Cloned DNA sequences related to the entire genomic RNA of human immunodeficiency virus II (HIV-2), polypeptides encoded by these DNA sequences and use of these DNA clones and polypeptides in diagnostic kits

- Institut Pasteur

A method for diagnosing an HIV-2 (LAV-II) infection and a kit containing reagents for the same is disclosed. These re-agents include cDNA probes which are capable of hybridizing to at least a portion of the genome of HIV-2. In one embodiment, the DNA probes are capable of hybridizing to the entire genome of HIV-2. These reagents also include polypeptides encoded by some of these DNA sequences.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description

[0001] This application is a continuation-in-part of U.S. patent application Ser. No. ______ of Alizon et al. for “Cloned DNA Sequences Related to the Entire Genomic RNA of Human Immunodeficiency Virus II (HIV-2), Polypeptides Encoded by these DNA Sequences and Use of these DNA Clones and Polypeptides in Diagnostic Kits,” filed Jan. 16, 1987, which is a continuation-in-part of U.S. patent application Ser. No. 931,866 filed Nov. 21, 1986, which is a continuation-in-part application of U.S. patent application Ser. No. 916,080 of Montagnier et al. for “Cloned DNA Sequences Related to the Genomic RNA of the Human Immunodeficiency Virus II (HIV-2), Polypeptides Encoded by these DNA Sequences and Use of these DNA Clones and Polypeptides in Diagnostic Kits,” filed Oct. 6, 1986 and U.S. patent application Ser. No. 835,228 of Montagnier et al. for “New Retrovirus Capable of Causing AIDS, Antigens Obtained from this Retrovirus and Corresponding Antibodies and their Application for Diagnostic Purposes,” filed Mar. 3, 1986. The disclosures of each of these predecessor applications are expressly incorporated herein by reference.

BACKGROUND OF THE INVENTION

[0002] The invention relates to cloned DNA sequences analogous to the genomic RNA of a virus known as Lymphadenopathy-Associated Virus II (“LAV-II”), a process for the preparation of these cloned DNA sequences, and their use as probes in diagnostic kits. In one embodiment, the invention relates to a cloned DNA sequence analogous to the entire genomic RNA of HIV-2 and its use as a probe. The invention also relates to polypeptides with amino acid sequences encoded by these cloned DNA sequences and the use of these polypeptides in diagnostic kits.

[0003] According to recently adopted nomenclature. as reported in Nature, May 1986, a substantially-identical group of retroviruses which has been identified as one causative agent of AIDS are now referred to as Human Immunodeficiency viruses I (HIV-1). This previously-described group of retroviruses includes Lymphadenopathy-Associated Virus I (LAV-I), Human T-cell Lymphotropic Virus-III (HTLV-III), and AIDS-Related Virus (ARV).

[0004] Lymphadenopathy-Associated Virus II has been described in U.S. application Ser. No. 835,228, which was filed Mar. 3, 1986, and is specifically incorporated herein by reference. Because LAV-II is a second, distinct causative agent of AIDS, LAV-II properly is classifiable as a Human Immunodeficiency Virus II (HIV-2). Therefore, “LAV-II” as used hereinafter describes a particular genus of HIV-2 isolates.

[0005] While HIV-2 is related to HIV-1 by its morphology, its tropism and its in vitro cytopathic effect on CD4 (T4) positive cell lines and lymphocytes, HIV-2 differs from previously described human retroviruses known to be responsible for AIDS. Moreover, the proteins of HIV-1 and 2 have different sizes and their serological cross-reactivity is restricted mostly to the major core protein, as the envelope glycoproteins of HIV-2 are not immune precipitated by HIV-1-positive sera except in some cases where very faint cross-reactivity can be detected. Since a significant proportion of the HIV infected patients lack antibodies to the major core protein of their infecting virus, it is important to include antigens to both HIV-1 and HIV-2 in an effective serum test for the diagnosis of the infection by these viruses.

[0006] HIV-2 was first discovered in the course of serological research on patients native to Guinea-Bissau who exhibited clinical and immunological symptoms of AIDS and from whom sero-negative or weakly sero-positive reactions to tests using an HIV-1 lysate were obtained. Further clinical studies on these patients isolated viruses which were subsequently named “LAV-II.”

[0007] One LAV-II isolate, subsequently referred to as LAV-II MIR, was deposited at the Collection Nationale des Cultures de Micro-Organismes (CNCM) at the Institut Pasteur in Paris, France on Dec. 19, 1985 under Accession No. I-502 and has also been deposited at the British ECA CC under No. 87.001.001 on Jan. 9, 1987. A second LAV-II isolate was deposited at CNCM on Feb. 21, 1986 under Accession No. 1-532 and has also been deposited at the British ECA CC under No. 87.001.002 on Jan. 9, 1987. This second isolate has been subsequently referred to as LAV-II ROD. Other isolates deposited at the CNCM on Dec. 19, 1986 are HIV-2 IRMO (No. I-642) and HIV-2 EHO (No. I-643). Several additional isolates have been obtained from West African patients, some of whom have AIDS, others with AIDS-related conditions and others with no AIDS symptoms. All of these viruses have been isolated on normal human lymphocyte cultures and some of them were thereafter propagated on lymphoid tumor cell lines such as CEM and MOLT.

[0008] Due to the sero-negative or weak sero-positive results obtained when using kits designed to identify HIV-1 infections in the diagnosis of these new patients with HIV-2 disease, it has been necessary to devise a new diagnostic kit capable of detecting HIV-2 infection, either by itself or in combination with an HIV-1 infection. The present inventors have, through the development of cloned DNA sequences analogous to at least a portion of the genomic RNA of LAV-II ROD viruses, created the materials necessary for the development of such kits.

SUMMARY OF THE INVENTION

[0009] As noted previously, the present invention relates to the cloned nucleotide sequences homologous or identical to at least a portion of the genomic RNA of HIV-2 viruses and to polypeptides encoded by the same. The present invention also relates to kits capable of diagnosing an HIV-2 infection.

[0010] Thus, a main object of the present invention is to provide a kit capable of diagnosing an infection caused by the HIV-2 virus. This kit may operate by detecting at least a portion of the RNA genome of the HIV-2 virus or the provirus present in the infected cells through hybridization with a DNA probe or it may operate through the immunodiagnostic detection of polypeptides unique to the HIV-2 virus.

[0011] Additional objects and advantages of the present invention will be set forth in part in the description which follows, or may be learned from practice of the invention. The objects and advantages may be realized and attained by means of the instrumentalities and combinations particularly pointed out in the appended claims.

[0012] To achieve these objects and in accordance with the purposes of the present invention, cloned DNA sequences related to the entire genomic RNA of the LAV-II virus are set forth. These sequences are analogous specifically to the entire genome of the LAV-II ROD strain.

[0013] To further achieve the objects and in accordance with the purposes of the present invention, a kit capable of diagnosing an HIV-2 infection is described. This kit, in one embodiment, contains the cloned DNA sequences of this invention which are capable of hybridizing to viral RNA or analogous DNA sequences to indicate the presence of an HIV-2 infection. Different diagnostic techniques can be used which include, but are not limited to: (1) Southern blot procedures to identify viral DNA which may or may not be digested with restriction enzymes; (2) Northern blot techniques to identify viral RNA extracted from cells; and (3) dot blot techniques, i.e., direct filtration of the sample through an ad hoc membrane such as nitrocellulose or nylon without previous separation on agarose gel. Suitable material for dot blot technique could be obtained from body fluids including, but not limited to, serum and plasma, supernatants from culture cells, or cytoplasmic extracts obtained after cell lysis and removal of membranes and nuclei of the cells by ultra-centrifugation as accomplished in the “CYTODOT” procedure as described in a booklet published by Schleicher and Schull.

[0014] In an alternate embodiment, the kit contains the polypeptides created using these cloned DNA sequences. These polypeptides are capable of reacting with antibodies to the HIV-2 virus present in sera of infected individuals, thus yielding an immunodiagnostic complex.

[0015] To further achieve the objects of the invention, a vaccinating agent is provided which comprises at least one peptide selected from the polypeptide expression products of the viral DNA in admixture with suitable carriers, adjuvents stabilizers.

[0016] It is understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention as claimed. The accompanying drawings, which are incorporated in and constitute a part of the specification, illustrate one embodiment of the invention and, together with the description, serve to explain the principles of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS

[0017] FIG. 1 generally depicts the nucleotide sequence of a cloned complementary DNA (cDNA) to the genomic RNA of HIV-2.

[0018] FIG. 1A depicts the genetic organization of HIV-1, position of the HIV-1 HindIII fragment used as a probe to screen the cDNA library, and restriction map of the HIV-2 cDNA clone, E2.

[0019] FIG. 1B depicts the nucleotide sequence of the 3′ end of HIV-2. The corresponding region of the HIV-1 LTR was aligned using the Wilbur and Lipman algorithm (window: 10; K-tuple: 7; gap penalty: 3) as described by Wilbur and Lipman in Proc. Natl. Acad. Sci. USA 80: 726-730 (1983), specifically incorporated herein by reference. The U3-R junction in HIV-1 is indicated and the poly A addition signal and potential TATA promoter regions are boxed. In FIG. 1B, the symbols B, H, Ps and Pv refer to the restriction sites BamHI, HindIII, PstI and PvuII, respectively.

[0020] FIG. 2 generally depicts the HIV-2 specificity of the E2 clone.

[0021] FIGS. 2A and B specifically depict a Southern blot of DNA extracted from CEM cells infected with the following isolates: HIV-2ROD (a, c), HIV-2DUL (b, d), and HIV-1BRU (e, f). DNA in lanes a, b, f was Pst I digested; in c, d, e DNA was undigested.

[0022] FIGS. 2C and D specifically depict dot blot hybridization of pelleted virions from CEM cells infected by the HIV-1BRU(1), Simian Immunodeficiency Virus (SIV) isolate Mm 142-83 (3), HIV-2DUL (4), HIV-2ROD (5), and HIV-1ELI (6). Dot 2 is a pellet from an equivalent volume of supernatant from uninfected CEM. Thus, FIG. 2A and C depicts hybridization with the HIV-2 cDNA (E2) and FIG. 2B and D depicts hybridization to an HIV-1 probe consisting of a 9Kb SacI insert from HIV-1 BRU (clone lambda J 19).

[0023] FIG. 3 generally depicts a restriction map of the HIV-2 ROD genome and its homology to HIV-1.

[0024] FIG. 3A specifically depicts the organization of three recombinant phage lambda clones, ROD 4, ROD 27, and ROD 35. In FIG. 3A, the open boxes represent viral sequences, the LTR are filled, and the dotted boxes represent cellular flanking sequences (not mapped). Only some characteristic restriction enzyme sites are indicated. &lgr;ROD 27 and &lgr;ROD 35 are derived from integrated proviruses while &lgr;ROD 4 is derived from a circular viral DNA. The portion of the lambda clones that hybridzes to the cDNA E2 is indicated below the maps. A restriction map of the &lgr;ROD isolate was reconstructed from these three lambda clones. In this map, the restriction sites are identified as follows: B: BamHI; E: EcoRI; H: HindIII; K: KnI; Ps: PstI; Pv: PvuII; S: SacI; X: XbaI. R and L are the right and left BamHI arms of the lambda L47.1 vector.

[0025] FIG. 3B specifically depicts dots 1-11 which correspond to the single-stranded DNA form of M13 subclones from the HIV-1BRU cloned genome (&lgr;J9). Their size and position on the HIV-1 genome, determined by sequencing is shown below the figure. Dot 12 is a control containing lambda phage DNA. The dot-blot was hybridized in low stringency conditions as described in Example 1 with the complete lambda &lgr;ROD 4 clone as a probe, and successively washed in 2× SSC, 0.1% SDS at 25° C. (Tm −42° C.), 1× SSC, 0.1% SDS at 60° C. (Tm −20° C.), and 0.1× SSC, 0.1% SDS at 60° C. (Tm −3° C.) and exposed overnight. A duplicate dot blot was hybridized and washed in stringent conditions (as described in Example 2) with the labelled lambda J19 clone carrying the complete HIV-1BRU genome. HIV-1 and HIV-2 probes were labelled the same specific activity (108 cpm/g.).

[0026] FIG. 4 generally depicts the restriction map polymorphism in different HIV-2 isolates and shows comparison of HIV-2 to SIV.

[0027] FIG. 4A specifically depicts DNA (20 ug. per lane) from CEM cells infected by the isolate HIV-2DUL (panel 1) or peripheral blood lymphocytes (PBL) infected by the isolates HIV-2GOM (panel 2) and HIV-2MIR (panel 3) digested with: EcoRI (a), PstI (b), and HindIII (c). Much less viral DNA was obtained with HIV-2 isolates propagated on PBL. Hybridization and washing were in stringent conditions, as described in Example 2, with 106 cpm/ml. of each of the E2 insert (cDNA) and the 5 kb. HindIII fragment of &lgr;ROD 4, labelled to 109 cpm/ug.

[0028] FIG. 4B specifically depicts DNA from HUT 78 (a human T lymphoid cell line) cells infected with STLV3 MAC isolate Mm 142-83. The same amounts of DNA and enzymes were used as indicated in panel A. Hybridization was performed with the same probe as in A, but in non-stringent conditions. As described in Example 1 washing was for one hour in 2× SSC, 0.1% SDS at 40° C. (panel 1) and after exposure, the same filter was re-washed in 0.1× SSC, 0.1% SDS at 60° C. (panel 2). The autoradiographs were obtained after overnight exposition with intensifying screens.

[0029] FIG. 5 depicts the position of derived plasmids from &lgr;ROD 27, &lgr;ROD 35 and &lgr;ROD 4.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0030] Reference will now be made in detail to the presently preferred embodiments of the invention, which, together with the following examples, serve to explain the principles of the invention.

[0031] The genetic structure of the HIV-2 virus has been analyzed by molecular cloning according to the method set forth herein and in the Examples. A restriction map of the genome of this virus is included in FIG. 4. In addition, the partial sequence of a cDNA complementary to the genomic RNA of the virus has been determined. This cDNA sequence information is included in FIG. 1.

[0032] Also contained herein is data describing the molecular cloning of the complete 9.5 kb genome of HIV-2, data describing the observation of restriction map polymorphism between different isolates, and an analysis of the relationship between HIV-2 and other human and simian retroviruses. From the totality of these data, diagnostic probes can be discerned and prepared.

[0033] Generally, to practice one embodiment of the present invention, a series of filter hybridizations of the HIV-2 RNA genome with probes derived from the complete cloned HIV-1 genome and from the gag and pol genes were conducted. These hybridizations yielded only extremely weak signals even in conditions of very low stringency of hybrization and washing. Thus, it was found to be difficult to assess the amount of HIV-2 viral and proviral DNA in infected cells by Southern blot techniques.

[0034] Therefore, a complementary DNA (cDNA) to the HIV-2 genomic RNA initially was cloned in order to provide a specific hybridization probe. To construct this cDNA, an oligo (dT) primed cDNA first-strand was made in a detergent-activated endogenous reaction using HIV-2 reverse transcriptase with virions purified from supernatants of infected CEM cells. The CEM cell line is a lymphoblastoid CD4+ cell line described by G. E. Foley et al. in Cancer 18: 522-529 (1965), specifically incorporated herein by reference. The CEM cells used were infected with the isolate ROD and were continuously producing high amounts of HIV-2.

[0035] After second-strand synthesis, the cDNAs were inserted into the M 13 tg 130 bacteriophage vector. A collection of 104 M13 recombinant phages was obtained and screened in situ with an HIV-1 probe spanning 1.5 kb. of the 3′ end of the LAVBRU isolate (depicted in FIG. 1A). Some 50 positive plaques were detected, purified, and characterized by end sequencing and cross-hybridizing the inserts. This procedure is described in more detail in Example 1 and in FIG. 1.

[0036] The different clones were found to be complementary to the a 3′ end of a polyadenylated RNA having the AATAAA signal about 20 nucleotides upstream of the poly A tail, as found in the long terminal repeat (LTR) of HIV-1. The LTR region of HIV-1 has been described by S. Wain Hobson et al. in Cell 40: 9-17 (1985), specifically incorporated herein by reference. The portion of the HIV-2 LTR that was sequenced was related only distantly to the homologous domain in HIV-1 as demonstrated in FIG. 1 B. Indeed, only about 50% of the nucleotides could be aligned and about a hundred insertions/deletions need to be introduced. In comparison, the homology of the corresponding domains in HIV-1 isolates from USA and Africa is greater than 95% and no insertions or deletions are seen.

[0037] The largest insert of this group of M13 clones was a 2 kb. clone designated E2. Clone E2 was used as a probe to demonstrate its HIV-2 specificity in a series of filter hybridization experiments. Firstly, this probe could detect the genomic RNA of HIV-2 but not HIV-1 in stringent conditions as shown in FIG. 2, C and D. Secondly, positive signals were detected in Southern blots of DNA from cells infected with the ROD isolate as well as other isolates of HIV-2 as shown in FIG. 2, A and FIG. 4, A. No signal was detected with DNA from uninfected cells or HIV-1 infected cells, confirming the exogenous nature of HIV-2. In undigested DNA from HIV-2 infected cells, an approximately 10 kb. species, probably corresponding to linear unintegrated viral DNA, was principally detected along with a species with an apparent size of 6 kb., likely to be the circular form of the viral DNA. Conversely, rehybridization of the same filter with an HIV-1 probe under stringent conditions showed hybridization to HIV-1 infected cells only as depicted in FIG. 2, B.

[0038] To isolate the remainder of the genome of HIV-2, a genomic library in lambda phage L47.1 was constructed. Lambda phage L47.1 has been described by W. A. M. Loenen et al. in Gene 10: 249-259 (1980), specifically incorporated herein by reference. The genomic library was constructed with a partial Sau3AI restriction digest of the DNA from the CEM cell line infected with HIV-2ROD.

[0039] About 2×106 recombinant plaques were screened in situ with labelled insert from the E2 cDNA clone. Ten recombinant phages were detected and plaque purified. Of these phages, three were characterized by restriction mapping and Southern blot hybridization with the E2 insert and probes from its 3′ end (LTR) or 5′ end (envelope), as well as with HIV-1 subgenomic probes. In this instance, HIV-1 probes were used under non-stringent conditions.

[0040] A clone carrying a 9.5 kb. insert and derived from a circular viral DNA was identified as containing the complete genome and designated &lgr;ROD 4. Two other clones, &lgr;ROD 27 and &lgr;ROD 35 were derived from integrated proviruses and found to carry an LTR and cellular flanking sequences and a portion of the viral coding sequences as shown in FIG. 3, A.

[0041] Fragments of the lambda clones were subcloned into a plasmid vector p UC 18.

[0042] Plasmid pROD 27-5′ is derived from &lgr;ROD 27 and contains the 5′ 2Kb of the HIV-2 genome and cellular flanking sequences (5′ LTR and 5′ viral coding sequences to the EcoRI site).

[0043] Plasmid p ROD 4-8 is dervied from &lgr;ROD 4 and contains the about 5 Kb HindIII fragment that is the central part of the HIV-2 genome.

[0044] Plasmid pROD 27-5′ and p ROD 4.8 inserts overlap.

[0045] Plasmid pROD 4.7 contains a HindIII 1.8 Kb fragment from &lgr;ROD 4. This fragment is located 3′ to the fragment subcloned into pROD 4.8 and contains about 0.8 Kb of viral coding sequences and the part of the lambda phage (&lgr;L47.1) left arm located between the BamHI and HindIII cloning sites.

[0046] Plasmid pROD 35 contains all the HIV-2 coding sequences 3′ to the EcoRI site, the 3′ L:R and about 4 Kb of cellular flanking sequences.

[0047] Plasmid pROD 27-5′ and pROD 35 in E. coli strain HB 101 are deposited respectively under No. 1-626 and 1-633 at the CNCM, and have also been deposited at the NCIB (British Collection). These plasmids are depicted in FIG. 5. Plasmids pROD 4-7 and pROD 4-8 in E. coli strain TG1 are deposited respectively under No. 1-627 and 1-628 at the CNCM.

[0048] To reconstitute the complete HIV-2 ROD genome, pROD 35 is linearized with EcoRI and the EcoRI insert of pROD 27-5′ is ligated in the correct orientation into this site.

[0049] The relationship of HIV-2 to other human and simian retroviruses was surmised from hybridization experiments. The relative homology of the different regions of the HIV-1 and 2 genomes was determined by hybridization of fragments of the cloned HIV-1 genome with the labelled &lgr;ROD 4 expected to contain the complete HIV-2 genome (FIG. 3, B). Even in very low stringency conditions (Tm −42° C.), the hybridization of HIV-1 and 2 was restricted to a fraction of their genomes, principally the gag gene (dots 1 and 2), the reverse transcriptase domain in pol (dot 3), the end of pol and the Q (or sor) genes (dot 5) and the F gene (or 3′ orf) and 3′ LTR (dot 11). The HIV-1 fragment used to detect the HIV-2 cDNA clones contained the dot 11 subclone, which hybridized well to HIV-2 under non-stringent conditions. Only the signal from dot 5 persisted after stringent washing. The envelope gene, the region of the tat gene and a part of pol thus seemed very divergent. These data, along with the LTR sequence obtained (FIG. 1, B), indicated that HIV-2 is not an envelope variant of HIV-1, as are African isolates from Zaire described by Alizon et al., Cell 40:63-74 (1986).

[0050] It was observed that HIV-2 is related more closely to the Simian Immunodeficiency Virus (SIV) than it is to HIV-1. This correlation has been described by F. Clavel et al. in C.R. Acad. Sci. (Paris) 302: 485-488 (1986) and F. Clavel et al. in Science 233: 343-346 (1986), both of which are specifically incorporated herein by reference. Simian Immunodeficiency Virus (also designated Simian T-cell Lymphotropic Virus Type 3, STLV-3) is a retrovirus first isolated from captive macaques with an AIDS-like disease in the USA. This simian virus has been described by M. D. Daniel et al. in Science 228: 1201-1204 (1985), specifically incorporated herein by reference.

[0051] All the SIV proteins, including the envelope, are immune precipitated by sera from HIV-2 infected patients, whereas the serological cross-reactivity of HIV-1 to 2 is restricted to the core proteins. However SIV and HIV-2 can be distinguished by slight differences in the apparent molecular weight of their proteins.

[0052] In terms of nucleotide sequence, it also appears that HIV-2 is closely related to SIV. The genomic RNA of SIV can be detected in stringent conditions as shown in FIG. 2, C by HIV-2 probes corresponding to the LTR and 3′ end of the genome (E2) or to the gag or pol genes. Under the same conditions, HIV-1 derived probes do not detect the SIV genome as shown in FIG. 2, D.

[0053] In Southern blots of DNA from SIV-infected cells, a restriction pattern clearly different from HIV-2ROD and other isolates is seen. All the bands persist after a stringent washing, even though the signal is considerably weakened, indicating a sequence homology throughout the genomes of HIV-2 and SIV. It has recently been shown that baboons and macaques could be infected experimentally by HIV-2, thereby providing an interesting animal model for the study of the HIV infection and its preventive therapy. Indeed, attempts to infect non-human primates with HIV-1 have been successful only in chimpanzees, which are not a convenient model.

[0054] From an initial survey of the restriction maps for certain of the HIV-2 isolates obtained according to the methods described herein, it is already apparent that HIV-2, like HIV-1, undergoes restriction site polymorphism. FIG. 4 A depicts examples of such differences for three isolates, all different one from another and from the cloned HIV-2ROD. It is very likely that these differences at the nucleotide level are accompanied by variations in the amino-acid sequence of the viral proteins, as evidenced in the case of HIV-1 and described by M. Alizon et al. in Cell 46: 63-74 (1986), specifically incorporated herein by reference. It is also to be expected that the various isolates of HIV-2 will exhibit amino acid heterogeneities. See, for example, Clavel et al., Nature 324 (18):691-695 (1986), specifically incorporated herein by reference.

[0055] Further, the chacterization of HIV-2 will also delineate the domain of the envelope glycoprotein that is responsible for the binding of the surface of the target cells and the subsequent internalization of the virus. This interaction was shown to be mediated by the CD4 molecule itself in the case of HIV-1 and similar studies tend to indicate that HIV-2 uses the same receptor. Thus, although there is wide divergence between the env genes of HIV-1 and 2, small homologous domains of the envelopes of the two HIV could represent a candidate receptor binding site. This site could be used to raise a protective immune response against this group of retroviruses.

[0056] From the data discussed herein, certain nucleotide sequences have been identified which are capable of being used as probes in diagnostic methods to obtain the immunological reagents necessary to diagnose an HIV-2 infection. In particular, these sequences may be used as probes in hybridization reactions with the genetic material of infected patients to indicate whether the RNA of the HIV-2 virus is present in these patient's lymphocytes or whether an analogous DNA is present. In this embodiment, the test methods which may be utilized include Northern blots, Southern blots and dot blots. One particular nucleotide sequence which may be useful as a probe is the combination of the 5 kb. HindIII fragment of ROD 4 and the E2 cDNA used in FIG. 4.

[0057] In addition, the genetic sequences of the HIV-2 virus may be used to create the polypeptides encoded by these sequences. Specifically, these polypeptides may be created by expression of the cDNA obtained according to the teachings herein in hosts such as bacteria, yeast or animal cells. These polypeptides may be used in diagnostic tests such as immunofluorescence assays (IFA), radioimmunoassays (RIA) and Western Blot tests.

[0058] Moreover, it is also contemplated that additional diagnostic tests, including additional immunodiagnostic tests, may be developed in which the DNA probes or the polypeptides of this invention may serve as one of the diagnostic reagents. The invention described herein includes these additional test methods.

[0059] In addition, monoclonal antibodies to these polypeptides or fragments thereof may be created. The monoclonal antibodies may be used in immunodiagnostic tests in an analogous manner as the polypeptides described above.

[0060] The polypeptides of the present invention may also be used as immunogenic reagents to induce protection against infection by HIV-2 viruses. In this embodiment, the polypeptides produced by recombinant-DNA techniques would function as vaccine agents.

[0061] Also, the polypeptides of this invention may be used in competitive assays to test the ability of various antiviral agents to determine their ability to prevent the virus from fixing on its target.

[0062] Thus, it is to be understood that application of the teachings of the present invention to a specific problem or environment will be within the capabilities of one having ordinary skill in the art in light of the teachings contained herein. Examples of the products of the present invention and representative processes for their isolation and manufacture appear above and in the following examples.

EXAMPLES Example 1 Cloning of a cDNA Complementary to Genomic RNA From HIV-2 Virions

[0063] HIV-2 virions were purified from 5 liters of supernatant from a culture of the CEM cell line infected with the ROD isolate and a cDNA first strand using oligo (dT) primer was synthesized in detergent activated endogenous reaction on pelleted virus, as described by M. Alizon et al. in Nature, 312: 757-760 (1984), specifically incorporated herein by reference. RNA-cDNA hybrids were purified by phenol-chloroform extraction and ethanol precipitation. The second-strand cDNA was created by the DNA polymerase I/RNAase H method of Gubler and Hoffman in Gene, 25: 263-269 (1983), specifically incorporated herein by reference, using a commercial cDNA synthesis kit obtained from Amersham. After attachment of EcoRI linkers (obtained from Pharmacia), EcoRI digestion, and ligation into EcoRI-digested dephosphorylated M13 tg 130 vector (obtained from Amersham), a cDNA library was obtained by transformation of the E. coli TG1 strain. Recombinant plaques (104) were screened in situ on replica filters with the 1.5 kb. HindIII fragment from clone J19, corresponding to the 31 part of the genome of the LAVBRU isolate of HIV-1, 32P labelled to a specific activity of 109cpm ug. The filters were prehybridized in 5× SSC, 5× Denhardt solution, 25% formamide, and denatured salmon sperm DNA (100 ug/ml.) at 37° C. for 4 hours and hybridized for 16 hours in the same buffer (Tm −42° C.) plus 4×107 cpm of the labelled probe (106 cpm/ml. of hybridization buffer). The washing was done in 5× SSC, 0.1% SDS at 25° C. for 2 hours. 20× SSC is 3M NaCl, 0.3M Na citrate. Positive plaques were purified and single-stranded M13 DNA prepared and end-sequenced according to the method described in Proc. Nat'l. Acad. Sci. USA, 74: 5463-5467 (1977) of Sanger et al.

Example 2 Hybridization of DNA from HIV-1 and HIV-2 Infected Cells and RNA from HIV-1 and 2 and SIV Virons with a Probe Derived From an HIV-2 Cloned cDNA

[0064] DNA was extracted from infected CEM cells continuously producing HIV-1 or 2. The DNA digested with 20 ug of PstI digested with or undigested, was electrophoresed on a 0.8% agarose gel, and Southern-transferred to nylon membrane. Virion dot-blots were prepared in duplicate, as described by F. Clavel et al. in Science 233: 343-346 (1986), specifically incorporated herein by reference, by pelleting volumes of supernatant corresponding to the same amount of reverse transcriptase activity. Prehybridization was done in 50% formamide, 5× SSC, 5× Denhardt solution, and 100 mg./ml. denatured salmon sperm DNA for 4 hours at 42° C. Hybridization was performed in the same buffer plus 10% Dextran sulphate, and 106 cpm/ml. of the labelled E2 insert (specific activity 109 cpm/ug.) for 16 hours at 42° C. Washing was in 0.1× SSC, 0.1% SDS for 2×30 mn. After exposition for 16 hours with intensifying screens, the Southern blot was dehybridized in 0.4 N NaOH, neutralized, and rehybridized in the same conditions to the HIV-1 probe labelled to 109 cpm/ug.

Example 3 Cloning in Lambda Phage of the Complete Provirus DNA of HIV-2

[0065] DNA from the HIV-2ROD infected CEM (FIG. 2, lanes a and c) was partially digested with Sau3AI. The 9-15 kb. fraction was selected on a 5-40% sucrose gradient and ligated to BamHI arms of the lambda L47.1 vector. Plaques (2×106) obtained after in vitro packaging and plating on E. coli LA 101 strain were screened in situ with the insert from the E2 cDNA clone. Approximately 10 positive clones were plaque purified and propagated on E. coli C600 recBC. The ROD 4, 27, and 35 clones were amplified and their DNA characterized by restriction mapping and Southern blotting with the HIV-2 cDNA clone under stringent conditions, and gag-pol probes from HIV-1 used under non stringent conditions.

Example 4 Complete Genomic Sequence of the ROD HIV-2 Isolate

[0066] Experimental analysis of the HIV-2 ROD isolate yielded the following sequence which represents the complete genome of this HIV-2 isolate. Genes and major expression products identified within the following sequence are indicated by nucleotides numbered below:

[0067] 1) GAG gene (546-2111) expresses a protein product having a molecular weight of around 55 Kd and is cleaved into the following proteins:

[0068] a) p 16 (546-950)

[0069] b) p 26 (951-1640)

[0070] c) p 12 (1701-2111)

[0071] 2) polymerase (1829-4936)

[0072] 3) Q protein (4869-5513)

[0073] 4) R protein (5682-5996)

[0074] 5) X protein (5344-5679)

[0075] 6) Y protein (5682-5996)

[0076] 7) Env protein (6147-8720)

[0077] 8) F protein (8557-9324)

[0078] 9) TAT gene (5845-6140 and 8307-8400) is expressed by two exons separated by introns.

[0079] 10) ART protein (6071-6140 and 8307-8536) is similarly the expression product of two exons.

[0080] 11) LTR:R (1-173 and 9498-9671)

[0081] 12) U5 (174-299)

[0082] 13) U3 (8942-9497)

[0083] It will be known to one of skill in the art that the absolute numbering which has been adopted is not essential. For example, the nucleotide within the LTR which is designated as “1” is a somewhat arbitrary choice. What is important is the sequence information provided. 1 GGTCGCTCTGCGGAGAGGCTGGCAGATTGAGCCCTGGGAGGTTCTCTCCAGCACTAGCAG          .         .         .         .         .         . GTAGAGCCTGGGTGTTCCCTGCTAGACTCTCACCAGCACTTGGCCGGTGCTGGGCAGACG          .         .         .       100         .         . GCCCCACGCTTGCTTGCTTAAAAACCTCTTAATAAAGCTGCCAGTTAGAAGCAAGTTAAG          .         .         .         .         .         . TGTGTGCTCCCATCTCTCCTAGTCGCCGCCTGGTCATTCGGTGTTCACCTGAGTAACAAG          .       200         .         .         .         . ACCCTGGTCTGTTAGGACCCTTCTTGCTTTGGGAAACCGAGGCAGGAAAATCCCTAGCAG          .         .         .         .         .      300 GTTGGCGCCTGAACAGGGACTTGAAGAAGACTGAGAAGTCTTGGAACACGGCTGAGTGAA          .         .         .         .         .         . GGCAGTAAGGGCGGCAGGAACAAACCACGACGGAGTGCTCCTAGAAAGGCGCGGGCCGAG          .         .         .       400         .         . GTACCAAAGGCAGCGTGTGGAGCGGGAGGAGAAGAGGCCTCCGGGTGAAGGTAAGTACCT          .         .         .         .         .         . ACACCAAAAACTGTAGCCGAAAGGGCTTGCTATCCTACCTTTAGACAGGTAGAAGATTGT          .       500         .         .         .         .      MetGlyAlaArgAsnSerValLeuArgGlyLysLysAlaAspGluLeuGluArgIle GGGAGATGGGCGCGAGAAACTCCGTCTTGAGAGGGAAAAAAGCAGATGAATTAGAAAGAA          .         .         .         .         .       600  ArgLeuArgProGlyGlyLysLysLysTyrArgLeuLysHisIleValTrpAlaAlaAsn TCAGGTTACGGCCCGGCGGAAAGAAAAAGTACAGGCTAAAACATATTGTGTGGGCAGCGA          .         .         .         .         .         .   LysLeuAspArgPheGlyLeuAlaGluSerLeuLeuGluSerLysGluGlyCysGlnLys ATAAATTGGACAGATTCGGATTAGCAGAGAGCCTGTTGGAGTCAAAAGAGGGTTGTCAAA          .         .         .       700         .         .   IleLeuThrValLeuAspProMetValProThrGlySerGluAsnLeuLysSerLeuPhe AAATTCTTACAGTTTTAGATCCAATGGTACCGACAGGTTCAGAAAATTTAAAAAGTCTTT          .         .         .         .         .         .   AsnThrValCysValIleTrpCysIleHisAlaGluGluLysValLysAspThrGluGly TTAATACTGTCTGCGTCATTTGGTGCATACACGCAGAAGAGAAAGTGAAAGATACTGAAG          .       800         .         .         .         .   AlaLysGlnIleValArgArgHisLeuValAlaGluThrGlyThrAlaGluLysMetPro GAGCAAAACAAATAGTGCGGAGACATCTAGTGCCAGAAACAGGAACTGCAGAGAAAATGG          .         .         .         .         .       900   SerThrSerArgProThrAlaProSerSerGluLysGlyGlyAsnTyrProValGlnHis CAAGCACAAGTAGACCAACAGCACCATCTAGCGAGAAGGGAGGAAATTACCCAGTGCAAC          .         .         .         .         .         .   ValGlyGlyAsnTyrThrHisIleProLeuSerProArgThrLeuAsnAlaTrpValLys ATGTAGGCGGCAACTACACCCATATACCGCTGAGTCCCCGAACCCTAAATGCCTGGGTAA          .         .         .       1000         .         .   LeuValGluGluLysLysPheGlyAlaGluValValProGlyPheGlnAlaLeuSerGlu AATTAGTAGAGGAAAAAAAGTTCGGGGCAGAAGTAGTGCCAGGATTTCAGGCACTCTCAG          .         .         .         .         .         . GlyCysThrProTyrAspIleAsnGlnMetLeuAsnCysValGlyAspHisGlnAlnAla AAGGCTGCACGCCCTATGATATCAACCAAATGCTTAATTGTGTGGGCGACCATCAAGCAG          .       1100         .         .         .         .   MetGlnIleIleArgGluIleIleAsnGluGluAlaAlaGluTrpAspValGlnLisPro CCATGCAGATAATCAGGGAGATTATCAATGAGGAAGCAGCAGAATGGGATGTCCAACATC          .         .         .         .         .       1200   IleProGlyProLeuProAlaGlyGlnLeuArgGluProArgGlySerAspIleAlaGly CAATACCAGGCCCCTTACCAGCGGGGCAGCTTAGAGAGCCAAGGGGATCTGACATAGCAG          .         .         .         .         .         .   ThrThrSerThrValGluGluGlnIleGlnTrpMetPheArgProGlnAsnProValPro GGACAACAAGCACAGTAGAAGAACAGATCCAGTGGATGTTTAGGCCACAAAATCCTGTAC          .         .         .       1300         .         . ValGlyAsnIleTyrArgArgTrpIleGlnIleGlyLeuGlnLysCysValArgMetTyr CAGTAGGAAACATCTATAGAAGATGGATCCAGATAGGATTGCAGAAGTGTGTCAGGATGT          .         .         .         .         .         .   AsnProThrAsnIleLeuAspIleLysGlnGlyProLysGluProPheGlnSerTyrVal ACAACCCGACCAACATCCTAGACATAAAACAGGGACCAAAGGAGCCGTTCCAAAGCTATG          .       1400         .         .         .         . AspArgPheTyrLysSerLeuArgAlaGluGlnThrAspProAlaValLysAsnTrpMet TAGATAGATTCTACAAAAGCTTGAGGGCAGAACAAACAGATCCAGCAGTGAAGAATTGGA          .         .         .         .         .       1500   ThrGlnThrLeuLeuValGlnAsnAlaAsnProAspCysLysLeuValLeuLysGlyLeu TGACCCAAACACTGCTAGTACAAAATGCCAACCCAGACTGTAAATTAGTGCTAAAAGGAC          .         .         .         .         .         .   GlyMetAsnProThrLeuGluGluMetLeuThrAlaCysGlnGlyValGlyGlyProGly TAGGGATGAACCCTACCTTAGAAGACATGCTGACCGCCTGTCAGGGGGTAGGTGGGCCAG          .         .         .       1600         .         .   GlnLysAlaArgLeuMetALaGluAlaLeuLysGluValIleGlyProAlaProIlePro GCCAGAAAGCTAGATTAATGGCAGAGGCCCTGAAAGAGGTCATAGGACCTGCCCCTATCC          .         .         .         .         .         .   PheAlaAlaAlaGlnGlnArgLysAlaPheLysCysTrpAsnCysGlyLysGluGlyHis CATTCGCAGCAGCCCAGCAGAGAAAGGCATTTAAATGCTGGAACTGTGGAAAGGAAGGGC          .       1700         .         .         .         .   SerAlaArgGlnCysArgAlaProArgArgGlnGlyCysTrpLysCysGlyLysProGly ACTCGGCAAGACAATGCCGAGCACCTAGAAGGCAGGGCTGCTGGAAGTGTGGTAAGCCAG          .         .         .         .         .       1800                             ThrGlyArgPhePheArgThrGlyProLeuGly   HisIleMetThrAsnCysProAspArgGlnAlaGlyPheLeuGlyLeuGlyProTrpGly GACACATCATGACAAACTGCCCCAGATAGACAGGCAGGTTTTTTAGGACTGGGCCCTTGGG          .         .         .         .         .         .  LysGluAlaProGlnLeuProArgGlyProSerSerAlaGlyAlaAspThrAsnSerThr   LysLysProArgAsnPheProValAlaGlnValProGlnGlyLeuThrProThrAlaPro GAAAGAAGCCCCGCAACTTCCCCGTGGCCCAAGTTCCGCAGGCGCTGACACCAACAGCAC          .         .         .       1900         .         .  ProSerGlySerSerSerGlySerThrGlyGluIleTyrAlaAlaArgGluLysThrGlu   ProValAspProAlaValAspLeuLeuGluLysTyrMetGlnGlnGlyLysArgGlnArg CCCCAGTGGATCCAGCAGTGGATCTACTGGAGAAATATATCCAGCAAGGGAAAAGACAGA          .         .         .         .         .         .  ArgAlaGluArgGluThrIleGlnGlySerAspArgGlyLeuThrAlaProArgAlaGly   GluGlnArgGluArgProTyrLysGluValThrGluAspLeuLeuHisLeuGluGlnGly GAGAGCAGAGAGAGAGACCATACAAGGAAGTGACAGAGGACTTACTGCACCTCGAGCAGG          .       2000         .         .         .         .  GlyAspThrIleGlnGlyAlaThrAsnArgGlyLeuAlaAlaProGlnPheSerLeuTrp   GluThrProTyrArgGluProProThrGluAspLeuLeuHisLeuAsnSerLeuPheGly GGGAGACACCATACAGGGAGCCACCAACAGAGGACTTGCTGCACCTCAATTCTCTCTTTG          .         .         .         .         .       2100  LysArgProValValThrAlaTyrIleGluGlyGlnProValGluValLeuLeuAspThr   LysAspGln GAAAAGACCAGTAGTCACAGCATACATTGAGGGTCAGCCAGTAGAAGTCTTGTTAGACAC          .         .         .         .         .         .  GlyAlaAspAspSerIleValAlaGlyIleGluLeuGlyAsnAsnTyrSerProLysIle AGGGGCTGACGACTCAATAGTAGCAGGAATAGAGTTAGGGAACAATTATAGCCCAAAAAT          .         .         .       2200         .         .  ValGlyGlyIleGlyGlyPheIleAsnThrLysGluTyrLysAsnValGluIleGluVal AGTAGGGGGAATAGGGGGATTCATAAATACCAAGGAATATAAAAATGTAGAAATAGAAGT          .         .         .         .         .         .  LeuAsnLysLysValArgAlaThrIleMetThrGlyAspThrProIleAsnIlePheGly TCTAAATAAAAAGGTACGGGCCACCATAATGACAGGCGACACCCCAATCAACATTTTTGG          .       2300         .         .         .         .  ArgAsnIleLeuThrAlaLeuGlyMetSerLeuAsnLeuProValAlaLysValGluPro CAGAAATATTCTGACAGCCTTAGGCATGTCATTAAATCTACCAGTCGCCAAAGTAGAGCC          .         .         .         .         .       2400  IleLysIleMetLeuLysProGlyLysAspGlyProLysLeuArgGlnTrpProLeuThr AATAAAAATAATGCTAAAGCCAGGGAAAGATGGACCAAAACTGAGACAATGGCCCTTAAC          .         .         .         .         .         .  LysGluLysIleGluAlaLeuLysGluIleCysGluLysMetGluLysGluGlyGlnLeu AATAAAAATAATGCTAAAGCCAGGGAAAGATGGACCAAAACTGAGACAATGGCCCTTAAC          .         .         .         .         .         .  LysGluLysIleGluAlaLeuLysGluIleCysGluLysMetGluLysGluGlyGlnLeu AAAAGAAAAAATAGAAGCACTAAAAGAAATCTGTGAAAAAATGGAAAAAGAAGGCCAGCT          .         .         .       2500         .         .  GluGluAlaProProThrAsnProTyrAsnThrProThrPheAlaIleLysLysLysAsp AGAGGAAGCACCTCCAACTAATCCTTATAATACCCCCAGATTTGCAATCAAGAAAAAGGA          .         .         .         .         .         .  LysAsnLysTrpArgMetLeuIleAspPheArgGluLeuAsnLysValThrGlnAspPhe CAAAAACAAATGGAGGATGCTAATAGATTTCAGAGAACTAAACAAGGTAACTCAAGATTT          .       2600         .         .         .         .  ThrTluIleGlnLeuGlyIleProHisProAlaGlyLeuAlaLysLysArgArgIleThr CACAGAAATTCAGTTAGGAATTCCACACCCAGCAGGGTTGGCCAAGAAGAGAAGAATTAC          .         .         .         .         .       2700  ValLeuAspValGlyAspAlaTyrPheSerIleProLeuHisGluAspPheArgProTyr TGTACTAGATGTAGGGGATGCTTACTTTTCCATACCACTACATGAGGACTTTAGACCATA          .         .         .         .         .         .  ThrAlaPheThrLeuProSerValAsnAsnAlaGluProGlyLysArgTyrIleTyrLys TACTGCATTTACTCTACCATCAGTGAACAATGCAGAACCAGGAAAAAGATACATATATAA          .         .         .       2800         .         .  ValLeuProGlnGlyTrpLysGlySerProAlaIlePheGlnHisThrMetArgGlnVal AGTCTTGCCACAGGGATGGAAGGGATCACCAGCAATTTTTCAACACACAATGAGACAGGT          .         .         .         .         .         .  LeuGluProPheArgLysAlaAsnLysAspValIleIleIleGlnTyrMetAspAspIle ATTAGAACCATTCAGAAAAGCAAACAAGGATGTCATTATCATTCAGTACATGGATGATAT          .       2900         .         .         .         .  LeuIleAlaSerAspArgThrAspLeuGluHisAspArgValValLeuGlnLeuLysGlu CTTAATAGCTAGTGACAGGACAGATTTAGAACATGATAGGGTAGTCCTGCAGCTCAAGGA          .         .         .         .         .       3000  LeuLeuAsnGlyLeuGlyPheSerThrProAspGluLysPheGlnLysAspProProTyr ACTTCTAAATGGCCTAGGATTTTCTACCCCAGATGAGAAGTTCCAAAAAGACCCTCCATA          .         .         .         .         .         .  HisTrpMetGlyTyrGluLeuTrpProThrLysTrpLysLeuGlnLysIleGlnLeuPro CCACTGGATGGGCTATGAACTATGGCCAACTAAATGGAAGTTGCAGAAAATACAGTTGCC          .         .       3100         .         .         .  GlnLysGluIleTrpThrValAsnAspIleGlnLysLeuValGlyValLeuAsnTrpAla CCAAAAAGAAATATGGACAGTCAATGACATCCAGAAGCTAGTGGGTGTCCTAAATTGGGC          .         .         .         .         .         .  AlaGlnLeuTyrProGlyIleLysThrLysHisLeuCysArgLeuIleArgGlyLysMet AGCACAACTCTACCCAGGGATAAAGACCAAACACTTATGTAGGTTAATCAGAGGAAAAAT          .       3200         .         .         .         .  ThrLeuThrGluGluValGlnTrpThrGluLeuAlaGluAlaGluLeuGluGluAsnArg GACACTCACAGAAGAAGTACAGTGGACAGAATTACCAGAAGCAGAGCTAGAAGAAAACAG          .         .         .         .         .       3300  IleIleLeuSerGlnGluGlnGluGlyHisTyrTyrGlnGluGluLysGluLeuGluAla AATTATCCTAAGCCAGGAACAAGAGGGACACTATTACCAAGAAGAAAAAGAGCTAGAAGC          .         .         .         .         .         .  ThrValGlnLysAspGlnGluAsnGlnTrpThrTyrLysIleHisGlnGluGluLysIle AACAGTCCAAAAGGATCAAGAGAATCAGTGGACATATAAAATACACCAGGAAGAAAAAAT          .         .         .       3400         .         .  LeuLysValGlyLysTyrAlaLysValLysAsnThrHisThrAsnGlyIleArgLeuLeu TCTAAAAGTAGGAAAATATGCAAAGGTGAAAAACACCCATACCAATGGAATCAGATTGTT          .         .         .         .         .         .  AlaGlnValValGlnLysIleGlyLysGluAlaLeuValIleTrpGlyArgIleProLys AGCACAGGTAGTTCAGAAAATAGGAAAAGAAGCACTAGTCATTTGGGGACGAATACCAAA          .       3500         .         .         .         .  PheHisLeuProValGluArgGluIleTrpGluGlnTrpTrpAspAsnTyrTrpGlnVal ATTTCACCTACCAGTAGAGAGAGAAATCTGGGAGCAGTGGTGGGATAACTACTGGCAAGT          .         .         .         .         .       3600  ThrTrpIleProAspTrpAspPheValSerThrProProLeuValArgLeuAlaPheAsn GACATGGATCCCAGACTGGGACTTCGTGTCTACCCCACCACTGGTCAGGTTAGCGTTTAA          .         .         .         .         .         .  LeuGluGlnThrThrAsnGlnGlnAlaGluLeuGluAlaPheAlaMetAlaLeuThrAsp ACTAGAGCAAACTACCAATCAGCAAGCAGAACTAGAAGCCTTTGCGATGGCACTAACAGA          .       3800.         .         .         .         .  SerGlyProLysValAsnIleIleValAspSerGlnTyrValMetGlyIleSerAlaSer CTCGGGTCCAAAAGTTAATATTATAGTAGACTCACAGTATGTAATGGGGATCAGTCCAAG          .         .         .         .         .       3900  GlnProThrGluSerGluSerLysIleValAsnGlnIleIleGluGluMetIleLysLys CCAACCAACAGAGTCAGAAAGTAAAATAGTGAACCAGATCATAGAAGAAATGATAAAAAA          .         .         .         .         .         .  GluAlaIleTyrValAlaTrpValProAlaHisLysGlyIleGlyGlyAsnGlnGluVal GGAAGCAATCTATGTTGCATGGGTCCCAGCCCACAAAGGCATAGGGGGAAACCAGGAAGT          .         .         .       4000         .         .  AspHisLeuValSerGlnGlyIleArgGlnValLeuPheLeuGluLysIleGluProAla AGATCATTTAGTGAGTCAGGGTATCAGACAAGTGTTGTTCCTGGAAAAAATAGAGCCCGC          .         .         .         .         .         .  GlnGluGluHisGluLysTyrHisSerAsnValLysGluLeuSerHisLysPheGlyIle TCAGGAAGAACATGAAAAATATCATAGCAATGTAAAAGAACTGTCTCATAAATTTGGAAT          .       4100         .         .         .         .  ProAsnLeuValAlaArgGlnIleValAsnSerCysAlaGlnCysGlnGlnLysGlyGlu ACCCAATTTAGTGGCAAGGCAAATAGTAAACTCATGTGCCCAATGTCAACAGAAAGGGGA          .         .         .         .         .       4200  AlaIleHisGlyGlnValAsnAlaGluLeuGlyThrTrpGlnMetAspCysThrHisLeu AGCTATACATGGGCAAGTAAATGCAGAACTAGGCACTTGGCAAATGGACTGCACACATTT          .         .         .         .         .         .  GluGlyLysIleIleIleValAlaValHisValAlaSerGlyPheIleGluAlaGluVal AGAAGGAAAGATCATTATAGTAGCAGTACATGTTGCAAGTGGATTTATAGAAGCAGAAGT          .         .         .       4300         .         .  IleProGluGluSerGlyArgGlnThrAlaLeuPheLeuLeuLysLeuAlaSerArgTrp CATCCCACAGGAATCAGGAAGACAAACAGCACTCTTCCTATTGAAACTGGCAAGTAGGTG          .         .         .         .         .         .  ProIleThrHisLeuHisThrAspAsnGlyAlaAsnPheThrSerGlnGluValLysMet GCCAATAACACACTTGCATACAGATAATGGTGCCAACTTCACTTCACAGGAGGTGAAGAT          .       4400         .         .         .         .  ValAlaTrpTrpIleGlyIleGluGlnSerPheGlyValProTyrAsnProGlnSerGln GGTAGCATGGTGGATAGGTATAGAACAATCCTTTGGAGTACGTTACAATCCACAGAGCCA          .         .         .         .         .       4500  GlyValValGluAlaMetAsnHisHisLeuLysAsnGlnIleSerArgIleArgGluGln AGGAGTAGTAGAAGCAATGAATCACCATCTAAAAAACCAAATAAGTAGAATCAGAGAACA          .         .         .         .         .         .  AlaAsnThrIleGluThrIleValLeuMetAlaIleHisCysMetAsnPheLysArgArg GGCAAATACAATAGAAACAATAGTACTAATGGCAATTCATTGCATGAATTTTAAAAGAAG          .         .         .       4600         .         .  GlyGlyIleGlyAspMetThrProSerGluArgLeuIleAsnMetIleThrThrGluGln GGGGGGAATAGGGGATATGACTCCATCAGAAAGATTAATCAATATGATCACCACAGAACA          .         .         .         .         .         .  GluIleGlnPheLeuGlnAlaLysAsnSerLysLeuLysAspPheArgValTyrPheArg AGAAGGCAGAGATCAGTTGTGGAAAGGACCTGGGGAACTACTGTGGAAAGGAGAAGGAGC          .       4700         .         .         .         .  GluGlyArgAspGlnLeuTrpLysGlyProGlyGluLeuLeuTrpLysGlyGluGlyAla AGAAGGCAGAGATCAGTTGTGGAAAGGACCTGGGGAACTACTGTGGAAAGGAGAAGGAGC          .         .         .         .         .       4800  ValLeuValLysValGlyThrAspIleLysIleIleProArgArgLysAlaLysIleIle AGTCCTAGTCAAGGTAGGAACAGACATAAAAATAATACCAAGAAGGAAAGCCAAGATCAT          .         .         .         .         .         .  ArgAspTyrGlyGlyArgGlnGluMetAspSerGlySerHisLeuGluGlyAlaArgGlu        Met GluGluAspLysArgTrpIleValValProThrTrpArgValProGlyArg CAGAGACTATGGAGGAAGACAAGAGATGGATAGTGGTTCCCACCTGGAGGGTGCCAGGGA          .         .         .       4900         .         .  AspGlyGluMetAla   MetGluLysTrpHisSerLeuValLysTryLeuLysTyrLysThrLysAspLeuGluLys GGATGGAGAAATGGCATAGCCTTGTCAAGTATCTAAAATACAAAACAAAGGATCTAGAAA          .         .         .         .         .         .   ValCysTyrValProHisHisLysValGlyTrpAlaTrpTrpThrCysSerArgValIle AGGTGTGCTATGTTCCCCACCATAAGGTGGGATGGGCATGCTGGACTTGCAGCAGGGTAA            .       5000         .         .         .         .     PheProLeuLysGlyAsnSerHisLeuGluIleGlnAlaTyrTrpAsnLeuThrProGlu   TATTCCCATTAAAAGGAAACAGTCATCTAGAGATACAGGCATATTGGAACTTAACACCAG            .         .         .         .         .       5100     LysGlyTrpLeuSerSerTyrSerValArgIleThrTrpTyrThrGluLysPheTrpThr   AAAAAGGATGGCTCTCCTCTTATTCAGTAAGAATAACTTGGTACACAGAAAAGTTCTGGA            .         .         .         .         .         .     AspValThrProAspCysAlaAspValLeuIleHisSerThrTyrPheProCysPheThr   CAGATGTTACCCCAGACTGTGCAGATGTCCTAATACATAGCACTTATTTCCCTTGCTTTA            .         .         .       5200         .         .     AlaGlyGluValArgArgAlaIleArgGlyGluLysLeuLeuSerCysCysAsnTyrPro   CAGCAGGTGAAGTAAGAAGAGCCATCAGAGGGGAAAAGTTATTGTCCTGCTGCAATTATC            .         .         .         .         .         .     ArgAlaHisArgAlaGlnValProSerLeuGlnPheLeuAlaLeuValValValGlnGln CCCGAGCTCATAGAGCCCAGGTACCGTCACTTCAATTTCTGGCCTTAGTGGTAGTGCAAC            .       5300          .         .         .         .    MetThrAspProArgGluThrValProProGlyAsnSerGlyGluGluThrIleGly   AsnAspArgProGluArgAspSerThrThrArgLysGlnArgArgArgAspTyrArgArg AAAATGACAGACCCCAGAGAGACAGTACCACCAGGAAACAGCCGCGAAGAGACTATCGGA          .         .         .         .         .       5400 GluAlaPheAlaTrpLeuAsnArgThrValGluAlaIleAsnArgGluAlaValAsnHis   GlyLeuArgLeuAlaLysGlnAspSerArgSerHisLysGlnArgSerSerGluSerPro GAGGCCTTCGCCTGGCTAAACAGGACAGTAGAAGCCATAAACAGAGAAGCAGTGAATCAC          .         .         .         .         .         . LeuProArgGluLeuIlePheGluValTrpGlnArgSerTrpArgTyrTrpHisAspGlu   ThrProArgThrTyrPheProGlyValAlaGluValLeuGluIleLeuAla CTACCCCGAGAACTTATTTTCCAGGTGTGGCAGACGTCCTGGAGATACTGGCATGATGAA          .         .         .       5500         .         . GlnGlyMetSerGluSerTyrThrLysTyrArgTyrLeuCysIleIleGlnLysAlaVal CAAGGGATGTCAGAAAGTTACACAAAGTATAGATATTTGTGCATAATACAGAAAGCACTG          .         .         .         .         .         . TyrMetHisValArgLysGlyCysThrCysLeuGlyArgGlyHisGlyProGlyGlyTrp TACATGCATGTTAGGAAAGGGTGTACTTGCCTGGGGACGGGACATGGGCCAGGAGGGTGG          .       5600         .         .         .         . ArgProGlyProProProProProProProGlyLeuVal                                          MetAlaGluAlaProThrGlu AGACCAGGGCCTCCTCCTCCTCCCCCTCCAGGTCTGGTGTAATGGCTGAAGCACCAACAG          .         .         .         .         .       5700   LeuProProValAspGlyThrProLeuArgGluProGlyAspGluTrpIleIleGluIle AGCTCCCCCCGGTGGATGGGACCCCACTGAGGGAGCCAGGGGATGAGTGGATAATAGAAA          .         .         .         .         .         .   LeuArgGluIleLysGluGluAlaLeuLysHisPheAspProArgLeuLeuIleAlaLeu TCTTGAGAGAAATAAAAGAAGAAGCTTTAAAGCATTTTGACCCTCGCTTGCTAATTGCTC          .         .         .       5800         .         .                         MetGluThrPreLeuLysAlaProGluSerSerLeu   GlyLysTyrIleTyrThrArgHisGlyAspThrLeuGluGlyAlaArgGluLeuIleLys TTGGCAAATATATCTATACTAGACATGGAGACACCCTTGAAGGCGCCAGAGAGCTCATTA          .         .         .         .         .         . LysSerCysAsnGluProPheSerArgThrSerGluGlnAspValAlaThrGlnGluLeu   ValLeuGlnArgAlaLeuPheThrHisPheArgAlaGlyCysGlyHisSerArgIleGly AAGTCCTGCAACGAGCCCTTTTCACGCACTTCAGAGCACTTCACAGCAGGATGTGGCCACTCAAGAATTG          .       5900         .         .         .         . AlaArgGlnGlyGluGluIleLeuSerGlnLeuTyrArgProLeuGluThrCysAsnAsn   GlnThrArgGlyGlyAsnProLeuSerAlaIleProThrProArgAsnMetGln GCCAGACAAGGGGAGGAAATCCTCTCTCAGCTATACCGACCCCTAGAAACATGCAATAAC          .         .         .         .         .       6000 SerCysTyrCysLysArgCysCysTyrHisCysGlnMetCysPheLeuAsnLysGlyLeu TCATGCTATTGTAAGCCATGCTGCTACCATTGTCAGATGTGTTTTCTAAACAAGGGGCTC          .         .         .         .         .         . GlyIleCysTyrGluArgLysGlyArgArgArgArgThrProLysLysThrLysThrHis           MetAsnGluArgAlaAspGluGluGlyLeuGlnArgLysLeuArgLeuIle GGGATATGTTATGAACGAAAGGGCAGACGAAGAAGCACTCCAAAGAAAACTAAGACTCAT          .         .         .       6100         .         . ProSerProThrProAspLys  ArgLeuLeuHisGlnThr                            MetMetAsnGlnLeuLeuIleAlaIleLeuLeuAla CCGTCTCCTACACCAGACAAGTGAGTATGATGAATCAGCTGCTTATTGCCATTTTATTAG          .         .         .         .         .         .   SerAlacysLeuValTyrCysThrGlnTyrValThrValPheTyrGlyValProThrTrp CTAGTGCTTGCTTAGTATATTGCACCCAATATGTAACTGTTTTCTATGGCGTACCCACGT          .       6200         .         .         .         .   LysAsnAlaThrIleProLeuPheCysAlaThrArgAsnArgAspThrTrpGlyThrIle GGAAAAATGCAACCATTCCCCTCTTTTGTGCAACCAGAAATAGGGATACTTGGGGAACCA          .         .         .         .         .       6300   GlnCysLeuProAspAsnAspAspTyrGlnGluIleThrLeuAsnValThrGluAlaPhe TACAGTGCTTGCCTGACAATGATGATTATCAGGAAATAACTTTGAATGTAACAGAGGCTT          .         .         .         .         .         . AspAlaTrpAsnAsnThrValThrGluGlnAlaIleGluAspValTrpHisLeuPheGlu TTGATGCATGGAATAATACAGTAACAGAACAAGCAATAGAAGATGTCTGGCATCTATTCG          .         .         .       6400         .         .   ThrSerIleLysProCysValLysLeuThrProLeuCysValAlaMetLysCysSerSer AGACATCAATAAAACCATGTGTCAAACTAACACCTTTATGTGTAGCAATGAAATGCAGCA          .         .         .         .         .         .   ThrGluSerSerThrGlyAsnAsnThrThrSerLysSerThrSerThrThrThrThrThr GCACAGAGAGCAGCACAGGGAACAACACAACCTCAAAGAGCACAAGCACAACCACAACCA          .       6500         .         .         .         .   ProThrAspGlnGluGlnGluIleSerGluAspThrProcysAlaArgAlaAspAsnCys CACCCACAGACCAGGAGCAAGAGATAAGTGAGGATACTCCATGCGCACGCGCAGACAACT          .         .         .         .         .       6600   SerGlyLeuGlyGluGluGluThrIleAsncysGlnPheAsnMetThrGlyLeuGluArg GCTCAGGATTGGGAGAGGAAGAAACGATCAATTGCCAGTTCAATATGACAGGATTAGAAA          .         .         .         .         .         .   AspLysLysGlnTyrAsnGluThrTrpTyrSerLysAspValValCysGluThrAsn GAGATAAGAAAAAACAGTATAATGAAACATGGTACTCAAAAGATGTGGTTTGTGAGACAA          .         .         .       6700         .         .   AsnSerThrAsnGlnThrGlnCysTyrMetAsnHisCysAsnThrSerValIleThrGlu ATAATAGCACAAATCAGACCCAGTGTTACATGAACCATTGCAACACATCAGTCATCACAG          .         .         .         .         .         .   SerCysAspLysHisTyrTrpAspAlaIleArgPheArgTyrCysAlaProProGlyTyr AATCATGTGACAAGCACTATTGGGATGCTATAAGGTTTAGATACTGTGCACCACCGGGTT          .       6800         .         .         .         .   AlaLeuLeuArgCysAsnAspThrAsnTyrSerGlyPheAlaProAsnCysSerLysVal ATGCCCTATTAAGATGTAATGATACCAATTATTCAGGCTTTGCACCCAACTGTTCTAAAG          .         .         .         .         .       6900   ValAlaSerThrCysThrArgMetMetGluThrGlnThrSerThrTrpPheGlyPheAsn TAGTAGCTTCTACATGCACCAGGATGATGGAAACGCAAACTTCCACATGGTTTGGCTTTA          .         .         .         .         .         .   GlyThrArgAlaGluAsnArgThrTyrIleTyrTrpHisGlyArgAspAsnArgThrIle ATGGCACTAGAGCAGAGAATAGAACATATATCTATTGGCATGGCAGAGATAATAGAACTA          .         .         .       7000         .         .   IleSerLeuAsnLysTyrTyrAsnLeuSerLeuHisCysLysArgProGlyAsnLysThr TCATCAGCTTAAACAAATATTATAATCTCAGTTTGCATTGTAAGAGGCCAGGGAATAAGA          .         .         .         .         .         .   ValLysGlnIleMetLeuMetSerGlyHisValPheHisSerHisTyrGlnProIleAsn CAGTGAAACAAATAATGCTTATGTCAGGACATGTGTTTCACTCCCACTACCAGCCGATCA          .       7100.         .         .         .         .   LysArgProArgGlnAlaTrpCysTrpPheLysGlyLysTrpLysAspAlaMetGlnGlu ATAAAAGACCCAGACAAGCATGGTGCTGGTTCAAAGGCAAATGGAAAGACGCCATGCAGG          .         .         .         .         .       7200   ValLysGluThrLeuAlaLysHisProArgTyrArgGlyThrAsnAspThrArgAsnIle AGGTGAAGGAAACCCTTGCAAAACATCCCAGGTATAGAGGAACCAATGACACAAGGAATA          .         .         .         .         .         .   SerPheAlaAlaProGlyLysGlySerAspProGluValAlaTyrMetTrpThrAsnCys TTAGCTTTGCAGCGCCAGGAAAAGGCTCAGACCCAGAAGTAGCATACATGTGGACTAACT          .         .         .       7300         .         .   ArgGlyGluPheLeuTyrCysAsnMetTHrTrpPheLeuAsnTrpIleGluAsnLysThr GCAGAGGAGAGTTTCTCTACTGCAACATGACTTGGTTCCTCAATTGGATAGAGAATAAGA          .         .         .         .         .         .   HisArgAsnTyrAlaProCysHisIleLysGlnIleIleAsnThrTrpHisLysValGly CACACCGCAATTATGCACCGTGCCATATAAAGCAAATAATTAACACATGGCATAAGGTAG          .       7400         .         .         .         .   ArgAsnValTyrLeuProProArgGluGlyGluLeuSerCysAsnSerThrValThrSer GGAGAAATGTATATTTGCCTCCCAGGGAACGGGAGCTGTCCTGCAACTCAACAGTAACCA          .         .         .         .         .       7500   IleIleAlaAsnIleAspTrpGlnAsnAsnAsnGlnThrAsnIleThrPheSerAlaGlu GCATAATTGCTAACATTGACTGGCAAAACAATAATCAGACAAACATTACCTTTAGTGCAG          .         .         .         .         .         .   ValAlaGluLeuTyrArgLeuGluLeuGlyAspTyrLysLeuValGluIleThrProIle AGGTGGCAGAACTATACAGATTGGAGTTGGGAGATTATAAATTGGTAGAAATAACACCAA          .       7600         .         .         .         .   GlyPheAlaProThrLysGluLysArgTyrSerSerAlaHisGlyArgHisThrArgGly TTGGCTTCGCACCTACAAAAGAAAAAAGATACTCCTCTGCTCACGGGAGACATACAAGAG          .         .         .         .         .         .   ValPheValLeuGlyPheLeuGlyPheLeuAlaThrAlaGlySerAlaMetGlyAlaAla GTGTGTTCGTGCTAGGGTTCTTGGGTTTTCTCGCAACAGCAGGTTCTGCAATGGGCGCGG          .       7700         .         .         .         .   SerLeuThrValSerAlaGlnSerArgThrLeuLeuAlaGlyIleValGlnGlnGlnGln CGTCCCTGACCGTGTCGGCTCAGTCCCGGACTTTACTGGCCGGGATAGTGCAGCAACAGC          .         .         .         .         .       7800   GlnLeuLeuAspValValLysArgGlnGlnGluLeuLeuArgLeuThrValTrpGlyThr AACAGCTGTTGGACGTGGTCAAGAGACAACAAGAACTGTTGCGACTGACGGTCTGGGGAA          .         .         .         .         .         .   LysAsnLeuGlnAlaArgValThrAlaIleGluLysTyrLeuGlnAspGlnAlaArgLeu CGAAAAACCTCCAGGCAAGAGTCACTGCTATAGAGAAGTACCTACAGGACCAGGCGCGGC          .         .         .       7900         .         .   AsnSerTrpGlyCysAlaPheArgGlnValCysHisThrThrValProTrpValAsnAsp TAAATTCATGGGGATGTGCGTTTAGACAAGTCTGCCACACTACTGTACCATGGGTTAATG          .         .         .         .         .         .   SerLeuAlaProAspTrpAspAsnMetThrTrpGlnGluTrpGluLysGlnValArgTyr ATTCCTTAGCACCTGACTGGGACAATATGACGTGGCAGGAATGGGAAAAACAAGTCCGCT          .       8000         .         .         .         .   LeuGluAlaAsnIleSerLysSerTrpAspIlePheGlyAsnTrpPheAspLeuThrSer TGTATGAACTACAAAAATTAAATAGCTGGGATATTTTTGGCAATTGGTTTGACTTAACCT          .         .         .         .         .       8100   TyrGluLeuGlnLysLeuAsnSerTrpAspIlePheGlyAsnTrpPheAspLeuThrSer TGTATGAACTACAAAAATTAAATAGCTGGGATATTTTTGGCAATTGGTTTGACTTAACCT          .         .         .         .         .         .   TrpValLysTyrIleGlnTyrGlyValLeuIleIleValAlaValIleAlaLeuArgIle CCTGGGTCAAGTATATTCAATATGGAGTGCTTATAATAGTAGCAGTAATAGCTTTAAGAA          .         .         .       8200         .         .   ValIleTyrValValGlnMetLeuSerArgLeuArgLysGlyTyrArgProValPheSer TAGTGATATATGTAGTACAAATGTTAAGTAGGCTTAGAAAGGGCTATAGGCCTGTTTTCT          .         .         .         .         .         .                            SerIleSerThrArgThrGlyAspSerGlnPro                          AsnProTyrProGlnGlyProGlyThrAlaSerGln   SerProProGlyTyrIleGlnGlnIleHisIleHisLysAspArgGlyGlnProAlaAsn CTTCCCCCCCCGGTTATATCCAACAGATCCATATCCACAAGGACCGGGGACAGCCAGCCA          .       8300         .         .         .         . ThrLysLysGlnLysLysThrValGluAlaThrValGluThrAspThrGlyProGlyArg  ArgArgAsnArgArgArgArgTrpLysGlnArgTrpArgGlnIleLeuAlaLeuAlaAsp   GluGluThrGluGluAspGlyGlySerAsnGlyGlyAspArgTyrTrpProTrpProIle          .         .         .         .         .       8400  SerIleTyrThrPheProAspProProAlaAspSerProLeuAspGlnThrIleGlnHis   AlaTyrIleHisPheLeuIleArgGlnLeuIleArgLeuLeuThrArgLeuTyrSerIle TAGCATATATACATTTCCTGATCCGCCAGCTGATTCGCCTCTTGACCAGACTATACAGCA          .         .         .         .         .         .  LeuGlnGlyLeuThrIleGlnGluLeuProAspProProThrHisLeuProGluSerGln   GysArgAspLeuLeuSerArgSerPheLeuThrLeuGlnLeuIleTyrGlnAsnLeuArg TCTGCAGGGACTTACTATCCAGGAGCTTCCTGACCCTCCAACTCATCTACCAGAATCTCA          .         .         .       8500         .         .  ArgLeuAlaGluThr                     MetGlyAlaSerGlySerLysLys   AspTrpLeuArgLeuArgThrAlaPheLeuGlnTyrGlyCysGluTrpIleGlnGluAla GAGACTGGCTGAGACTTAGAACAGCCTTCTTGGAATATGGGTGCGAGTGGATCCAAGAAG          .         .         .         .         .         . HisSerArgProProArgGlyLeuGlnGluARgLeuLeuArgLalArgAlaGlyAlaCys   PheGlnAlaAlaAlaArgAlaThrArgGluThrLeuAlaGlyAlaCysArgGlyLeuTrp CATTCCAGGCCGCCGCGAGGGCTACAAGAGAGACTCTTGCGGGCGCGTGCAGGGGCTTGT          .       8600         .         .         .         . GlyGlyTyrTrpAsnGluSerGlyGlyGluTyrSerArgPheGlnGluGlySerAspArg   ArgValLeuGluArgIleGlyArgGlyileLeuAlaValProArgARgIleArgGlnGly GCAGGGTATTGGAACGAATCGGGAGGGGAATACTCGCGGTTCCAAGAAGGATCAGACAGG          .         .         .         .         .       8700 GluGlnLysSerProSerCysGluGlyArgGlnTyrGlnGlnGlyAspPheMetAsnThr   AlaGluIleAlaLeuLeu GAGCAGAAATCGCCCTCCTGTGAGGGACGGCAGTATCAGCAGGGAGACTTTATGAATACT          .         .         .         .         .         . ProTrpLysAspProAlaAlaGluArgGluLysAsnLeuTyrArgGlnGlnAsnMetAsp CCATGGAAGGACCCAGCAGCAGAAAGGGAGAAAAATTTGTACAGGCAACAAAATATGGAT          .         .         .       8800         .         . AspValAspSerAspAspAspAspGlnValArgValSerValThrProLysValProLeu GATGTAGATTCAGATGATGATGACCAAGTAAGAGTTTCTGTCACACCAAAAGTACCACTA          .         .         .         .         .         . ArgProMetThrHisArgLeuAlaIleAspMetSerHisLeuIleLysThrArgGlyGly AGACCAATGACACATAGATTGGCAATAGATATGTCACATTTAATAAAAACAAGGGGGGGA          .       8900         .         .         .         . LeuGluGlyMetPheTyrSerGluArgArgHisLysIleLeuAsnIleTyrLeuGluLys CTGGAAGGGATGTTTTACAGTGAAAGAAGACATAAAATCTTAAATATATACTTAGAAAAG          .         .         .         .         .       9000 GluGluGlyIleIleAlaAspTrpGlnAsnTyrThrHisGlyProGlyValArgTyrPro GAAGAAGGGATAATTGCAGATTGGCAGAACTACACTCATGGGCCAGGAGTAAGATACCA          .         .         .         .         .         . MetPhePheGlyTrpLeuTrpLysLeuValProValAspValProGlnGluGlyGluAsp ATGTTCTTTGGGTGGCTATGGAAGCTAGTACCAGTAGATGTCCCACAAGAAGGGGAGGAC          .         .         .       9100         .         . ThrGluThrHisCysLeuValHisProAlaGlnThrSerLysPheAspAspProHisGly ACTGAGACTCACTGCTTAGTACATCCAGCACAAACAAGCAAGTTTGATGACCCGCATGGG          .         .         .         .         .         . GluThrLeuValTrpGluPheAspProLeuLeuAlaTyrSerTyrGluAlaPheIleArg GAGACACTAGTCTGGGAGTTTGATCCCTTGCTGGCTTATAGTTACGAGGCTTTTATTCGG          .       9200         .         .         .         . TyrProGluGluPheGlyHisLysSerGlyLeuProGluGluGluTrpLysAlaArgLeu TACCCAGAGGAATTTGGGCACAAGTCAGGCCTGCCAGAGGAAGAGTGGAAGGCGAGACTG          .         .         .         .         .       9300 LysAlaArgGlyIleProPheSer AAAGCAAGAGGAATACCATTTAGTTAAAGACAGGAACAGCTATACTTGGTCAGGGCAGGA          .         .         .         .         .         . AGTAACTAACAGAAACAGCTGAGACTGCAGGGACTTTCCAGAAGGGGCTGTAACCAAGGG          .         .         .       9400         .         . AGGGACATGGGAGGAGCTGGTGGGGAACGCCCTCATATTCTCTGTATAAATATACCCGCT          .         .         .         .         .         . AGCTTGCATTGTACTTCGGTCGCTCTGCGGAGAGGCTGGCAGATTGAGCCCTGGGAGGTT          .       9500         .         .         .         . CTCTCCAGCAGTAGCAGGTAGAGCCTGGGTGTTCCCTGCTAGACTCTCACCAGCACTTGG          .         .         .         .         .       9600 CCGGTGCTGGGCAGACGGCCCCACGCTTGCTTGCTTAAAAACCTCCTTAATAAAGCTGCC          .         .         .         .         .         . AGTTAGAAGCA          .

Example 5 Sequences of the Coding Regions for the Envelope Protein and GAG Product of the ROD HIV-2 Isolate

[0084] Through experimental analysis of the HIV-2 ROD isolate, the following sequences were identified for the regions encoding the env and gag gene products. One of ordinary skill in the art will recognize that the numbering for both gene regions which follow begins for convenience with “1” rather than the corresponding number for its initial nucleotide as given in Example 4, above, in the context of the complete genomic sequence.

[0085] Envelope Sequence 2 MetMetAsnGlnLeuLeuIleAlaIleLeuLeuAlaSerAlaCys ATGATGAATCAGCTGCTTATTGCCATTTTATTAGCTAGTGCTTGC          .         .         .         . LeuValTyrCysThrGlnTyrValThrValPheTyrGlyValPro TTAGTATATTGCACCCAATATGTAACTGTTTTCTATGGCGTACCC     .         .         .         .         . ThrTrpLysAsnAlaThrIleProLeuPheCysAlaThrArgAsn ACGTGGAAAAATGCAACCATTCCCCTGTTTTGTGCAACCAGAAAT        100         .         .         . ArgAspThrTrpGlyThrIleGlnCysLeuProAspAsnAspAsp AGGGATACTTGGGGAACCATACAGTGCTTGCCTGACAATGATGAT     .         .         .         .         . TyrGlnGluIleThrLeuAsnValThrGluAlaPheAspAlaTrp TATCAGGAAATAACTTTGAATGTAACAGAGGCTTTTGATGCATGG          .       200         .         . AsnAsnThrValThrGluGluAlaIleGluAspValTrpHisLeu AATAATACAGTAACAGAACAAGCAATAGAAGATGTCTGGCATCTA     .         .         .         .         . PheGluThrSerIleLysProCysValLysLeuThrProLeuCys TTCGAGACATCAATAAAACCATGTGTCAAACTAACACCTTTATGT          .         .       300         . ValAlaMetLysCysSerSerThrGluSerSerThrGlyAsnAsn GTAGCAATGAAATGCAGCAGCACAGAGAGCAGCACAGGGAACAAC     .         .         .         .         . ThrThrSerLysSerThrSerThrThrThrThrThrProThrAsp ACAACCTCAAAGAGCACAAGCACAACGACAACCACACCCAGAGAC          .         .         .       400 GlnGluGlnGluIleSerGluAspThrProCysAlaArgAlaAsp CAGGAGCAAGAGATAAGTGAGGATACTCCATGCGCACGCGCAGAC     .         .         .         .         . AsnCysSerGlyLeuGlyGluGluGluThrIleAsnCysGlnPhe AACTGCTCAGGATTGGGAGAGGAAGAAACGATCAATTGCCAGTTC          .         .         .         . AsnMetThrGlyLeuGluARgAspLysLysLysGlnTyrAsnGlu AATATGACAGGATTAGAAAGAGATAAGAAAAAAACAGTATAATGAA   500         .         .         .         . ThrTrpTyrSerLysAspValValCysGluThrAsnAsnSerThr ACATGGTACTCAAAAGATGTGGTTTGTGAGACAAATAATAGCACA          .         .         .         . AsnGlnThrGlnCysTyrMetAsnHisCysAsnThrSerValIle AATCAGACCCAGTGTTACATGAACCATTGCAACACATCAGTCATC     .       600         .         .         . ThrGluSerCysAspLysHisTyrTrpAspAlaIleArgPheArg ACAGAATCATGTGACAAGCACTATTGGGATGCTATAAGGTTTAGA          .         .         .         . TyrCysAlaProProGlyTyrAlaLeuLeuArgCysAsnAspThr TACTGTGCACCACGGGTTATGCCCTATTAAGATGTAATGATACC     .        .       700         .         . AsnTyrSerGlyPheAlaProAsncysSerLysValValAlsSer AATTATTCAGGCTTTGCACCCAACTGTTCTAAAGTAGTAGCTTCT          .         .         .         . ThrCysThrArgMetMetGluThrGlnThrSerThrTrpPheGly ACATGCACCAGGATGATGGAAACGCAAACTTCCACATGGTTTGGC     .         .         .       800        . PheAsnGlyThrArgAlaGluAsnArgThrTyrIleTyrTrpHis TTTAATGGCACTAGAGCAGAGAATAGAACATATATCTATTGGCAT          .         .         .         . GlyArgAspAsnArgThrIleIleSerLeuAsnLysTyrTyrAsn GGCAGAGATAATAGAACTATCATCAGCTTAAACAAATATTATAAT     .         .         .         .       900 LeuSerLeuHisCysLysArgProGlyAsnLysThrValLysGln CTCAGTTTGCATTGTAAGAGGCCAGGGAATAAGACAGTGAAACAA          .         .         .         . IleMetLeuMetSerGlyHisValPheHisSerHisTyrGlnPro ATAATGCTTATGTCAGGACATGTGTTTCACTCCCACTACCAGCCG     .         .         .         .         . IleAsnLysArgProArgGlnAlaTrpCysTrpPheLysGlyLys ATCAATAAAAGACCCAGACAAGCATGGTGCTGGTTCAAAGGCAAA       1000         .         .         . TrpLysAspAlaMetGlnGluValLysThrLeuAlaLysHisPro TGGAAAGACGCCATGCAGGAGGTGAAGACCCTTGCAAAACATCCC     .         .         .         .         . ArgTyrArgGlyThrAsnAspThrArgAsnIleSerPheAlaAla AGGTATAGAGGAACCAATGACACAAGGAATATTAGCTTTGCAGCG          .      1100         .         . ProGlyLysGlySerAspProGluValAlaTyrMetTrpThrAsa CCAGGAAAAGGCTCAGACCCAGAAGTAGCATACATGTGGACTAAC     .         .         .         .         . CysArgGlyGluPheLeuTyrCysAsnMetThrTrpPheLeuAsn TGCAGAGGAGAGTTTCTCTACTGCAACATGACTTGGTTCCTCAAT         .         .      1200         . TrpIleGluAsnLysThrHisArgAsnTyrAlaProcysHisIle TGGATAGAGAATAAGACACACCGCAATTATGCACCGTGCCATATA     .         .         .         .         . LysGlnIleIleAsnThrTrpHisLysValGlyArgAsnValTyr AAGCAAATAATTAACACATGGCATAAGGTAGGGAGAAATGTATAT          .         .         .      1300 LeuProProArgGluGlyGluLeuSerCysAsnSerThrValThr TTGCCTCCCAGGGAACGGGAGCTGTCCTGCAACTCAACAGTAACC     .         .         .         .         . SerIleIleAlaAsnIleAspTrpGlnAsnAsnAsnGlnThrAsn AGCATAATTGCTAACATTGACTGGCAAAACAATAATCAGACAAC          .         .         .         . IleThrPheSerAlaGluValAlaGluLeuTyrArgLeuGluLeu ATTACCTTTAGTGCAGAGGTGGCAGAACTATACAGATTGGAGTTG  1400         .         .         .         . GlyAspTyrLysLeuValGluIleThrProIleGlyPheAlaPro GCAGATTATAAATTGGTAGAAATAACACCAATTGGCTTCGCACCT ThrLysGluLysArgTyrSerSerAlaHisGlyArgHisThrArg ACAAAAGAAAAAAGATACTCCTCTGCTCACGGGAGACATACAAGA     .      1500         .         .         . GlyValPheValLeuGlyPheLeuGlyPheLeuAlaThrAlaGly GGTGTGTTCGTGCTAGGGTTCTTGGGTTTTCTCGCAACAGCAGGT          .         .         .         . SerAlaMetGlyAlaArgAlaSerLeuThrValSerAlaGluSer TCTGCAATGGGCGCTCGAGCGTCCCTGACCGTGTCGGCTCAGTCC     .         .      1600         .         . ArgThrLeuLeuAlaGlyIleValGlnGlnGluGlnGluLeuLeu CGGACTTTACTGGCCGGGATAGTGCAGCAACAGCAACAGCTGTTG          .         .         .         . AspValValLysArgGlnGlnGluLeuLeuArgLeuThrValTrp GACGTGGTCAAGAGACAACAAGAACTGTTGCGACTGACCGTCTGG     .         .         .      1700         . GlyThrLysAsnLeuGlnAlaArgValThrAlaIleGluLysTyr GGAACGAAAAACCTCCAGGCAAGAGTCACTGCTATAGAGAAGTAC          .         .         .         . LeuGlnAspGlnAlaArgLeuAsnSerTrpGlyCysAlaPheArg CTACAGGACCAGGCGCGGCTAAATTCATGGGGATGTGCGTTTAGA     .         .         .         .      1800 GlnValCysHisThrThrValProTrpValAsnAspSerLeuAla CAAGTCTGCCACACTACTGTACCATGGGTTAATGATTCCTTAGCA          .         .         .         . ProAspTrpAspAsnMetThrTrpGlnGluTrpGluLysGluVal CCTGACTGGGACAATATGACGTGGCAGGAATGGGAAAAACAAGTC     .         .         .         .         . ArgTyrLeuGluAlaAsnIleSerLysSerLeuGluGlnAlaGln CGCTACCTGGAGGCAAATATCAGTAAAAGTTTAGAACAGGCACAA       1900         .         .         . IleGlnGlnGluLysAsnMetTyrGluLeuGlnLysLeuAsnSer ATTCAGCAAGAGAAAAATATGTATGAACTACAAAAATTAAATAGC     .         .         .         .         . TrpAspIlePheGlyAsnTrpPheAspLeuThrSerTrpValLys TGGGATATTTTTGGCAATTGGTTTGACTTAACCTCCTGGGTCAAG          .      2000         .         . TyrIleGlnTyrGlyValLeuIleIleValAlaValIleAlaLeu TATATTCAATATGGAGTGCTTATAATAGTAGCAGTAATAGCTTTA     .         .         .         .         . ArgIleValIleTyrValValGlnMetLeuSerArgLeuArgLys AGAATAGTGATATATGTAGTACAAATGTTAAGTAGGCTTAGAAAG          .         .      2100         . GlyTyrArgProValPheSerSerProProGlyTyrIleGln*** GGCTATAGGCCTGTTTTCTCTTCCCCCCCCGGTTATATCCAATAG IleHisIleHisLysAspArgGlyGluProAlaAsnGluGluThr ATCCATATCCACAAGGACCGGGGACAGCCAGCCAACGAAGAAACA          .         .         .      2200 GluGluAspGlyGlySerAsnGlyGlyAspArgTyrTrpProTrp GAAGAAGACGGTGGAAGCAACGGTGGAGACAGATACTGGCCCTGG     .         .         .         .         . ProIleAlaTyrIleHisPheLeuIleArgGlnLeuIleArgLeu GCGATAGCATATATACATTTCCTGATCCGCCAGCTGATTCGCCTC          .         .         .         . LeuThrArgLeuTyrSerIleCysArgAspLeuLeuSerArgSer TTGACCAGACTATACAGCATCTGCAGGGACTTACTATCCAGGAGC  2300         .         .         .         . PheLeuThrLeuGluLeuIleTyrGlnAsnLeuArgAspTrpLeu TTCCTGACCCTCCAACTCATCTACCAGAATCTCAGAGACTGGCTG          .         .         .         . ArgLeuArgThrAlaPheLeuGlnTyrGlyCysGluTrpIleGln AGACTTAGAACAGCCTTCTTGCAATATGGGTGCGAGTGGATCCAA     .      2400         .         .         . GluAlaPheGlnAlaAlaAlaArgAlaThrArgGluThrLeuAla GAAGCATTCCAGGCCGCCGCGAGGGCTACAAGAGAGACTCTTGCG          .         .         .         . GlyAlaCysArgGlyLeuTrpArgValLeuGluArgIleGlyArg GGCGCGTGCAGGGGCTTGTGGAGGGTATTGGAACGAATCGGGACG          .         .      2500         .         . GlyIleLeuAlaValProArgARgIleArgGlnGlyAlaGluIle GGAATACTCGCGGTTCCAAGAAGGATCAGACAGGGAGCAGAAATC          .         .         .         . AlaLeuLeu***GlyThrAlaValSerAlaGlyArgLeuTyrGlu GCCCTCCTGTGAGGGACGGCAGTATCAGCAGGGAGACTTTATGAA     .         .         .      2600         . TyrSerMetGluGlyProSerSerArgLysGlyGluLysPheVal TACTCCATGGAAGGACCCAGCAGCAGAAAGGGAGAAAAATTTGTA          .         .         .         . GlnAlaThrLysTyrGly CAGGCAACAAAATATGGA     .         . MetGlyAlaArgAsnSerValLeuArgGlyLysLysAlaAspGlu ATGGGCGCGAGAAACTCCGTCTTGAGAGGGAAAAAAGCAGATGAA          .         .         .         . LeuGluArgIleArgLeuArgProGlyGlyLysLysLysTyrArg TTAGAAAGAATCAGGTTACGGCCCGGCGGAAAGAAAAAGTACAGG     .         .         .         .         . LeuLysHisIleValTrpAlaAlaAsnLysLeuAspArgPheGly CTAAAACATATTGTGTGGGCAGCGAATAAATTGCACAGATTCGGA        100         .         .         . LeuAlaGluSerLeuLeuGluSerLysGluGlyCysGlnLysIle TTAGCAGAGAGCCTGTTGGAGTCAAAAGAGGGTTGTCAAAAAATT     .         .         .         . LeuThrValLeuAspProMetValProThrGlySerGluAsnLeu CTTACAGTTTTAGATCCAATGGTACCGACAGGTTCAGAAAATTTA          .       200         .         . LysSerLeuPheAsnThrValCysValIleTrpCysIleHisAla AAAAGTCTTTTTAATACTGTCTGCGTCATTTGGTGCATACAGGCA     .         .         .         .         . GluGluLysValLysAspThrGluGlyAlaLysGlnIleValArg GAAGAGAAAGTGAAAGATACTGAAGGAGCAAAACAAATAGTGCGG          .         .       300         . ArgHisLeuValAlaGluThrGlyThrAlaGluLysMetProSer AGACATCTAGTGGCAGAAACAGGAACTGCAGAGAAAATGCCAAGG     .         .         .         . ThrSerArgProThrAlaProSerSerGluLysGlyGlyAsnTyr ACAAGTAGACCAACAGCACCATCTAGCGAGAAGGGAGGAAATTAC         .         .         .       400 ProValGlnHisValGlyGlyAsnTyrThrHisIleProLeuSer CCAGTGCAACATGTAGGCGGCAACTACACCCATATACCGCTGACT     .         .         .         .         . ProArgThrLeuAsnAlaTrpValLysLeuValGluGluLysLys CCCCGAACCCTAAATGCCTGGGTAAAATTAGTAGAGGAAAAAAAG          .         .         .         . PheGlyAlaGluValValProGlyPheGlnAlaLeuSerGluGly TTCGGGGCAGAAGTAGTGCCAGGATTTCAGGCACTCTCAGAAGGC   500         .         .         .         . CysThrProTyrAspIleAsnGlnMetLeuAsnCysValGlyAsp TGCACGCCCTATGATATCAACCAAATGCTTAATTGTGTGGGCGAC          .         .         .         . HisGlnAlaAlaMetGlnIleIleArgGluIleIleAsnGluGlu CATCAAGCAGCCATGCAGATAATCAGGGAGATTATCAATGAGGAA     .       600         .         .         . AlaAlaGluTrpAspValGlnHisProIleProGlyProLeuPro GCAGCAGAATGGGATGTGCAACATCCAATACCAGGCCCCTTACCA          .         .         .         . AlaGlyGlnLeuArgGluProArgGlySerAspIleAlaGlyThr GCGGGGCAGCTTAGAGAGCCAAGGGGATCTGACATAGCAGGGACA     .         .       700         .         . ThrSerThrValGluGluGlnIleGlnTrpMetPheArgProGln ACAAGCACAGTAGAAGAACAGATCCAGTGGATGTTTAGGCCAGAA AsnProValProValGlyAsnIleTyrArgArgTrpIleGlnIle AATCCTGTACCAGTAGGAAACATCTATAGAAGATGGATCCAGATA     .         .         .       800         . GlyLeuGlnLysCysValARgMetTyrAsnProThrAsnIleLeu GGATTGCAGAAGTGTGTCAGGATGTACAACCCGACCAACATCCTA          .         .         .         .         . AspIleLysGlnGlyProLysGluProPheGlnSerTyrValAsp GACATAAAACAGGGACCAAAGGAGCCGTTCCAAAGCTATGTAGAT     .         .         .         .      900 ArgPheTyrLysSerLeuArgAlaGluGlnThrAspProAlaVal AGATTCTACAAAAGCTTGAGGGCAGAACAAACAGATCCAGCAGTG          .         .         .         . LysAsnTrpMetThrGlnThrLeuLeuValGlnAsnAlaAsnPro AAGAATTGGATGACCCAAACACTGCTAGTACAAAATGCCAACGCA     .         .         .         .         . AspCysLysLeuValLeuLysGlyLeuGlyMetAsnProThrLeu GACTGTAAATTAGTGCTAAAAGGACTAGGGATGAACCCTACCTTA       1000         .         .         . GluGluMetLeuThrAlacysGlnGlyValGlyGlyProGlyGln GAAGAGATGCTGACCGCCTGTCAGGGGGTAGGTGGGCCAGGCCAG     .         .         .         .         . LysAlaArgLeuMetAlaGluAlaLeuLysGluValIleGlyPro AAAGCTAGATTAATGGCAGAGGCCCTGAAAGAGGTCATAGGACCT          .      1100         .         . AlaProIleProPheALaAlaAlaGlnGlnArgLysAlaPheLys GCCCCTATCCCATTCGCAGCAGCCCAGGAGAGAAAGGCATTTAAA     .         .         .         .         . CysTrpAsnCysGlyLysGluGlyHisSerAlaArgGlnCysArg TGCTGGAACTGTGGAAAGGAAGGGCACTCGGCAAGACAATGCCGA          .         .       1200         . AlaProArgARgGlnGlyCysTrpLysCysGlyLysProGlyHis GCACCTAGAAGGCAGGGCTGCTGGAAGTGTGGTAAGCCAGGACAC     .         .         .         .         . IleMetThrAsnCysProAspArgGlnAlaGlyPheLeuGlyLeu ATCATGACAAACTGCCCAGATAGACAGGCAGGTTTTTTAGGACTG          .         .         .       1300 GlyProTrpGlyLysLysProArgAsnPheProValAlaGlnVal GGCCCTTGGGGAAAGAAGCCCCGCAACTTCCCCGTGGCCCAAGTT     .         .         .         .         . ProGlnGlyLeuThrProThrAlaProProValAspProAlaVal CCGCAGGGGCTGACACCAACAGCACCCCCAGTGGATCCAGCAGTG          .         .         .         . AspLeuLeuGluLysTyrMetGlnGlnGlyLysArgGlnArgGlu GATCTACTGGAGAAATATATGCAGCAAGGGAAAAGACAGAGAGAG  1400         .         .         .         . GlnArgGluArgProTyrLysGluValThrGluAspLeuLeuHis CAGAGAGAGAGACCATACAAGGAAGTGACAGAGGACTTACTGCAC          .         .         .         . LeuGluGlnGlyGluThrProTyrArgGluProProThrGluAsp CTCGAGCAGGGGGAGACACCATACAGGGAGCCACCAACAGAGGAC     .       1500         .         .         . LeuLeuHisLeuAsnSerLeuPheGlyLysAspGln TTGCTGCACCTCAATTCTCTCTTTGGAAAAGACCAG          .         .         .

Example 6 Peptide Sequences Encoded by the ENV and GAG Genes

[0086] The following coding regions for antigenic peptides, identified for convenience only by the nucleotide numbers of Example 5, within the env and gag gene regions are of particular interest. 3 envl (1732-1809)                       ArgValThrAlaIleGluLysTyr                       AGAGTCACTGCTATAGAGAAGTAC                               .         . LeuGluAspGlnAlaArgLeuAsnSerTrpGlyCysAlaPheArg CTACAGGACCAGGCGCGGCTAAATTCATGGGGATGTGCGTTTAGA     .         .         .         .      1    GlnValCys CAAGTCTGC env2 (1912-1983)                       SerLysSerLeuGluGlnAlaGln                       AGTAAAAGTTTAGAACAGGCACAA                               .         . IleGlnGlnGluLysAsnMetTyrGluLeuGlnLysLeuAsnSer ATTCAGCAAGAGAAAAATATGTATGAACTACAAAAATTAAATAGC  1940          .         .         .         . Trp TGG env3 (1482-1530) Pro ThrLysGluLysArgTyrSerSerAlaHisGlyArgHisThrArg CCT ACAAAAGAAAAAAGATACTCCTCTGCTCACGGGAGACATACAAGA         .      1500         .         .         . env4 (55-129)          CysThrGlnTyrValThrValPheTyrGlyValPro          TGCACCCAATATGTAACTGTTTTCTATGGCGTACCC                .         .         .         . ThrTrpLysAsnAlaThrIleProLeuPheCysAlaThr ACGTGGAAAAATGCAACCATTCCCCTCTTTTGTGCAACC       100         .         . env5 (175-231)                                         AspAsp                                         GATGAT                                              . TyrGluGluIleThrLeuAsnValThrGluAlaPheAspAlaTrp TATCAGGAAATAACTTTGAATGTAACAGAGGCTTTTGATGCATGG         .       200         .         .      AsnAsn AATAAT env6 (274-330)    GluThrSerIleLysProCysValLysLeuThrProLeuCys    GAGACATCAATAAACCATGTGTGAAACTAACACCTTTATGT          .         .       300         . ValAlaMetLysCys GTAGCAATGAAATGC     .         . env7 (607-660)                      AsnHisCysAsnThrSerValIle                      AACCATTGCAACACATCAGTCATC                       610         .         . ThrGluSerCysAspLysHisTyrTrpAsp ACAGAATCATGTGACAAGCACTATTGGGAT          .         .         . env8 (661-720)                               AlaIleArgPheArg                               GCTATAAGGTTTAGA                                         . TyrCysAlaProProGlyTyrAlaLeuLeuArgCysAsnAspThr TACTGTGCACCACCGGGTTATGCCCTATTAAGATGTAATGATACC     .         .       700         .        . env9 (997-1044)       LysArgProArgGlnAlaTrpCysTrpPheLysGlyLys       AAAAGACCCAGACAAGCATGGTGCTGGTTCAAAGGCAAA       1000         .         .          . TrpLysAsp TGGAAAGAC env10 (1132-1215)       LysGlySerAspProGluValAlaTyrMetTrpThrAsa       AAAGGCTCAGACCCAGAAGTAGCATACATGTGGACTAAC              .       .         .         . CysArgGlyGluPheLeuTyrCysAsnMetThrTrpPheLeuAsn TGCAGAGGACACTTTTFTFTACTGCAACATGACTTGGTTCCTCAAT          .         .       1200        . env11 (1237-1305)                      ArgAsnTyrAlaProCysHisIle                      CGCAATTATGCACCGTGCCATATA                         .         .         . LysGlnIleIleAsnThrTrpHisLysValGlyArgAsnValTyr AAGCAAATAATTAACACATGGCATAAGGTAGGGAGAAATGTATAT          .         .         .      1300 GAG1 (991-1053) AspCysLysLeuValLeuLysGlyLeuGlyMetAsnProThrLeu GACTGTAAATTAGTGCTAAAAGGACTAGGGATGAACCCTACCTTA       1000         .         .         . GluGluMetLeuThrAla GAAGAGATGCTGACCGCC

[0087] Of the foregoing peptides, env1, env2, env3 and gag1 are particularly contemnplated for diagnostic purposes, and env4, env5, env6, env7, env8, env9, env10 and env11 are particularly, contemplated as protecting agents. These peptides have been selected in part because of their sequence homology to certain of the envelope and gag protein products of other of the retroviruses in the HIV group. For vaccinating purposes, the foregoing peptides may be coupled to a carrier protein by utilizing suitable and well known techniques to enhance the host's immune response. Adjuvants such as calcium phosphate or alum hydroxide may also be added. The foregoing peptides can be synthesized by conventional protein synthesis techniques, such as that of Merrifield.

[0088] It will be apparent to those skilled in the art that various modifications and variations can be made in the processes and products of the present invention. Thus, it is intended that the present application cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents. For convenience in interpreting the following claims, the following table sets forth the correspondence between codon codes and amino acids and the correspondence between three-letter and one-letter amino acid symbols. 4            DNA CODON      AMINO ACID 3 LET.  AMINO ACID 1 LET. -------------------------------------------------------------- :   : \2:  T   C   A   G  :  T   C   A   G  :  T   C   A   G  : : 1 : 3\:                 :                 :                 : -------------------------------------------------------------- :   : T : TTT TCT TAT TGT : PHE SER TYR CYS :  F   S   Y   C  : : T : C : TTC TCC TAC TGC : PHE SER TYR CYS :  F   S   Y   C  : :   : A : TTA TCA TAA TGA : LEU SER *** *** :  L   S   *   *  : :   : G : TTG TCG TAG TCG : LEU SER III TRP :  L   S   *   W  : -------------------------------------------------------------- :   : T : CTT CCT CAT CGT : LEU PRO HIS ARG :  L   P   H   R : : C : C : CTC CCC CAC CGC : LEU PRO HIS ARG :  L   P   H   R  : :   : A : CTA CCA CAA CGA : LEU PRO GLN ARG :  L   P   Q   R  : :   : G : CTG CCG CAG CCG : LEU PRO GLN ARG :  L   P   Q   R  : -------------------------------------------------------------- :   : T : ATT ACT AAT AGT : ILE THR ASN SER :  I   T   N   S  : : A : C : ATC ACC AAC AGC : ILE THR ASN SER :  I   T   N   S  : :   : A : ATA ACA AAA AGA : ILE THR LYS ARG :  I   T   K   R  : :   : G : ATG ACG AAG AGG : MET THR LYS ARG :  M   T   K   R  : -------------------------------------------------------------- :   : T : GTT GCT GAT GGT : VAL ALA ASP GLY :  V   A   D   G  : : G : C : GTC GCC GAC GGC : VAL ALA ASP GLY :  V   A   D   G  : :   : A : GTA GCA GAA GGA : VAL ALA GLY GLY :  V   A   E   G  : :   : G : GTG GCG GAG GGG : VAL ALA GLU GLY :  V   A   E   G  : -------------------------------------------------------------- 3 Letter 1 Letter CODONS ALA A GCT GCC CGA GCG ARG R CGT CGC CGA CGG AGA AGG ASN N AAT AAC ASP O GAT GAC CYS C TGT TGC GLN Q CAA CAG GLU E GAA CAG GLY G GGT GGC CGA CCG HIS H CAT CAC ILE I ATT ATC ATA LEU L CTT CTC CTA CTG TTA TTG LYS K AAA AAG MET M ATG PHE F TTT TTC PRO P CCT CCC CCA CCG SER S TCT TCC TCA TCG AGT AGC THR T ACT ACC ACA ACG TRP W TGG TYR Y TAT TAC VAL V GTT GTC GTA GTG *** * TAA TAG TGA

Claims

1. A method for diagnosing an HIV-2 infection which comprises:

(a) contacting genetic DNA or RNA from a body sample obtained from a person suspected of having an HIV-2 infection with a DNA probe derived from at least a portion of the genome of the HIV-2 virus; and
(b) determining whether a hybridized complex is created.

2. The method of claim 1 wherein said body sample is selected from the group consisting of tissue, blood cells, cells and body fluids.

3. The method of claim 1 wherein the presence of the hybridized complex is determined by a process selected from the group consisting of Southern blot, Northern blot and dot blot.

4. The method of claim 1 wherein the cDNA probe is analogous to the entire genome of the HIV-2 virus.

5. A DNA probe capable of hybridizing to the entire genome of the HIV-2 virus.

6. A method for diagnosing an HIV-2 infection which comprises:

(a) contacting sera obtained from a patient suspected of having an HIV-2 infection with a polypeptide expression product of a DNA segment derived from the genome of the HIV-2 virus; and
(b) determing whether an immunocomplex is formed.

7. The method of claim 6 wherein the formation of the immunocomplex is determined by a process selected from the group consisting of radioimmunoassays (RIA), radioimmunoprecipitation assays (RIPA), immunofluoresence assays (IFA), enzyme-linked immunosorbent assays (ELISA) and Western blots.

8. A process for detecting the presence of a virus selected from the group consisting of LAV-II, HIV-2, STLV-III and other viruses which form complexes with LAV-II reagents comprising:

(a) contacting DNA or RNA from a sample suspected of containing viral genetic material with a DNA probe derived from a portion of the genome of the HIV-2 virus; and
(b) determining whether a hybridized complex is created.

9. A peptide selected from the group consisting of env1, env2, env3, env4, env5, env6, env7, env8, env9, env10, env11 and gag1.

10. A kit for diagnosing an HIV-2 infection by the method of claim 6 and comprising env1, env2, env3 and gag1 peptides as the polypeptide expression product.

11. A vaccinating agent comprising at least one peptide selected from the group consisting of env4, env5, env6, env7, env8, env9, env10 and env11 in admixture with suitable carriers.

12. A peptide having common immunological properties with the peptide structure of the envelope glycoprotein of a virus of the HIV-2 class, said peptide having no more than 40 amino acid residues.

13. A peptide according to claim 12 having either of the following formulas:

5 XR--A-E-D-YL-DQ--L-WGC-----CZ    XA-E-D-YL-DZ
in which X and Z are OH or NH2 or, to the extent that the immunological properties of the natural peptides lacking these groups shall not be essentially modified, the groups having from one to five amino acid residues, and each of the hyphens corresponding to an aminoacyl residue chosen from those which permit the conservation for the peptide characterized above of the immunological properties of either of the following peptide sequences:
6 RVTAIEKYLQDQARLNSWGCAFRQVC    AIEKYLQDQ

14. A peptide according to claim 12 having either of the following formulas:

7 X--E--Q-QQEKN--EL--L---Z      XQ-QQEKNZ
in which X and Z are OH or NH2 or, to the extent that the immunological properties of the natural peptides lacking these groups shall not be essentially modified, the groups having from one to five amino acid residues, and each of the hyphens corresponding to an aminoacyl residue chosen from those which permit the conservation for the peptide characterized above of the immunological properties of either of the following peptide sequences:
8 SLEQAQIQQEKNMYELQKLNSW      QIQQEKN

15. A peptide according to claim 12 characterized as having either of the following formulas

9 XEL--YK-V-I-P-G-APTK-KR-----Z     XYK-V-I-P-G-APTK-KRZ
in which X and Z are OH or NH2 or, to the extent that the immunological properties of the natural peptides lacking these groups shall not be essentially modified, the groups having from one to five amino acid residues, and each of the hyphens corresponding to an aminoacyl residue chosen from those which permit the conservation for the peptide characterized above of the immunological properties of either of the following peptide sequences:
10 ELGDYKLVEITPIGFAPTKEKRYSSAH     YKLVEITPIGFAPTKEK

16. A peptide according to claim 12 characterized as having either of the following formulas:

11 X----VTV-YGVP-WK-AT--LPCA-Z     XVTV-YGVP-WK-ATZ
in which X and Z are OH or NH2 or, to the extent that the immunological properties of the natural peptides lacking these groups shall not be essentially modified, the groups having from one to five amino acid residues, and each of the hyphens corresponding to an aminoacyl residue chosen from those which permit the conservation for the peptide characterized above of the immunological properties of one of the following peptide sequences:
12 CTQYVTVFYGVPTWKNATIPLFCAT     VTVFYGVPTWKNAT EKLWVTVYYGVPVWKEATTTLFCAS     VTVYYGVPVWKEAT

17. A peptide according to claim 16 characterized as having one of the following formulas:

13 CTQYVTVFYGVPTWKNATIPLFCAT     VTVFYGVPTWKNAT EKLWVTVYYGVPVWKEATTTLFCAS     VTVYYGVPVWKEAT EDLWVTVYYGVPVWKEATTTLFCAS     VTVYYGVPVWKEAT DNLWVTVYYGVPVWKEATTTLFCAS     VTVYYGVPVWKEAT

18. A peptide according to claim 12 characterized as having either of the following formulas:

14 X---QE--L-NVTE-F--W-NZ         XL-NVTE-FZ
in which X and Z are OH or NH2 or, to the extent that the immunological properties of the natural peptides lacking these groups shall not be essentially modified, the groups having from one to five amino acid residues, and each of the hyphens corresponding to an aminoacyl residue chosen from those which permit the conservation for the peptide characterized above of the immunological properties of one of the following peptide sequences:
15 DDYQEITL-NVTEAFDAWNN        L-NVTE PNPQEVVLVNVTENFNMWKN        LVNVTE

19. A peptide according to claim 18 characterized as having one of the following formulas:

16 DDYQEITL-NVTEAFDAWNN        L-NVTEAF PNPQEVVLVNVTENFNMWKN        LVNVTENF PNPQEIELENVTEGFNMWKN        LENVTEGF PNPQEIALENVTENFNMWKN        LENVTENF

20. A peptide according to claim 12 characterized as having one of the following formulas:

17 XL---S-KPCVKLTPLCV--KZ       XKPCVKLTPLCVZ     XS-KPCVKLTPLCVZ
in which X and Z are OH or NH2 or, to the extent that the immunological properties of the natural peptides lacking these groups shall not be essentially modified, the groups having from one to five amino acid residues, and each of the hyphens corresponding to an aminoacyl residue chosen from those which permit the conservation for the peptide characterized above of the immunological properties of one of the following peptide sequences:
18 ETSIKPCVKLTPLCVAMK DQSLKPCVKLTPLCVSLK     KPCVKLTPLCV   SLKPCVKLTPLCV

21. A peptide according to claim 20 characterized as having one of the following formulas:

19 ETSIKPCVKLTPLCVAMK DQSLKPCVKLTPLCVSLK DQSLKPCVKLTPLCVTLN      PCVKLTPLC

22. A peptide characterized as having either of the following formulas:

20 X---N-S-IT--C-Z    XN-S-ITZ
in which X and Z are OH or NH2 or, to the extent that the immunological properties of the natural peptides lacking these groups shall not be essentially modified, the groups having from one to five amino acid residues, and each of the hyphens corresponding to an aminoacyl residue chosen from those which permit the conservation for the peptide characterized above of the immunological properties of one of the following peptide sequences:
21 NHCNTSVITESCD    NTSVIT TSCNTSVITQACP    NTSAIT

23. A peptide according to claim 22 characterized as having one of the following formulas:

22 NHCNTSVITESCD    NTSVIT TSCNTSVITQACP    NTSVIT INCNTSVITQACP    NTSVIT INCNTSAITQACP    NTSAIT

24. A peptide according to claim according to claim 12 characterized as having the following formula:

XYC-P-G-A-L-C-N-TZ
in which X and Z are OH or NH2 or, to the extent that the immunological properties of the natural peptides lacking these groups shall not be essentially modified, the groups having from one to five amino acid residues, and each of the hyphens corresponding to an aminoacyl residue chosen from those which permit the conservation for the peptide characterized above of the immunological properties of either of the following peptide sequences:
23 YCAPPGYALLRC-NDT YCAPAGFAILKCNNKT

25. A peptide according to claim 24 characterized as having one of the following formulas:

24 YCAPPGYALLRC-NDT YCAPAGFAILKCNNKT
25 YCAPAGFAILKCNDKK YCAPAGFAILKCRDKK

26. A peptide according to claim 12 characterized as having the following formula:

X------A-C------W--Z
in which X and Z are OH or NH2 or, to the extent that the immunological properties of the natural peptides lacking these groups shall not be essentially modified, the groups having from one to five amino acid residues, and each of the hyphens corresponding to an aminoacyl residue chosen from those which permit the conservation for the peptide characterized above of the immunological properties of either of the following peptide sequences:
26 NKRPRQAWCWFKG-KWKD N--MRQAHCNISRAKWNA

27. A peptide according to claim 26 characterized as having one of the following formulas:

27 NKRPRQAWCWFKG-KWKT N--MRQAHCNISRAKWNA D--IRRAYCTINETEWDK I--IGQAHCNISRAQWSK

28. A peptide according to claim 12 characterized as having either of the following formulas:

28 X-G-DPE------NC-GEF-YCN-----NZ             XNC-GEF-YCNZ
in which X and Z are OH or NH2 or, to the extent that the immunological properties of the natural peptides lacking these groups shall not be essentially modified, the groups having from one to five amino acid residues, and each of the hyphens corresponding to an aminoacyl residue chosen from those which permit the conservation for the peptide characterized above of the immunological properties of one of the following peptide sequences:
29 KGSDPEVAYMWTNCRGEFLYCNMTWFLN             NCRGEFLYCN -GGDPEIVTHSFNCGGEFFYCNSTQLFN             NCGGEFFYCN

29. A peptide according to claim 28 characterized as having one of the following formulas:

30 KGSDPEVAYMWTNCRGEFLYCNMTWFLN             NCRGEFLYCN -GGDPEIVTHSFNCGGEFFYCNSTQLFN             NCGGEFFYCN -GGDPEITTHSFNCRGEFFYCNTSKLFN             NCRGEFFYCN -GGDPEITTHSFNCGGEFFYCNTSGLFN             NCGGEFFYCN

30. A peptide according to claim 12 characterized as having either of the following formulas:

31 X-----C-IKQ-I------G---YZ      XC-IKQ-IZ
in which X and Z are OH or NH2 or, to the extent that the immunological properties of the natural peptides lacking these groups shall not be essentially modified, the groups having from one to five amino acid residues, and each of the hyphens corresponding to an aminoacyl residue chosen from those which permit the conservation for the peptide characterized above of the immunological properties of one of the following peptide sequences:
32 RNYAPCHIKQIINTWHKVGRNVY      CHIKQII TITLPCRIKQFINMWQEVGKAMY      CRIKQFI

31. A peptide according to claim 30 characterized as having one of the following formulas:

33 RNYAPCHIKQIINTWHKVGRNVY      CHIKQII TITLPCRIKQFINMWQEVGKAMY      CRIKQFI SITLPCRIKQIINMWQKTCKAMY      CRIKQII NITLQCRIKQIIKMVAGR-KAIY      CRIKQII

32. The antigenic peptide gag1 characterized as having the following formula:

XNCKLVLKGLGMNPTLEEMLTAZ
in which X and Z are OH or NH2 or, to the extent that the immunological properties of the natural peptides lacking these groups shall not be essentially modified, the groups having from one to five amino acid residues, and each of the hyphens corresponding to an aminoacyl residue chosen from those which permit the conservation for the peptide characterized above of the immunological properties of the following peptide sequence:
XNCKLVLKGLGMNPTLEEMLTA

33. An antigenic composition containing at least one gag1 peptide according to claim 32 or at least an oligomer of this peptide, characterized as having the capacity to be recognized by human biological fluids such as serum containing anti-HIV-2 antibodies and under appropriate conditions anti-HIV-1 antibodies.

34. An antigenic composition containing at least one peptide according to claims 13, 14 or 15, or at least an oligomer of the peptide, characterized in that the peptide specifically recognizes the presence of anti-HIV-2 antibodies.

35. An immunogenic composition containing at least one peptide according to any one of the claims 16-31 or at least an oligomer of the peptide or the peptide conjugated with a carrier molecule, in association with an acceptable pharmaceutical vehicle for the production of vaccines, the composition characterized in that it induces antibody production against the peptide in sufficient quantities to form an effective immunocomplex with the entire HIV-2 retrovirus and its corresponding proteins.

36. An immunogenic composition according to claim 35 further comprising peptides having formulas corresponding to the envelope glycloprotein sequences of HIV-1 and HIV-2 which have an amino acid homology greater than 50%.

37. An immunogenic composition according to either of claims 35 or 36 having at least one peptide or at least an oligomer of the peptide or the peptide conjugated with a carrier molecule, the composition coresponding to a peptide chosen from the group consisting of Env4, Env5, Env6 and Env10.

38. A procedure for the in vitro diagnosis of HIV-2 infections in a biological fluid, comprising:

contacting the biological fluid with at least one peptide according to claims 12, 13, 14, 15 or 32, or a conjugate of the peptide with a carrier molecule;
detecting the eventual presence in the biological fluid of an antigen-antibody complex by physical or chemical methods.

39. The diagnostic procedure of claim 38, wherein the detection step is performed by a test selected by the group consisting of enzyme-linked immuno absorbent assay (ELISA), immunofluoresence assay (IFA), radioimmunoassay (RIA), and radioimmunoprecipitation assay (RIPIA).

40. A kit for the in vitro diagnosis of an HIV-2 infection in a biological fluid comprising:

a peptide composition containing a peptide according to claims 12, 13, 14, 15 or 32, or a mixture of such peptides, or a conjugate of such peptides with a carrier molecule;
an appropriate reaction environment for the production of an antigen-antibody complex;
one or more reagents adapted for the detection of the formation of antigen-antibody complexes; and
a biological fluid as a reference sample having no antibodies recognized by said peptide composition.

41. An protein selected from the group described in Example 4 consisting of p 16, p 26, p 12, polymerase, Q protein, R protein, X protein, Y protein, env protein, F protein, TAT, ART, U5 and U3.

42. A kit for diagnosing an HIV-2 infection by the method of claim 6 and comprising as the polypeptide expression product a protein of claim 41.

43. A vaccinating agent comprising at least one protein of claim 41 in association with appropriate carriers.

Patent History
Publication number: 20030091985
Type: Application
Filed: Nov 19, 2001
Publication Date: May 15, 2003
Applicant: Institut Pasteur
Inventors: Marc Alizon (Paris), Luc Montagnier (Le Plessis Robinson), Denise Guetard (Paris), Francois Clavel (Rockville, MD), Pierre Sonigo (Paris), Mireille Guyader (Toulouse)
Application Number: 09988213
Classifications
Current U.S. Class: Involving Virus Or Bacteriophage (435/5); 435/6; Dna Or Rna Fragments Or Modified Forms Thereof (e.g., Genes, Etc.) (536/23.1)
International Classification: C12Q001/70; C12Q001/68; C07H021/02;