Abstract: The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method.

Abstract: An electrochromic film and an electrochromic device including the electrochromic film are disclosed. The electrochromic film includes an electrochromic layer and a passivation layer on one side of the electrochromic layer. The coloration level of the electrochromic film is different from the coloration level of the passivation layer. The film may change optical properties as a result of electrochromism according to an electrochemical reaction. The electrochromic film and the electrochromic device have improved electrochromism, excellent durability, excellent color-switching speed, and stepwise control of optical properties.

Abstract: A decorative member including: a color developing layer including a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on a surface of the color developing layer. The substrate comprises a pattern layer, and the light absorbing layer comprises silicon (Si).

Abstract: The present disclosure relates to a decoration element comprising a light reflective layer; and a light absorbing layer provided on the light reflective layer, wherein the light reflective layer is a discontinuous film.

Abstract: An electrochromic film, which is a reflective electrochromic film, which includes an electrode layer, a light absorbing layer and an electrochromic layer. The film can improve an electrochromism rate and realize various colors or esthetic senses.

Abstract: A light-transmitting film and a device including the light-transmitting film are disclosed. The light-transmitting film includes an oxynitride containing two or more metals selected from Ti, Nb, Mo, Ta and W, and having light transmittance of 60% or more. The oxynitride may be represented by Formula 1, which is MoaTibOxNy where a>0, b>0, x>0, y>0, 0.5<a/b<4.0, and 0.005<y/x<0.02. The film has a light transmission characteristic, is capable of reversible color-switching depending on the applied voltage, and has excellent durability within a driving voltage range in which the film changes its color.

Abstract: The disclosed relates to a decoration element and a method for preparing the decoration element. The decoration element has dichroism expressing different colors depending on a viewing direction, and has improved visibility of the dichroism.

Abstract: Disclosed is a positive electrode and a lithium secondary battery comprising the same, the positive electrode comprising a current collector, and a positive electrode active material layer comprising a plurality of positive electrode active materials, and an atomic layer deposition coating layer disposed in surfaces and pores of the positive electrode active materials and gaps between the plurality of positive electrode active materials, wherein the atomic layer deposition coating layer is 0.2 to 1 nm in thickness. A ratio of an amount of the atomic layer deposition coating layer of a lowermost portion of the positive electrode active material layer in contact with the current collector, to an amount of the atomic layer deposition coating layer of an uppermost portion of the positive electrode active material layer, is 40 weight % or more, and the positive electrode has a porosity of 15% to 35%.

Abstract: The present disclosed relates to a decoration element and a method for preparing the decoration element. decoration element has dichroism expressing different colors depending on a viewing direction, and has improved visibility of the dichroism.

Abstract: A coating apparatus, and particularly, an atomic layer deposition apparatus. The atomic layer deposition apparatus consecutively coats the surfaces of powder particles with different kinds of materials.

Abstract: The present invention provides a method for integrated online monitoring and a system for integrated online monitoring from a remote location for a nuclear power plant. The method includes a first step of collecting machine monitoring data of a plurality of units in the nuclear power plant selectively from the local data acquisition device via the monitoring data relay device, and a second step of collecting machine diagnostic data of a plurality of units in the nuclear power plant selectively from the local data acquisition device via the diagnostic data relay device.

Abstract: Provided is an aqueous humour discharge apparatus for glaucoma prevention. The aqueous humour discharge apparatus for glaucoma prevention includes: an aqueous humour discharge tube including a contact portion provided on one side and contacting the cornea of an eyeball, an exposed portion exposed not to contact the sclera of the eyeball and provided on the other side, and a channel formed between the contact portion and the exposed portion, to enable aqueous humour to flow therethrough; and a cover member arranged to surround the cornea and the sclera, the cover member including a contact hole formed on one surface that contacts the cornea, and contacted by the aqueous humour discharge tube, a discharge hole formed on the other surface located on the opposite side to the one surface and exposed to the outside, to discharge the aqueous humour, and a flow channel provided between the contact hole and the discharge hole to provide a discharge path of the aqueous humour.

Abstract: The present disclosure relates to a decoration element comprising a color developing layer comprising a light reflective layer, and a light absorbing layer provided on the light reflective layer; and an electrochromic device provided on one surface of the color developing layer.

Abstract: The present invention provides methods for producing cell populations enriched for stable, regulatory T cells (Tregs). In particular, the invention relates to methods for culturing T cells such that the final culture is enriched for stable, regulatory T cells. It also relates to methods for stabilizing regulatory T cells. Also provided are compositions enriched for stable, regulatory T cells, which are useful for treating individuals in need of such treatment. The methods and compositions disclosed herein can also be used to treat an individual suffering from an immune-mediated disease.

Abstract: The present disclosure relates to a decoration element comprising a light reflective layer; and a light absorbing layer provided on the light reflective layer, wherein the light reflective layer has surface resistance of 20 ohm/square or less.

Abstract: The present disclosure provides methods for producing cell populations enriched for induced regulatory T cells (iTregs). In particular, the disclosure relates to methods for culturing T cells such that the final culture is enriched for induced regulatory T cells. The disclosure also relates to methods for inducing regulatory T cells. Also provided are compositions enriched for induced regulatory T cells, which are useful for treating individuals in need of such treatment. The methods and compositions disclosed herein can also be used to treat individuals suffering from immune-mediated diseases.

Abstract: The present disclosure relates to a decoration element comprising a light reflective layer; and a light absorbing layer provided on the light reflective layer, wherein the light reflective layer has surface resistance of 20 ohm/square or greater.

Abstract: The present disclosure relates to a method for manufacturing a decoration element, the method including depositing a light reflective layer having a structure of two or more islands separated from each other on one surface of a light absorbing layer; and dry etching the light absorbing layer using the island as a mask, wherein a resistance value of the decoration element after the dry etching of the light absorbing layer increases by two times or more compared to before the dry etching of the light absorbing layer.

Abstract: The present disclosure relates to a method for manufacturing a film for a decoration element, the method including depositing two or more islands on one surface of a film; and forming a pattern portion by dry etching the film using the island as a mask.

Abstract: The present specification relates to a decorative member comprising a base and inorganic layers comprising a first light absorption layer, a light reflection layer, and a second light absorption layer sequentially provided on the base, in which ?E12 indicated in Equation 1 is 1 or more, and a method of manufacturing the decorative member.