Compositions and methods for identification of a duplicate sequencing read

- Tecan Genomics

The present invention provides methods, compositions and kits for detecting duplicate sequencing reads. In some embodiments, the duplicate sequencing reads are removed.

Skip to: Description  ·  Claims  ·  References Cited  · Patent History  ·  Patent History
Description
CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of U.S. Provisional Application Ser. No. 61/903,826, filed Nov. 13, 2013, which is herein incorporated by reference in its entirety.

DESCRIPTION OF THE TEXT FILE SUBMITTED ELECTRONICALLY

The contents of the text file submitted electronically herewith are incorporated herein by reference in their entirety: A computer readable format copy of the Sequence Listing (filename: NUGN_001_01US_SeqList_ST25.txt, date recorded: Nov. 12, 2014, file size 3 kilobytes).

FIELD OF THE PRESENT INVENTION

The present invention relates generally to the field of high throughput sequencing reactions and the ability to discern artifacts arising through sequence duplications from nucleotide molecules that are unique molecules.

BACKGROUND OF THE PRESENT INVENTION

In RNA sequencing applications, accurate gene expression measurements may be hampered by PCR duplicate artifacts that occur during library amplification. When analyzing RNA sequencing data, when two or more identical sequences are found, it can be difficult to know if these represent unique cDNA molecules derived independently from different RNA molecules, or if they are PCR duplicates derived from a single RNA molecule. In genotyping by sequencing, duplicate reads can be considered non-informative and may be collapsed down to a single read, thus reducing the number of sequencing reads used in final analysis. Generally, sequencing reads may be determined to be duplicates if both forward and reverse reads have identical starting positions, even though two independently generated molecules can have identical starting positions by random chance. Single primer extension based targeted resequencing suffers from an issue in that only one end of a sequencing read is randomly generated, while the other (reverse read) end is generated by a specific probe. This may make it difficult to determine if two reads are duplicates because they have been duplicated by PCR or because by chance they happened to start at the same position.

In expression analysis studies there may be limited value in doing paired end sequencing since the goal of the experiment is to determine amounts of transcript present as opposed to studying exon usage. In these studies, paired end sequencing adds costs while the only value is in helping distinguish PCR duplicates. The probability of two reads starting in the same position on only one end is higher than the probability of two reads having the same starting position on two ends (forward and reverse read). There is a need for improved methods that allow for low-cost, high throughput sequencing of regions of interest, genotyping or simple detection of RNA transcripts without inherent instrument inefficiencies that drive up sequencing costs due to the generation of unusable or non-desired data reads. The invention described herein fulfills this need. Here, we describe an adaptor approach that allows for the identification of true PCR duplicates and their removal.

The methods of the present invention provide novel methods for identifying true duplicate reads during sequencing, such as to improve data analysis of sequencing data, and other related advantages.

SUMMARY OF THE PRESENT INVENTION

The present invention is based, in part, on compositions and methods for discerning duplicate sequencing reads from a population of sequencing reads. The detection and/or removal of duplicate sequencing reads presented herein is a novel approach to increasing the efficacy of evaluating data generated from high throughput sequence reactions, including complex multiplex sequence reactions.

Accordingly, the present invention provides a method of detecting a duplicate sequencing read from a population of sample sequencing reads, the method comprising ligating an adaptor to a 5′ end of each nucleic acid fragment of a plurality of nucleic acid fragments from one or more samples, wherein the adaptor comprises an indexing primer binding site, an indexing site, an identifier site, and a target sequence primer binding site. The ligated adaptor-nucleic acid fragment products can be amplified, thus generating a population of sequencing reads from the amplified adaptor-nucleic acid ligation products. The sequencing reads with a duplicate identifier site and target sequence can then be detected from the population of sequencing reads. The methods can further include the removal of the sequencing reads with the duplicate identifier site and target sequence from the population of sequence reads.

In some embodiments, the identifier site is sequenced with the indexing site or the target sequence. In further embodiments, the identifier site is sequenced separately from the indexing site or the target sequence.

In some embodiments, the adaptor comprises from 5′ to 3′ the indexing primer binding site; the indexing site; the identifier site; and the target sequence primer binding site. In further embodiments, the adaptor comprises from 5′ to 3′ the indexing primer binding site; the indexing site; the target sequence primer binding site; and the identifier site.

In some embodiments, the plurality of nucleic acid fragments is generated from more than one sample. In some embodiments, the nucleic acid fragments from each sample have the same indexing site. In some embodiments, the sequencing reads are separated based on the indexing site. In yet other embodiments, the separation of sequencing reads is performed prior to detecting sequence reads with a duplicate identifier site and target sequence.

In some embodiments, the nucleic acid fragments are DNA fragments, RNA fragments, or DNA/RNA fragments. In further embodiments, the nucleic acid fragments are genomic DNA fragments or cDNA fragments.

In some embodiments, the indexing site is between 2 and 8 nucleotides in length. In further embodiments, the indexing site is about 6 nucleotides in length. In some embodiments, the identifier site is between 1 and 8 nucleotides in length. In further embodiments, the identifier site is about 8 nucleotides in length.

In some embodiments, the indexing primer binding site is a universal indexing primer binding site; and in some embodiments, the target sequence primer binding site is a universal target sequence primer binding site.

The present invention also encompasses embodiments that include a kit comprising a plurality of adaptors, wherein each adaptor comprise an indexing primer binding site; an indexing site, and identifier site, and a target sequencing primer binding site.

BRIEF DESCRIPTION OF THE DRAWINGS

A better understanding of the novel features of the invention and advantages of the present invention will be obtained by reference to the following description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:

FIG. 1 depicts a schematic of generating sequencing reads of a library including where an indexing primer and a target sequence primer anneal.

FIG. 2A depicts a mechanism of the Single Primer Enrichment Technology (SPET) and how an identifier site is carried over into the final library and how sequencing through the indexing site into the identifier site provides data on which nucleic acid molecule is being identified.

FIG. 2B is a continuation of FIG. 2A.

FIG. 3 offers a detailed view of the sequence of an example adaptor, among many envisioned embodiments, and the position of the indexing and identifier sites (SEQ ID NO: 1). “N” refers to any nucleic acid.

FIG. 4 depicts a schematic of two separate sequence libraries, indicating where the indexing primers and the target primers anneal in a traditional library as compared to a library using an identifier site.

FIG. 5 depicts a data table demonstrating the accuracy of resolving true duplicates versus apparent or perceived duplicates using an identifier site in the adaptors.

DETAILED DESCRIPTION OF THE PRESENT INVENTION

The present invention is based, in part, on compositions and methods for discerning duplicate sequencing reads from a population of sequencing reads. The present invention encompasses methods of detecting sequences duplicated in sequencing applications, and further removal of the duplicated sequence reads. The present invention further encompasses kits comprising components that would allow for customized applications of the method of detecting and removing duplicated sequence reads in high throughput sequencing reactions. The compositions and methods can be used with various applications for genetic sample analysis, such as RNA sequence analysis, copy number variation analysis, methylation sequencing analysis, genotyping and whole genome amplification.

Reference will now be made in detail to exemplary embodiments of the invention. While the disclosed methods and compositions will be described in conjunction with the exemplary embodiments, it will be understood that these exemplary embodiments are not intended to limit the present invention. On the contrary, the present disclosure is intended to encompass alternatives, modifications and equivalents, which may be included in the spirit and scope of the present invention.

Unless otherwise specified, terms and symbols of genetics, molecular biology, biochemistry and nucleic acid used herein follow those of standard treatises and texts in the field, e.g. Kornberg and Baker, DNA Replication, Second Edition (W.H. Freeman, New York, 1992); Lehninger, Biochemistry, Second Edition (Worth Publishers, New York, 1975); Strachan and Read, Human Molecular Genetics, Second Edition (Wiley-Liss, New York, 1999); Eckstein, editor, Oligonucleotides and Analogs: A Practical Approach (Oxford University Press, New York, 1991); Gait, editor, Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); and the like.

In some embodiments, the methods disclosed herein is for detecting from a population of sequencing reads a sequencing read, such as a duplicate sequencing read with a duplicate identifier site and target sequence. A duplicate sequencing read can be a sequencing read with the same identifier site and target sequence as another sequencing read in the population of sequencing reads.

Adaptor

The present invention provides compositions of adaptors and methods comprising use of an adaptor. An adapter refers to an oligonucleotide sequence, the ligation of which to a target polynucleotide or a target polynucleotide strand of interest enables the generation of amplification-ready products of the target polynucleotide or the target polynucleotide strand of interest. The target polynucleotide molecules may be fragmented or not prior to the addition of adaptors. In some embodiments, a method disclosed herein comprises ligating an adaptor to a 5′ end of each nucleic acid fragment of a plurality of nucleic acid fragments from one or more samples.

Various adaptor designs are envisioned which are suitable for generation of amplification-ready products of target sequence regions/strands of interest. For example, the two strands of the adaptor may be self-complementary, non-complementary or partially complementary. In some embodiments, the adaptor can comprise an indexing primer binding site, an indexing site, an identifier site, and a target sequence primer binding site.

An indexing primer binding site is a nucleotide sequence for binding a primer for an indexing site. An indexing site is a nucleic acid sequence that acts as an index for multiple polynucleotide samples, thus allowing for the samples to be pooled together into a single sequencing run, which is known as multiplexing. In some embodiments, the indexing site is at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In some embodiments, the indexing site is between 2 and 8 nucleotides in length. In some embodiments, the indexing site is about 6 nucleotides in length.

An identifier site is a nucleic acid sequence that comprises random bases and is used to identify duplicate sequencing reads. In some embodiments, the identifier site is at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In some embodiments, the identifier site is between 1 and 8 nucleotides in length. In some embodiments, the identifier site is about 8 nucleotides in length. This identifier site can be designed as a set of sequences, or it can be semi-random, or it can be completely random. In addition, this identifier site can be a fixed length, or it can be a variable length. In some embodiments, the identifier sites in a plurality of adaptors are of a fixed length. For example, the identifier sites can all be eight random bases. In another embodiment, the identifier sites in a plurality of adaptors are of a variable length. For example, the identifier sites can range in size from 1 to 8 bases. In yet another embodiment, the identifier sites can be of a defined set of defined sequence. For example, the identifier site of a plurality of adaptors can be one of 96 defined six-base nucleotide sequences.

A target sequence primer binding site nucleotide sequence for binding a primer for a target sequence. The primer can be used to amplify the target sequence (e.g., a nucleic acid fragment from a sample). Accordingly, in some embodiments, the adaptor comprises an indexing primer binding site and a target sequence primer binding site.

A primer is a polynucleotide chain, typically less than 200 residues long, most typically between 15 and 100 nucleotides long, but can encompass longer polynucleotide chains. A primer targeting the primer binding sites are typically designed to hybridize to single-stranded nucleic acid strands. In some embodiments, the primers targeting the primer binding sites are designed to hybridize to single-stranded DNA targets. In the case where the sample comprises genomic DNA or other double-stranded DNA, the sample can be first denatured to render the target single stranded and enable hybridization of the primers to the desired sequence regions of interest. In these embodiments, the methods and compositions described herein can allow for region-specific enrichment and amplification of sequence regions of interest. In some embodiments, the other double-stranded DNA can be double-stranded cDNA generated by first and second strand synthesis of one or more target RNAs.

In other embodiments, the primers targeting the primer binding sites are designed to hybridize to double-stranded nucleic acid targets, without denaturation of the double stranded nucleic acids. In other embodiments, the primers targeting the primer binding sites are designed to hybridize to a double-stranded DNA target, without denaturation of the dsDNA. In these embodiments, the primers targeting the selected sequence regions of interest are designed to form a triple helix (triplex) at the selected sequence regions of interest. The hybridization of the primers to the double-stranded DNA sequence regions of interest can be carried out without prior denaturation of the double stranded nucleic acid sample. In such embodiments, the methods and compositions described herein can allow for region-specific enrichment as well as strand-specific enrichment and amplification of sequence regions of interest. This method can be useful for generation of copies of strand specific sequence regions of interest from complex nucleic acid without the need to denature the dsDNA input DNA, thus enabling enrichment and analysis of multiplicity of sequence regions of interest in the native complex nucleic acid sample. The method can find use for studies and analyses carried out in situ, enable studies and analysis of complex genomic DNA in single cells or collection of very small well defined cell population, as well as permit the analysis of complex genomic DNA without disruption of chromatin structures.

The primers of the invention are generally oligonucleotides that are employed in an extension reaction by a polymerase along a polynucleotide template, such as for amplification of a target sequence (e.g., in PCR). The oligonucleotide primer can be a synthetic polynucleotide that is single stranded, containing a sequence at its 3′-end that is capable of hybridizing with a sequence of the target polynucleotide. In some embodiments, the 3′ region of the primer that hybridizes with the target nucleic acid has at least 80%, preferably 90%, more preferably 95%, most preferably 100%, complementarity to a primer binding site.

In some embodiments, the primer binding site is a binding site for a universal primer. A universal primer is a primer that can be used for amplifying a number of different sequences. In some embodiments, a universal primer is used to amplify different libraries. In some embodiments, an indexing primer binding site is a binding site for a universal indexing primer (i.e., the indexing primer binding site is a universal indexing primer binding site). In some embodiments, the adaptors used for ligating a plurality of nucleic acid fragments have a universal indexing primer binding site. In some embodiments, the universal indexing primer can be used to amplify and/or sequence a number of different indexing sites.

In some embodiments, a target sequence primer binding site is a binding site for a universal target sequence primer (i.e., the target sequence primer binding site is a universal target sequence primer binding site). In some embodiments, the adaptors used for ligating a plurality of nucleic acid fragments have a universal target sequence primer binding site. In some embodiments, the universal target sequence primer can be used to amplify and/or sequence a number of different target sequences.

In some embodiments, the adaptor comprises an identifier site 3′ to an indexing site. In some embodiments, the adaptor comprises an identifier site 5′ to an indexing site. In some embodiments, the adaptor comprises from 5′ to 3′ an indexing primer binding site, indexing site, identifier site, and target sequence primer binding site. In other embodiments, the adaptor comprises from 5′ to 3′ an indexing primer binding site, indexing site, identifier site, and target sequence primer binding site. In yet other embodiments, the adaptor comprises from 5′ to 3′ an indexing primer binding site, identifier site, indexing site, and target sequence primer binding site.

Samples

In some embodiments, an adaptor is ligated to a nucleic acid fragment (e.g., the 5′ end of the nucleic acid fragment). The nucleic acid fragment can be from a plurality of nucleic acid fragments from one or more samples. The nucleic acid fragment can be RNA, DNA, or complex DNA, for example genomic DNA and PNA, in which case one might use a modified nucleic acid. The nucleic acid fragment may also be cDNA. The cDNA can be generated from RNA, e.g., mRNA.

The sample can be a biological sample. For example, the sample can be an animal, plant, bacterial, algal, or viral sample. In some embodiments, the sample is a human, rat, or mouse sample. The sample can be from a mixture of genomes of different species such as host-pathogen, bacterial populations and the like. The sample can be cDNA made from a mixture of genomes of different species. In some embodiments, the sample can be from a synthetic source. The sample can be mitochondrial DNA. The sample can be cell-free DNA. The cell-free DNA can be obtained from sources such as a serum or a plasma sample. The sample can comprise one or more chromosomes. For example, if the sample is from a human, the sample can comprise one or more of chromosome 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, X, or Y. In some embodiments, the sample comprises a linear or circular genome. The sample can be plasmid DNA, cosmid DNA, bacterial artificial chromosome (BAC), or yeast artificial chromosome (YAC). The sample can be from more than one individual or organism. The sample can be double-stranded or single-stranded. The sample can be part of chromatin. The sample can be associated with histones.

In some embodiments, adaptors are ligated to a plurality of nucleic acid fragments from more than one sample, such as 2, 3, 4, 5, or more samples. In some embodiments, the nucleic acid fragments from each sample have the same indexing site. In some embodiments, a plurality of nucleic acid fragments is generated from a first sample and a second sample and adaptors are ligated to each nucleic acid fragment, in which adaptors ligated to each nucleic acid fragment from the first sample have the same first indexing site and adaptors ligated to nucleic acid fragments from the second sample has the same second indexing site. In some embodiments, the nucleic acid fragments or data associated with the nucleic acid fragments (e.g., sequencing reads) are separated based on the indexing site.

In some embodiments, a population of nucleic acid fragments generated from a sample is of one or more specific size range(s). In some embodiments, the fragments have an average length from about 10 to about 10,000 nucleotides. In some embodiments, the fragments have an average length from about 50 to about 2,000 nucleotides. In some embodiments, the fragments have an average length from about 100-2,500, 10-1,000, 10-800, 10-500, 50-500, 50-250, or 50-150 nucleotides. In some embodiments, the fragments have an average length less than 10,000 nucleotide, such as less than 5,000 nucleotides, less than 2,500 nucleotides, less than 2,500 nucleotides, less than 1,000 nucleotides, less than 500 nucleotides, such as less than 400 nucleotides, less than 300 nucleotides, less than 200 nucleotides, or less than 150 nucleotides.

In some embodiments, fragmentation of the nucleic acids can be achieved through methods known in the art. Fragmentation can be achieved through physical fragmentation methods and/or enzymatic fragmentation methods. Physical fragmentation methods can include nebulization, sonication, and/or hydrodynamic shearing. In some embodiments, the fragmentation can be accomplished mechanically comprising subjecting the nucleic acids in the input sample to acoustic sonication. In some embodiments, the fragmentation comprises treating the nucleic acids in the input sample with one or more enzymes under conditions suitable for the one or more enzymes to generate double-stranded nucleic acid breaks. Examples of enzymes useful in the generation of nucleic acid or polynucleotide fragments include sequence specific and non-sequence specific nucleases. Non-limiting examples of nucleases include DNase I, Fragmentase, restriction endonucleases, variants thereof, and combinations thereof. Reagents for carrying out enzymatic fragmentation reactions are commercially available (e.g., from New England Biolabs). For example, digestion with DNase I can induce random double-stranded breaks in DNA in the absence of Mg++ and in the presence of Mn++. In some embodiments, fragmentation comprises treating the nucleic acids in the input sample with one or more restriction endonucleases. Fragmentation can produce fragments having 5′ overhangs, 3′ overhangs, blunt ends, or a combination thereof. In some embodiments, such as when fragmentation comprises the use of one or more restriction endonucleases, cleavage of sample polynucleotides leaves overhangs having a predictable sequence. In some embodiments, the method includes the step of size selecting the fragments via standard methods known in the art such as column purification or isolation from an agarose gel.

In some embodiments, fragmentation of the nucleic acids is followed by end repair of the nucleic acid fragments. End repair can include the generation of blunt ends, non-blunt ends (i.e sticky or cohesive ends), or single base overhangs such as the addition of a single dA nucleotide to the 3′-end of the nucleic acid fragments, by a polymerase lacking 3′-exonuclease activity. End repair can be performed using any number of enzymes and/or methods known in the art including, but not limited to, commercially available kits such as the Encore™ Ultra Low Input NGS Library System I. In some embodiments, end repair can be performed on double stranded DNA fragments to produce blunt ends wherein the double stranded DNA fragments contain 5′ phosphates and 3′ hydroxyls. In some embodiments, the double-stranded DNA fragments can be blunt-end polished (or “end-repaired”) to produce DNA fragments having blunt ends, prior to being joined to adapters. Generation of the blunt ends on the double stranded fragments can be generated by the use of a single strand specific DNA exonuclease such as for example exonuclease 1, exonuclease 7 or a combination thereof to degrade overhanging single stranded ends of the double stranded products. Alternatively, the double stranded DNA fragments can be blunt ended by the use of a single stranded specific DNA endonuclease, for example, but not limited to, mung bean endonuclease or 51 endonuclease. Alternatively, the double stranded products can be blunt ended by the use of a polymerase that comprises single stranded exonuclease activity such as for example T4 DNA polymerase, or any other polymerase comprising single stranded exonuclease activity or a combination thereof to degrade the overhanging single stranded ends of the double stranded products. In some cases, the polymerase comprising single stranded exonuclease activity can be incubated in a reaction mixture that does or does not comprise one or more dNTPs. In other cases, a combination of single stranded nucleic acid specific exonucleases and one or more polymerases can be used to blunt end the double stranded fragments generated by fragmenting the sample comprising nucleic acids. In still other cases, the nucleic acid fragments can be made blunt ended by filling in the overhanging single stranded ends of the double stranded fragments. For example, the fragments may be incubated with a polymerase such as T4 DNA polymerase or Klenow polymerase or a combination thereof in the presence of one or more dNTPs to fill in the single stranded portions of the double stranded fragments. Alternatively, the double stranded DNA fragments can be made blunt by a combination of a single stranded overhang degradation reaction using exonucleases and/or polymerases, and a fill-in reaction using one or more polymerases in the presence of one or more dNTPs.

U.S. Patent Publication Nos. 2013-0231253 A1 and 2014-0274729 A1 further describe methods of generating nucleic acid fragments, methods of modifying the fragments and analysis of the fragments, and are incorporated by reference in their entirety herein.

Ligation of Adaptors

Ligation of adaptors at the desired end of the sequence regions of interest (e.g., at the 5′ or 3′ end of a nucleic acid fragment generated form a sample) is suitable for carrying out the methods of the invention. Various ligation modalities are envisioned, dependent on the choice of nucleic acid, nucleic acid modifying enzymes and the resulting ligatable end of the nucleic acid. For example, when a blunt end product comprising the target region/sequence of interest is generated, blunt end ligation can be suitable. Alternatively, where the cleavage is carried out using a restriction enzyme of known sequence specificity, leading to the generation of cleavage sites with known sequence overhangs, suitable ends of the adaptors can be designed to enable hybridization of the adaptor to the cleavage site of the sequence region of interest and subsequent ligation. Ligation also refers to any joining of two nucleic acid molecules that results in a single nucleic acid sequence that can be further modified to obtain the sequence of the nucleic acids in question. Reagents and methods for efficient and rapid ligation of adaptors are commercially available, and are known in the art.

In some embodiments, the 5′ and/or 3′ end nucleotide sequences of fragmented nucleic acids are not modified or end-repaired prior to ligation with the adapter oligonucleotides of the present invention. For example, fragmentation by a restriction endonuclease can be used to leave a predictable overhang, followed by ligation with one or more adapter oligonucleotides comprising an overhang complementary to the predictable overhang on a nucleic acid fragment. In another example, cleavage by an enzyme that leaves a predictable blunt end can be followed by ligation of blunt-ended nucleic acid fragments to adapter oligonucleotides comprising a blunt end. In some embodiments, end repair can be followed by an addition of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides, such as one or more adenine, one or more thymine, one or more guanine, or one or more cytosine, to produce an overhang. Nucleic acid fragments having an overhang can be joined to one or more adapter oligonucleotides having a complementary overhang, such as in a ligation reaction. For example, a single adenine can be added to the 3′ ends of end-repaired DNA fragments using a template independent polymerase, followed by ligation to one or more adapters each having a thymine at a 3′ end. In some embodiments, adapter oligonucleotides can be joined to blunt end double-stranded nucleic acid fragments which have been modified by extension of the 3′ end with one or more nucleotides followed by 5′ phosphorylation. In some cases, extension of the 3′ end can be performed with a polymerase such as for example Klenow polymerase or any of the suitable polymerases provided herein, or by use of a terminal deoxynucleotide transferase, in the presence of one or more dNTPs in a suitable buffer containing magnesium. In some embodiments, nucleic acid fragments having blunt ends can be joined to one or more adapters comprising a blunt end. Phosphorylation of 5′ ends of nucleic acid fragments can be performed for example with T4 polynucleotide kinase in a suitable buffer containing ATP and magnesium. The fragmented nucleic acid molecules may optionally be treated to dephosphorylate 5′ ends or 3′ ends, for example, by using enzymes known in the art, such as phosphatases.

In some embodiments, appending the adaptor to the nucleic acid fragments generated by methods described herein can be achieved using a ligation reaction or a priming reaction. In some embodiments, appendage of an adaptor to the nucleic acid fragments comprises ligation. In some embodiments, ligation of the adaptor to the nucleic acid fragments can be following end repair of the nucleic acid fragments. In another embodiment, the ligation of the adaptor to the nucleic acid fragments can be following generation of the nucleic acid fragments without end repair of the nucleic acid fragments. The adaptor can be any type of adaptor known in the art including, but not limited to, conventional duplex or double stranded adaptors in which the adaptor comprises two complementary strands. In some embodiments, the adaptor can be a double stranded DNA adaptor. In some embodiments, the adaptor can be an oligonucleotide of known sequence and, thus, allow generation and/or use of sequence specific primers for amplification and/or sequencing of any polynucleotides to which the adaptor is appended or attached. In some embodiments, the adaptor can be a conventional duplex adaptor, wherein the adaptor comprises sequence well known in the art. In a some embodiments, the adaptor can be appended to the nucleic acid fragments generated by the methods described herein in multiple orientations. In some embodiment, the methods described herein can involve the use of a duplex adaptor comprising double stranded DNA of known sequence that is blunt ended and can bind to the double stranded nucleic acid fragments generated by the methods described herein in one of two orientations. In some embodiments, the adaptor can be ligated to each of the nucleic acid fragments such that each of the nucleic acid fragments comprises the same adaptor. In other words, each of the nucleic acid fragments comprises a common adaptor. In another embodiment, an adaptor can be appended or ligated to a library of nucleic acid fragments generated by the methods described herein such that each nucleic acid fragment in the library of nucleic acid fragments comprises the adaptor ligated to one or both ends. In another embodiment, more than one adaptor can be appended or ligated to a library of nucleic acid fragments generated by the methods described herein. The multiple adaptors may occur adjacent to one another, spaced intermittently, or at opposite ends of the nucleic acid fragments. In some embodiments, the adaptor can be ligated or appended to the 5′ and/or 3′ ends of the nucleic acid fragments generated by the methods described herein. The adaptor can comprise two strands wherein each strand comprises a free 3′ hydroxyl group but neither strand comprises a free 5′ phosphate. In some embodiments, the free 3′ hydroxyl group on each strand of the adaptor can be ligated to a free 5′ phosphate present on either end of the nucleic acid fragments of the present invention. In this embodiment, the adaptor comprises a ligation strand and a non-ligation strand whereby the ligation strand can be ligated to the 5′ phosphate on either end of the nucleic acid fragment while a nick or gap can be present between the non-ligation strand of the adaptor and the 3′ hydroxyl on either end of the nucleic acid fragment. In some embodiments, the nick or gap can be filled in by performing a gap repair reaction. In some embodiments, the gap repair can be performed with a DNA dependent DNA polymerase with strand displacement activity. In some embodiments, the gap repair can be performed using a DNA-dependent DNA polymerase with weak or no strand displacement activity. In some embodiments, the ligation strand of the adaptor can serve as the template for the gap repair or fill-in reaction. The gap repair or fill-in reaction may comprise an extension reaction wherein the ligation strand of the adaptor serves as a template and leads to the generation of nucleic acid fragments with complementary termini or ends. In some embodiments, the gap repair can be performed using Taq DNA polymerase. In some embodiments, the ligation of the first adaptor to the nucleic acid fragments generated by the methods described herein may not be followed by gap repair. The nucleic acid fragments may comprise the adaptor sequence ligated only at the 5′ end of each strand.

Ligation and, optionally gap repair, of the adaptor to the nucleic acid fragments generates an adaptor-nucleic acid fragment complex. In some embodiments, the adaptor-nucleic acid fragment complex can be denatured. Denaturation can be achieved using any of the methods known in the art including, but not limited to, physical, thermal, and/or chemical denaturation. In some embodiments, denaturation can be achieved using thermal or heat denaturation. In some embodiments, denaturation of the adaptor-nucleic acid fragment complex generates single stranded nucleic acid fragments comprising the adaptor sequence at only the 5′ end of the nucleic acid fragments. In another embodiment, denaturation of the first adaptor-nucleic acid fragment complex generates single stranded nucleic acid fragments comprising adaptor sequence at both the 5′ end and 3′ end of the nucleic acid fragments.

Methods of Amplification

The methods, compositions and kits described herein can be useful to generate amplification-ready products directly from a nucleic acid source for downstream applications such as next generation sequencing, as well as generation of libraries with enriched population of sequence regions of interest. In some embodiments, the adapter-nucleic fragment ligated products, e.g., from the ligation of an adaptor to a 5′ end of each nucleic acid fragment of a plurality of nucleic acid fragments from one or more samples, is amplified.

Methods of amplification are well known in the art. In some embodiments, the amplification is exponential, e.g. in the enzymatic amplification of specific double stranded sequences of DNA by a polymerase chain reaction (PCR). In other embodiments the amplification method is linear. In other embodiments the amplification method is isothermal. In some embodiments, the amplification is exponential, e.g. in the enzymatic amplification of specific double stranded sequences of DNA by a polymerase chain reaction (PCR).

Suitable amplification reactions can be exponential or isothermal and can include any DNA amplification reaction, including but not limited to polymerase chain reaction (PCR), strand displacement amplification (SDA) linear amplification, multiple displacement amplification (MDA), rolling circle amplification (RCA), single primer isothermal amplification (SPIA, see e.g. U.S. Pat. No. 6,251,639), Ribo-SPIA, or a combination thereof. In some cases, the amplification methods for providing the template nucleic acid may be performed under limiting conditions such that only a few rounds of amplification (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 2.4, 25, 26, 28, 29, 30 etc.), such as for example as is commonly done for cDNA generation, The number of rounds of amplification can be about 1-30, 1-20, 1-1-10, 5-30, 10-30, 15-30, 20-30, 10-30, 15-30, 20-30, or 25-30.

PCR is an in vitro amplification procedure based on repeated cycles of denaturation, oligonucleotide primer annealing, and primer extension by thermophilic template dependent polynucleotide polymerase, resulting in the exponential increase in copies of the desired sequence of the polynucleotide analyte flanked by the primers. The two different PCR primers, which anneal to opposite strands of the DNA, are positioned so that the polymerase catalyzed extension product of one primer can serve as a template strand for the other, leading to the accumulation of a discrete double stranded fragment whose length is defined by the distance between the 5′ ends of the oligonucleotide primers.

LCR uses a ligase enzyme to join pairs of preformed nucleic acid probes. The probes hybridize with each complementary strand of the nucleic acid analyte, if present, and ligase is employed to bind each pair of probes together resulting in two templates that can serve in the next cycle to reiterate the particular nucleic acid sequence.

SDA (Westin et a 2000, Nature Biotechnology, 18, 199-202; Walker et al 1992, Nucleic Acids Research, 20, 7, 1691-1696), is an isothermal amplification technique based upon the ability of a restriction endonuclease such as HincII or BsoBI to nick the unmodified strand of a hemiphosphorothioate form of its recognition site, and the ability of an exonuclease deficient DNA polymerase such as Klenow exo minus polymerase, or Bst polymerase, to extend the 3′-end at the nick and displace the downstream DNA strand. Exponential amplification results from coupling sense and antisense reactions in which strands displaced from a sense reaction serve as targets for an antisense reaction and vice versa.

Some aspects of the invention utilize linear amplification of nucleic acids or polynucleotides. Linear amplification generally refers to a method that involves the formation of one or more copies of the complement of only one strand of a nucleic acid or polynucleotide molecule, usually a nucleic acid or polynucleotide analyte. Thus, the primary difference between linear amplification and exponential amplification is that in the latter process, the product serves as substrate for the formation of more product, whereas in the former process the starting sequence is the substrate for the formation of product but the product of the reaction, i.e. the replication of the starting template, is not a substrate for generation of products. In linear amplification the amount of product formed increases as a linear function of time as opposed to exponential amplification where the amount of product formed is an exponential function of time.

Downstream Applications

One aspect of the present invention is that the methods and compositions disclosed herein can be efficiently and cost-effectively utilized for downstream analyses, such as in next generation sequencing or hybridization platforms, with minimal loss of biological material of interest. The methods of the present invention can also be used in the analysis of genetic information of selective genomic regions of interest (e.g., analysis of SNPs or other disease markers) as well as genomic regions which may interact with the selective region of interest. The methods of the present invention may further be used in the analysis of copy number variation as well as differential expression.

Sequencing

In some embodiments, a population of sequencing reads is generated from the amplified adapter-nucleic fragment ligated products. In some embodiments, a sequencing read comprises an index read, which comprises the sequence of an indexing site. In some embodiments, an index read comprises the sequence of an indexing site and the sequence of an identifier site. For example, the indexing site is sequenced with the identifier site. In some embodiments, the index read does not include the sequence of an identifier site. For example, the indexing site is not sequenced with the identifier site. In some embodiments, a sequencing read comprises the target sequence. In some embodiments, a sequencing read comprises a target sequence and an identifier sequence. For example, the target sequence is sequenced with the identifier site. In some embodiments, the target sequence is not sequenced with the identifier site.

The methods of the present invention are useful for sequencing by the method commercialized by Illumina, as described U.S. Pat. Nos. 5,750,341; 6,306,597; and 5,969,119.

In general, double stranded fragment polynucleotides can be prepared by the methods of the present invention to produce amplified nucleic acid sequences tagged at one (e.g., (A)/(A′) or both ends (e.g., (A)/(A′) and (C)/(C′)). In some cases, single stranded nucleic acid tagged at one or both ends is amplified by the methods of the present invention (e.g., by SPIA or linear PCR). The resulting nucleic acid is then denatured and the single-stranded amplified polynucleotides are randomly attached to the inside surface of flow-cell channels. Unlabeled nucleotides are added to initiate solid-phase bridge amplification to produce dense clusters of double-stranded DNA. To initiate the first base sequencing cycle, four labeled reversible terminators, primers, and DNA polymerase are added. After laser excitation, fluorescence from each cluster on the flow cell is imaged. The identity of the first base for each cluster is then recorded. Cycles of sequencing are performed to determine the fragment sequence one base at a time.

In some embodiments, the methods of the invention are useful for preparing target polynucleotides for sequencing by the sequencing by ligation methods commercialized by Applied Biosystems (e.g., SOLiD sequencing). In other embodiments, the methods are useful for preparing target polynucleotides for sequencing by synthesis using the methods commercialized by 454/Roche Life Sciences, including but not limited to the methods and apparatus described in Margulies et al., Nature (2005) 437:376-380 (2005); and U.S. Pat. Nos. 7,244,559; 7,335,762; 7,211,390; 7,244,567; 7,264,929; and 7,323,305. In other embodiments, the methods are useful for preparing target polynucleotide(s) for sequencing by the methods commercialized by Helicos BioSciences Corporation (Cambridge, Mass.) as described in U.S. application Ser. No. 11/167,046, and U.S. Pat. Nos. 7,501,245; 7,491,498; 7,276,720; and in U.S. Patent Application Publication Nos. US20090061439; US20080087826; US20060286566; US20060024711; US20060024678; US20080213770; and US20080103058. In other embodiments, the methods are useful for preparing target polynucleotide(s) for sequencing by the methods commercialized by Pacific Biosciences as described in U.S. Pat. Nos. 7,462,452; 7,476,504; 7,405,281; 7,170,050; 7,462,468; 7,476,503; 7,315,019; 7,302,146; 7,313,308; and US Application Publication Nos. US20090029385; US20090068655; US20090024331; and US20080206764.

An example of a sequencing technique that can be used in the methods of the provided invention is semiconductor sequencing provided by Ion Torrent (e.g., using the Ion Personal Genome Machine (PGM)). Ion Torrent technology can use a semiconductor chip with multiple layers, e.g., a layer with micro-machined wells, an ion-sensitive layer, and an ion sensor layer. Nucleic acids can be introduced into the wells, e.g., a clonal population of single nucleic can be attached to a single head, and the bead can be introduced into a well. To initiate sequencing of the nucleic acids on the beads, one type of deoxyribonucleotide (e.g., dATP, dCTP, dGTP, or dTTP) can be introduced into the wells. When one or more nucleotides are incorporated by DNA polymerase, protons (hydrogen ions) are released in the well, which can be detected by the ion sensor. The semiconductor chip can then be washed and the process can be repeated with a different deoxyribonucleotide. A plurality of nucleic acids can be sequenced in the wells of a semiconductor chip. The semiconductor chip can comprise chemical-sensitive field effect transistor (chemFET) arrays to sequence DNA (for example, as described in U.S. Patent Application Publication No. 20090026082). Incorporation of one or more triphosphates into a new nucleic acid strand at the 3′ end of the sequencing primer can be detected by a change in current by a chemFET. An array can have multiple chemFET sensors.

Another example of a sequencing technique that can be used in the methods of the provided invention is nanopore sequencing (see e.g., Soni G V and Meller A. (2007) Clin Chem 53: 1996-2001). A nanopore can be a small hole of the order of 1 nanometer in diameter. Immersion of a nanopore in a conducting fluid and application of a potential across it can result in a slight electrical current due to conduction of ions through the nanopore. The amount of current that flows is sensitive to the size of the nanopore. As a DNA molecule passes through a nanopore, each nucleotide on the DNA molecule obstructs the nanopore to a different degree. Thus, the change in the current passing through the nanopore as the DNA molecule passes through the nanopore can represent a reading of the DNA sequence.

Data Analysis

In some embodiments, the sequence reads are used in the analysis of genetic information of selective genomic regions of interest as well as genomic regions which may interact with the selective region of interest. Amplification methods as disclosed herein can be used in the devices, kits, and methods known to the art for genetic analysis, such as, but not limited to those found in U.S. Pat. Nos. 6,449,562, 6,287,766, 7,361,468, 7,414,117, 6,225,109, and 6,110,709.

In some embodiments, the sequencing reads are used to detect duplicate sequencing reads. In some embodiments, a sequencing read is identified as a duplicate sequencing read when it contains an identifier site and target sequence that is the same as another sequencing read from the same population of sequencing reads.

In some embodiments, duplicate sequencing reads are differentiated from one another as being true duplicates versus apparent or perceived duplicates. Apparent or perceived duplicates may be identified from sequencing libraries and using conventional measures of duplicate reads (i.e., reads were mapped using bowtie), where all reads with the same start and end nucleic acid coordinates were counted as duplicates. True duplicates may be identified from sequencing libraries having had an identifier site introduced through ligation to differentiate between fragments of DNA that randomly have the same start and end mapping coordinates.

In some embodiments, the sequence of the identifier sites from the index read of two nucleic acids generated from any dsDNA may have the same start site, as determined from the sequencing reads of the target sequence of the generated nucleic acid fragments. If the identifier site from the index read of the two nucleic acid fragments are not identical, then the target sequence reads were not generated from the same original dsDNA molecule and, therefore, are no true duplicate reads. The ligation of random sequences onto dsDNA molecules, accompanied by the methods of the invention, allow for the identification of true duplicate reads versus apparent or perceived duplicate reads.

In some embodiments, the sequence of the identifier sites from the index read of two nucleic acid fragments generated from a genomic DNA (gDNA) molecule that have the same start site, which can be determined from the sequencing reads of the target sequence of the nucleic acid fragments is determined. If the identifier site from the index read of the two nucleic acid fragments are not identical, then the target sequence reads were not generated from the same original gDNA molecule and, therefore, are not true duplicate reads. In another embodiment, an identifier site is inserted at the adapter insert junction. The sequence of the identifier site is carried through the library amplification step. The identifier site is the first sequence read during the forward read. As the identifier sequence is not logically present adjacent to naturally occurring sequence, this uniquely identifies the DNA fragment. Therefore, by ligating random sequences onto the original gDNA, the methods of the invention identify true duplicate reads.

In some embodiments, a duplicate sequencing read is detected and analyzed. Duplicate reads can be filtered using ‘samtools rmdup’, wherein reads with identical external coordinates are removed, only one read with highest mapping quality is retained. After filtering, a filtered set of deduplicated reads can be used in any downstream analysis. Conversely, this filtering step can be skipped, and downstream analysis can be done using the unfiltered reads, including duplicates.

In some embodiments, sequencing reads are generated from a number of samples. In some embodiments, adaptors are ligated to a plurality of nucleic acid fragments from the samples, in which the nucleic acid fragments from each sample has the same indexing site. In some embodiments, a plurality of nucleic acid fragments is generated from a first sample and a second sample and adaptors are ligated to each nucleic acid fragment, in which adaptors ligated to each nucleic acid fragment from the first sample have the same first indexing site and adaptors ligated to nucleic acid fragments from the second sample has the same second indexing site. In some embodiments, the data associated with the nucleic acid fragments (e.g., sequencing reads) are separated based on the indexing site before sequencing reads of the target sequence and/or identifier site are analyzed. In some embodiments, the nucleic acid fragments or data associated with the nucleic acid fragments (e.g., sequencing reads) are separated based on the indexing site before duplicate sequencing reads are analyzed and/or removed.

In some embodiments, a method disclosed herein identifies or detects one or more true duplicate(s) with increased accuracy as compared to other methods. For example, in some embodiments, a method disclosed herein identify true duplicates (in contrast to identifying apparent or perceived duplicates) with increased accuracy as compared to other methods. The increased resolution and/or accuracy in identifying one or more true duplicate(s) can provide a considerable contribution to the state of the art in more accurately identifying true duplicates. In some embodiments, a method disclosed herein identifies or detects a true duplicate with increased efficiency as compared to other methods, such as paired end sequencing. The increase in accuracy, resolution, and/or efficiency in detecting duplicate reads (e.g., true duplicate(s)) can increase confidence in sequencing results, such as for expression and CNV analysis.

Kits

Any of the compositions described herein may be comprised in a kit. In a non-limiting example, the kit, in a suitable container, comprises: an adaptor or several adaptors, one or more of oligonucleotide primers and reagents for amplification.

The containers of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other containers, into which a component may be placed, and preferably, suitably aliquotted. Where there is more than one component in the kit, the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed. However, various combinations of components may be comprised in a container.

When the components of the kit are provided in one or more liquid solutions, the liquid solution can be an aqueous solution. However, the components of the kit may be provided as dried powder(s). When reagents and/or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent.

A kit may include instructions for employing the kit components as well the use of any other reagent not included in the kit. Instructions may include variations that can be implemented.

In some embodiments, the invention provides kits containing any one or more of the elements disclosed in the above methods and compositions. In some embodiments, a kit comprises a composition of the invention, in one or more containers. In some embodiments, the invention provides kits comprising adapters, primers, and/or other oligonucleotides described herein. In some embodiments, the kit further comprises one or more of: (a) a DNA ligase, (b) a DNA-dependent DNA polymerase, (c) an RNA-dependent DNA polymerase, (d) a forward adapter (e) one or more oligonucleotides comprising reverse adaptor sequence and (f) one or more buffers suitable for one or more of the elements contained in said kit. The adapters, primers, other oligonucleotides, and reagents can be, without limitation, any of those described above. Elements of the kit can further be provided, without limitation, in any of the amounts and/or combinations (such as in the same kit or same container) described above. The kits may further comprise additional agents, such as those described above, for use according to the methods of the invention. For example, the kit can comprise a first forward adaptor that is a partial duplex adaptor as described herein, a second forward adapter, and a nucleic acid modifying enzyme specific for a restriction and/or cleavage site present in the first forward adaptor. The kit elements can be provided in any suitable container, including but not limited to test tubes, vials, flasks, bottles, ampules, syringes, or the like. The agents can be provided in a form that may be directly used in the methods of the invention, or in a form that requires preparation prior to use, such as in the reconstitution of lyophilized agents. Agents may be provided in aliquots for single-use or as stocks from which multiple uses, such as in a number of reaction, may be obtained.

In some embodiments, the kit comprises a plurality of adaptor oligonucleotides, wherein each of the adaptor oligonucleotides comprises at least one of a plurality of identifier site sequences, wherein each identifier site sequence of the plurality of identifier site sequences differs from every other identifier site sequence in said plurality of identifier site sequences at at least three nucleotide positions, and instructions for using the same. Adapters comprising different identifier site sequences can be supplied individually or in combination with one or more additional adapters having a different identifier site sequence. In some embodiments, the kit can comprises a plurality of adapter oligonucleotides.

EXAMPLES Example 1: Identification of Duplicate Sequencing Reads with NuGEN Ovation Target Enrichment Library System

Sample Description:

100 ng of DNA from a human HapMap sample (NA19238) was fragmented to approximately 500 base pair in length by sonication with a Covaris system (Covaris, Inc., Woburn, Mass.). The resulting DNA was treated with end repair enzyme mix NuGEN R01280 and R01439 (NuGEN Technologies, Inc., San Carlos, Calif.) according to supplier's recommendation to produce blunt ended DNA fragments.

Library Generation, Enrichment, and Identifier Site Incorporation:

An oligonucleotide with segments, from 5′ to 3′ of the top strand, 1) an Illumina indexing read priming site such as AGAGCACACGTCTGAACTCCAGTCAC (SEQ ID NO:2), 2) an indexing site, 3) an identifier site having a random 6 base sequence and, 4) a sequence compatible with an Illumina forward sequencing priming site such as TCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO:3), was annealed to a second oligonucleotide to form a partially double stranded DNA adapter. Five uM of these adapters were ligated onto the end-repaired DNA using Ligase and Ligase reaction buffer from NuGEN's Ovation Ultralow Library System (NuGEN Technologies, Inc., San Carlos, Calif.) according to supplier's recommendations. Following 30 minutes of incubation at 25° C., the reaction mixture was diluted with water, 0.8× volume of Ampure XP magnetic beads (Agencourt Biosciences Corporation, A Beckman Coulter Company, Beverly, Mass.) was added and the solution thoroughly mixed. The beads were collected, washed and the ligated DNA fragments eluted according to manufacturer's recommendations. A pool of targeting probes was annealed to the eluted DNA fragments by initially heating the solution to 95° C. then slowly cooling the mixture from 80° C. to 60° C. by 0.6 degrees/minute. Targeting probes that were specifically annealed were extended with Taq DNA polymerase (New England Biolabs, Inc., Ipswich, Mass.) according to the manufacturer's protocols. Following extension, the DNA fragments were collected on Agencourt magnetic beads, washed and eluted according to manufacturer's recommendations. These libraries were enriched by 30 cycles of PCR using NuGEN library enrichment primers (Ovation Target Enrichment Library System, NuGEN Technologies, Inc., San Carlos, Calif.) that also contain the Illumina flow cell sequences (Illumina Inc., San Diego, Calif.) according to supplier's recommendation.

The resulting libraries were quantitated by qPCR using a kit provided by KAPA, diluted to 2 nM and applied to an Illumina MiSeq DNA Sequencer (Illumina Inc., San Diego, Calif.). The following series was run: 36 base first read, 14 base second read, and 24 base third read.

Data Analysis: The sequencer output was processed in accordance with manufacturer's recommendation. In order to analyze the data, the indexing read was split into two files. The first file contained the first 8 bases of the indexing reads and is utilized as the library index file for standard library parsing. The other file contains only the random bases and is set aside for further sequence parsing.

Following our data analysis pipeline of sequence alignment with bowtie aligner (Langmead B. et al., Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009, 10:R2), duplicate reads were identified by their genomic start positions. At this point, sequencing reads that started at the same genomic position were checked against the random bases file to see if they have the same or different set of random bases that were ligated to them. Where two sequences with the same starting genomic coordinate had the same set of random bases, they were considered to have come from the same initial DNA ligation event, regardless of which Ovation Target Enrichment targeting probe was used to generate the sequence fragment in question. These sequences, therefore, did not provide unique information about the starting genomic DNA and are considered as one sequencing read for the purpose of variant analysis. Two sequence reads with the same starting genomic coordinate that have different random bases were derived from unique ligation events and were considered to both be valid sequencing reads for the purpose of variant identification. FIG. 5 provides the analysis results demonstrating the identification of the duplicate reads. The use of an identifier site allowed for the determination of the number of true duplications versus the number of apparent or perceived duplicates.

If the sequences of two libraries are identical, their duplication status is unknown since this could occur by chance in any library. If an identifier sequence is used in combination with the library reads, the status can be determined (duplicates if identical, distinct if different). With the SPET system, one end is common so the probability of two libraries having identical ends increases. These would appear to be duplicate sequences and their true status can be determined by looking at an identifier sequence.

Over the sampling of all randomly selected reads, the use of identifier sites provided an increased resolution on the presence of true duplicates. When evaluating two million random reads, the apparent duplicates were found to comprise 39% of all reads. However, the true duplicates, identified through the use of an identifier site, were found to comprise only 26% of all reads. The methods employing the use of an identifier site were found to considerably increase the resolution of the true number of duplicates within the pool of reads.

Example 2: Removal of Duplicate Sequencing Reads with 8 Base Identifier Site

In a standard RNA sequencing library, adaptors are ligated to the ends of double stranded cDNA. These adaptors contain universal sequences that allow for PCR amplification and sequencing on high throughput sequencing machines. The adaptors are synthesized with a large population of additional sequences, in which each additional sequence is an identifier site, at the ligation end. The identifier sites are present at the junction between the adaptor and the cDNA. The sequence read starts with the identifier site and follows with the cDNA sequence.

This pool of identifier sites is used for the detection of PCR duplicates, as PCR duplicates will contain the identical identifier site, whereas two different cDNA molecules will ligate to two different adaptors containing two different identifier sites. This identifier site is designed as eight random bases introduced onto the end of the adaptor. Sequence reads from libraries made with such adaptors contain the 8 bases of the identifier site followed by the cDNA sequence. Standard PCR duplicate removal software such as PICARD, Markduplicates, and/or SAMtools rndup is used to identify and remove the PCR duplicates, leaving behind for analysis any instances of multiple cDNA fragments that happen to have the same sequence.

Example 3: Removal of Duplicate Sequencing Reads with Mixture of Random 1-8 Base Identifier Sites

In a standard RNA sequencing library, adaptors are ligated to the ends of double stranded cDNA. These adaptors contain universal sequences that allow for PCR amplification and sequencing on high throughput sequencing machines. The adaptors are synthesized with a large population of additional sequences, in which each additional sequence is an identifier site, at the ligation end. The identifier sites are present at the junction between the adaptor and the cDNA. The sequence read starts with the identifier site and follows with the cDNA sequence.

This pool of identifier sites is used for the detection of PCR duplicates, as PCR duplicates will contain the identical identifier site, whereas two different cDNA molecules will ligate to two different adaptors containing two different identifier sites.

One to eight random bases are introduced onto the end of the adaptor. Sequence reads from libraries made with such adaptors contain between 1 and 8 bases of the identifier site followed by the cDNA sequence. Standard PCR duplicate removal software such as PICARD, Markduplicates, and/or SAMtools rndup is used to identify and remove the PCR duplicates, leaving behind for analysis any instances of multiple cDNA fragments that happen to have the same sequence.

Example 4: Removal of Duplicate Sequencing Reads with Mixture of 96 Defined 6-Base Identifier Sites

In a standard RNA sequencing library, adaptors are ligated to the ends of double stranded cDNA. These adaptors contain universal sequences that allow for PCR amplification and sequencing on high throughput sequencing machines. The adaptors are synthesized with a large population of additional sequences, in which each additional sequence is an identifier site, at the ligation end. The identifier sites are present at the junction between the adaptor and the cDNA. The sequence read starts with the identifier site and follows with the cDNA sequence.

This pool of identifier sites is used for the detection of PCR duplicates, as PCR duplicates will contain the identical identifier site, whereas two different cDNA molecules will ligate to two different adaptors containing two different identifier sites.

A mixture of 96 defined six-bases sequences are introduced onto the end of the adaptors. Thus, each six-base sequence is an identifier site. Sequence reads from libraries made with such adaptors contain one of the 96 six-base identifier site followed by the cDNA sequence. Standard PCR duplicate removal software such as PICARD, Markduplicates, and/or SAMtools rndup is used to identify and remove the PCR duplicates, leaving behind for analysis any instances of multiple cDNA fragments that happen to have the same sequence.

Example 5: Identification of Duplicate Sequencing Reads in Determining mRNA Expression Levels

Sample Description: Total RNA is extracted from tumor and normal adjacent tissue for the purpose of finding differences in expression levels of transcripts between the two sample types. 100 ng of each sample is converted into cDNA using the USP primers, reaction buffer, and Reverse Transcriptase provided in NuGEN's Encore Complete Library System (NuGEN Technologies, Inc., San Carlos, Calif.) according to the supplier's recommendations. This is followed by second strand synthesis, again using materials provided in the kit according to recommendations. Double stranded cDNA was prepared using the SuperScript® Double-Stranded cDNA Synthesis Kit from Life Technologies (Carlsbad, Calif.) according the manufacturer's instructions. DNA was sheared with a Covaris S-series device (Covaris, Inc., Woburn, Mass.) using the 200 bp sonication protocol provided with the instrument (10% duty cycle, 200 cycles/burst, 5 intensity, 180 seconds). DNA was treated with 1.5 μL 10× Blunting Buffer, 0.5 uL Blunting Enzyme (New England Biolabs, Inc., Ipswich, Mass.; p/n E1201) and 1.2 uL of 2.5 mM of each dNTP mix in a total volume of 15 uL for 30 minutes at 25° C. followed by 10 minutes at 70° C.

Library Generation:

The DNA fragments were then subjected to end repair using end repair buffers and enzymes provided in NuGEN's Ovation Ultralow Library System (NuGEN Technologies, Inc., San Carlos, Calif.).

Forward adaptor (SEQ ID NO: 4) 5′ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGC TCTTCCGATCTNNNNNNNN, Reverse adaptor 1) (SEQ ID NO: 5) 5′ CAAGCAGAAGACGGCATACGAGATTCCCTTGTGACTGGAGTTCAGAC GTGTGCTCTTCCGATCTNNNNNNNN, Reverse adaptor 2) (SEQ ID NO: 6) 5′ CAAGCAGAAGACGGCATACGAGATTGAAGGGTGACTGGAGTTCAGAC GTGTGCTCTTCCGATCNNNNNNNN, and Common partner (SEQ ID NO: 7) 5′ NNNNNNNNAGATCGGAAGAGC

and

Common partner 5′ NNNNNNNNAGATCGGAAGAGC (SEQ ID NO:7) were all ordered from IDT (Integrated DNA Technologies, Coralville, Iowa). The reverse adaptors each contain a unique identifier (underlined) that enables libraries made with these adapters to be distinguished. In this case N represents an equimolar mixture of A, C, G, and T. A mixture of 5 uM forward, 5 uM reverse, and 10 uM common in 10 mM MgCl2, 50 mM Tris pH 8 was heated to 95 C for 5 minutes, then cooled to 20 C. Adaptor ligation was performed by addition of 4.5 uL water, 3 uL Adaptor mix (prepared above), 6 uL 5× NEBNext Quick Ligation Reaction Buffer and 1.5 uL Quick T4 DNA Ligase (New England Biolabs, Inc., Ipswich, Mass.; p/n E6056), followed by incubation for 30 minutes at 25° C. followed by 10 minutes at 70° C. Ligation products were purified by adding 70 uL water and 80 uL of Ampure XP beads (Agencourt Genomics), washing twice with 70% ethanol and eluting with 20 uL of 10 mM Tris pH 8.0. Library products were amplified in a 50 uL PCR containing 0.5 uM each of primer (5′ AATGATACGGCGACCACCGA (SEQ ID NO:8), and 5′ CAAGCAGAAGACGGCATACGA (SEQ ID NO:9), 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2 mM MgCl2, 0.2 mM each dNTP, and 1 unit Taq polymerase. The reaction was cycled 15 times under the conditions 95 C for 15 seconds, 60 C for 1 minute. PCR products were purified with 1 volume of Ampure XP beads (Agencourt Biosciences Corporation, A Beckman Coulter Company, Beverly, Mass.) as described above. The library was analyzed by HS DNA Bioanalyzer (Agilent Technologies, Santa Clara, Calif.) and quantitated with the KAPA Library Quantification Kit (KAPA Biosystems, Wilmington, Mass.; p/n KK4835) according to the supplied instructions. The resulting libraries are combined and are compatible with standard TruSeq single end or paired Illumina sequencing protocols for GAIIx, MiSeq, or Hi Seq sequencing instruments (Illumina Inc., San Diego, Calif.). The following series is run; 50 base first read, 6 base second read. A third read is not required for counting purposes or duplication analysis.

Data Analysis:

The sequencer output was processed in accordance with manufacturer's recommendation. The 6 bases of the index read is used for standard library parsing, separating the data files from the two sample types. The first 50 bases of the target sequence read are compared to each other. Any read that has identical sequence to any other read is identified as a duplicate and removed from the population, thus, only a single copy is retained within the file. Once the duplicate reads have been removed, 8 bases are trimmed from each read. The trimmed reads are aligned to a reference genome. Differential expression is then determined by comparing FPKM (fragments per kilobase per million reads) values between libraries utilizing scripts such as cufflinks or cuffdiff (Trapnell et al. 2010, Nature Biotechnology, 28, 511-515; Trapnell et al. 2013, Nature Biotechnology, 31, 46-53).

Example 6: Sequencing of the Identifier Site With the Target Sequence in Paired End Reads

The Ovation Library System for Low Complexity Samples (NuGEN Technologies, Inc., San Carlos, Calif.) was used to generate four libraries, each from a single amplicon, following manufacturer's protocol. Purified libraries were mixed and sequenced as a multiplex on the Illumina MiSeq (Illumina Inc., San Diego, Calif.) to produce 125nt forward, 8nt index 1, 8nt index 2, and 25nt reverse reads. Because all amplicon reads start and end at the same sequence coordinates, the traditional method of marking library PCR duplicates (marking reads that start and end at the same genomic coordinates as duplicates) cannot be used. Instead, the 0-8nt of random sequence contained in the adaptors ligated to the amplicon were treated as an identifier sequence and used to mark duplicates. Any paired end reads that shared the same length and sequence of these random bases with any other paired end read was called a duplicate. The table below shows the results of this duplicate marking.

TABLE 1 Reads from Duplicate independent Library Reads Reads molecules 1 454249 376797 77452 2 439367 364001 75366 3 317760 253057 64703 4 476572 398380 78192

Table 1 demonstrates the accuracy of the method used to differentiate between duplicate reads and reads from truly independent molecules. The population of reads from independent molecules, depicted in the final column of Table 1, represent sequences from independent amplicon molecules used in generating the libraries.

Example 7: Sequencing of the Identifier Site with the Target Sequence in Reduced Representation Bisulfite (RRBS) Libraries

Reduced representation bisulfite (RRBS) libraries of the human genome are generated through the complete restriction enzyme digestion of 100 ng input sample, followed by selection for short fragments. The resulting pool of fragments are ligated to adaptor sequences comprising an indexing site and an identifier site. The identifier sites comprise either 6 or 8 random nucleotides. The sequences are then sequenced to identify the identifier sites, thus revealing the true number of duplicates in the pool. In the absence of identifier sites, the number of apparent or perceived duplicates are greater than the number of true duplicates. The inclusion of an identifier site results in the identification of the number of true duplicates, as compared to the larger number of apparent or perceived duplicates.

Unless defined otherwise, all technical and scientific terms herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials, similar or equivalent to those described herein, can be used in the practice or testing of the present invention, the preferred methods and materials are described herein. All publications, patents, and patent publications cited are incorporated by reference herein in their entirety for all purposes.

The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention.

All references, articles, publications, patents, patent publications, and patent applications cited herein are incorporated by reference in their entireties for all purposes. However, mention of any reference, article, publication, patent, patent publication, and patent application cited herein is not, and should not be taken as an acknowledgment or any form of suggestion that they constitute valid prior art or form part of the common general knowledge in any country in the world.

While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth and as follows in the scope of the appended claims.

Claims

1. A kit comprising:

in a suitable container: a plurality of synthetic forward adaptors, wherein each forward adaptor is at least partially double-stranded and comprises: (i) an indexing primer binding site; (ii) an indexing site; (iii) an identifier site consisting of between 3 and 8 nucleotides, wherein each identifier site has a sequence that differs from the every other identifier site sequence in the kit at at least three nucleotide positions; and (iv) a target sequencing primer binding site comprising SEQ ID NO: 3;
wherein each indexing site is unique amongst a subset of the adaptors and is an index for multiple polynucleotides, thus allowing for samples to be pooled together for a multiplexed sequencing run; and wherein the sequence of the identifier site is variable in sequence content in the plurality of adaptors and is used to identify duplicate sequence reads in the multiplexed sequencing run.

2. The kit of claim 1 further comprising, in one or more further suitable containers one or more oligonucleotide primers, and reagents for amplification.

3. The kit of claim 1, wherein the adaptors are in an aqueous solution.

4. The kit of claim 1, wherein the adaptors are lyophilized.

5. The kit of claim 1 further comprising, in one or more additional suitable containers, one or more of the following reagents:

reverse adapter, and
one or more buffers suitable for one or more of the elements contained in said kit.

6. The kit of claim 1, wherein the adaptors comprise from 5′ to 3′:

a) the indexing primer binding site;
b) the indexing site;
c) the identifier site; and
d) the target sequence primer binding site.

7. The kit of claim 1, wherein the adaptors comprise from 5′ to 3′:

a) the indexing primer binding site;
b) the indexing site;
c) the target sequence primer binding site; and
d) the identifier site.

8. The kit of claim 1, wherein the indexing site is about 6 nucleotides in length.

9. The kit of claim 1, wherein the identifier site is 6 nucleotides in length.

10. The kit of claim 1, wherein the identifier site is 8 nucleotides in length.

11. The kit of claim 1, wherein the indexing primer binding site is a universal indexing primer binding site.

12. The kit of claim 1, wherein the identifier site is 5′ to the indexing site.

13. The kit of claim 1, wherein the indexing primer binding site in each of the plurality of synthetic double-stranded adaptors comprises SEQ ID NO: 2.

14. The kit of claim 13, further comprising, in one or more additional suitable containers: DNA ligase, DNA-dependent DNA polymerase, or a RNA-dependent DNA polymerase.

Referenced Cited
U.S. Patent Documents
4362867 December 7, 1982 Paddock
4458066 July 3, 1984 Caruthers et al.
4469863 September 4, 1984 Ts'o et al.
4582877 April 15, 1986 Fairchok et al.
4876187 October 24, 1989 Duck et al.
4925065 May 15, 1990 Golias
4935357 June 19, 1990 Szybalski
4942124 July 17, 1990 Church
4988617 January 29, 1991 Landegren et al.
4996143 February 26, 1991 Heller et al.
5011769 April 30, 1991 Duck et al.
5034506 July 23, 1991 Summerton et al.
5035996 July 30, 1991 Hartley
5043272 August 27, 1991 Hartley
5082830 January 21, 1992 Brakel et al.
5090591 February 25, 1992 Long
5130238 July 14, 1992 Malek et al.
5169766 December 8, 1992 Schuster et al.
5171534 December 15, 1992 Smith et al.
5194370 March 16, 1993 Berninger et al.
5216141 June 1, 1993 Benner
5234809 August 10, 1993 Boom et al.
5235033 August 10, 1993 Summerton et al.
5242794 September 7, 1993 Whiteley et al.
5384242 January 24, 1995 Oakes
5386023 January 31, 1995 Sanghvi et al.
5399491 March 21, 1995 Kacian et al.
5409818 April 25, 1995 Davey et al.
5418149 May 23, 1995 Gelfand et al.
5427929 June 27, 1995 Richards et al.
5480784 January 2, 1996 Kacian et al.
5494810 February 27, 1996 Barany et al.
5508169 April 16, 1996 Deugau et al.
5508178 April 16, 1996 Rose et al.
5510270 April 23, 1996 Fodor et al.
5525471 June 11, 1996 Zeng
5545522 August 13, 1996 Van Gelder et al.
5554516 September 10, 1996 Kacian et al.
5554517 September 10, 1996 Davey et al.
5556752 September 17, 1996 Lockhart et al.
5565340 October 15, 1996 Chenchik et al.
5573913 November 12, 1996 Rosemeyer et al.
5578832 November 26, 1996 Trulson et al.
5589339 December 31, 1996 Hampson et al.
5602240 February 11, 1997 De Mesmaeker et al.
5637684 June 10, 1997 Cook et al.
5641658 June 24, 1997 Adams et al.
5644048 July 1, 1997 Yau
5665549 September 9, 1997 Pinkel et al.
5667976 September 16, 1997 Van Ness et al.
5667979 September 16, 1997 Berrens
5679512 October 21, 1997 Laney et al.
5681726 October 28, 1997 Huse et al.
5683879 November 4, 1997 Laney et al.
5688648 November 18, 1997 Mathies et al.
5705628 January 6, 1998 Hawkins
5708154 January 13, 1998 Smith et al.
5710028 January 20, 1998 Eyal et al.
5712126 January 27, 1998 Weissman et al.
5716785 February 10, 1998 Van Gelder et al.
5726329 March 10, 1998 Jones et al.
5750341 May 12, 1998 Macevicz
5759822 June 2, 1998 Chenchik et al.
5763178 June 9, 1998 Chirikjian et al.
5789206 August 4, 1998 Tavtigian et al.
5824517 October 20, 1998 Cleuziat et al.
5824518 October 20, 1998 Kacian et al.
5837832 November 17, 1998 Chee et al.
5876976 March 2, 1999 Richards et al.
5882867 March 16, 1999 Ullman et al.
5888779 March 30, 1999 Kacian et al.
5888819 March 30, 1999 Goelet et al.
5945313 August 31, 1999 Hartley et al.
5952176 September 14, 1999 McCarthy et al.
5958681 September 28, 1999 Wetmur et al.
5965409 October 12, 1999 Pardee et al.
5969119 October 19, 1999 Macevicz
5972618 October 26, 1999 Bloch
6004744 December 21, 1999 Goelet et al.
6004745 December 21, 1999 Arnold, Jr. et al.
6027889 February 22, 2000 Barany et al.
6027923 February 22, 2000 Wallace
6030774 February 29, 2000 Laney et al.
6037152 March 14, 2000 Richards et al.
6056661 May 2, 2000 Schmidt
6077674 June 20, 2000 Schleifer et al.
6087103 July 11, 2000 Burmer
6090553 July 18, 2000 Matson
6090591 July 18, 2000 Burg et al.
6107023 August 22, 2000 Reyes
6110709 August 29, 2000 Ausubel et al.
6150112 November 21, 2000 Weissman et al.
6159685 December 12, 2000 Pinkel et al.
6160105 December 12, 2000 Cunningham et al.
6169194 January 2, 2001 Thompson et al.
6172208 January 9, 2001 Cook
6174680 January 16, 2001 Makrigiorgos
6180338 January 30, 2001 Adams
6190865 February 20, 2001 Jendrisak et al.
6194211 February 27, 2001 Richards et al.
6197501 March 6, 2001 Cremer et al.
6197557 March 6, 2001 Makarov et al.
6210891 April 3, 2001 Nyren et al.
6225109 May 1, 2001 Juncosa et al.
6225451 May 1, 2001 Ballinger et al.
6232104 May 15, 2001 Lishanski et al.
6251639 June 26, 2001 Kurn
6262490 July 17, 2001 Hsu et al.
6270961 August 7, 2001 Drmanac
6280935 August 28, 2001 Macevicz
6287766 September 11, 2001 Nolan et al.
6287825 September 11, 2001 Weissman et al.
6291170 September 18, 2001 Van Gelder et al.
6306365 October 23, 2001 Ruoslahti et al.
6306597 October 23, 2001 Macevicz
6309843 October 30, 2001 Timms
6326142 December 4, 2001 Royer
6335167 January 1, 2002 Pinkel et al.
6339147 January 15, 2002 Lukhtanov et al.
6440705 August 27, 2002 Stanton, Jr. et al.
6449562 September 10, 2002 Chandler et al.
6582938 June 24, 2003 Su et al.
6670461 December 30, 2003 Wengel et al.
6686156 February 3, 2004 Kurn
6692918 February 17, 2004 Kurn
6770748 August 3, 2004 Imanishi et al.
6777180 August 17, 2004 Fisher et al.
6794499 September 21, 2004 Wengel et al.
6815164 November 9, 2004 Kurn
6815167 November 9, 2004 Crothers et al.
6825011 November 30, 2004 Romantchikov
6833246 December 21, 2004 Balasubramanian
6849404 February 1, 2005 Park et al.
6858413 February 22, 2005 Kurn
6913884 July 5, 2005 Stuelpnagel et al.
6917726 July 12, 2005 Levene et al.
6924104 August 2, 2005 Weissman et al.
6946251 September 20, 2005 Kurn
7001724 February 21, 2006 Greenfield
7033764 April 25, 2006 Korlach et al.
7048481 May 23, 2006 Sugata et al.
7052847 May 30, 2006 Korlach et al.
7056676 June 6, 2006 Korlach et al.
7056716 June 6, 2006 Potter et al.
7060441 June 13, 2006 Bourget et al.
7094536 August 22, 2006 Kurn
7115400 October 3, 2006 Adessi et al.
7170050 January 30, 2007 Turner et al.
7175982 February 13, 2007 McCarthy et al.
7176025 February 13, 2007 Kurn et al.
7189512 March 13, 2007 Porat et al.
7211390 May 1, 2007 Rothberg et al.
7232656 June 19, 2007 Balasubramanian et al.
7244559 July 17, 2007 Rothberg et al.
7244567 July 17, 2007 Chen et al.
7264929 September 4, 2007 Rothberg et al.
7273730 September 25, 2007 Du Breuil Lastrucci
7276720 October 2, 2007 Ulmer
7294461 November 13, 2007 Kurn
7300755 November 27, 2007 Petersdorf et al.
7302146 November 27, 2007 Turner et al.
7313308 December 25, 2007 Turner et al.
7315019 January 1, 2008 Turner et al.
7323305 January 29, 2008 Leamon et al.
7335762 February 26, 2008 Rothberg et al.
7351557 April 1, 2008 Kurn
7354717 April 8, 2008 Kurn
7361466 April 22, 2008 Korlach et al.
7361468 April 22, 2008 Liu et al.
7402386 July 22, 2008 Kurn et al.
7405281 July 29, 2008 Xu et al.
7414117 August 19, 2008 Saito et al.
7416844 August 26, 2008 Korlach et al.
7462452 December 9, 2008 Williams et al.
7462468 December 9, 2008 Williams et al.
7476503 January 13, 2009 Turner et al.
7476504 January 13, 2009 Turner
7491498 February 17, 2009 Lapidus et al.
7501245 March 10, 2009 Quake et al.
7579153 August 25, 2009 Brenner et al.
7704687 April 27, 2010 Wang et al.
7741463 June 22, 2010 Gormley et al.
7771934 August 10, 2010 Kurn
7771946 August 10, 2010 Kurn
7803550 September 28, 2010 Makarov et al.
7846666 December 7, 2010 Kurn
7846733 December 7, 2010 Kurn
7867703 January 11, 2011 Sampson et al.
7939258 May 10, 2011 Kurn et al.
7948015 May 24, 2011 Rothberg et al.
7985565 July 26, 2011 Mayer et al.
8017335 September 13, 2011 Smith
8034568 October 11, 2011 Kurn et al.
8053192 November 8, 2011 Bignell et al.
8071311 December 6, 2011 Kurn
8143001 March 27, 2012 Kurn et al.
8209130 June 26, 2012 Kennedy et al.
8334116 December 18, 2012 Kurn
8465950 June 18, 2013 Kurn et al.
8492095 July 23, 2013 Kurn
8512956 August 20, 2013 Kurn
8551709 October 8, 2013 Kurn et al.
8852867 October 7, 2014 Kurn et al.
8999677 April 7, 2015 Soldatov et al.
9175325 November 3, 2015 Kurn et al.
9175336 November 3, 2015 Soldatov et al.
9181582 November 10, 2015 Kurn
9206418 December 8, 2015 Armour
9248076 February 2, 2016 Sullivan et al.
9546399 January 17, 2017 Amorese et al.
9702004 July 11, 2017 Van Eijk et al.
9745627 August 29, 2017 van Eijk et al.
9896721 February 20, 2018 Van Eijk et al.
20010000077 March 29, 2001 Engelhardt et al.
20010031739 October 18, 2001 Dare
20010034048 October 25, 2001 Kurn
20010041334 November 15, 2001 Rashtchian et al.
20020028447 March 7, 2002 Li et al.
20020058270 May 16, 2002 Kurn
20020115088 August 22, 2002 Kurn
20020150919 October 17, 2002 Weismann et al.
20020155451 October 24, 2002 Makrigiorgos
20020164628 November 7, 2002 Kurn
20020164634 November 7, 2002 Patil et al.
20020197639 December 26, 2002 Shia et al.
20030017591 January 23, 2003 Kurn
20030022207 January 30, 2003 Balasubramanian et al.
20030082543 May 1, 2003 Su et al.
20030087251 May 8, 2003 Kurn
20030119150 June 26, 2003 Ankenbauer et al.
20030143555 July 31, 2003 Bourget et al.
20030175780 September 18, 2003 Jones
20030180779 September 25, 2003 Lofton-Day et al.
20030186234 October 2, 2003 Kurn
20030207279 November 6, 2003 Crothers et al.
20030211616 November 13, 2003 Leong
20030215926 November 20, 2003 Kurn et al.
20030224439 December 4, 2003 Lafferty et al.
20030232348 December 18, 2003 Jones et al.
20040002371 January 1, 2004 Paquin et al.
20040005614 January 8, 2004 Kurn et al.
20040023271 February 5, 2004 Kurn et al.
20040115815 June 17, 2004 Li et al.
20040137456 July 15, 2004 Yokota et al.
20040161742 August 19, 2004 Dean et al.
20040203019 October 14, 2004 Kurn
20040203025 October 14, 2004 Kurn
20040248153 December 9, 2004 Dear et al.
20050003441 January 6, 2005 Kurn
20050014192 January 20, 2005 Kurn
20050019793 January 27, 2005 Kurn et al.
20050059048 March 17, 2005 Gunderson et al.
20050064456 March 24, 2005 Kurn
20050123956 June 9, 2005 Blume et al.
20050136417 June 23, 2005 Cole et al.
20050142577 June 30, 2005 Jones et al.
20050191656 September 1, 2005 Drmanac et al.
20050191682 September 1, 2005 Barone et al.
20050208538 September 22, 2005 Kurn et al.
20060008824 January 12, 2006 Ronaghi et al.
20060014182 January 19, 2006 Kurn
20060024678 February 2, 2006 Buzby
20060024711 February 2, 2006 Lapidus et al.
20060035274 February 16, 2006 Dong
20060046251 March 2, 2006 Sampson et al.
20060051789 March 9, 2006 Kazakov et al.
20060068415 March 30, 2006 Jones et al.
20060134633 June 22, 2006 Chen et al.
20060216724 September 28, 2006 Christians et al.
20060263789 November 23, 2006 Kincaid
20060281082 December 14, 2006 Zhu
20060286566 December 21, 2006 Lapidus et al.
20060292597 December 28, 2006 Shapero et al.
20070031857 February 8, 2007 Makarov et al.
20070134128 June 14, 2007 Korlach
20070141604 June 21, 2007 Gormley et al.
20070224607 September 27, 2007 Morgan et al.
20070224613 September 27, 2007 Strathmann
20070231823 October 4, 2007 McKernan et al.
20070238122 October 11, 2007 Allbritton et al.
20070263045 November 15, 2007 Okazawa
20080038727 February 14, 2008 Spier
20080087826 April 17, 2008 Harris et al.
20080103058 May 1, 2008 Siddiqi
20080131937 June 5, 2008 Schroeder
20080160580 July 3, 2008 Adessi et al.
20080176311 July 24, 2008 Kurn
20080182300 July 31, 2008 Kurn
20080194413 August 14, 2008 Albert
20080194416 August 14, 2008 Chen
20080206764 August 28, 2008 Williams et al.
20080213770 September 4, 2008 Williams et al.
20080217246 September 11, 2008 Benn et al.
20080241831 October 2, 2008 Fan et al.
20080242560 October 2, 2008 Gunderson et al.
20080286795 November 20, 2008 Kawashima et al.
20090011959 January 8, 2009 Costa et al.
20090024331 January 22, 2009 Tomaney et al.
20090026082 January 29, 2009 Rothberg et al.
20090029385 January 29, 2009 Christians et al.
20090036663 February 5, 2009 Kurn
20090061425 March 5, 2009 Lo et al.
20090061439 March 5, 2009 Buzby
20090068645 March 12, 2009 Sibson
20090068655 March 12, 2009 Williams
20090068709 March 12, 2009 Kurn et al.
20090105081 April 23, 2009 Rodesch et al.
20090117573 May 7, 2009 Fu et al.
20090117621 May 7, 2009 Boutell et al.
20090124514 May 14, 2009 Fu et al.
20090127589 May 21, 2009 Rothberg et al.
20090130721 May 21, 2009 Kurn et al.
20090203085 August 13, 2009 Kurn et al.
20090203531 August 13, 2009 Kurn
20090233802 September 17, 2009 Bignell et al.
20090233804 September 17, 2009 Kurn et al.
20090239232 September 24, 2009 Kurn
20090275486 November 5, 2009 Kurn et al.
20090280538 November 12, 2009 Patel et al.
20090298075 December 3, 2009 Travers et al.
20100015666 January 21, 2010 Brenner et al.
20100021973 January 28, 2010 Makarov et al.
20100022403 January 28, 2010 Kurn et al.
20100029511 February 4, 2010 Raymond et al.
20100105052 April 29, 2010 Drmanac et al.
20100113296 May 6, 2010 Myerson
20100129879 May 27, 2010 Ach et al.
20100137143 June 3, 2010 Rothberg et al.
20100159559 June 24, 2010 Kurn et al.
20100167954 July 1, 2010 Earnshaw et al.
20100173394 July 8, 2010 Colston, Jr. et al.
20100203597 August 12, 2010 Chen et al.
20100273219 October 28, 2010 May et al.
20100311066 December 9, 2010 Kurn
20100323348 December 23, 2010 Hamady et al.
20110015096 January 20, 2011 Chiu
20110039732 February 17, 2011 Raymond et al.
20110104785 May 5, 2011 Vaidyanathan et al.
20110105364 May 5, 2011 Kurn
20110129827 June 2, 2011 Causey et al.
20110189679 August 4, 2011 Kurn et al.
20110224105 September 15, 2011 Kurn et al.
20110288780 November 24, 2011 Rabinowitz et al.
20110294132 December 1, 2011 Kurn
20110319290 December 29, 2011 Raymond et al.
20120003657 January 5, 2012 Myllykangas et al.
20120028310 February 2, 2012 Kurn et al.
20120045797 February 23, 2012 Kurn et al.
20120071331 March 22, 2012 Casbon et al.
20120074925 March 29, 2012 Oliver
20120102054 April 26, 2012 Popescu et al.
20120107811 May 3, 2012 Kelso et al.
20120122701 May 17, 2012 Ryan et al.
20120149068 June 14, 2012 Kurn
20120156728 June 21, 2012 Li et al.
20120157322 June 21, 2012 Myllykangas et al.
20120190587 July 26, 2012 Kurn et al.
20120208705 August 16, 2012 Steemers et al.
20120220483 August 30, 2012 Kurn et al.
20120220494 August 30, 2012 Samuels et al.
20120237943 September 20, 2012 Soldatov et al.
20120238738 September 20, 2012 Hendrickson
20120245041 September 27, 2012 Brenner et al.
20120270212 October 25, 2012 Rabinowitz et al.
20120283145 November 8, 2012 Wang
20120289426 November 15, 2012 Roos et al.
20120309002 December 6, 2012 Link
20130005585 January 3, 2013 Anderson et al.
20130059738 March 7, 2013 Leamon et al.
20130231253 September 5, 2013 Amorese et al.
20140038188 February 6, 2014 Kurn
20140038236 February 6, 2014 Kurn et al.
20140065692 March 6, 2014 Kurn et al.
20140274729 September 18, 2014 Kurn et al.
20140274731 September 18, 2014 Raymond et al.
20140274738 September 18, 2014 Amorese et al.
20140303000 October 9, 2014 Armour
20140378345 December 25, 2014 Hindson et al.
20150011396 January 8, 2015 Schroeder et al.
20150017635 January 15, 2015 Myllykangas et al.
20150101595 April 16, 2015 Hancock et al.
20150133319 May 14, 2015 Fu et al.
20150284769 October 8, 2015 Schroeder
20150299767 October 22, 2015 Armour et al.
20150299784 October 22, 2015 Fan et al.
20150299812 October 22, 2015 Talasaz
20160122756 May 5, 2016 Armour
20160130576 May 12, 2016 Armour
20160153039 June 2, 2016 Amorese et al.
20160203259 July 14, 2016 Scolnick et al.
20160220994 August 4, 2016 Wright
20160251711 September 1, 2016 Amorese et al.
20160265042 September 15, 2016 Schroeder et al.
20160275240 September 22, 2016 Huelga et al.
20160296930 October 13, 2016 Matear et al.
Foreign Patent Documents
2444926 November 2002 CA
1661102 August 2005 CN
101565746 October 2009 CN
105890722 August 2016 CN
0365627 December 1993 EP
0329822 June 1994 EP
0667393 August 1995 EP
1071811 March 2002 EP
0843735 July 2002 EP
2272976 January 2011 EP
2322612 May 2011 EP
2451973 May 2012 EP
2511381 October 2012 EP
1929039 November 2013 EP
89/09284 October 1989 WO
92/07951 May 1992 WO
93/18052 September 1993 WO
94/16090 July 1994 WO
96/40998 December 1996 WO
97/12061 April 1997 WO
97/25416 July 1997 WO
98/06736 February 1998 WO
98/38296 September 1998 WO
98/044151 October 1998 WO
99/10540 March 1999 WO
99/11819 March 1999 WO
99/42618 August 1999 WO
00/08208 February 2000 WO
2000/09756 February 2000 WO
00/018957 April 2000 WO
00/39345 July 2000 WO
00/52191 September 2000 WO
2000/55364 September 2000 WO
00/70039 November 2000 WO
01/20035 March 2001 WO
01/23613 April 2001 WO
01/46464 June 2001 WO
01/57248 August 2001 WO
01/64952 September 2001 WO
02/00938 January 2002 WO
02/28876 April 2002 WO
02/29117 April 2002 WO
02/36821 May 2002 WO
02/48402 June 2002 WO
02/060318 August 2002 WO
02/072772 September 2002 WO
02/072773 September 2002 WO
02/081753 October 2002 WO
02/090584 November 2002 WO
03/004690 January 2003 WO
2003/002736 January 2003 WO
2003/012118 February 2003 WO
03/027259 April 2003 WO
03/078645 September 2003 WO
03/083435 October 2003 WO
03/106642 December 2003 WO
04/011665 February 2004 WO
2004/070007 August 2004 WO
2004/092418 October 2004 WO
2005/003375 January 2005 WO
2005/038427 April 2005 WO
2005/065321 July 2005 WO
2006/081222 August 2006 WO
2006/086668 August 2006 WO
2006/137733 December 2006 WO
2007/018601 February 2007 WO
2007/019444 February 2007 WO
2007/030759 March 2007 WO
2007/037678 April 2007 WO
2007/052006 May 2007 WO
2007/057652 May 2007 WO
2007/073165 June 2007 WO
2007/136717 November 2007 WO
2008/005459 January 2008 WO
2008/015396 February 2008 WO
2008/033442 March 2008 WO
2008/093098 August 2008 WO
2008/115185 September 2008 WO
2009/053039 April 2009 WO
2009/102878 August 2009 WO
2009/102896 August 2009 WO
2009/112844 September 2009 WO
2009/117698 September 2009 WO
2009/120372 October 2009 WO
2009/120374 October 2009 WO
2010/003153 January 2010 WO
2010/030683 March 2010 WO
2010/039991 April 2010 WO
2010/063711 June 2010 WO
2010/064893 June 2010 WO
2010/085715 July 2010 WO
2010/091246 August 2010 WO
2010/115154 October 2010 WO
2010/129937 November 2010 WO
2011/003630 January 2011 WO
2011/009941 January 2011 WO
2011/019964 February 2011 WO
2011/032053 March 2011 WO
2011032040 March 2011 WO
2011/053987 May 2011 WO
2011/151777 December 2011 WO
2011/156529 December 2011 WO
2012/013932 February 2012 WO
2012/061832 May 2012 WO
2012/054873 August 2012 WO
2012/103154 August 2012 WO
2013/059740 April 2013 WO
2013/059746 April 2013 WO
2013/112923 August 2013 WO
2013/130512 October 2013 WO
2013/177220 November 2013 WO
2013/190441 December 2013 WO
2013/191775 December 2013 WO
2014/039556 March 2014 WO
2014/082032 May 2014 WO
2013/138510 July 2014 WO
2014/144092 September 2014 WO
2014/150931 September 2014 WO
2015/031691 March 2015 WO
2015/073711 May 2015 WO
2015/131107 September 2015 WO
Other references
  • Ion Total RNA-Seq Kit v2, pp. 1-82 (Year: 2012).
  • Benson et al., GenBank, Nucl. Acids Res., vol. 41, pp. D36-D42 (Year: 2013).
  • Anonymous, 1998, Gene characterization kits, Stratagene Catalog, p. 39.
  • Anonymous, 2011, TruSeq RNA and DNA Sample Preparation Kits v2, 1-15 Illumina, dated Apr. 27, 2011 (4 pages), XP055366497; retrieved from the Internet on Apr. 21, 2017, at web.archive.org/web/2013041019 0518/https://www.illumina.com/documents/pr oducts/datasheets/datasheet_truseq_sample_ prep_kits.pdf.
  • Benson, 2013, Genbank, Nucl. Acids Res., 41:D36-D42.
  • Grothues, 1993, PCR amplification of megabase DNA with tagged random primers (T-PCR) Nucl. Acids Res., 21:1321-1322.
  • International Search Report and Written Opinion dated Mar. 5, 2015, in international patent application PCT/US2014/065530, filed Nov. 13, 2014 (12 pages).
  • Langmead, 2009, Ultrafast and memory-efficient alignment of short DNA sequences to the human genome, Genome Biol., 10:R25.
  • Liu, 2008, Sequence space coverage, entropy of genomes and the potential to detect non-human DNA in human samples, BMC Genomics, 9(509):1-17.
  • Margulies, 2005, Genorne sequencing in open microfabricated high density picoliter reactors, Nature, 437 (7057):376-380.
  • McCloskey, 2007, Encoding PCR products with batch-stamps and barcodes, Biochem. Genet., 45:761-767.
  • Myers, 2013, Protocol for Creating Multiplexed miRNA Libraries for Use in Illumina Sequencing, Myers lab microRNA-seq Protocol, Hudson Alpha Institute for Biotechnology web site, dated May 2, 2013, (15 pages); retrieved from the Internet on Feb. 28, 2015, at <https://www.encodeproject.org/documents/9fb8e06c-d145-447a-a6-06-e7f3dc44b549/@@download/attachment/HA.sub.—Myers.sub.—miRNA-seq.sub.- —Protocol.sub.--2013-05-02.pdf>.
  • Schiemer 2011, Illumina TruSeq Adapters Demystified,TUFTS University Core Facility XP055357867 (5 pages); retrieved from the Internet on Aug. 30, 2017, at tucf-genomics.tufts.edu/documents/protocols/TUCF_Understanding_Illumina_TruSeq_Adapters.pdf.
  • Soni, 2007, Progress toward ultrafast DNA sequencing using solid-state nanopores, Clin. Chem., 53(11):1996-2001.
  • Trapnell, 2010, Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation, Nat. Biotech., 28:511-515.
  • Trapnell, 2013, Differential analysis of gene regulation at transcript resolution with RNA-seq, Nat. Biotech. 31:46-53.
  • Walker, 1992, Strand displacement amplification—an isothermal, in vitro DNA amplification technique, Nucleic Acids Res., 20(7):1691-1696.
  • Westin, 2000, Anchored multiplex amplification on a microelectronic chip array, Nat. Biotech., 18:199-204.
  • Amos, 2000, DNA pooling in mutation detection with reference to sequence analysis, Am J Hum Genet 66:1689-1692.
  • Church, 1988, Multiplexed DNA sequencing, Science 240:185-188.
  • Colbert, 2001, High-throughput screening for induced point mutations, Plant Physiol 126:480-484.
  • Collard, 2005, An introduction to markers, quantitative trait loci (QTL) mapping and marker-assisted selection for crop improvements: the basic concepts Euphytica 142:169-196.
  • Fakhrai-Rad, 2002, Pyroseqeuncing: An accurate detection platform for single nucleotide polymorphisms, Human Mutation 19:479-485.
  • Hajibabaei, 2005, Critical factors for assembling a high volume of DNA barcodes, Phil Trans R Soc B 360:1959-1967.
  • Ion Total RNA-Seq Kit v2, User Guide, 2012, Life Technologies (82 pages).
  • Lai, 2004, Characterization of the maize endosperm transcriptome and its comparison to the rice genome, Genome Res14:1932-1937.
  • Lindstrom, 2004, Pyrosequencing for detection of Lamivudine-resistant Hepatitis B virus, J Clin Microb 42 (10):4788-4795.
  • Miner, 2004, Molecular barcodes detect redundancy and contamination in hairpin-bisulfite PCR, Nucl Acids Res 32 (17):e135.
  • Qiu, 2003, DNA sequence-based “bar-codes” for tracking the origins of expressed sequence tags from a maize cDNA library constructed using multiple mRNA sources, Plant Physiol 133:475-481.
  • Ronaghi, 2001, Pyrosequencing sheds light on DNA sequencing, Genome Res 11:3-11.
  • Shapero, 2001, SNP Genotyping by multiplexed solid-phase amplification and fluorescent minisequencing, Genome Res 11:1926-1934.
  • Shendure, 2005, Accurate multiplex polony sequencing of an evolved bacterial genome, Science 309:1728.
  • Sood, 2006, Methods for reverse genetic screening in zebrafish by resequencing and TILLING, Methods 39:220-227.
  • Till, 2003, Large-scale discovery of induced point mutations with high-throughput TILLING, Genome Res 13:524-530.
  • Unemo, 2004, Molecular typing of Neisseria gonorrhoeae isolates by pyrosequencing of highly polymorphic segments of the porB gene, J Clin Microb 42(7):2926-2934.
  • Vigal, 2002, A review on SNP and other types of molecular markers and their use in animal genetics, Genet Sel Evol 34:275-305.
  • Wienholds, 2004, Target-selected gene inactivation in zebrafish, Meth Cell Biol 77:69-90.
  • Wolford, 2000, High-throughput SNP detection by using DNA pooling and denaturing high performance liquid chromatography (DHPLC), Hum Genet 107:483-487.
  • Xu, 2012, FastUniq: A fast de novo duplicates removal tool for paired short reads, PLoSOne 7(12):e52249.
  • Bellos, 2014, cnvCapSeq: detecting copy number variation in long-range targeted resequencing data, Nucleic Acids Res 42(20):e158.
  • Blomquist, 2013, Targeted RNA-Sequencing with Competitive Multiplex-PCR Amplicon Libraries, PLOS ONE 8(11): e79120.
  • Bodi, 2013, Comparison of commercially available target enrichment methods for next-generation sequencing, J Biomolecular Tech 24:73-86.
  • Eminaga, 2013, Quantification of microRNA Expression with Next-Generation Sequencing, Unit 4.17 in Current Protocols in Molecular Biology, Wiley, New York, NY (14 pages).
  • International Search Report and Written Opinion dated Jan. 6, 2016, for PCT/US15/44065, filed Aug. 6, 2015 (21 pages).
  • International Search Report and Written Opinion dated Jul. 10, 2017, for Application No. PCT/US17/27060, filed Apr. 11, 2017 (9 pages).
  • Jiang, 2015, CODEX: a normalization and copy number variation detection method for whole exome sequencing, Nucleic Acids Res 43(6):e39.
  • Krumm, 2012, Copy number variation detection and genotyping from exome sequence data, Genome Res 22 (8):1525-1532.
  • Li, 2012, CONTRA: copy number analysis for targeted resequencing, Bioinformatics 28(10):1307-1313.
  • Ma, 2015, Quantitative Analysis of Copy Number Variants Based on Real-Time LightCycler PCR, Curr Protoc Hum Genet 80:7.21.1-7.23.8.
  • Machine translation generated on Mar. 7, 2018, of CN 105890722 by website of European Patent Office (4 pages).
  • NuGEN, 2014, User Guide Ovation Target Enrichment System, NuGEN Technologies Inc., San Carlos, CA (45 pages).
  • Plagnol, 2012, A robust model for read count data in exome sequencing experiments and implications for copy number variant calling, Bioinformatics 28(21):2747-2754.
  • Querfurth, 2012, Creation and application of immortalized bait libraries for targeted enrichment and next-generation sequencing, Biotechniques 52(6):375-380.
  • Sathirapongsasuti, 2011, Exome sequencing-based copy-number variation and loss of heterozygosity detection: ExomeCNV, Bioinformatics 27(19):2648-2654.
  • Staroscik, 2004, Calculator for determining the No. Of copies of a template, URI Genomics, webpage archive dated Apr. 6, 2017 (1 page), Retreived from the internet on Mar. 7, 2018, from <https://web.archive.org/web/20170406174850/http://cels.uri.edu/gsc/cndna.html>.
  • Supplementary European search report and opinion dated Jan. 30, 2018, for European patent application No. 15830393.3 (6 pages).
  • Xi, 2011, Copy number variation detection in whole-genome sequencing data using the Bayesian information criterion, PNAS 108(46):e1128-e1136.
Patent History
Patent number: 10570448
Type: Grant
Filed: Jan 13, 2017
Date of Patent: Feb 25, 2020
Patent Publication Number: 20170240963
Assignee: Tecan Genomics (Redwood City, CA)
Inventors: Douglas Amorese (Los Altos, CA), Jonathan Scolnick (San Francisco, CA), Ben Schroeder (San Mateo, CA)
Primary Examiner: Teresa E Strzelecka
Application Number: 15/406,002
Classifications
Current U.S. Class: With Significant Amplification Step (e.g., Polymerase Chain Reaction (pcr), Etc.) (435/6.12)
International Classification: C12Q 1/6874 (20180101); C12Q 1/6869 (20180101); C12N 1/15 (20060101);