Patents by Inventor Yong Chan Kim

Yong Chan Kim has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Patent number: 12258071
    Abstract: A method for manufacturing a lightweight cowl crossbar includes: producing an inner pipe, laminating a plurality of composite material layers wound around the inner pipe, and extruding an outer pipe on the winding layer, in which the plurality of composite material layers adjacent to each other are wound in different directions.
    Type: Grant
    Filed: December 21, 2020
    Date of Patent: March 25, 2025
    Assignees: HYUNDAI MOTOR COMPANY, KIA MOTORS CORPORATION, LG HAUSYS, LTD., HYUNDAI MOBIS CO., LTD.
    Inventors: Jae Hyun An, In Soo Han, Hee Seok Kim, Il Sang Kim, Ik Jin Jung, Kyeong Hoon Jang, Young Jin You, Sang Hyeon Park, Wook Hee Lee, Yong Woo Jung, Ik Keun Choi, Young Chan Cho
  • Publication number: 20250093987
    Abstract: A transparent touch display apparatus including a device substrate, a touch electrode and a routing line. The device substrate may include an emission area and a transmission area. The touch electrode may be disposed on the transmission area of the device substrate. The routing line may be disposed outside the emission area and the transmission area of the device substrate. A transmittance of the touch electrode may be higher than a transmittance of the routing line. Thus, in the transparent touch display apparatus, the reliability of the touch detection may be improved.
    Type: Application
    Filed: December 2, 2024
    Publication date: March 20, 2025
    Inventors: Hwi Deuk Lee, Yang Sik Lee, Yong Chan Park, Hyoung Su Kim, Sung Su Han
  • Patent number: 12252180
    Abstract: A lower cross member for a vehicle is disposed on a floor of a vehicle. The lower cross member includes a core member and a reinforcing layer. The core member is made of a composite material containing 70 wt. % or more of unidirectional carbon fibers, and the reinforcing layer is made of a composite material containing 70 wt. % or more of fiberglass.
    Type: Grant
    Filed: November 17, 2021
    Date of Patent: March 18, 2025
    Assignees: Hyundai Motor Company, Kia Corporation, Kolon Spaceworks Co., Ltd.
    Inventors: Sang Yoon Park, Seung Chan Lee, Yong Beom Lee, Pil Won Kang, Hyun Sik Kim, Sang Sun Park, Hee Seouk Chung, Seung Uk Kang, Chi Hoon Choi, Seong Jong Kim, Dong Won Kim
  • Publication number: 20250064867
    Abstract: The present invention relates to a method for improving muscle strength, and/or muscle mass by administering a composition containing as an active ingredient at least one selected from the group consisting of Akkermansia muciniphila cells, a culture thereof and a lysate thereof, and a method for preventing or treating muscle diseases where muscle strength and/or mass is weakened by sarcopenia, cachexia or muscle wasting.
    Type: Application
    Filed: September 18, 2024
    Publication date: February 27, 2025
    Applicant: KOREA RESEARCH INSTITUTE OF BIOSCIENCE AND BIOTECHNOLOGY
    Inventors: Chul-Ho LEE, Byoung-Chan KIM, Yong-Hoon KIM, Jung-Ran NOH, Jae-Hoon KIM, Kyoung-Shim KIM, Dong-Hee CHOI, Young-Keun CHOI, Dong-Ho CHANG, Haiyoung JUNG, Jung Hwan HWANG
  • Publication number: 20250058291
    Abstract: An apparatus for controlling viscosity of a slurry includes a mixing module mixing raw materials for a secondary battery, and a processor performing machine learning for prediction of viscosity of the slurry, predicting viscosity of the slurry in real time during a mixing process through machine learning, and adjusting conditions of the mixing process performed by the mixing module such that a predictive viscosity of the slurry meets a target viscosity.
    Type: Application
    Filed: December 8, 2023
    Publication date: February 20, 2025
    Inventors: Bo Ra KIM, Yong Jin KIM, Jake KIM, Tae Sung AHN, Hee Chan JUNG, Yong Jun HWANG, Jee Hoon HAN, Jong Man KIM, Gi Heon KIM
  • Patent number: 12229361
    Abstract: A transparent touch display apparatus including a device substrate, a touch electrode and a routing line. The device substrate may include an emission area and a transmission area. The touch electrode may be disposed on the transmission area of the device substrate. The routing line may be disposed outside the emission area and the transmission area of the device substrate. A transmittance of the touch electrode may be higher than a transmittance of the routing line. Thus, in the transparent touch display apparatus, the reliability of the touch detection may be improved.
    Type: Grant
    Filed: August 17, 2023
    Date of Patent: February 18, 2025
    Assignee: LG Display Co., Ltd.
    Inventors: Hwi Deuk Lee, Yang Sik Lee, Yong Chan Park, Hyoung Su Kim, Sung Su Han
  • Publication number: 20250057013
    Abstract: A display device includes a substrate including a display area and a first non-display area around the display area; a light emitting element on the display area of the substrate in the display area; a lower inorganic encapsulation film on the substrate in the display area and the first non-display area; an organic encapsulation film on the lower inorganic encapsulation film; an upper inorganic encapsulation film on the organic encapsulation film; and a first dam between the lower inorganic encapsulation film and the upper inorganic encapsulation film in the first non-display area, wherein a first side surface of the first dam is in contact with the organic encapsulation film, and a second side surface of the first dam different from the first side surface of the first dam is in contact with the upper inorganic encapsulation film.
    Type: Application
    Filed: May 13, 2024
    Publication date: February 13, 2025
    Inventors: Yeon Guk KIM, Hee Yeon PARK, Chang Yeong SONG, Hye In JUNG, Yong Chan JU, Jae Heung HA
  • Patent number: 12223881
    Abstract: A gate driver according to an embodiment and a display device including the same are disclosed. The gate driver according to the embodiment includes an output clock line through which an output clock signal is applied, a dummy clock line disposed side by side with the output clock line and through which a dummy clock signal is applied, a pull-up transistor including a first electrode connected to the output clock line, a gate electrode connected to a first control node, and a second electrode connected to an output node from which a gate signal is output, and a pull-down transistor including a first electrode connected to the output node, a gate electrode connected to a second control node, and a second electrode connected to a power line through which a low-potential power voltage is applied.
    Type: Grant
    Filed: October 30, 2023
    Date of Patent: February 11, 2025
    Assignee: LG Display Co., Ltd.
    Inventors: Ju Hong Kim, Yong Chan Park
  • Patent number: 12195724
    Abstract: The present invention provides methods for producing cell populations enriched for stable, regulatory T cells (Tregs). In particular, the invention relates to methods for culturing T cells such that the final culture is enriched for stable, regulatory T cells. It also relates to methods for stabilizing regulatory T cells. Also provided are compositions enriched for stable, regulatory T cells, which are useful for treating individuals in need of such treatment. The methods and compositions disclosed herein can also be used to treat an individual suffering from an immune-mediated disease.
    Type: Grant
    Filed: July 9, 2021
    Date of Patent: January 14, 2025
    Assignee: The United States of America, as represented by the Secretary, Department of Health and Human Services
    Inventors: Yong Chan Kim, Ethan Shevach
  • Patent number: 12138957
    Abstract: Provided is a decorative member including a substrate and a decorative layer provided on the substrate, wherein the decorative member has a depth parameter value ?1m represented by Formula 1 of 0.15 or more.
    Type: Grant
    Filed: January 8, 2019
    Date of Patent: November 12, 2024
    Assignee: LG CHEM, LTD.
    Inventors: Jin Suk Song, Sangcholl Han, Yong Chan Kim, Nansra Heo, Jeong Woo Shon, Pilsung Jo
  • Patent number: 12075898
    Abstract: The present application relates to a decorative member including a color developing layer including a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on one surface of the color developing layer, wherein the light absorbing layer includes a copper oxide (CuaOx).
    Type: Grant
    Filed: April 10, 2019
    Date of Patent: September 3, 2024
    Assignee: LG CHEM, LTD.
    Inventors: Yong Chan Kim, Ki Hwan Kim, Nansra Heo, Jeong Woo Shon, Pilsung Jo
  • Publication number: 20240281934
    Abstract: A method for three-dimensionally modeling an eyeball and optical nerves using the merging of MRI images and OCT images, comprises: (a) a step for three-dimensionally modeling an eyeball model on the basis of the shapes of an eyeballs in a first MRI head image and a second MRI head image; (b) a step for three-dimensionally modeling an ASCO model in a corrected OCT eyeball cross-sectional image; (c) a step for three-dimensionally modeling the lamina cribrosa in the corrected OCT eyeball image; and (d) a step for generating an optic nerve model by three-dimensionally modeling an optic tract connected to the three-dimensionally modeled eyeball model.
    Type: Application
    Filed: August 31, 2022
    Publication date: August 22, 2024
    Inventor: Yong Chan KIM
  • Patent number: 12053073
    Abstract: The present application relates to a decoration member including a pattern layer provided on one surface of the substrate and including a convex structure or a concave structure arranged two-dimensionally, and a method for preparing the decoration member.
    Type: Grant
    Filed: April 9, 2019
    Date of Patent: August 6, 2024
    Assignee: LG CHEM, LTD.
    Inventors: Pilsung Jo, Jin Suk Song, Sangcholl Han, Ki Hwan Kim, Yong Chan Kim, Nansra Heo, Jeong Woo Shon
  • Publication number: 20240255582
    Abstract: A method for evaluating an accelerated idle life of a secondary battery, includes an evaluation condition input process including inputting an idle temperature and a measurement period for a reference performance test to evaluate the accelerated idle life of the secondary battery, a data computation process including computing an evaluation period, in which a state of health of the secondary battery reaches a set range, a capacity degradation rate, and a direct current internal resistance change rate, and an acceleration factor calculation process including calculating an acceleration factor of the secondary battery using a first equation that the acceleration factor is equal to the direct current internal resistance change rate divided by a capacity degradation rate.
    Type: Application
    Filed: October 18, 2023
    Publication date: August 1, 2024
    Inventors: Yong Chan KIM, Seon Hye YOON, Hye Won KIM, Su Jin PARK, Jeong Won OH
  • Patent number: 12037674
    Abstract: The present disclosure relates to a method for manufacturing a decoration element, the method including depositing a light reflective layer having a structure of two or more islands separated from each other on one surface of a light absorbing layer; and dry etching the light absorbing layer using the island as a mask, wherein a resistance value of the decoration element after the dry etching of the light absorbing layer increases by two times or more compared to before the dry etching of the light absorbing layer.
    Type: Grant
    Filed: September 2, 2019
    Date of Patent: July 16, 2024
    Assignee: LG Chem, Ltd.
    Inventors: Pilsung Jo, Yong Chan Kim, Song Ho Jang, Ki Hwan Kim, Nansra Heo, Jeong Woo Shon
  • Patent number: 12034147
    Abstract: A negative electrode for a lithium secondary battery including a negative electrode current collector; and a negative electrode active material layer formed on the negative electrode current collector, wherein the negative electrode active material layer includes graphite and silicon oxide, and lithium is incorporated in the negative electrode active material layer, and a method for preparing the same.
    Type: Grant
    Filed: September 19, 2018
    Date of Patent: July 9, 2024
    Assignee: LG ENERGY SOLUTION, LTD.
    Inventors: Yong Chan Kim, Ki Hwan Kim, Jeong Woo Shon, Pilsung Jo
  • Publication number: 20240210487
    Abstract: A method for evaluating a life of a secondary battery, including an evaluation condition input process of inputting a temperature, a charging rate, and a discharging rate to evaluate the life of the secondary battery, a data computation process of computing an evaluation period, in which a state of health of the secondary battery reaches a set range, a capacity degradation rate, and a direct current internal resistance change rate, and an acceleration factor calculation process of calculating an acceleration factor of the secondary battery using a first equation, the first equation being that the acceleration factor is equal to the direct current internal resistance increase rate divided by the capacity degradation rate.
    Type: Application
    Filed: October 18, 2023
    Publication date: June 27, 2024
    Inventors: Yong Chan KIM, Hye Won KIM, Seon Hye YOON, Su Jin PARK, Seon Yeong LEE, Hack Jun LEE, Chan Yeong KIM
  • Patent number: 12014837
    Abstract: The present invention provides a method for integrated online monitoring and a system for integrated online monitoring from a remote location for a nuclear power plant. The method includes a first step of collecting machine monitoring data of a plurality of units in the nuclear power plant selectively from the local data acquisition device via the monitoring data relay device, and a second step of collecting machine diagnostic data of a plurality of units in the nuclear power plant selectively from the local data acquisition device via the diagnostic data relay device.
    Type: Grant
    Filed: August 29, 2017
    Date of Patent: June 18, 2024
    Assignee: KOREA HYDRO & NUCLEAR POWER CO., LTD.
    Inventors: Dae Woong Kim, Yang Seok Kim, Bum Nyun Kim, Young Sheop Park, Chi Yong Park, Jong Seog Kim, Hyoung Kyun Kim, Byoung Oh Lee, Ji In Kim, Nam Woo Choi, Jae Hun Shin, Jae Min An, Yong Chan Kim
  • Patent number: 12013555
    Abstract: The present disclosure relates to a decoration member comprising a color developing layer comprising a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on one surface of the color developing layer, wherein the light absorbing layer comprises a molybdenum-titanium oxide (MoaTibOx).
    Type: Grant
    Filed: June 14, 2019
    Date of Patent: June 18, 2024
    Assignee: LG CHEM, LTD.
    Inventors: Yong Chan Kim, Ki Hwan Kim, Nansra Heo, Jeong Woo Shon, Pilsung Jo
  • Publication number: 20240182855
    Abstract: The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method, and a composition for treating an autoimmune disease, the composition comprising the regulatory T cells.
    Type: Application
    Filed: March 31, 2022
    Publication date: June 6, 2024
    Inventors: Yong Chan KIM, Nari BYUN, Jeong Heon YOON