Abstract: Provided herein are systems and methods for an iterative approach to topic modeling and the use of web mapping technology to implement advanced spatial operators for interactive high-dimensional visualization and inference.

Abstract: A composition for the treatment of bladder fibrosis in a patient in need that includes a miR-29 mimic is disclosed. The miR-29 mimic may include a working RNA strand with the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO 4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO 5). The passenger RNA strand includes a 2?-O-methylation modification to increase stability. Cholesterol is conjugated to the 3?-end of the passenger RNA strand to enhance cellular uptake. The composition may further include a carrier molecule including, but not limited to, branched polyethylenimine at an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands. In some aspects, the composition may be an injectable composition that includes a polyplex dissolved in a 0.5% glucose solution, where the polyplex is formed from the working and passenger RNA strands and the carrier molecule.

Abstract: The disclosure relates to molecularly-imprinted cross-linked micelles that can selectively hydrolyze carbohydrates.

Abstract: Disclosed herein are embodiments of an Al—Ce—Ni alloy for use in additive manufacturing. The disclosed alloy embodiments provide fabricated objects, such as bulk components, comprising a heterogeneous microstructure and having good mechanical properties even when exposed to conditions used during the additive manufacturing process. Methods for making and using alloy embodiments also are disclosed herein.

Abstract: A method of designing an optimized seawater pumping apparatus, using a computer in a system in which a seawater pumping apparatus including a pumping pipe and a well disposed to surround a lateral surface of a land-buried portion of the pumping pipe is installed to reduce seawater intrusion in a land in which an aquifer with a seawater-fresh water boundary surface is formed, includes applying an optimization algorithm to initial condition data of the aquifer to generate n decision variable sets of the seawater pumping apparatus, applying an underground water flow model to each of the n decision variable sets to generate n prediction results of change in the seawater-fresh water boundary surface, calculating a performance evaluation value of each of the n prediction results, and selecting a decision variable set having a maximum performance evaluation value, where n is an integer and equal to or greater than 2.

Abstract: One or more techniques and/or systems are disclosed for a center frame positioning method for an agricultural sprayer. The method comprises activating a center frame positioning system and collecting and processing position data related to a position of a suspended center frame in the center frame positioning system. The method further comprises evaluating the position data to determine whether any adjustment to the position of the suspended center frame is needed and controlling actuator force in at least one actuator to adjust the position of the suspended center frame based on the evaluating the position data.

Abstract: A method of making a catalyst layer of a membrane electrode assembly (MEA) for a polymer electrolyte membrane fuel cell includes the step of preparing a porous buckypaper layer comprising at least one selected from the group consisting of carbon nanofibers and carbon nanotubes. Platinum group metal nanoparticles are deposited in a liquid solution on an outer surface of the buckypaper to create a platinum group metal nanoparticle buckypaper. A proton conducting electrolyte is deposited on the platinum group metal nanoparticles by electrophoretic deposition to create a proton-conducting layer on the an outer surface of the platinum nanoparticles. An additional proton-conducting layer is deposited by contacting the platinum group metal nanoparticle buckypaper with a liquid proton-conducting composition in a solvent. The platinum group metal nanoparticle buckypaper is dried to remove the solvent. A membrane electrode assembly for a polymer electrolyte membrane fuel cell is also disclosed.

Abstract: Ultra-High-Performance Concrete (UHPC), owing to its superior mechanical and durability properties, presents a unique opportunity for innovative use in unbonded post-tensioned floor systems. In unbonded post-tensioned (PT) slabs and beams, the use of cast-in-place steel confined UHPC Bond Anchors (UBA) can be used to anchor steel prestressing strands for better durability, increased strand ductility, cost-effectiveness, and ease of installation. A conical, steel confining device is used as part of the UBA. The device resists hoop tension and eliminates splitting cracks in the UHPC during prestress transfer. It also helps to reduce the anchorage length. High average bond stress helps reduce the UBA length, and consequently, the material consumption. The bond stress at the strand-UHPC interface can be increased by intentionally roughening or indenting the strand.

Abstract: Permanent magnet materials are provided. The permanent magnet materials are cerium based materials including zirconium and iron in combination with cobalt. The permanent magnet materials may have the formula Ce2ZrFe15?xCox wherein 6?x?15. In some embodiments, the permanent magnet materials have the formula Ce2+yZr1?yFe(15?x)(2?z)/2)CoxCu((15?x)z/2) wherein 6?x?15, 0?y?0.4, and z=0 or 1. In other embodiments, the permanent magnet materials have the formula Ce2Zrx(Fe1?yCoy)17?2x, where 0<x?1 and 0.4?y?1. Permanent magnets including the permanent magnet materials are also provided.

Abstract: The present disclosure relates to triblock and pentablock copolymers and methods of making thereof. Aspects of the disclosure further relate to block copolymer hydrogels that exhibit both fatigue resistance and fracture resistance with superior rates of recovery.

Abstract: Methods and delivery agents for treatment of connective tissue that includes elastic fibers are described. Delivery agents are nano- or micro-sized particles that include a biologically active compound useful in treatment of degraded elastic fibers, and an anchoring agent at a surface that binds at or near the area of degraded elastic fibers. The delivery agents may be utilized for targeted delivery of biologically active compounds to degraded elastic fibers so as to maintain and/or regenerate the elastin component of connective tissue, and to prevent further degradation and/or rehabilitate the structural architecture of the connective tissue.

Abstract: The present invention relates to a polymer comprising a repeating group having the structure of formula (I) wherein R, R1, R2, R3, R4, X, and s are as described herein and salt thereof. Also disclosed is a process of synthesizing such polymers.

Abstract: A ceria-carbon-sulfur (CeO2—C—S) composite including a ceria-carbon (CeO2—C) composite in which cylindrical carbon materials having ceria (CeO2) particles bonded to surfaces thereof are entangled and interconnected to each other in three dimensions; and sulfur introduced into at least a portion of an outer surface and an inside of the ceria-carbon composite, a method for preparing the same, and positive electrode for a lithium-sulfur battery and a lithium-sulfur battery including the same.

Abstract: Described herein are systems and methods for profiling structured or semi-structured datasets. An example computer-implemented method includes grouping, using a machine learning classifier, a plurality of tables in a dataset that are associated with an object into a cluster, where each of the tables of the cluster includes respective data and respective metadata, the respective metadata including at least one respective attribute, generating a metadata-profile for the cluster, where the metadata-profile includes the at least one respective attribute of each of the tables of the cluster; and querying the cluster using the metadata-profile.

Abstract: The disclosure provides a method of dehydrogenating hydrocarbons, such as C2 or C3 hydrocarbons, selectively and efficiently, to provide the corresponding alkylenes. The method is based on a Pt nanolayer catalyst over MXene (Pt/MXene) that shows resistance to coke deposition. The dehydrogenation conditions developed provided about 22% propane conversion and over 90% selectivity toward the desired propylene product, and the catalyst was stable for a 24-hour continuous run. The byproducts were ethane, ethylene, and methane, and only trace amounts of coke deposition over the catalyst were detected. Similar dehydrogenation conditions provided about 18% ethane conversion and over 90% selectivity toward the desired ethylene product. A mass balance of greater than 96% was achieved in each case.

Abstract: The invention relates to a method of patterning a substrate with graphene-based or other electroactive-material-based solution that includes solid-phase particles as hard templates, reducing the solution, and processing the reduced solution to expose the particles. The exposed hard template particles are removed to leave a three-dimensional (3D) porous architecture that can be beneficially used for a variety of applications, including but not limited to bio sensors and supercapacitors. In one example, the exposure is by etching with a CO2 laser. The method can be practiced with scalable MEMS fabrication technologies.

Abstract: Disclosed herein are a video decoding method and apparatus and a video encoding method and apparatus. In video encoding and decoding, multiple partition blocks are generated by splitting a target block. A prediction mode is derived for at least a part of the multiple partition blocks, among the multiple partition blocks, and prediction is performed on the multiple partition blocks based on the derived prediction mode. When prediction is performed on the partition blocks, information related to the target block may be used, and information related to an additional partition block, which is predicted prior to the partition block, may be used.

Abstract: There is provided with a method for treating cancer, comprising administering a pharmaceutical composition to a patient with cancer in combination with an anti-cancer agent, the pharmaceutical composition. A compound is represented by General Formula (I) or a pharmaceutically acceptable salt thereof: where R1 is an acyl residue from a fatty acid.

Abstract: The invention provides methods of inhibiting the growth or metastasis of a cancer in a mammal by inhibiting a Ral GTPase in the mammal. The invention also provides small molecule inhibitors of Ral GTPases useful in the methods of the invention and pharmaceutical compositions containing the therapeutically effective compounds of the invention, and methods of using the same.

Abstract: Methods and devices for microfluidic detection of a biological maker in a biospecimen collected from a subject are disclosed. The microfluidic devices include nanoparticle-based nanosensors comprising supramolecular recognition sequences, protease consensus sequences, post-translationally modifiable sequences, or sterically hindered benzylether bonds for specific interaction with a biological marker. Also disclosed are particular nanosensors for detecting cytokines, and other proteins based upon supramolecular recognition without chemical modification or enzymatic cleavage.