Abstract: An apparatus for controlling viscosity of a slurry includes a mixing module mixing raw materials for a secondary battery, and a processor performing machine learning for prediction of viscosity of the slurry, predicting viscosity of the slurry in real time during a mixing process through machine learning, and adjusting conditions of the mixing process performed by the mixing module such that a predictive viscosity of the slurry meets a target viscosity.

Abstract: A transparent touch display apparatus including a device substrate, a touch electrode and a routing line. The device substrate may include an emission area and a transmission area. The touch electrode may be disposed on the transmission area of the device substrate. The routing line may be disposed outside the emission area and the transmission area of the device substrate. A transmittance of the touch electrode may be higher than a transmittance of the routing line. Thus, in the transparent touch display apparatus, the reliability of the touch detection may be improved.

Abstract: A display device includes a substrate including a display area and a first non-display area around the display area; a light emitting element on the display area of the substrate in the display area; a lower inorganic encapsulation film on the substrate in the display area and the first non-display area; an organic encapsulation film on the lower inorganic encapsulation film; an upper inorganic encapsulation film on the organic encapsulation film; and a first dam between the lower inorganic encapsulation film and the upper inorganic encapsulation film in the first non-display area, wherein a first side surface of the first dam is in contact with the organic encapsulation film, and a second side surface of the first dam different from the first side surface of the first dam is in contact with the upper inorganic encapsulation film.

Abstract: A gate driver according to an embodiment and a display device including the same are disclosed. The gate driver according to the embodiment includes an output clock line through which an output clock signal is applied, a dummy clock line disposed side by side with the output clock line and through which a dummy clock signal is applied, a pull-up transistor including a first electrode connected to the output clock line, a gate electrode connected to a first control node, and a second electrode connected to an output node from which a gate signal is output, and a pull-down transistor including a first electrode connected to the output node, a gate electrode connected to a second control node, and a second electrode connected to a power line through which a low-potential power voltage is applied.

Abstract: The present invention provides methods for producing cell populations enriched for stable, regulatory T cells (Tregs). In particular, the invention relates to methods for culturing T cells such that the final culture is enriched for stable, regulatory T cells. It also relates to methods for stabilizing regulatory T cells. Also provided are compositions enriched for stable, regulatory T cells, which are useful for treating individuals in need of such treatment. The methods and compositions disclosed herein can also be used to treat an individual suffering from an immune-mediated disease.

Abstract: Provided is a decorative member including a substrate and a decorative layer provided on the substrate, wherein the decorative member has a depth parameter value ?1m represented by Formula 1 of 0.15 or more.

Abstract: The present application relates to a decorative member including a color developing layer including a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on one surface of the color developing layer, wherein the light absorbing layer includes a copper oxide (CuaOx).

Abstract: A method for three-dimensionally modeling an eyeball and optical nerves using the merging of MRI images and OCT images, comprises: (a) a step for three-dimensionally modeling an eyeball model on the basis of the shapes of an eyeballs in a first MRI head image and a second MRI head image; (b) a step for three-dimensionally modeling an ASCO model in a corrected OCT eyeball cross-sectional image; (c) a step for three-dimensionally modeling the lamina cribrosa in the corrected OCT eyeball image; and (d) a step for generating an optic nerve model by three-dimensionally modeling an optic tract connected to the three-dimensionally modeled eyeball model.

Abstract: The present application relates to a decoration member including a pattern layer provided on one surface of the substrate and including a convex structure or a concave structure arranged two-dimensionally, and a method for preparing the decoration member.

Abstract: A method for evaluating an accelerated idle life of a secondary battery, includes an evaluation condition input process including inputting an idle temperature and a measurement period for a reference performance test to evaluate the accelerated idle life of the secondary battery, a data computation process including computing an evaluation period, in which a state of health of the secondary battery reaches a set range, a capacity degradation rate, and a direct current internal resistance change rate, and an acceleration factor calculation process including calculating an acceleration factor of the secondary battery using a first equation that the acceleration factor is equal to the direct current internal resistance change rate divided by a capacity degradation rate.

Abstract: The present disclosure relates to a method for manufacturing a decoration element, the method including depositing a light reflective layer having a structure of two or more islands separated from each other on one surface of a light absorbing layer; and dry etching the light absorbing layer using the island as a mask, wherein a resistance value of the decoration element after the dry etching of the light absorbing layer increases by two times or more compared to before the dry etching of the light absorbing layer.

Abstract: A negative electrode for a lithium secondary battery including a negative electrode current collector; and a negative electrode active material layer formed on the negative electrode current collector, wherein the negative electrode active material layer includes graphite and silicon oxide, and lithium is incorporated in the negative electrode active material layer, and a method for preparing the same.

Abstract: A method for evaluating a life of a secondary battery, including an evaluation condition input process of inputting a temperature, a charging rate, and a discharging rate to evaluate the life of the secondary battery, a data computation process of computing an evaluation period, in which a state of health of the secondary battery reaches a set range, a capacity degradation rate, and a direct current internal resistance change rate, and an acceleration factor calculation process of calculating an acceleration factor of the secondary battery using a first equation, the first equation being that the acceleration factor is equal to the direct current internal resistance increase rate divided by the capacity degradation rate.

Abstract: The present invention provides a method for integrated online monitoring and a system for integrated online monitoring from a remote location for a nuclear power plant. The method includes a first step of collecting machine monitoring data of a plurality of units in the nuclear power plant selectively from the local data acquisition device via the monitoring data relay device, and a second step of collecting machine diagnostic data of a plurality of units in the nuclear power plant selectively from the local data acquisition device via the diagnostic data relay device.

Abstract: The present disclosure relates to a decoration member comprising a color developing layer comprising a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on one surface of the color developing layer, wherein the light absorbing layer comprises a molybdenum-titanium oxide (MoaTibOx).

Abstract: The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method, and a composition for treating an autoimmune disease, the composition comprising the regulatory T cells.

Abstract: A decoration element is described. The decoration element includes a light reflective layer; a light absorbing layer provided on the light reflective layer; and a color developing layer comprising a color film, wherein the color developing layer is provided: on a surface of the light reflective layer opposite to a surface of the light reflective layer facing the light absorbing layer; between the light reflective layer and the light absorbing layer; or on a surface of the light absorbing layer opposite to a surface of the light absorbing layer facing the light reflective layer.

Abstract: The present disclosure relates to a decoration member comprising: a color expression layer comprising a light reflection layer and a light absorption layer provided on the light reflection layer; and a substrate provided on one surface of the color expression layer, in which the light absorption layer comprises a copper nickel oxide (CuaNibOx).

Abstract: This specification relates to a decoration member including: a substrate; a pattern layer comprising two or more unit pattern provided on one surface of the substrate; and an inorganic layer formed on the pattern layer, in which the inorganic layer includes a region in which a thickness t(x) of the inorganic layer formed on each unit pattern increases in a direction x in which the unit patterns are arranged.

Abstract: A system and method for controlling an after blow for a mobility includes an air conditioner and a control unit to perform sterilization and prevents bacteria generation through a removal of condensed water generated in an evaporator by operating a blower of an air conditioner to dry the evaporator when turning off a mobility after using the air conditioner in an electric mobility including a high voltage battery.