Abstract: The present invention provides methods for producing cell populations enriched for stable, regulatory T cells (Tregs). In particular, the invention relates to methods for culturing T cells such that the final culture is enriched for stable, regulatory T cells. It also relates to methods for stabilizing regulatory T cells. Also provided are compositions enriched for stable, regulatory T cells, which are useful for treating individuals in need of such treatment. The methods and compositions disclosed herein can also be used to treat an individual suffering from an immune-mediated disease.

Abstract: An image sensing device includes a pixel configured to generate a pixel signal having a single photon avalanche diode (SPAD) pulse by detecting incident light, a time-to-digital converter (TDC) configured to generate time-to-digital converter (TDC) data representing a time of flight (TOF) for the SPAD pulse, and a TDC memory configured to store the TDC data in a unit memory that is determined from among a plurality of unit memories according to the number of occurrences of the SPAD pulse.

Abstract: There is provided a thin optical system for real-world occlusion in an augmented reality display. The optical system according to an embodiment includes: a first DCRA configured to reflect light beams focused on holes; a mask positioned on a light emitting surface of the first DCRA to pass or block the light beams emitted from the first DCRA; and a second DCRA configured to reflect the light beams which are focused on holes after passing through the mask. Accordingly, the optical system can implement real-world occlusion in the unit of pixel while having a thin form factor.

Abstract: There is provided an object attribute-based watermarking method for preventing leakage of a digital content. A video watermarking method according to an embodiment may acquire a requested video and watermarking information upon receiving a request for video streaming from a user, may determine some of objects appearing in the video according to the watermarking information, may transform attributes of the determined objects, and may stream the transformed video. Accordingly, by watermarking an attribute of an object appearing in a video differently according to a user and providing the video, a watermark may be difficult to perceive, robustness against various attacks may be guaranteed, and a leakage path of a content may be checked.

Abstract: Provided is a decorative member including a substrate and a decorative layer provided on the substrate, wherein the decorative member has a depth parameter value ?1m represented by Formula 1 of 0.15 or more.

Abstract: The present disclosure relates to a large-scale production method of plant exosomes. The method of the present disclosure can isolate high purity plant exosomes from a large amount of raw plants, using centrifugation and TFF, which can process a large amount of plant raw materials at once. This improves a conventional isolation process of plant exosomes stayed at the laboratory level, and thereby, suggests an easy process for large-scale production.

Abstract: A display device includes: a display panel including a folding area and a first non-folding area extended from a first folding line located on a first side of the folding area; a digitizer layer disposed on the display panel and including electrode patterns; and a step covering layer disposed between the display panel and the digitizer layer, wherein the step covering layer includes a first metal plate, a second metal plate, and a first non-metal plate, wherein the first metal plate overlaps the folding area, wherein the second metal plate overlaps the first non-folding area, and wherein the first non-metal plate overlaps the first non-folding area and is disposed on a first surface of the second metal plate.

Abstract: The present application relates to a decorative member including a color developing layer including a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on one surface of the color developing layer, wherein the light absorbing layer includes a copper oxide (CuaOx).

Abstract: A method for three-dimensionally modeling an eyeball and optical nerves using the merging of MRI images and OCT images, comprises: (a) a step for three-dimensionally modeling an eyeball model on the basis of the shapes of an eyeballs in a first MRI head image and a second MRI head image; (b) a step for three-dimensionally modeling an ASCO model in a corrected OCT eyeball cross-sectional image; (c) a step for three-dimensionally modeling the lamina cribrosa in the corrected OCT eyeball image; and (d) a step for generating an optic nerve model by three-dimensionally modeling an optic tract connected to the three-dimensionally modeled eyeball model.

Abstract: The present application relates to a decoration member including a pattern layer provided on one surface of the substrate and including a convex structure or a concave structure arranged two-dimensionally, and a method for preparing the decoration member.

Abstract: A pixel circuit of a display apparatus includes a driving transistor including a gate electrode coupled with a gate node, a drain electrode coupled with a high level pixel power source, and a source electrode coupled with a source node; a light emitting device coupled with the source node and coupled with a low level pixel power source; a first transistor turned on based on a first scan signal; a second transistor turned on based on a second scan signal; a first capacitor coupled between the gate node and the source node; a second capacitor coupled with the source node at one electrode thereof; a third transistor turned on based on a third scan signal to couple the gate node with the other electrode of the second capacitor; and a fourth transistor turned on based on a fourth scan signal to apply a data voltage to the gate node.

Abstract: A method for evaluating an accelerated idle life of a secondary battery, includes an evaluation condition input process including inputting an idle temperature and a measurement period for a reference performance test to evaluate the accelerated idle life of the secondary battery, a data computation process including computing an evaluation period, in which a state of health of the secondary battery reaches a set range, a capacity degradation rate, and a direct current internal resistance change rate, and an acceleration factor calculation process including calculating an acceleration factor of the secondary battery using a first equation that the acceleration factor is equal to the direct current internal resistance change rate divided by a capacity degradation rate.

Abstract: A gate driver according to an embodiment and a display device including the same are disclosed. The gate driver according to the embodiment includes an output clock line through which an output clock signal is applied, a dummy clock line disposed side by side with the output clock line and through which a dummy clock signal is applied, a pull-up transistor including a first electrode connected to the output clock line, a gate electrode connected to a first control node, and a second electrode connected to an output node from which a gate signal is output, and a pull-down transistor including a first electrode connected to the output node, a gate electrode connected to a second control node, and a second electrode connected to a power line through which a low-potential power voltage is applied.

Abstract: A display device includes a display panel; a first upper support member on the display panel; and a second upper support member on the display panel and spaced from the first upper support member; and a blocking member including a blocking part crossing the first upper support member and the second upper support member, a first stretchable part connected to a side of the blocking part and including a plurality of openings, a second stretchable part connected to another side of the blocking part and including a plurality of openings, a first fixing part connected to the first stretchable part, and a second fixing part connected to the second stretchable part.

Abstract: The present disclosure relates to a method for manufacturing a decoration element, the method including depositing a light reflective layer having a structure of two or more islands separated from each other on one surface of a light absorbing layer; and dry etching the light absorbing layer using the island as a mask, wherein a resistance value of the decoration element after the dry etching of the light absorbing layer increases by two times or more compared to before the dry etching of the light absorbing layer.

Abstract: A negative electrode for a lithium secondary battery including a negative electrode current collector; and a negative electrode active material layer formed on the negative electrode current collector, wherein the negative electrode active material layer includes graphite and silicon oxide, and lithium is incorporated in the negative electrode active material layer, and a method for preparing the same.

Abstract: A method for evaluating a life of a secondary battery, including an evaluation condition input process of inputting a temperature, a charging rate, and a discharging rate to evaluate the life of the secondary battery, a data computation process of computing an evaluation period, in which a state of health of the secondary battery reaches a set range, a capacity degradation rate, and a direct current internal resistance change rate, and an acceleration factor calculation process of calculating an acceleration factor of the secondary battery using a first equation, the first equation being that the acceleration factor is equal to the direct current internal resistance increase rate divided by the capacity degradation rate.

Abstract: The present invention provides a method for integrated online monitoring and a system for integrated online monitoring from a remote location for a nuclear power plant. The method includes a first step of collecting machine monitoring data of a plurality of units in the nuclear power plant selectively from the local data acquisition device via the monitoring data relay device, and a second step of collecting machine diagnostic data of a plurality of units in the nuclear power plant selectively from the local data acquisition device via the diagnostic data relay device.

Abstract: The present disclosure relates to a decoration member comprising a color developing layer comprising a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on one surface of the color developing layer, wherein the light absorbing layer comprises a molybdenum-titanium oxide (MoaTibOx).

Abstract: The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method, and a composition for treating an autoimmune disease, the composition comprising the regulatory T cells.