Abstract: The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5? UAAACAAUCGCAAGAAGCUGA 3? (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5? AGCUUCUUGCGAUUGUUUAAG 3? (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.

Abstract: A shark barrier that comprises an anchoring assembly having a pair of anchors (9) with a flexible connecting element (11) extending between the anchors. The shark barriers also includes multiple spaced apart buoyant resiliently flexible elongate members (15) that are secured at one end along a length of the connecting element of the anchoring assembly to operatively extend generally upwardly from the connecting element. The buoyant members comprise an elongate flexible spine (32) that extends through a series of tubular members (38).

Abstract: A system and method for the detection and quantification of biomolecules by measuring a piezoelectric signal is described. The system comprises a plurality of elongate zinc oxide nanowires mounted generally parallel to each another on a semi conductive silicon substrate. The free ends of the nanowires are provided with biomolecules that are capable of associating with complementary biomolecules within a biological or water sample. Following incubation of the system in a sample, the association of molecules of interest with the immobilised biomolecules on the system results in the displacement of the zinc oxide nanowires. The displacement of the nanowires produces a piezoelectric voltage signal that is useful in diagnosing a pathogenic infection or the contamination of a sample.

Abstract: A solution including an antimicrobial polymer in a polar solvent and a method of producing the solution. The polymer has the structure of Formula (I). The antimicrobial solution may be coated onto a substrate and cured to provide an antimicrobial substrate in which the polymer is covalently bonded to the substrate so that it cannot leach from the substrate.

Abstract: An ankle imaging accessory is provided by the present invention, particularly an ankle positioning device to facilitate the taking of X-ray views of a patient who had sustained an ankle fracture. The ankle imaging accessory is made from an X-ray translucent material and includes heel supports on which heels of a patient can locate. A pair of spaced apart stops defines the limits of an arc on which a foot pivoting on the heel support can move.

Abstract: A peptide-polymer conjugate is provided for use in treating malaria infections, and in particular terminal or drug resistant malaria infections. The conjugate is formed from a polymer to which a peptide having activity against a malaria parasite is co-valently attached. The peptide is a cyclic decapeptide from the closely-related group of tyrocidines, tryptocidines, phenycidines and gramicidin S, and the polymer is a hydrophilic and biocompatible polymer with a terminal thiol, such as poly(N-vinylpyrrolidone) (PVP). The polymer chains can be decorated with a hydrophilic targeting ligand that specifically targets an epitope on red blood cells, and in particular red blood cells infected with a plasmodial parasite. A method for synthesising the peptide-polymer conjugate is also provided.

Abstract: A versatile phantom provides image quality control on multiple different types of medical x-ray imaging equipment. The phantom has a radiolucent housing including a first series of elements of the same shape and size wherein each element has a different electron density such that grey scale can be evaluated. A second series of elements of the same shape and material has a range of different sizes for assessing low contrast detectability. At least one position indicating item is selected from a central ball within the housing, position indicating lines on the housing and a unique flat peripheral face of the housing. The phantom also has at least one mammography dedicated item selected from elements representative of mammography fibers and mammography micro-calcifications. An instruction manual and optional result analysis program provides for semi-automatic result analysis for analyzing results and recommending corrective action for test results that are out of tolerance.

Abstract: A dephlegmator is provided comprising two stages connected in series wherein a first stage includes an air-cooled reflux condenser and a second stage includes a generally horizontal tube bundle of smooth or finned tubes that can be operated selectively in either an air-cooled (dry) mode under selected ambient conditions or in a wet evaporatively cooled mode under other selected ambient conditions including that of elevated ambient temperature. Spray nozzles may be installed above the tube bundle whereby water can be sprayed onto the tube bundle. One or more collection troughs are preferably provided beneath the tube bundle for collecting run-off water and enabling recycling of excess deluge water. Preferably, the tube bundle comprises at least two, and preferably three groups of tubes communicating with each other wherein the second group of tubes has appreciably fewer tubes in it than the first group of tubes and any third group of tubes has appreciably fewer tubes in it than the second group of tubes.

Abstract: A device for detecting target biomolecules is provided. The device consists of an electrically conductive membrane having a biological recognition component configured to bind a target biomolecule immobilized thereon. The membrane is connected to an electric circuit by means of electrodes. A voltage source applies a voltage to the membrane and a resistance monitoring device monitors the resistance of the membrane as a selected volume of fluid sample suspected of containing the target biomolecule is delivered onto the membrane.

Abstract: The present invention is directed to a yeast strain, or strains, secreting a full suite, or any subset of that full suite, of enzymes to hydrolyze corn starch, corn fiber, lignocellulose, (including enzymes that hydrolyze linkages in cellulose, hemicellulose, and between lignin and carbohydrates) and to utilize pentose sugars (xylose and arabinose). The invention is also directed to the set of proteins that are well expressed in yeast for each category of enzymatic activity. The resulting strain, or strains can be used to hydrolyze starch and cellulose simultaneously. The resulting strain, or strains can be also metabolically engineered to produce less glycerol and uptake acetate. The resulting strain, or strains can also be used to produce ethanol from granular starch without liquefaction.

Abstract: A shark barrier that comprises an anchoring assembly having a pair of anchors (9) with a flexible connecting element (11) extending between the anchors. The shark barriers also includes multiple spaced apart buoyant resiliently flexible elongate members (15) that are secured at one end along a length of the connecting element of the anchoring assembly to operatively extend generally upwardly from the connecting element. The buoyant members comprise an elongate flexible spine (32) that extends through a series of tubular members (38).

Abstract: The use of plant material from the Prosopis glandulosa tree (commonly known as Honey mesquite) is described for aiding sporting ability, and in particular for preventing and/or treating muscle injury and enhancing muscle strength. The plant material is typically the dried and ground pods from the tree, but could also be from other parts of the tree, such as the leaves, bark or roots.

Abstract: A recombinant yeast that expresses both an ?-amylase (SEQ ID NO: 1) and a glucoamylase (SEQ ID NO: 2) from Talaromyces emersonii (recently re-named as Rasamsonia emersonii) is provided. The use of the recombinant yeast in a process for producing an alcohol, in particular a biofuel, from starch or sugars is also described.

Abstract: A method for preparing a fermented beverage having a modulated aromatic profile is provided as well as a fermented beverage produced thereby. The method includes preparing a fermentable mixture, such as juice, must, or wort and introducing ammonium sulphide into the fermentable mixture at a predetermined concentration. The fermentable mixture is then subjected to fermentation. A C6 aldehyde, C6 alcohol or a combination thereof may be added to the fermentable mixture in combination with ammonium sulphide to enhance its effect on the aromatic profile of the fermented beverage.

Abstract: The present invention provides for heterologous expression of polypeptides encoded by wild-type and codon-optimized cbh2 genes from the organisms Cochliobolus heterostrophus, Gibberella zeae, Irpex lacteus, Volvariella volvacea, and Piromyces sp. in host cells, such as the yeast Saccharomyces cerevisiae. The expression in such host cells of the corresponding genes, and variants and combinations thereof, result in improved specific activity of the expressed cellobiohydrolases. Thus, such genes and expression systems are useful for efficient and cost-effective consolidated bioprocessing systems.

Abstract: The disclosure describes a composition comprising a lipidaceous carrier and a peptide complex formed from poly-L-lysine or a salt thereof; and either poly-L-glutamic acid or poly-L-aspartic acid, or a salt thereof. The composition can be used to prevent or treat a disease related to pulmonary surfactant dysfunction, such as hyaline membrane disease (HMD), respiratory distress syndrome (RDS), hydrocarbon poisoning, near-drowning, HIV/AIDS-related lung diseases, adult respiratory distress syndrome (ARDS) or acute lung injury (ALI), asthma, tuberculosis (TB) or severe acute respiratory syndrome (SARS). Alternatively, the composition can be used to increase the permeability of a pharmaceutical compound or composition across a membrane of a subject or to act as a carrier. The poly-L-lysine or salt thereof is longer than the poly-L-glutamic acid or poly-L-aspartic acid so that the complex that forms has a charge-neutralized region and a positively-charged region.

Abstract: A method of diagnosing tuberculosis (TB) disease and distinguishing between active TB and latent TB infection in a subject is described herein. A sample from the subject is stimulated with at least one Mycobacterium tuberculosis (M.tb) infection phase-dependent antigen selected from Rv0081, Rv2032, Rv1737c, Rv2389c, Rv0867c, TB18.2, Rv2099c, Rv1733c, M.tb PPD, PHA and ESAT-6/CFP-10 and the presence of at least one host marker in the sample is detected, the host marker being selected from EGF, TGF-?, TNF-?, VEGF, RANTES, IL-12(p40), IL-12(p70), IL-10, IP-10, IFN-?2, fractalkine, IFN-?, IL-13, IL-1Ra, IL-3, IL-4, IL-5, MIP-1?, ENA-78, BCA-1, TARC, X6-Ckine, eotaxin, eotaxin-2, SCF, APOA-1, APOE, HPALBN, HCF, Serum amyloid protein A (SAA), C-reactive protein (CRP), serum amyloid protein P (SAP), TIMP-1, MIP-1?, IL-6, GM-CSF, IL-1?, MMP-9, MMP-2, MCP-1, TRAIL, IL-15, IL-17F, IL-22, TNF-?, MCP-2 and MCP-4. Additional host markers may also be detected in an unstimulated sample from the subject.

Abstract: A recombinant yeast that expresses both an ?-amylase (SEQ ID NO: 1) and a glucoamylase (SEQ ID NO: 2) from Talaromyces emersonii (recently re-named as Rasamsonia emersonii) is provided. The use of the recombinant yeast in a process for producing an alcohol, in particular a biofuel, from starch or sugars is also described.

Abstract: The present invention is directed to cellulytic host cells. The host cells of the invention expressing heterologous cellulases and are able to produce ethanol from cellulose. According to the invention, host cells expressing a combination of heterologous cellulases can be used to produce ethanol from cellulose. In addition, multiple host cells expressing different heterologous cellulases can be co-cultured together and used to produce ethanol from cellulose. Furthermore, the invention demonstrates for the first time the ability of Kluveryomyces to produce ethanol from cellulose. The yeast strains and co-cultures of yeast strains of the invention can be used to produce ethanol on their own, or can also be used in combination with externally added cellulases to increase the efficiency of saccharification and fermentation processes.

Abstract: A shark barrier includes a plurality of resiliently flexible, elongate members that extend in a generally upright condition between a sea floor and a sea surface. The elongate members are arranged so as to have the appearance of a thicket, preferably a kelp forest, when viewed from within the water and include magnets to assist in deterring certain shark species. The elongate members may be secured to the sea floor by an anchoring base and are held in the generally upright condition by a buoy or buoyant material held within the elongate members.