Abstract: The present application relates to a decoration member including a substrate layer having a convex structure or a concave structure arranged two-dimensionally, and a method for preparing the decoration member.

Abstract: An electrochromic device having a conductive layer having reflectiveness and light absorption characteristics simultaneously. The device is capable of realizing various esthetic senses, color senses or stereoscopic color patterns, and at the same time has excellent durability.

Abstract: A decoration member for a cosmetic container including: a color expression layer having a light reflecting layer and a light absorbing layer provided on the light reflecting layer; and a substrate provided on one surface of the color expression layer.

Abstract: The present disclosure relates to a decoration element comprising a light reflective layer; and a light absorbing layer provided on the light reflective layer, wherein the light absorbing layer has surface resistance of 20 ohm/square or greater.

Abstract: A method of determining pathologic myopia by using the geometric structure of a posterior sclera of a fundus includes obtaining geometric location data about a fovea, an optic disc, and a deepest point of the eye (DPE) in the posterior sclera of the fundus; obtaining an elevation difference TEPSfovea?DPE between the fovea and the DPE, an elevation difference TEPSdisc?DPE between the optic disc and the DPE, and an elevation difference TEPSfovea?disc between the fovea and the optic disc by using location information about the fovea, the optic disc, and the DPE in the posterior sclera; and determining pathologic myopia by using at least two elevation differences selected from among the elevation difference TEPSfovea?DPE between the fovea and the DPE, the elevation difference TEPSdisc?DPE between the optic disc and the DPE, and the elevation difference TEPSfovea?disc between the fovea and the optic disc.

Abstract: A decoration element including: a color developing layer including a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on a surface of the color developing layer. The substrate comprises a pattern layer, and the light absorbing layer comprises an aluminum oxynitride (AlaObNc).

Abstract: A method for preparing an electrochromic device. In the method the device is prepared by inserting monovalent cations into a reducing electrochromic layer in advance, for instance, through a dry process. In particular, the method involves inserting monovalent cations into an electrochromic layer which includes a reducing electrochromic material. Then, subsequently and sequentially, placing an electrolyte layer and an ion storage layer on the electrochromic layer. In this way, it is possible to improve driving durability of the electrochromic device.

Abstract: A decoration member including: a color developing layer including a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on one surface of the color developing layer. The substrate includes a pattern layer, and the light absorbing layer includes silicon (Si).

Abstract: The present disclosure relates to a decoration element comprising a light reflective layer; a light absorbing layer provided on the light reflective layer; and a color developing layer comprising a color film provided on a surface opposite to the surface facing the light absorbing layer of the light reflective layer, between the light reflective layer and the light absorbing layer, or on a surface opposite to the surface facing the light reflective layer of the light absorbing layer.

Abstract: An electrochromic device including an electrode layer, an electrochromic layer and a conductive band having a closed ring shape. The electrochromic device having the above structure has excellent color-switching speeds and electrochromic uniformity.

Abstract: A secondary battery includes: an electrode assembly; a case accommodating the electrode assembly; a cap plate sealing the case; and an insulating member between the electrode assembly and the cap plate, and a relationship of M/E=R1 is satisfied, where M is a melting point (° C.) of the insulating member, E is an energy density (Wh/kg) of the secondary battery, and R1 is 0.5 to 3.5.

Abstract: A decorative member including: a color developing layer including a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on one surface of the color developing layer. The light absorbing layer includes a copper oxynitride (CuaObNc).

Abstract: A presbyopia diagnosis apparatus includes: a measurement bar that is elongated along an axis in one direction, has a front end arranged to face the eyes of a subject for presbyopia measurement, and a rear end connected to a support, wherein a scale for measuring a distance is marked on the measurement bar; and a sliding unit that is movably installed on the measurement bar and has an installation groove formed therein, the installation groove for mounting a card for measuring presbyopia.

Abstract: The present disclosure relates to a method for manufacturing a film for a decoration element, the method including depositing two or more islands on one surface of a film; and forming a pattern portion by dry etching the film using the island as a mask.

Abstract: The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method.

Abstract: The present disclosure relates to a decoration member comprising a color developing layer comprising a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on one surface of the color developing layer, wherein the light absorbing layer comprises a molybdenum-titanium oxide (MoaTibOx).

Abstract: The present disclosure relates to a decoration element comprising a light reflective layer, and a light absorbing layer provided on the light reflective layer and comprising Si.

Abstract: A decoration element including a color developing layer including a light reflective layer, a light absorbing layer provided on the light reflective layer, and a convex portion or concave portion having an asymmetric-structured cross-section; an electrochromic device provided on any one surface of the color developing layer; and an in-mold label layer provided on the other surface of the color developing layer.

Abstract: A decoration element including a color developing layer including a light reflective layer, and a light absorbing layer provided on the light reflective layer; and an in-mold label layer provided on one surface of the color developing layer. The light absorbing layer includes a convex portion shape or concave portion shape having an asymmetric cross-section.

Abstract: A decoration member including: a color developing layer including a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on one surface of the color developing layer. The light absorbing layer includes a copper oxynitride (CuaObNc).