent number: 10395560
    Abstract: A versatile phantom provides image quality control on multiple different types of medical x-ray imaging equipment. The phantom has a radiolucent housing including a first series of elements of the same shape and size wherein each element has a different electron density such that grey scale can be evaluated. A second series of elements of the same shape and material has a range of different sizes for assessing low contrast detectability. At least one position indicating item is selected from a central ball within the housing, position indicating lines on the housing and a unique flat peripheral face of the housing. The phantom also has at least one mammography dedicated item selected from elements representative of mammography fibers and mammography micro-calcifications. An instruction manual and optional result analysis program provides for semi-automatic result analysis for analyzing results and recommending corrective action for test results that are out of tolerance.
    Type: Grant
    Filed: March 2, 2016
    Date of Patent: August 27, 2019
    Assignee: Stellenbosch University
    Inventor: Annemari Groenewald
  • Patent number: 10328842
    Abstract: A cargo securing apparatus and a method of maintaining a user configured tension in a cargo securing element are disclosed. The apparatus includes at least one sensor arranged to measure a first and second tension in a tensile element (used to secure the cargo) at different times and a processor in data communication with the sensor. The processor is configured to receive the tension measurements from the sensor and to distinguish between acute and sustained deviations in tension based on the tension measurements. Conditionally, the processor may compare the first and second tension measurements to a user configured tension setting and determine tension correction parameters required to maintain the tension in the tensile element within a range of the user configured setting. The apparatus may include one or more manual or automated adjustment drives to adjust the tension in the tensile element in accordance with the tension correction parameters.
    Type: Grant
    Filed: November 13, 2015
    Date of Patent: June 25, 2019
    Assignee: STELLENBOSCH UNIVERSITY
    Inventor: Leo David McNally
  • Patent number: 10315128
    Abstract: A dephlegmator is provided comprising two stages connected in series wherein a first stage includes an air-cooled reflux condenser and a second stage includes a generally horizontal tube bundle of smooth or finned tubes that can be operated selectively in either an air-cooled (dry) mode under selected ambient conditions or in a wet evaporatively cooled mode under other selected ambient conditions including that of elevated ambient temperature. Spray nozzles may be installed above the tube bundle whereby water can be sprayed onto the tube bundle. One or more collection troughs are preferably provided beneath the tube bundle for collecting run-off water and enabling recycling of excess deluge water. Preferably, the tube bundle comprises at least two, and preferably three groups of tubes communicating with each other wherein the second group of tubes has appreciably fewer tubes in it than the first group of tubes and any third group of tubes has appreciably fewer tubes in it than the second group of tubes.
    Type: Grant
    Filed: July 10, 2012
    Date of Patent: June 11, 2019
    Assignee: Stellenbosch University
    Inventors: Hanno Carl Rudolf Reuter, Detlev G. Kröger
  • Patent number: 10302637
    Abstract: A device for detecting target biomolecules is provided. The device consists of an electrically conductive membrane having a biological recognition component configured to bind a target biomolecule immobilized thereon. The membrane is connected to an electric circuit by means of electrodes. A voltage source applies a voltage to the membrane and a resistance monitoring device monitors the resistance of the membrane as a selected volume of fluid sample suspected of containing the target biomolecule is delivered onto the membrane.
    Type: Grant
    Filed: November 16, 2016
    Date of Patent: May 28, 2019
    Assignee: Stellenbosch University
    Inventors: Christiaan Gunter Alwyn Viviers, Willem Jacobus Perold, Leon Milner Theodore Dicks, Giles Hubert Coyle Maybery
  • Patent number: 10294484
    Abstract: The present invention is directed to a yeast strain, or strains, secreting a full suite, or any subset of that full suite, of enzymes to hydrolyze corn starch, corn fiber, lignocellulose, (including enzymes that hydrolyze linkages in cellulose, hemicellulose, and between lignin and carbohydrates) and to utilize pentose sugars (xylose and arabinose). The invention is also directed to the set of proteins that are well expressed in yeast for each category of enzymatic activity. The resulting strain, or strains can be used to hydrolyze starch and cellulose simultaneously. The resulting strain, or strains can be also metabolically engineered to produce less glycerol and uptake acetate. The resulting strain, or strains can also be used to produce ethanol from granular starch without liquefaction.
    Type: Grant
    Filed: November 10, 2015
    Date of Patent: May 21, 2019
    Assignees: Lallemand Hungary Liquidity Management LLC, Stellenbosch University
    Inventors: Elena Brevnova, John E. McBride, Erin Wiswall, Kevin S. Wenger, Nicky Caiazza, Heidi Lau, Aaron Argyros, Frank Agbogbo, Charles F. Rice, Trisha Barrett, John S. Bardsley, Abigail Foster, Anne K. Warner, Mark Mellon, Ryan Skinner, Indraneel Shikhare, Riaan Den Haan, Chhayal V. Gandhi, Alan Belcher, Vineet B. Rajgarhia, Allan C. Froehlich, Kristen M. Deleault, Emily Stonehouse, Shital A. Tripathi, Jennifer Gosselin, Yin-Ying Chiu, Haowen Xu
  • Publication number: 20190119873
    Abstract: A shark barrier that comprises an anchoring assembly having a pair of anchors (9) with a flexible connecting element (11) extending between the anchors. The shark barriers also includes multiple spaced apart buoyant resiliently flexible elongate members (15) that are secured at one end along a length of the connecting element of the anchoring assembly to operatively extend generally upwardly from the connecting element. The buoyant members comprise an elongate flexible spine (32) that extends through a series of tubular members (38).
    Type: Application
    Filed: March 24, 2017
    Publication date: April 25, 2019
    Applicant: Stellenbosch University
    Inventors: Michael Rutzen, Sara Andreotti, Pierre Becker, Laurie Barwell
  • Patent number: 10265365
    Abstract: The use of plant material from the Prosopis glandulosa tree (commonly known as Honey mesquite) is described for aiding sporting ability, and in particular for preventing and/or treating muscle injury and enhancing muscle strength. The plant material is typically the dried and ground pods from the tree, but could also be from other parts of the tree, such as the leaves, bark or roots.
    Type: Grant
    Filed: March 19, 2015
    Date of Patent: April 23, 2019
    Assignee: Stellenbosch University
    Inventors: Barbara Huisamen, Cindy George
  • Patent number: 10253337
    Abstract: A recombinant yeast that expresses both an ?-amylase (SEQ ID NO: 1) and a glucoamylase (SEQ ID NO: 2) from Talaromyces emersonii (recently re-named as Rasamsonia emersonii) is provided. The use of the recombinant yeast in a process for producing an alcohol, in particular a biofuel, from starch or sugars is also described.
    Type: Grant
    Filed: December 4, 2017
    Date of Patent: April 9, 2019
    Assignee: Stellenbosch University
    Inventors: Rosemary Anne Cripwell, Willem Heber Van Zyl, Shaunita Hellouise Rose
  • Patent number: 10233414
    Abstract: A method for preparing a fermented beverage having a modulated aromatic profile is provided as well as a fermented beverage produced thereby. The method includes preparing a fermentable mixture, such as juice, must, or wort and introducing ammonium sulphide into the fermentable mixture at a predetermined concentration. The fermentable mixture is then subjected to fermentation. A C6 aldehyde, C6 alcohol or a combination thereof may be added to the fermentable mixture in combination with ammonium sulphide to enhance its effect on the aromatic profile of the fermented beverage.
    Type: Grant
    Filed: July 13, 2017
    Date of Patent: March 19, 2019
    Assignee: Stellenbosch University
    Inventors: Wessel Johannes Du Toit, Sebastian Vannevel