Abstract: A novel group of pectate lyases comprising the amino acid sequence Asn Leu Asn Ser Arg Val Pro (NLNSRVP) belonging to Family 1 of polysaccharide lyases have good performance in industrial processes under neutral or alkaline conditions such as laundering and textile processing. The pectate lyase may be derivable from Bacillus species.

Abstract: The present invention relates to an enzyme with galactanase activity, a DNA construct encoding the enzyme, a method of producing the enzyme, an enzyme composition comprising the enzyme, and the use of the enzyme and enzyme composition for a number of industrial applications.

Abstract: A method for providing a hybrid polypeptide having an activity of interest, by i) performing PCR amplification using an uncharacterized DNA sample and oligonucleotide primers with homology to one or more known genes encoding a polypeptide exhibiting said activity of interest, to obtain one or more PCR products, ii) linking the obtained PCR products to a 5′ structural gene sequence and a 3′ structural gene sequence, wherein the 5′ and 3′ structural gene sequences are derived from one or more genes encoding a polypeptide exhibiting said activity of interest, to form hybrid DNA sequences, iii) expressing the resulting hybrid DNA sequences, and iv) screening the hybrid polypeptides to identify a sequence encoding a polypeptide exhibiting said activity of interest or a related activity.

Abstract: The present invention relates to polypeptides having laccase activity and isolated nucleic acid sequences encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the nucleic acid sequences as well as methods for producing the polypeptides.

Abstract: The present invention relates to an enzyme with galactanase activity, a DNA construct encoding the enzyme with galactanase activity, a method of producing the enzyme, an enzyme composition comprising the enzyme with galactanase activity, and the use of the galactanase enzyme and enzyme composition for a number of industrial applications.

Abstract: An enzyme preparation comprising (a) first enzyme with xylanase activity and (b) a second enzyme having cellulotytic, xylanolytic or pectinolytic activity and are supported by the specification.

Abstract: An enzyme from Aspergillus aculeatus exhibiting endoglucanase activity encoded by the DNA sequence of SEQ ID NO:17 or 18, and useful for degrading plant cell walls.

Abstract: The present invention relates to polypeptides having laccase activity and isolated nucleic acid sequences encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the nucleic acid sequences as well as methods for producing the polypeptides.

Abstract: The present invention relates to an enzyme exhibiting aminopeptidase activity, a method for producing said enzyme, an enzyme preparation containing said enzyme exhibiting aminopeptidase activity, and use of said enzyme for various industrial purposes.

Abstract: A DNA construct encoding an enzyme(s) exhibiting xylanase activity, which enzyme is immunologically reactive with antibody raised against a purified xylanase derived from Aspergillus aculealus, CBS 101.43, recombinant vectors and cells comprising said construct and a method for producing said enzyme using said cell comprising said construct.

Abstract: An isolated and purified enzyme exhibiting protease activity at a pH of 4-7 which exhibits protease in 5% hydrogen peroxide and which is encoded by a DNA sequence which hybridizes to a DNA sequence depicted in SEQ ID NO: 1 or 2. Methods are described for using the protease compositions in reducing vescosity, cleaning contact lenses, baking, and preparing animal feed.

Abstract: A novel group of pectate lyases comprising the amino acid sequence Asn Leu Asn Ser Arg Val Pro (NLNSRVP) belonging to Family 1 of polysaccharide lyases have good performance in industrial processes under neutral or alkaline conditions such as laundering and textile processing. The pectate lyase are derivable from Bacillus species.

Abstract: An enzyme exhibiting polygalacturonase activity, which enzyme is immunologically reactive with an antibody raised against a purified polygalacturonase derived from Aspergillus aculeatus, CBS 101.43. The enzyme may be produced by recombinant DNA techniques and may be used for degradation of plant cell walls, for instance in the wine and juice production.

Abstract: The present invention relates to an enzyme exhibiting aminopeptidase activity, a method for producing said enzyme, an enzyme preparation containing said enzyme exhibiting aminopeptidase activity, and use of said enzyme for various industrial purposes.

Abstract: An enzyme having endo-1,3(4)-.beta.-glucanase activity is described which is encoded by the DNA sequence ATGTGGTCTCCCAAGGTTGCTGCTGCCGTCCTCGCCTTTGTTGGTGCTACCAACGCCT GGCAGCCCCCGACCTACAGCGGCTTCAACTTGGTCTGGACTGACACCTTCGCTGGCAACGGTGGCACTTCTCCT A ACCAGAACAACTGGAACATCATCACCGGAAACTTGAACGTCAACGCCGAGCAGGAGACCTACTCCTCCAGCAC C GCCAATGTTCAGCTCAGTGGTGGCAGCACCCTTCAGCTGGTCCCCTGGAGAGACAGCAGCAAGGGAACCAGCA C CTTTGGTGGCTGGACCTCCGGTCGTCTTGAGTCCAAGTACACATTCACTCCCGCGGCCGGCAAGGTCACCCGT CTT GAAGCCGCCATCCGCTTCGGCAGCAACGCTCAGGCCAACAAGCAGGGTATCTGGCCTGCTTTCTGGATGCTGGG T GACTCCCTCCGTCAACCGGGCGGCAGCTGGCCCAACTGTGGTGAGATCGACATCATGGAGACTGTCGACGGCC A GGCTACCGGCCACGGTACCCTTCACTGCGACGTCTACCCCGGCGGTATCTGCAACGAGGGTAACGGTATTGGA GG CCCTGTCAACATCGCCAACGTCAACGACTGGCACGCTTGGCGTGTTGAGATCGACCGCACTCCCAGCAGCTGGC A ATCCGAGACCCTCACCTGGTCCCTCGACGGCACCATCTACTTCCAGATCACTGGCTCTCGCATTGGCAACCAG GG CGTCTGGAACAACATTGCTCACAGCCCCCTCTTCTTCATTCTTAACGTTGCTGTCGGTGGCAACTGGCCTGGCA AC CCCAACAGCGCTACCCTCGATGGCTACGGAAGCATGATGGAGGTTGGCTACGTCGCTCAGTACTCTACCTAA (SEQ ID NO:3).

Abstract: An enzyme exhibiting xylanase activity, which enzyme is immunologically reactive with antibody raised against a purified xylanase derived from Aspergillus aculeatus, CBS 101.43. The enzyme may be used for degrading plant cell wall components, e.g., in the preparation of feed, in baking, in the paper and pulp industry, and in connection with separation of wheat into starch and gluten.

Abstract: The present invention relates to an isolated enzyme exhibiting cellulolytic (endoglucanase) activity at alkaline pH, an enzyme composition comprising the enzyme, a DNA construct encoding the enzyme, methods for producing the enzyme or enzyme composition, a detergent composition comprising the enzyme, and methods for using the enzyme in, e.g., providing localized variation in the color density of dyed fabric, improving the drainage of an aqueous suspension of paper pulp, and de-inking of recycled paper.

Abstract: The present invention provides an enzyme with acetyl esterase activity comprising the amino acid sequence IxFGDxYYT(SEQ ID NO: 1), in which x designates any amino acid residue. The enzyme exhibits activity towards acetylated xylan and acetylated mannan and may be used for modifying or degrading plant containing materials.

Abstract: Animal feed compositions and methods for treating one or more of soy, pea or rape-seed, or other material derived from Fabales or Cruciferaceae, with an enzyme having rhamnogalacturonase activity, wherein the enzyme having rhamnogalacturonase activity cleaves a rhamnogalacturonan backbone to produce rhamnose as a non-reducing end (RGase II) or cleaves a rhamnogalaturonan backbone to produce galacturonic acid as a non-reducing end.

Abstract: The present invention relates to an enzyme with .beta.-(1-6)-endoglucanase activity encoded by a DNA sequence, which DNA sequence a) comprises the DNA sequence shown in SEQ ID No. 3, or b) comprises an analogue of the DNA sequence shown in SEQ ID No. 3, which i) is homologous with the DNA sequences shown in or SEQ ID No. 3, and/or ii) hybridizes with the same oligonucleotide probe as the DNA sequence shown in SEQ ID No. 3, and/or iii) encodes a polypeptide which is homologous with the polypeptide encoded by a DNA sequence comprising the DNA sequence shown in SEQ ID No. 3, and/or iv) encodes a polypeptide which is immunologically reactive with an antibody raised against a purified .beta.-(1-6)-glucanase shown in SEQ ID No. 4 derived from Trichoderma harzianum, CBS 243.71.