Abstract: The present disclosure relates to a decoration element comprising a light reflective layer; a light absorbing layer provided on the light reflective layer; and a color developing layer comprising a color film provided on a surface opposite to the surface facing the light absorbing layer of the light reflective layer, between the light reflective layer and the light absorbing layer, or on a surface opposite to the surface facing the light reflective layer of the light absorbing layer.

Abstract: An electrochromic device including an electrode layer, an electrochromic layer and a conductive band having a closed ring shape. The electrochromic device having the above structure has excellent color-switching speeds and electrochromic uniformity.

Abstract: A secondary battery includes: an electrode assembly; a case accommodating the electrode assembly; a cap plate sealing the case; and an insulating member between the electrode assembly and the cap plate, and a relationship of M/E=R1 is satisfied, where M is a melting point (° C.) of the insulating member, E is an energy density (Wh/kg) of the secondary battery, and R1 is 0.5 to 3.5.

Abstract: A decorative member including: a color developing layer including a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on one surface of the color developing layer. The light absorbing layer includes a copper oxynitride (CuaObNc).

Abstract: A presbyopia diagnosis apparatus includes: a measurement bar that is elongated along an axis in one direction, has a front end arranged to face the eyes of a subject for presbyopia measurement, and a rear end connected to a support, wherein a scale for measuring a distance is marked on the measurement bar; and a sliding unit that is movably installed on the measurement bar and has an installation groove formed therein, the installation groove for mounting a card for measuring presbyopia.

Abstract: The present disclosure relates to a method for manufacturing a film for a decoration element, the method including depositing two or more islands on one surface of a film; and forming a pattern portion by dry etching the film using the island as a mask.

Abstract: The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method.

Abstract: The present disclosure relates to a decoration member comprising a color developing layer comprising a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on one surface of the color developing layer, wherein the light absorbing layer comprises a molybdenum-titanium oxide (MoaTibOx).

Abstract: A decoration element including a color developing layer including a light reflective layer, a light absorbing layer provided on the light reflective layer, and a convex portion or concave portion having an asymmetric-structured cross-section; an electrochromic device provided on any one surface of the color developing layer; and an in-mold label layer provided on the other surface of the color developing layer.

Abstract: The present disclosure relates to a decoration element comprising a light reflective layer, and a light absorbing layer provided on the light reflective layer and comprising Si.

Abstract: A decoration element including a color developing layer including a light reflective layer, and a light absorbing layer provided on the light reflective layer; and an in-mold label layer provided on one surface of the color developing layer. The light absorbing layer includes a convex portion shape or concave portion shape having an asymmetric cross-section.

Abstract: A decoration member including: a color developing layer including a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on one surface of the color developing layer. The light absorbing layer includes a copper oxynitride (CuaObNc).

Abstract: The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method.

Abstract: A decorative member including: a color developing layer including a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on a surface of the color developing layer. The substrate comprises a pattern layer, and the light absorbing layer comprises silicon (Si).

Abstract: An electrochromic film and an electrochromic device including the electrochromic film are disclosed. The electrochromic film includes an electrochromic layer and a passivation layer on one side of the electrochromic layer. The coloration level of the electrochromic film is different from the coloration level of the passivation layer. The film may change optical properties as a result of electrochromism according to an electrochemical reaction. The electrochromic film and the electrochromic device have improved electrochromism, excellent durability, excellent color-switching speed, and stepwise control of optical properties.

Abstract: The present disclosure relates to a decoration element comprising a light reflective layer; and a light absorbing layer provided on the light reflective layer, wherein the light reflective layer is a discontinuous film.

Abstract: An electrochromic film, which is a reflective electrochromic film, which includes an electrode layer, a light absorbing layer and an electrochromic layer. The film can improve an electrochromism rate and realize various colors or esthetic senses.

Abstract: A light-transmitting film and a device including the light-transmitting film are disclosed. The light-transmitting film includes an oxynitride containing two or more metals selected from Ti, Nb, Mo, Ta and W, and having light transmittance of 60% or more. The oxynitride may be represented by Formula 1, which is MoaTibOxNy where a>0, b>0, x>0, y>0, 0.5<a/b<4.0, and 0.005<y/x<0.02. The film has a light transmission characteristic, is capable of reversible color-switching depending on the applied voltage, and has excellent durability within a driving voltage range in which the film changes its color.

Abstract: The disclosed relates to a decoration element and a method for preparing the decoration element. The decoration element has dichroism expressing different colors depending on a viewing direction, and has improved visibility of the dichroism.

Abstract: Disclosed is a positive electrode and a lithium secondary battery comprising the same, the positive electrode comprising a current collector, and a positive electrode active material layer comprising a plurality of positive electrode active materials, and an atomic layer deposition coating layer disposed in surfaces and pores of the positive electrode active materials and gaps between the plurality of positive electrode active materials, wherein the atomic layer deposition coating layer is 0.2 to 1 nm in thickness. A ratio of an amount of the atomic layer deposition coating layer of a lowermost portion of the positive electrode active material layer in contact with the current collector, to an amount of the atomic layer deposition coating layer of an uppermost portion of the positive electrode active material layer, is 40 weight % or more, and the positive electrode has a porosity of 15% to 35%.