Patents by Inventor Yong Chan Kim

Yong Chan Kim has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Patent number: 12290158
    Abstract: The present application relates to a decorative member including a color developing layer including a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on one surface of the color developing layer, wherein the light absorbing layer includes a copper oxide (CuaOx).
    Type: Grant
    Filed: April 10, 2019
    Date of Patent: May 6, 2025
    Assignee: LG CHEM, LTD.
    Inventors: Yong Chan Kim, Ki Hwan Kim, Nansra Heo, Jeong Woo Shon, Pilsung Jo
  • Publication number: 20250138125
    Abstract: A method for generating an optic nerve pathway, using matches of MRI images and OCT images, in which low-resolution MRI head images capable of showing the eyeball and optic nerve are matched with corrected OCT eyeball cross-sectional images to model the eyeball and optic nerve pathway in a 3D manner and deformed states of individual eyeballs and optic nerves are identified through the eyeball model and optic nerve model constructed through the 3D modeling, whereby the possibility of myopia and glaucoma can be predicted.
    Type: Application
    Filed: August 31, 2022
    Publication date: May 1, 2025
    Inventor: Yong Chan KIM
  • Patent number: 12195724
    Abstract: The present invention provides methods for producing cell populations enriched for stable, regulatory T cells (Tregs). In particular, the invention relates to methods for culturing T cells such that the final culture is enriched for stable, regulatory T cells. It also relates to methods for stabilizing regulatory T cells. Also provided are compositions enriched for stable, regulatory T cells, which are useful for treating individuals in need of such treatment. The methods and compositions disclosed herein can also be used to treat an individual suffering from an immune-mediated disease.
    Type: Grant
    Filed: July 9, 2021
    Date of Patent: January 14, 2025
    Assignee: The United States of America, as represented by the Secretary, Department of Health and Human Services
    Inventors: Yong Chan Kim, Ethan Shevach
  • Patent number: 12138957
    Abstract: Provided is a decorative member including a substrate and a decorative layer provided on the substrate, wherein the decorative member has a depth parameter value ?1m represented by Formula 1 of 0.15 or more.
    Type: Grant
    Filed: January 8, 2019
    Date of Patent: November 12, 2024
    Assignee: LG CHEM, LTD.
    Inventors: Jin Suk Song, Sangcholl Han, Yong Chan Kim, Nansra Heo, Jeong Woo Shon, Pilsung Jo
  • Patent number: 12075898
    Abstract: The present application relates to a decorative member including a color developing layer including a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on one surface of the color developing layer, wherein the light absorbing layer includes a copper oxide (CuaOx).
    Type: Grant
    Filed: April 10, 2019
    Date of Patent: September 3, 2024
    Assignee: LG CHEM, LTD.
    Inventors: Yong Chan Kim, Ki Hwan Kim, Nansra Heo, Jeong Woo Shon, Pilsung Jo
  • Publication number: 20240281934
    Abstract: A method for three-dimensionally modeling an eyeball and optical nerves using the merging of MRI images and OCT images, comprises: (a) a step for three-dimensionally modeling an eyeball model on the basis of the shapes of an eyeballs in a first MRI head image and a second MRI head image; (b) a step for three-dimensionally modeling an ASCO model in a corrected OCT eyeball cross-sectional image; (c) a step for three-dimensionally modeling the lamina cribrosa in the corrected OCT eyeball image; and (d) a step for generating an optic nerve model by three-dimensionally modeling an optic tract connected to the three-dimensionally modeled eyeball model.
    Type: Application
    Filed: August 31, 2022
    Publication date: August 22, 2024
    Inventor: Yong Chan KIM
  • Patent number: 12053073
    Abstract: The present application relates to a decoration member including a pattern layer provided on one surface of the substrate and including a convex structure or a concave structure arranged two-dimensionally, and a method for preparing the decoration member.
    Type: Grant
    Filed: April 9, 2019
    Date of Patent: August 6, 2024
    Assignee: LG CHEM, LTD.
    Inventors: Pilsung Jo, Jin Suk Song, Sangcholl Han, Ki Hwan Kim, Yong Chan Kim, Nansra Heo, Jeong Woo Shon
  • Publication number: 20240255582
    Abstract: A method for evaluating an accelerated idle life of a secondary battery, includes an evaluation condition input process including inputting an idle temperature and a measurement period for a reference performance test to evaluate the accelerated idle life of the secondary battery, a data computation process including computing an evaluation period, in which a state of health of the secondary battery reaches a set range, a capacity degradation rate, and a direct current internal resistance change rate, and an acceleration factor calculation process including calculating an acceleration factor of the secondary battery using a first equation that the acceleration factor is equal to the direct current internal resistance change rate divided by a capacity degradation rate.
    Type: Application
    Filed: October 18, 2023
    Publication date: August 1, 2024
    Inventors: Yong Chan KIM, Seon Hye YOON, Hye Won KIM, Su Jin PARK, Jeong Won OH
  • Patent number: 12037674
    Abstract: The present disclosure relates to a method for manufacturing a decoration element, the method including depositing a light reflective layer having a structure of two or more islands separated from each other on one surface of a light absorbing layer; and dry etching the light absorbing layer using the island as a mask, wherein a resistance value of the decoration element after the dry etching of the light absorbing layer increases by two times or more compared to before the dry etching of the light absorbing layer.
    Type: Grant
    Filed: September 2, 2019
    Date of Patent: July 16, 2024
    Assignee: LG Chem, Ltd.
    Inventors: Pilsung Jo, Yong Chan Kim, Song Ho Jang, Ki Hwan Kim, Nansra Heo, Jeong Woo Shon
  • Patent number: 12034147
    Abstract: A negative electrode for a lithium secondary battery including a negative electrode current collector; and a negative electrode active material layer formed on the negative electrode current collector, wherein the negative electrode active material layer includes graphite and silicon oxide, and lithium is incorporated in the negative electrode active material layer, and a method for preparing the same.
    Type: Grant
    Filed: September 19, 2018
    Date of Patent: July 9, 2024
    Assignee: LG ENERGY SOLUTION, LTD.
    Inventors: Yong Chan Kim, Ki Hwan Kim, Jeong Woo Shon, Pilsung Jo
  • Publication number: 20240210487
    Abstract: A method for evaluating a life of a secondary battery, including an evaluation condition input process of inputting a temperature, a charging rate, and a discharging rate to evaluate the life of the secondary battery, a data computation process of computing an evaluation period, in which a state of health of the secondary battery reaches a set range, a capacity degradation rate, and a direct current internal resistance change rate, and an acceleration factor calculation process of calculating an acceleration factor of the secondary battery using a first equation, the first equation being that the acceleration factor is equal to the direct current internal resistance increase rate divided by the capacity degradation rate.
    Type: Application
    Filed: October 18, 2023
    Publication date: June 27, 2024
    Inventors: Yong Chan KIM, Hye Won KIM, Seon Hye YOON, Su Jin PARK, Seon Yeong LEE, Hack Jun LEE, Chan Yeong KIM
  • Patent number: 12013555
    Abstract: The present disclosure relates to a decoration member comprising a color developing layer comprising a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on one surface of the color developing layer, wherein the light absorbing layer comprises a molybdenum-titanium oxide (MoaTibOx).
    Type: Grant
    Filed: June 14, 2019
    Date of Patent: June 18, 2024
    Assignee: LG CHEM, LTD.
    Inventors: Yong Chan Kim, Ki Hwan Kim, Nansra Heo, Jeong Woo Shon, Pilsung Jo
  • Patent number: 12014837
    Abstract: The present invention provides a method for integrated online monitoring and a system for integrated online monitoring from a remote location for a nuclear power plant. The method includes a first step of collecting machine monitoring data of a plurality of units in the nuclear power plant selectively from the local data acquisition device via the monitoring data relay device, and a second step of collecting machine diagnostic data of a plurality of units in the nuclear power plant selectively from the local data acquisition device via the diagnostic data relay device.
    Type: Grant
    Filed: August 29, 2017
    Date of Patent: June 18, 2024
    Assignee: KOREA HYDRO & NUCLEAR POWER CO., LTD.
    Inventors: Dae Woong Kim, Yang Seok Kim, Bum Nyun Kim, Young Sheop Park, Chi Yong Park, Jong Seog Kim, Hyoung Kyun Kim, Byoung Oh Lee, Ji In Kim, Nam Woo Choi, Jae Hun Shin, Jae Min An, Yong Chan Kim
  • Publication number: 20240182855
    Abstract: The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method, and a composition for treating an autoimmune disease, the composition comprising the regulatory T cells.
    Type: Application
    Filed: March 31, 2022
    Publication date: June 6, 2024
    Inventors: Yong Chan KIM, Nari BYUN, Jeong Heon YOON
  • Patent number: 11971564
    Abstract: A decoration element is described. The decoration element includes a light reflective layer; a light absorbing layer provided on the light reflective layer; and a color developing layer comprising a color film, wherein the color developing layer is provided: on a surface of the light reflective layer opposite to a surface of the light reflective layer facing the light absorbing layer; between the light reflective layer and the light absorbing layer; or on a surface of the light absorbing layer opposite to a surface of the light absorbing layer facing the light reflective layer.
    Type: Grant
    Filed: July 4, 2018
    Date of Patent: April 30, 2024
    Assignee: LG CHEM, LTD.
    Inventors: Pilsung Jo, Song Ho Jang, Yong Chan Kim, Jeong Woo Shon, Jin Suk Song, Ki Hwan Kim
  • Patent number: 11940636
    Abstract: The present disclosure relates to a decoration member comprising: a color expression layer comprising a light reflection layer and a light absorption layer provided on the light reflection layer; and a substrate provided on one surface of the color expression layer, in which the light absorption layer comprises a copper nickel oxide (CuaNibOx).
    Type: Grant
    Filed: June 14, 2019
    Date of Patent: March 26, 2024
    Assignee: LG Chem, Ltd.
    Inventors: Yong Chan Kim, Ki Hwan Kim, Nansra Heo, Jeong Woo Shon, Pilsung Jo
  • Patent number: 11906760
    Abstract: This specification relates to a decoration member including: a substrate; a pattern layer comprising two or more unit pattern provided on one surface of the substrate; and an inorganic layer formed on the pattern layer, in which the inorganic layer includes a region in which a thickness t(x) of the inorganic layer formed on each unit pattern increases in a direction x in which the unit patterns are arranged.
    Type: Grant
    Filed: June 17, 2019
    Date of Patent: February 20, 2024
    Assignee: LG CHEM, LTD.
    Inventors: Yong Chan Kim, Ki Hwan Kim
  • Publication number: 20240051371
    Abstract: A system and method for controlling an after blow for a mobility includes an air conditioner and a control unit to perform sterilization and prevents bacteria generation through a removal of condensed water generated in an evaporator by operating a blower of an air conditioner to dry the evaporator when turning off a mobility after using the air conditioner in an electric mobility including a high voltage battery.
    Type: Application
    Filed: January 20, 2023
    Publication date: February 15, 2024
    Applicants: Hyundai Motor Company, Kia Corporation
    Inventors: Won Young BAE, Woo Hyeok AHN, Yong Chan KIM
  • Patent number: 11889910
    Abstract: The present disclosure relates to a decoration member comprising: a color expression layer comprising a light reflection layer and a light absorption layer provided on the light reflection layer; and a substrate provided on one surface of the color expression layer, in which the light absorption layer comprises a copper nickel oxide (CuaNibOx).
    Type: Grant
    Filed: June 14, 2019
    Date of Patent: February 6, 2024
    Assignee: LG Chem, Ltd.
    Inventors: Yong Chan Kim, Ki Hwan Kim, Nansra Heo, Jeong Woo Shon, Pilsung Jo
  • Publication number: 20230404394
    Abstract: The disclosure relates to a glaucoma determination device and method. In particular, there may be provided a glaucoma determination device and method capable of determining the presence or absence of glaucoma from gaze tracking information. Specifically, there may be provided a glaucoma determination device and method capable of determining the presence or absence by determining the start time point and end time point of a gaze movement from gaze movement information and calculating area information about the gaze movement based thereupon.
    Type: Application
    Filed: May 19, 2023
    Publication date: December 21, 2023
    Inventor: Yong Chan KIM