Abstract: A semiconductor device includes a semiconductor constructing body which has a semiconductor substrate, a plurality of external connection electrodes formed on the semiconductor substrate, and heat dissipation columnar electrodes. Upper interconnections are mounted on one side of the semiconductor constructing body and connected to the external connection electrodes of the semiconductor constructing body. A heat dissipation layer is mounted on one side of the semiconductor constructing body and made of the same material as that of the upper interconnections.

Abstract: A network electronic component comprises a network-electronic-component substrate, a thin-film passive element provided on the substrate, and a plurality of external connection electrodes provided on the substrate in connection with the thin-film passive element.

Abstract: The semiconductor device of the present invention has a semiconductor substrate having a top surface of a quadrangular shape on which a plurality of connection pads are formed, an insulation film formed on the semiconductor substrate except the connection pads, and a plurality of external connection electrodes formed on the insulation film so as to be connected to the connection pads. The plurality of external connection electrodes constitute at least a first group of external connection electrodes which are arranged on first lines running along each of the two diagonal lines of the semiconductor substrate and second group of external connection electrodes which are arranged on second lines running along the first lines outside the first lines as seen from the diagonal lines.

Abstract: A first semiconductor element is mounted on a base plate, and is in a sealed state by the periphery thereof being covered by an insulation member, and the upper surface thereof being covered by an upper insulation film. An upper wiring layer formed on the upper insulation film, and the lower wiring layer formed below the base plate via lower insulation films are connected by conductors. A second semiconductor element is mounted exposed, being connected to the lower wiring layer.

Abstract: A semiconductor device includes a semiconductor constructing body which has a semiconductor substrate, a plurality of external connection electrodes formed on the semiconductor substrate, and heat dissipation columnar electrodes. Upper interconnections are mounted on one side of the semiconductor constructing body and connected to the external connection electrodes of the semiconductor constructing body. A heat dissipation layer is mounted on one side of the semiconductor constructing body and made of the same material as that of the upper interconnections.

Abstract: A semiconductor package includes at least one semiconductor constructing body which has a semiconductor substrate and a plurality of external connection electrodes formed thereon. An insulating film covers the semiconductor constructing body. Each of interconnections which has a projecting electrode is formed on the insulating film. The projecting electrodes of the interconnection cut through the insulating film at portions corresponding to the external connection electrodes and electrically connected to the external connection electrodes.

Abstract: A semiconductor device includes a semiconductor substrate which has a plurality of semiconductor device formation regions and alignment mark formation region having the same planar size as that of the semiconductor device formation region, a plurality of post electrodes which are formed in each semiconductor device formation region, and an alignment post electrode which is formed in the alignment mark formation region and smaller in number than the post electrodes formed in each semiconductor device formation region.

Abstract: Frames making up an input speech are each collated with a string of phonemes representing speech candidates to be recognized, whereby evaluation values regarding the phonemes are computed. The frames are each compared with part of the phoneme string so as to reduce computations and memory capacity required in recognizing the input speech based on the evaluation values. That is, each frame is compared with a portion of the phoneme string to acquire an evaluation value for each phoneme. If the acquired evaluation value meets a predetermined condition, part of the phonemes to be collated with the next frame are changed. Illustratively, if the evaluation value for the phoneme heading a given portion of collated phonemes is smaller than the evaluation value of the phoneme which terminates that phoneme portion, then the head phoneme is replaced by the next phoneme. The new portion of phonemes obtained by the replacement is used for collation with the next frame.

Abstract: A liquid crystal display system which can accept input display data having a resolution which is larger (e.g. 1120×780 dots) or smaller (e.g. 640×480 dots) than a resolution of a liquid crystal panel (e.g. 1024×768 dots), and convert the input display data to reduced or enlarged display data for display on the liquid crystal panel. The system generates, for example, one new vertical or horizontal line based on two contiguous vertical or horizontal lines in the input display data. If the resolution of the input display data is larger than the resolution of the liquid crystal panel, the system replaces the two contiguous lines with the one new line. If the resolution of the input display data is smaller than the resolution of the liquid crystal panel, the system inserts the one new line between the two contiguous lines.

Abstract: Frames making up an input speech are each collated with a string of phonemes representing speech candidates to be recognized, whereby evaluation values regarding the phonemes are computed. The frames are each compared with part of the phoneme string so as to reduce computations and memory capacity required in recognizing the input speech based on the evaluation values. That is, each frame is compared with a portion of the phoneme string to acquire an evaluation value for each phoneme. If the acquired evaluation value meets a predetermined condition, part of the phonemes to be collated with the next frame are changed. Illustratively, if the evaluation value for the phoneme heading a given portion of collated phonemes is smaller than the evaluation value of the phoneme which terminates that phoneme portion, then the head phoneme is replaced by the next phoneme. The new portion of phonemes obtained by the replacement is used for collation with the next frame.

Abstract: A liquid crystal display system which can accept input display data having a resolution which is larger (e.g. 1120×780 dots) or smaller (e.g. 640×480 dots) than a resolution of a liquid crystal panel (e.g. 1024×768 dots), and convert the input display data to reduced or enlarged display data for display on the liquid crystal panel. The system generates, for example, one new vertical or horizontal line based on two contiguous vertical or horizontal lines in the input display data. If the resolution of the input display data is larger than the resolution of the liquid crystal panel, the system replaces the two contiguous lines with the one new line. If the resolution of the input display data is smaller than the resolution of the liquid crystal panel, the system inserts the one new line between the two contiguous lines.

Abstract: A liquid crystal display system which can accept display data having a resolution different from that of a screen for the liquid crystal display and display the display data. For example, a CPU outputs display data of 1120×780 dots and a liquid crystal panel has a 1024×768-dot resolution which is smaller than the display data resolution. The display screen of the liquid crystal panel comprises a linear arrangement of pixels. A data conversion section generates display data for a new horizontal or vertical line based on display data for two horizontal or vertical lines contiguous to each other and repeats replacement of display data of the two lines with the display data of the one line for reducing the number of horizontal lines of one screen and the number of dots of one line so as to match the resolution of the display data output by the CPU with the liquid crystal display.

Abstract: A study system of a voice recognizing and translating system is provided with a sound data base for storing data from which noise is removed; a sound analysis unit for extracting the features of the voice corresponding to the voice data stored in the sound data base; and a model learning unit for creating an acoustic model on the basis of the analysis result of the sound analysis unit. A recognition system of the voice recognizing and translating system is provided with: an acoustic model storing unit for storing acoustic models; a second sound analysis unit for extracting the feature of the voice corresponding to the data concerned on the basis of the data obtained by removing the data representing noise from the voice data of a newly input voice, and a voice collating unit for collating the voice data obtained by the second sound analysis unit with the data of the acoustic models so as to recognize the voice.

Abstract: A liquid crystal display system which can accept display data having a resolution different from that of a screen for the liquid crystal display and display the display data. For example, a CPU outputs display data of 1120.times.780 dots and a liquid crystal panel has a 1024.times.768-dot resolution which is smaller than the display data resolution. The display screen of the liquid crystal panel comprises a linear arrangement of pixels. A data conversion section generates display data for a new horizontal or vertical line based on display data for two horizontal or vertical lines contiguous to each other and repeats replacement of display data of the two lines with the display data of the one line for reducing the number of horizontal lines of one screen and the number of dots of one line so as to match the resolution of the display data output by the CPU with the liquid crystal display.

Abstract: A speech recognition system realizing large-vocabulary speech recognition at a low cost without deteriorating the rate of recognition and a recognition speed performance is provided with a dictionary change-over section for making a change-over between dictionaries to be subjected to speech recognition in accordance with dictionary change-over information, a first memory for storing a plurality of dictionaries, a second memory for storing one dictionary made an object of recognition, and a speech recognition section for performing a speech recognition processing, whereby speech recognition is performed while making a change-over between dictionaries, as required. For example, in a car navigation speech recognition system, the change-over between dictionaries is made for each area in accordance with position information.

Abstract: A study system of a character recognizing and translating system is provided with a character data base for storing character data representing characters contained in a sensed image; a character shape analysis unit for analyzing the shape of a character to extract the features of character constituting elements constituting the character; and, a mask learning unit for generating sample mask data of the character constituting elements on the basis of the analysis result of the character shape analysis unit. A recognition system of the character recognizing and translating system is provided with a collating unit for collating the character data of a character to be recognized with the sample mask data so as to recognize the character.

Abstract: A method and a kit for detecting methicillin-resistant Staphylococcus aureus which use, as primers in a gene amplification reaction, the four oligonucleotides represented by the following nucleotide sequences (1) through (4):5'AGAAATGACTGAACGTCCG3' (SEQ ID NO:1) (1)5'GCGATCAATGTTACCGTAG3' (SEQ ID NO:2) (2)5'TACATGTCGTTAAACCTGGTG3' (SEQ ID NO:3) (3)5'TACAGTTGTACCGATGAATGG3' (SEQ ID NO:4) (4)wherein A, G, C, and T denote adenine, guanine, cytosine, and thymine, respectively, and any T may be substituted by uracil (U). According to the method and kit of the present invention, it is possible to detect MRSA accurately and rapidly while distinguishing it from MR-CNS. Thus, proper treatment and prevention can be achieved against MRSA infections.

Abstract: An information processing system having a character/pattern generator, in which outline information of a character/pattern expressed in a vector form is subjected to any of at least two sorts of coordinate transformations in accordance with an address allocation scheme of an output engine to-be-used. Besides, in generating and transferring character/pattern data of dot form for each of the outline information items of character/pattern parts in subregions into which a region of the character/pattern has been divided, the outline information of the character/pattern is divided in either of horizontal and vertical directions in data transfer unit in accordance with the address allocation scheme of the output engine to-be-used. Further, in transferring the character/pattern data of the dot form, addresses are updated in conformity with any of at least two address update schemes in accordance with the address allocation scheme of the output engine to-be-used.