Method for enhancing long-term memory in a subject and uses thereof
The present invention provides for a method to enhance long-term memory in a subject whose cAMP-responsive gene expression is repressed due to binding of a cAMP-response-element-binding-protein-2 to a protein or a DNA associated with cAMP-responsive gene expression, or both, which comprises administering to the subject a compound capable of interfering with such binding in an amount effective to interfere with binding of the protein or the DNA so as to thereby derepress cAMP-responsive gene expression in the subject and enhance the subject's long-term memory.
Latest The Trustees of Columbia University Patents:
- Methods of treating RBP4 related diseases with triazolopyridines
- Beam steering and receiving method based on an optical switch array
- Short TAT oligomers for drug delivery
- NOVEL COMPOUNDS COMPRISING A NEW CLASS OF TRANSTHYRETIN LIGANDS FOR TREATMENT OF COMMON AGE-RELATED COMORBIDITIES
- OXA-IBOGAINE ANALOGUES FOR TREATMENT OF SUBSTANCE USE DISORDERS
The invention disclosed herein was made with Government support under Grants No. MH37134 and GM32099 from NIH. Accordingly, the U.S. Government has certain rights in this invention.
BACKGROUND OF THE INVENTIONThroughout this application, various publications are referenced by author and date. Full citations for these publications may be found listed alphabetically at the end of the specification immediately preceding Sequence Listing and the claims. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art as known to those skilled therein as of the date of the invention described and claimed herein.
INTRODUCTIONMemory acquisition has at least two components, a transient short-term memory lasting minutes to hours that can be followed by a more persistent and self-maintained long-term memory lasting days to years. Whereas short-term memory requires only covalent modifications of preexisting proteins, long-term memory requires the synthesis of new mRNA and proteins (Flexner et al., 1963; Davis and Squire, 1984; Montarolo et al., 1986) and is accompanied by the growth of new synaptic connections (Bailey and Kandel, 1993).
The switch from short- to long-term memory can be studied on the molecular level in the gill-withdrawal reflex of the marine snail Aplysia. Following a single noxious stimulus to the tail, the animal acquires a short-term memory for the noxious stimulus lasting minutes, during which time both the amplitude and the duration of the gill-withdrawal reflex to tactile stimulation of the siphon is greatly enhanced (Pinsker et al., 1970; Carew et al., 1971). Following five or more spaced sensitizing stimuli, the animal acquires a long-term memory lasting days or weeks (Carew et al., 1972; Pinsker et al., 1973). The short-term memory does not require new protein synthesis, whereas long-term memory is blocked by inhibitors of protein and RNA synthesis (Montarolo et al., 1986; Castellucci et al., 1989; Bailey et al., 1992).
A cellular representation of both types of memeory storage can be studied in cocultures of a single sensory neuron and a single motor neuron of the gill withdrawal reflex. Here one brief application of 5-HT, a modulatory transmitter released in vivo by interneurons activated by sensitizing tail stimuli, produces short-term facilitation that results from a strengthening of preexisting synaptic connections between the sensory and motor cell by means of covalent modifications of preexisting proteins (Montarolo et al., 1986; Rayport and Schacher, 1986). By contrast, five applications of 5-HT, spaced by 20 min, produce long-term facilitation that lasts for more than one day, is dependent on the synthesis of mRNA and protein, and is accompanied by an increase in the number of sensory neuron synaptic terminal varicosities in contact with the motor neuron (Montarolo et al., 1986; Glanzman et al., 1990; Bailey et al., 1992).
SUMMARY OF THE INVENTIONThe present invention provides for a method to enhance long-term memory in a subject whose cAMP-responsive gene expression is repressed due to binding of a cAMP-response-element-binding-protein-2 to a protein or a DNA associated with cAMP-responsive gene expression, or both, which comprises administering to the subject a compound capable of interfering with such binding in an amount effective to interfere with binding of the protein or the DNA so as to thereby derepress cAMP-responsive gene expression in the subject and enhance the subject's long-term memory.
BRIEF DESCRIPTION OF THE FIGURES
(A) The predicted amino acid sequence of ApCREB-2 deduced from two independent clones isolated by a yeast two-hybrid screen of an Aplysia CNS cDNA library. The bZIP domain that interacts with ApC/EBP is boxed and labeled I. Within this domain, hydrophobic residues of the leucine zipper motif are shaded. The box labeled II delineates a second leucine heptad repeat. ApCREB-2 contains a consensus sequence for PKC phosphorylation (aa 271-274, bold, underlined). In addition, ApCREB-2 has putative consensus sequences for MAP kinase in similar positions to those in human CREB-2 and mouse ATF-4 (aa 235-238 and aa 150-153, italics, underlined). (SEQ ID NO 1) This sequence and ApCREB-2 cDNA sequence were deposited in GenBank. See deposit information hereinbelow.
(
(
(
(
ApCREB-2 is expressed in the Aplysia central nervous system and migrates on SDS-PAGE as multiple bands with an apparent molecular weight of around 50 kD.
(
(
Unlike ApC/EBP mRNA, ApCREB-2 and ApCREB-1 mRNAs are constitutively expressed in the Aplysia central nervous system, and their steady-state level is not affected by exposure to 5-HT in vivo.
(
(
(
(
(
(
(
(
(
(
(
(
(
(
(
For the functional changes, the height of each bar is the mean±SEM of the percent change in the amplitude of the EPSP induced in motor neuron L7 following a single pulse of 5-HT and retested 24 hr later. For the structural changes, the height of each bar represents the mean±SEM of the percent change in the number of fluorescent varicosities per sensory neuron reexamined 24 hr after one pulse of 5-HT.
Injection of the ApCREB-2 antiserum paired with one pulse of 5-HT results 24 hr later in a significant enhancement of the EPSP amplitude and a concomitant significant increase in the number of varicosities.
The fluorescent micrographs taken from the same regions of sensory neurites contacting the axon hillock of L7 before (1 and 3) and 24 hr after treatment (2 and 4). Arrows in (2) illustrate examples of some of the new varicosities present one day after one pulse of 5-HT paired with the injection of the ApCREB-2 antiserum. By contrast, cocultures exposed to one pulse of 5-HT in the absence of antiserum injection (4) showed no long-term increases in either the amplitude of the evoked EPSP or in the number of sensory neuron varicosities. All micrographs are composed of superimpositions of labeled sensory neurite images taken from all focal planes of the view area. As a result, the shape of individual varicosities may be obscured. Scale=20 μm. The EPSPs, evoked before (0 hr) and after (24 hr) one pulse of 5-HT in the pictured neurons are indicated in the inserts.
DETAILED DESCRIPTION OF THE INVENTIONThe present invention provides for a method to enhance long-term memory in a subject whose cAMP-responsive gene expression is repressed due to binding of a cAMP-response-element-binding-protein-2 to a protein or a DNA associated with cAMP-responsive gene expression, or both, which includes administering to the subject a compound capable of interfering with such binding in an amount effective to interfere with binding of the protein or the DNA so as to thereby derepress cAMP-responsive gene expression in the subject and enhance the subject's long-term memory.
The compound may be an anti-cAMP-response-element-binding-protein-2 antibody. The compound may be capable of altering phosphorylation of the cAMP-response-element-binding-protein-2. The compound may be an organic compound, a peptide, a peptide mimetic, a small molecule, or a nucleic acid. The protein associated with cAMP-responsive gene expression may include a cAMP-response-element-binding-protein-1, a C/EBP protein, an Aplysia ApC/EBP protein, a human C/EBPβ protein, an AF-1 protein, a c-jun protein, a fla protein, or a c-Fos protein. The administration may include intralesional, intramuscular or intravenous injection; infusion; liposome mediated delivery; viral infection; gene bombardment; topical, nasal, oral, anal, ocular, cerebro-spinal, or otic delivery.
Another embodiment of the subject invention may be a method for evaluating the ability of a compound to interfere with binding of a cAMP-response-element-binding-protein-2 to a protein associated with cAMP-responsive gene expression in a cell which includes:
-
- (a) contacting the cell with the compound under suitable cell culture conditions;
- (b) measuring the amount of unbound protein associated with cAMP-responsive gene expression in the cell;
- (c) comparing the amount in step (b) with the amount of unbound protein associated with cAMP-responsive gene expression in the absence of the compound, so as to thereby evaluate the ability of the compound to interfere with binding of the cAMP-response-element-binding-protein-2 to the protein.
Another embodiment of the present invention is a method for evaluating the ability of a compound to interfere with binding of a cAMP-response-element-binding-protein-2 to a DNA associated with cAMP-responsive gene expression in a cell which includes:
-
- (a) contacting the cell with the compound under suitable cell culture conditions;
- (b) measuring the amount of unbound DNA associated with cAMP-responsive gene expression in the cell;
- (c) comparing the amount in step (b) with the amount of unbound DNA associated with cAMP-responsive gene expression in the absence of the compound, so as to thereby evaluate the ability of the compound to interfere with binding of the cAMP-response-element-binding-protein-2 to the DNA.
Another embodiment of the present invention is a method for treating a subject with a long-term memory defect due to binding of a cAMP-response-element-binding-protein-2 to a protein or a DNA associated with cAMP-responsive gene expression, or both, which includes administering to the subject a compound capable of interfering with such binding in an amount effective to interfere with the binding of the protein or the DNA so as to thereby treat the subject's long-term memory defect.
The long-term memory defect may include age-related memory loss, Alzheimer's Disease, amnesia, ischemia, shock, head trauma, neuronal injury, neuronal toxicity, neuronal degradation, Parkinson's disease, or senility. The compound may comprises an anti-cAMP-response-element-binding-protein-2 antibody. The protein may include a cAMP-response-element-binding-protein-1, a C/EBP protein, an Aplysia ApC/EBP protein, a human C/EBPβ protein, an AF-1 protein, a c-jun protein, a fla protein, or a c-Fos protein. The cAMP-response-element-binding-protein-2 may include human CREB2 transcription factor, murine ATF4 transcription factor, or Aplysia ApCREB2 transcription factor. The administration may include intralesional, intramuscular or intravenous injection; infusion; liposome mediated delivery; viral infection; gene bombardment; topical, nasal, oral, anal, ocular, cerebro-spinal, or otic delivery.
The present invention provides for a recombinant eukaryotic cell including a DNA encoding a cAMP-response-element-binding-protein-2 not naturally present in the cell, operatively linked to a promoter capable of directed enhanced expression of the DNA, the DNA and the promoter being stably integrated into the genome of the eukaryotic cell.
The present invention provides for a transgenic, non-human mammal whose somatic and germ cells contain and express a DNA encoding a cAMP-response-element-binding-protein-2 not naturally occurring in the non-human mammal, operatively linked to a promoter capable of directed-enhanced expression of the DNA, the DNA and the promoter being stably integrated into the genome of the non-human mammal.
The present invention further provides for a pharmaceutical composition which includes an effective amount of a compound capable of interfering with binding of a cAMP-response-element-binding-protein-2 to a protein associated with cAMP-responsive gene expression in a cell and a pharmaceutically acceptable carrier. The carrier may be a diluent, an aerosol, a topical carrier, an aqueous solution, a nonaqueous solution, or a solid carrier. The carrier may include an appropriate adjuvant, a herpes virus, a liposome, a microencapsule, a neuronal cell receptor ligand, a neuronal-specific virus, a polymer encapsulated cell, or a retroviral vector.
As used herein “cAMP-response-element-binding-protein-2” encompasses CREB2, Aplysia CREB2 transcription factor protein, Aplysia CREB2 transcription factor nucleic acid, ApCREB2, human CREB2 transcription factor protein, human CREB2 transcription factor nucleic acid, murine ATF2 transcription factor protein, murine ATF2 transcription factor nucleic acid and natural variants thereof. Such variants encompass homologues of CREB2 in human, mouse, Drosophila, pig, dog, horse, monkey, C. Elegans and Aplysia.
As used herein “subject” encompasses a mammal, a human, a primate, a dog, a swine, an Aplysia or a mouse.
Trangenics
This invention provides a transgenic nonhuman mammal whose somatic and germ cells contain and express a gene coding for a cAMP-response-element-binding-protein-2 not naturally occurring in the non-human mammal. The gene, having been introduced into the nonhuman mammal, or an ancestor of the nonhuman mammal at the single cell stage or an embryonic stage, is operably linked to a promoter and integrated into the genome of the nonhuman mammal. One skilled in the art would be familiar with the experimental methods necessary to produce a transgenic mammal, e.g. Leder et al., U.S. Pat. No. 4,736,866 and Krimpenfort and Berns, U.S. Pat. No. 5,175,384 and Wagner and Chen, U.S. Pat. No. 5,175,385. Preferably, the nonhuman mammal may be a mouse. The gene may be a combination of human cAMP-response-element-binding-protein-2 nucleic acid sequences and adjacent, homologous nonhuman mammal apolipoprotein-J nucleic acid sequences. The promoter may be a nerve tissue specific promoter such as the mouse neurofilament-light gene promoter or the rat neuronal specific enolase promoter (Forss-Petter et al., 1990), which is effective for the expression of the gene in neuronal cells of the brain. The human platelet-derived growth factory-β gene promoter, which is effective for the expression of the gene in cells of the brain may also be utilized. Other nerve tissue specific promoters which may be used are rat sodium channel gene promoter (Maue et al., 1990), the human APP gene promoter (Wirak et al., 1991) and mouse mylein basic protein gene promoter (Readhead et al., 1987). A yeast artificial chromosome construct containing the human cAMP-response-element-binding-protein-2 gene may also be utilized.
This invention provides a nonhuman mammal whose neuronal cells or glial cells or both, express a cAMP-response-element-binding-protein-2 gene. Preferably, the nonhuman mammal may be a mouse. The gene, having been introduced into the mouse by localized infection with retrovirus, is operably linked to a promoter. The retrovirus has an inducible retroviral vector consisting of a marker gene, a constitutive promoter and an inducible promoter. Retroviral-mediated gene transfer is a procedure known to individuals skilled in the art. Procedures for the infection of neuronal progenitor cells have been established, see, for example, Levison and Goldman (1993).
CREB2-containing retroviral expression constructs may be introduced into fetal and neonatal animals by direct viral infection of subventricular zone (primitive neuronal and glial precursor) cells (see Levison and Goldman, 1993). In this protocol, the CREB2 constructs may be cloned downstream of a constitutive promoter (e.g. SV40) in tandem with a beta-galactosidase gene under the control of the retroviral long terminal repeat (LTR) promoter. Thus, CREB-2-producing retrovirally infected cells will be specifically marked by β-galactosidase enzymatic activity (i.e. blue stain in tissue sections). It would then be possible to search for effects of local CREB2 protein overexpression in the intact animal brain on neuronal morphology, amyloid deposition, tau protein phosphorylation and determine whether these effects differ for each CREB2 isoform. If pathological changes are observed, then these animals would serve as a useful in vivo assay system for pharmacological agents.
The transgenic nonhuman mammals may provide an experimental medium for elucidating aspects of long-term facilitation and memory and to serve as tools for screening drugs that may have potential application as therapeutic agents to prevent or limit memory defects. Transgenic nonhuman mammals provide both a prognostic and diagnostic means for the study of memory, in particular for determining the efficacy of pharmaceutical drugs in treating a subject.
This invention is illustrated in the Experimental Details section which follows. These sections are set forth to aid in an understanding of the invention but are not intended to, and should not be construed to, limit in any way the invention as set forth in the claims which follow thereafter.
Experimental Details
EXAMPLE 1 Transcription Factor CREB2/ATF4 as a Repressor of Memory and a Potential Target of Drugs for Improvement of Memory FormulationA transcription factor CREB2 has been identified as a repressor of long-term facilitation in Aplysia neurons. Injection of anti-CREB2 antibodies into sensory neurons has been shown to interfere with CREB2 function and causes a single pulse of serotonin (5-HT). This pulse of serotonin usually induces only short term facilitation lasting minutes, however, under these conditions (with anti-CREB2), serotonin evokes facilitation lasting more than one day. This facilitation has the properties characteristic of long-term facilitation. Specifically, it requires transcription and translation, it induces growth of new synaptic connections and finally it occludes further facilitation by five pulses of 5-HT.
It has been demonstrated that similar to its human homologue CREB2, Aplysia CREB2 is a repressor of the transcriptional activator CREB1. Furthermore, both Aplysia CREB2 and its mammalian homologue ATF4 both heterodimerize, and are repressors of the transcriptional activators ApC/EBP and C/EBPβ, respectively. Another transcriptional activator has also been identified, AF-1, which is necessary for the establishment of long-term facilitation. AF-1 has been demonstrated to interact with CREB2.
Therefore, CREB2 blocks the transition from short term to long-term facilitation by interacting with transcriptional activators necessary for development of long-term facilitation. Long-term facilitation is a close cellular correlate to long-term memory in Aplysia. It is possible, therefore, that CREB2 blocks the transition from short-term memory to long-term memory in both Aplysia and mammals, including humans. Certain defects in memory formation, in particular the age-related memory loss, may represent in part the inability to remove such repression. Repression of memory mediated by CREB2 and the CREB2 protein itself can be targets for developing drugs for use in the treatment of memory defects. The use may extend to memory defects which are related to Alzheimers disease and other diseases or trauma.
EXAMPLE 2 CREB-2/ATF-4 as a Repressor of Long-Term Facilitation in Aplysia: Relief of Repression Converts a Transient Facilitation into a Long-Term Functional and Structural Change SUMMARYThe switch from short- to long-term facilitation induced by behavioral sensitization in Aplysia involves CREB-like proteins, as well as the immediate-early gene ApC/EBP. Using the bZIP domain of ApC/EBP in a two-hybrid system, we have cloned ApCREB-2, transcription factor constitutively expressed in sensory neurons which resembles human CREB-2 and mouse ATF-4. ApCREB-2 represses ApCREB-1 mediated transcription in F9 cells. Injection of anti-ApCREB-2 antibodies into Aplysia sensory neurons causes a single pulse of serotonin (5-HT), which induces only short-term facilitation lasting minutes, to evoke facilitation lasting more than one day. This facilitation has the properties of long-term facilitation: it requires transcription and translation, induces the growth of new synaptic connections, and occludes further facilitation by five pulses of 5-HT.
In cell culture, as in the intact ganglion, both short- and long-term facilitation involve an enhancement of transmitter release induced by cAMP and mediated by the cAMP dependent protein kinase (PKA) (Brunelli et al., 1976, Schacher et al., 1988; Scholz and Byrne, 1988; Ghirardi et al., 1992). With repeated pulses of 5-HT, which give rise to long-term facilitation, the intracellular cAMP concentration increases (Bernier et al., 1982) and the catalytic subunit of PKA translocates to the nucleus of the sensory neurons (Bacskai et al., 1993), where it appears to phosphorylate one or more cAMP response element-binding proteins (CREB-like transcription factors), thereby activating cAMP-inducible gene expression (Kaang et al., 1993). Injection of an oligonucleotide containing the somatostatin cAMP response element (CRE) into the nucleus of a sensory neuron selectively blocks the long-term enhancement in synaptic strength induced by 5-HT without affecting the short-term process (Dash et al., 1990). An Aplysia homolog of CREB-1 has recently been cloned. ApCREB-1 has 42% homology with the mouse CREB-1 over the whole length of the protein, while the basic region/leucine zipper (bZIP) and the phosphorylation domain (P-box), characteristic of CREB-1, are 96% and 90% identical, respectively. Similar to its mammalian homologues, ApCREB-1 binds to the CRE in vitro and is a PKA dependent transactivator (Bartsch et al., in preparation).
In sensory neurons, 5-HT and cAMP induce the immediate-early gene ApC/EBP, a transcription factor necessary for the establishment and maintenance of the stable, self-maintained structural changes characteristic of the long-term memory process (Bailey and Chen, 1983; 1988; 1989; Glanzman et al., 1990). There is apparent generality of CREB-1 as a component of the switch between short-term and long-term memory in Aplysia, Drosophila, mice and perhaps humans. (Yin et al., 1994, 1995; Bourtchuladze et al., 1994., Petrij et al., 1995) It is a question as to whether ApCREB-1 and ApC/EBP can recruit additional transcription factors in the sensory neurons following sensitizing stimuli.
Results
Cloning of ApCREB-2 by its Interaction with ApC/EBP in the Yeast Two-Hybrid System.
The C-terminal portion of ApC/EBP containing the basic region/leucine zipper (bZIP) domain was used to screen an Aplysia CNS specific cDNA library by the yeast two-hybrid system (Fields and Song, 1989; Chien et al., 1991). Two independent clones contained an identical open reading frame of 1134 bp encoding a putative 378 amino acids polypeptide (
The predicted polypeptide shows highest sequence homology to the amino acid sequences of two transcription factors: human CREB-2 (hCREB-2) [(Karpinski et al., 1992); also ATF-4 or TAXREB 67 (Hai et al., 1989, Tsujimoto et al., 1991)] and mouse ATF-4 (mATF-4) [(Mielnicki and Pruitt, 1991), also C/ATF (Vallejo et al., 1993)]. Therefore the Aplysia polypeptide has been termed APCREB-2. Over the whole length of the protein ApCREB-2 shares 21% identical amino acids with hCREB-2 and mATF-4. In the bZIP domain, ApCREB-2, mATF-4, and hCREB-2 are 50% identical (
ApCREB-2 is Expressed in the Nervous System of Aplysia.
ApCREB-2 is expressed at high levels in the CNS and the gill, but is detectable at low levels by Northern blot in all Aplysia tissues tested (
In Western blots of Aplysia CNS extracts, polyclonal ApCREB-2 antiserum raised against full length recombinant ApCREB-2 and the affinity-purified anti-ApCREB-2 antibody recognize a protein that migrates as multiple bands with an apparent molecular weight of around 50 kD (
ApCREB-2 is Constitutively Expressed in Sensory Neurons.
To determine whether ApCREB-2 is expressed in the neurons that exhibit long-term presynaptic facilitation, RT-PCR was used to examine the expression of ApCREB-2 mRNA in cultures of Aplysia sensory neurons. We detected ApCREB-2 mRNA both in nontreated cultures of sensory neurons and in cultures exposed to repeated pulses of 5-HT. (
ApCREB-2 is a Substrate for Protein Kinases.
The primary structure of ApCREB-2 has putative phosphorylation sites for both PKC and MAP kinases (
ApCREB-2 is a Repressor of ApCREB-1 Mediated Activation in F9 Cells.
Human CREB-2 represses CREB-1 mediated transcriptional activation in CV-1 cells and neurons (Karpinski et al., 1992; Jungling et al., 1994). Whether ApCREB-2 could also function as a repressor of ApCREB-1 mediated transactivation in transfected undifferentiated mouse F9 cells was examined. The ability of ApCREB-2 and ApCREB-1 to regulate a minimal control region (a single CRE in front of a minimal SV40 promoter) of a pGL3-CRE luciferase reporter gene was first examined. ApCREB-1 activates this minimal CRE reporter in a PKA dependent manner (relative activation 2.13±0.26 without and 10.50±1.42 with the PKA) and is repressed by ApCREB-2 upon cotransfection in the absence and presence of PKA catalytic subunit (relative activation 0.96±0.15 and 1.64±0.20, respectively) (
In previous experiments, Kaang et al. (1993) demonstrated that a 5xCRE-VIP-lacZ reporter is activated by 5-HT and cAMP in Aplysia sensory neurons. We therefore also cotransfected ApCREB-2 and ApCREB-1 were cotransfected with this reporter. Upon cotransfection, ApCREB-2 again abolished the transcriptional activity of ApCREB-1 both in the absence and in the presence of PKA (relative activation 1.84±0.25 and 4.12±0.53, respectively, as compared to 2.13±0.30 and 48.60±5.23 for ApCREB-1 alone.) (
Thus this data suggest that ApCREB-2 can repress both ApCREB-1 and rat CREB-1 mediated transactivation from a CRE and are consistent with the possibility that ApCREB-2 and ApCREB-1 may interact directly on the CRE.
ApCREB-2 can be an Activator in the Absence of ApCREB-1.
In addition to repressing transcription mediated by ApCREB-1, it was found that ApCREB-2 can also function as an activator of the 5xCRE-VIP-lacZ reporter gene in F9 cells. ApCREB-2 transactivation in F9 cells is stimulated by PKA to the level comparable with ApCREB-1 (relative activation 2.46±0.2 without and 43.12±5.1 with PKA) (
ApCREB-2 is a CRE Binding Protein.
The DNA binding specificity of ApCREB-2 was examined in a binding site selection assay using bacterial-expressed recombinant ApCREB-2 protein to select optimal binding sequences from a pool of randomly generated DNA targets. This assay identified a binding sequence (BS1) for ApCREB-2 which resembles the CRE DNA-binding sequence of the CREB/CREM/ATF family of transcription factors, as well as the CAAT DNA binding motif of the C/EBP family of transcription factors (
One Pulse of 5-HT Produces Long-Term Facilitation when Paired with Injection of ApCREB-2 Antiserum.
In both the intact Aplysia and in neuronal cell culture, five pulses of 5-HT induce long-term facilitation in the connections between the sensory and motor neurons lasting 24 hr or more. By contrast, a single pulse of 5-HT produces only a short-term facilitation lasting about 10 min (
To determine whether ApCREB-2 could also act as a functional repressor and parallel its action as a transcriptional repressor of ApCREB-1 in transfection assays, we injected ApCREB-2 antiserum into the sensory neurons 1 hr before exposure to single or multiple pulses of 5-HT. In the presence of the antiserum, rather than producing the short-term facilitation lasting 10 min, one pulse of serotonin produced facilitation lasting more than 24 hour. This facilitation was robust; it was seen in 42 out of 43 cells. Moreover, the facilitation seen at 24 hr was comparable in magnitude to that seen at 24 hr with five pulses of 5-HT.
The long-term facilitation following five pulses of 5-HT is seen as early as 2 hr after the first pulse (
Facilitation Produced by One Pulse of 5-HT Paired with Injection of ApCREB-2 Antiserum has the Properties of Transcriptionally-Dependent Long-Term Facilitation.
Long-term facilitation induced by repeated pulses of 5-HT requires protein and RNA synthesis. (Montarolo et al., 1986; Bailey et al., 1992). The effect of the protein synthesis inhibitor anisomycin and the RNA synthesis inhibitor actinomycin D was examined on the synaptic modifications produced at 2 and 24 hr after the injection of ApCREB-2 antiserum paired with the application of a single pulse of 5-HT. Incubating sensory-motor neuron cocultures with anisomycin during a single pulse of 5-HT blocks the increase in amplitude of synaptic potential after injection with ApCREB-2 antiserum, both at 2 hr after exposure (±19.17%±6.85, n=18) and at 24 hr (+3.67%±5.54, n=18) (
If one pulse of 5-HT in the presence of ApCREB-2 antiserum phenocopies long-term facilitation, the injection of antibody should also occlude the effects of five pulses of 5-HT. In the cocultures injected with ApCREB-2 antiserum, the facilitation measured 24 hr after five pulses of 5-HT was not significantly greater (+74.5%±13.56, n=20) than the facilitation obtained in cells exposed to five pulses of 5-H and not injected with antibody (+79.6%±12.95, n=15), or cells treated with five pulses of 5-HT and injected with normal rabbit serum (+91.6%±21.31, n=10) (
The facilitation produced at 2 hr by five pulses of 5-HT is completely blocked by inhibitors of protein synthesis, but is only partially blocked by inhibitors of transcription (Ghirardi et al., 1995). This suggests that five pulses of 5-HT modulate both transcription and translation. Since ApCREB-2 presumably acts only on the transcriptional component of long-term facilitation, one might predict that the pairing of one pulse of 5-HT with injection of ApCREB-2 antiserum with would produce less facilitation at 2 hr than 5 pulses of 5-HT. The facilitation at 2 hr produced by one pulse of 5-HT in the presence of ApCREB-2 antibody is approximately 30% less than that produced by five pulses of 5-HT (
Facilitation Induced by One Pulse of 5-HT Paired with Injection of ApCREB-2 Antiserum has Two Distinct Phases
The facilitation induced by one pulse of 5-HT paired with injection of ApCREB-2 antiserum shows two temporal stages: the first phase is similar both in amplitude and time course to the short-term facilitation induced by one pulse of 5-HT in the absence of the antibody (
Injection of ApCREB-2 Antiserum does not Affect Short-Term Facilitation.
The effect of ApCREB-2 antiserum injection on short-term facilitation induced by one pulse of 5-HT was next investigated. One minute after exposure of one pulse of 5-HT the noninjected cells showed a facilitation of +79.43% (±7.06, n=7), the ApCREB-2 antiserum injected cells showed a facilitation of +96.17% (±32.35, n=6) and the cells injected with normal rabbit serum had a facilitation of +76.45% (±12.03, n=11) (
One Pulse of 5-HT Paired with Injection of the ApCREB-2 Antiserum Induces the Growth of New Synaptic Connections
Long-term memory for sensitization of the gill-withdrawal reflex is associated with the growth of new synaptic connections between the sensory neurons and their follower motor neurons (Bailey and Chen, 1983, 1988). The duration of this structural change parallels the behavioral retention of the memory (Bailey and Chen, 1989). Similar changes can be observed in sensory-motor neuron cocultures where five pulses of 5-HT produce a long-lasting (24 hr) increase in the number of sensory varicosities contacting the motor neuron (Glanzman et al., 1990; Bailey et al, 1992).
To determine whether ApCREB-2 can also act as a repressor of the morphological changes that accompany long-term facilitation, the ApCREB-2 antiserum was injected into sensory neurons and examined the consequences of one pulse of 5-HT on long-term changes in both the strength of the sensory-motor neuron connection and on the number of fluorescently-labeled sensory neuron varicosities contacting the motor neuron (
By contrast, control cells receiving just one pulse of 5-HT and no injection of antiserum showed no facilitation (−31.5%±6, n=6) and no increase in the number of sensory neuron varicosities (−10%±7, n=6) 24 hr following training (
Discussion
A bZIP transcription factor, ApCREB-2, has been cloned which is homologous to human CREB-2 Hai et al., 1989; Tsujimoto et al., 1991: Karpinski et al, 1992) and mouse ATF-4 (Mielnicki and Pruitt, 1991; Vallejo et al., 1993). ApCREB-2 represses the activation mediated by ApCREB-1 in mouse F-9 cells. Following injection into the presynaptic sensory neurons of two specific ApCREB-2 antisera, one pulse of 5-HT, which normally induces short-term presynaptic facilitation that does not require RNA or protein synthesis, produces long-term facilitation that lasts more than a day, requires both transcription and translation, and is accompanied by a growth of new synaptic connections.
Although the parallel between the inhibition of ApCREB-1 mediated transactivation in the F9 cells, and the inhibitory action of ApCREB-2 in the sensory neurons, is suggestive, the functional repression by ApCREB-2 in the induction and maintenance of long-term facilitation does not necessarily mean it occurs by means of transcriptional repression. Since ApCREB-2 can activate transcription on its own, it is conceivable that ApCREB-2 may be a repressor only indirectly and that it functions in sensory neurons by activating expression of genes that are themselves inhibitory for the induction of long-term facilitation. Furthermore, the possibility cannot be ruled out that the anti-ApCREB-2 antibodies activate ApCREB-2 rather than blocking it. Nevertheless, the idea that ApCREB-2 acts as a direct repressor of long-term facilitation is favored. The data so far are most consistent with the idea that the anti-ApCREB-2 antibodies prevent ApCREB-2 from interacting with transcriptional activators (such as ApCREB-1).
ApCREB-2 Resembles Human CREB-2 in Both Sequence and Repression of ApCREB-1
ApCREB-2 resembles most closely human CREB-2 and mouse ATF-4 in its primary amino acids sequence and in its binding (albeit with low affinity) to the CRE (Hai et al., 1989; Karpinski et al., 1992). Furthermore, interaction of ApCREB-2 with Ap/CEBP resembles the interaction of ATF-4 and C/EBP(Vallejo et al., 1993). In addition, ApCREB-2 represses ApCREB-1 mediated transactivation in F9 cells, thus resembling the repression of CREB-1 by human CREB-2. (Karpinski et al., 1992, Jungling et al., 1994). In fact, ApCREB-2 can substitute for human CREB-2 as a repressor of mammalian CREB-1 in mouse F9 cells.
The mechanisms whereby ApCREB-2 mediates transcriptional repression of ApCREB-1 are not yet elucidated. However, its action seems to be distinct from the known inducible and constitutive repressors of CRE-mediated transactivation. For example, unlike the inducible repressors ICER or E4BP4 (Molina et al., 1993, Cowell et al., 1992), ApCREB-2 is constitutively expressed and can act as a transcriptional activator. This ability to activate transcription also distinguished ApCREB-2 from the constitutive repressors of CRE-mediated transactivation exemplified by CREM and ApCREB-2 also lacks other features characteristic of the CREMs, such as the highly conserved KID domain. (Foulkes and Sassone-Corsi, 1992)
In Addition to being a Repressor of ApCREB-1, ApCREB-2 can also be an Activator
The finding that ApCREB-2 can both repress and activate transcription further demonstrates that the distinction between activators and repressors is not strict but is critically dependent on the particular promoter, on the recruitment of the specific second messenger pathways, and on the repertoire of the transcription factors available (Hai et al., 1989; Vallejo et al., 1993; Lemaigre et al., 1993; Ellis et al. 1995). ApCREB-2 is an activator as a GAL4 fusion protein in yeast and a PKA dependent transactivator when cotransfected with the 5xCRE-VIP-lacZ reporter gene. However, ApCREB-2 does not activate transcription from the minimal CRE-SV40 regulatory region in pGL3-CRE reporter gene although it can repress the transactivation by ApCREB-1 from this minimal reporter. The reason for this difference is not clear. Perhaps for effective transactivation, ApCREB-2 requires multiple CRE elements; alternatively, ApCREB-2 may interact with additional regulatory elements in 5xCRE-VIP-lacZ reporter that are unrelated to the CRE.
Induction of Long-Term Memory Requires the Coordinated Regulation of Both CREB-1 and CREB-2
The data herein provide evidence that ApCREB-2 is a functional repressor of long-term facilitation. These data provide the first molecular evidence for a possible role of functional repressors in memory storage. Overexpression of an inhibitory form of Drosophila CREB-1, dCREB-2b, blocks the formation of long-term memory in transgenic flies (Yin et al., 1994). Recently, Yin et al. (1995) demonstrated that overexpressing the activating form of Drosophila CREB-1 (dCREB-2a) greatly reduces the number of training trials needed to establish long-term memory. This gain of function, where a single massed training trial is sufficient to achieve long-term memory which normally requires spaced training trials, greatly strengthens the earlier evidence from Drosophila (Yin et-al., 1994, 1995), Aplysia (Dash et al., 1990; Kaang et al., 1993), and mice (Bourtchuladze et al., 1994) that CREB-1 is of central importance in initiating the long-term memory formation.
The results in Aplysia point to a parallel importance for ApCREB-2 in this process. Injection of anti-ApCREB-2 antibodies paired with a single training trial, which normally produces only short-term facilitation, results in induction of long-term facilitation. This gain of function resembles overexpression of the dCREB-2a activator in Drosophila. These findings suggest the interesting possibility that removal of the ApCREB-2-mediated repression may be limiting in regulating the long-term increase in synaptic strength.
A Possible Mechanism for the Physiological Role of ApCREB-2
There are a number of ways by which a transcription factor such as ApCREB-2 could directly repress (for recent review, see Johnson, 1995). First, ApCREB-2 could act directly to inhibit the basal transcriptional machinery. Since ApCREB-2 can be an activator on its own, this is unlikely. Second, ApCREB-2 could compete for the DNA binding sequence with ApCREB-1 (or another activator). Since the affinity of the ApCREB-2 homodimers for CRE is much lower than that of ApCREB-1, this is also unlikely. Therefore, the possibility that ApCREB-2 might mediate repression by interacting directly with ApCREB-1 (or another activators) to form an inactive heterodimer is favored. Both ApCREB-1 and ApCREB-2 are coexpressed in the sensory neurons. Moreover, ApCREB-2 can form heterodimers on a CRE with rat CREB-1 in vitro. However it remains to be determined whether ApCREB-2 also heterodimerizes with ApCREB-1 in vivo.
How might the repression of ApCREB-1 by ApCREB-2 be relieved? Since a change in the amount of the ApCREB-2 protein after exposure to 5-HT is not detected, the relief of repression most likely does not involve targeted degradation of the ApCREB-2 protein. More likely the repressive action of ApCREB-2 is relieved by a covalent modification induced by the repeated pulses of 5-HT. According to this view, the physiological role of ApCREB-2 may be:
First it may prevent the long-term process from being turned on adventitiously without repeated exposures to 5-HT.
Second, it may regulate the amplitude of synaptic change by integrating the activation of ApCREB-1 by PKA with signals from additional second messenger pathways. The induction of long-term facilitation and the concomitant structural changes induced by a single pulse of 5-HT paired with injection of anti ApCREB-2 antibody is consistent with the idea that a single pulse of 5-HT is sufficient to fully induce the activating pathway. The finding that ApCREB-2 transcriptionally represses ApCREB-1 in the presence of cotransfected catalytic subunit of PKA in F9 cells indicates that another pathway besides PKA (a pathway not active in undifferentiated F9 cells) must mediate its derepression. This suggests the interesting possibility that additional second messengers and kinases or phosphatases may be involved in relieving the repression.
The pathways regulating stimulation of the activator and relief of the repressor may have distinctive kinetics. Such differences in kinetics could define the optimal time window separating training trials and account for the well established difference between massed and spaced training. In cell culture, as in the intact animal, spaced training (5 pulses of 5-HT separated by 20 min) trial is more effective in triggering long-term facilitation than massed training (5 pulses of 5-HT not separated at all but given continuously over 25 min). The synaptic potential is facilitated by +80% (12.95, n=15) after 5 spaced pulses as compared with only +39% (19, n=16) after 25 minutes of continuous exposure to 5-HT. Perhaps the reason that spaced training is more effective than massed training is that only spaced training allows coordinated activation of ApCREB-1 and derepression of ApCREB-2.
That 5-HT triggers different signaling pathways in a coordinated way PKA to stimulate the activator and possibly others to relieve the repressor should not be taken to indicate that each of these pathways cannot be engaged alone by other transmitter signals acting on surface receptors. Certain modulatory transmitters might act selectively to relieve repression. Such a priming action on memory might allow for one trial learning.
One Trial Learning: Flashbulb Memories
Dual control of activators and repressors by different second messenger pathways could provide a beginning insight into to a range of features characteristic of memory, ranging from amnesia to photographic memory. For example, a characteristic feature of age-related memory loss (benign senescent forgetfulness) is the inability to consolidate long-term memories (Petersen et al., 1992). This aging defect, therefore, may represent not only a weakening stimulation by activators, but perhaps also an inability to relieve repression. Conversely, genetically endowed differences in the activity of the repressor in relation to the activator could prime the storage process and contribute to exceptional memory. Although long-term memory typically requires repeated spaced training, it occasionally occurs following a single exposure. One trial learning is particularly well-developed in certain rare individuals (memorists) with exceptional memory. For example, the famous memorist D. C. Shershevski, studied by A. R. Luria (1968), seemed never to forget anything he had learned following a single exposure, even after more than a decade. More commonly, memorists have more restricted capabilities: they may be exceptionally good in remembering certain specific types of knowledge and not others (Brown and Deffenbacher, 1995). There are people with astonishing memory that is selective for visual images, for musical scores, for chess games, for poetry, or for faces. But photographic memory is not limited to memorists. The most common type of photographic memory, flashbulb memory, is a detailed and vivid memory most people store on one or another occasion and retain for a lifetime (Brown and Kulik, 1977; Conway, 1995; Neisser, 1982). Flashbulb memories, such as the memory of where you were when President Kennedy was assassinated, preserve knowledge of an event in an almost indiscriminate way, much as a photograph preserves all the details of the scene. Initial studies on flashbulb memories focused on important historical events. But there is now good evidence that autobiographical details of surprising and important defining personal events are retained with the same vivid clarity for details (Conway, 1995).
How are the details of these dramatically personal and historical events stored? These surprising and emotionally-charged events are thought to recruit the amygdala and the major arousal systems of the brain the serotonergic, noradrenergic, dopaminergic, and cholinergic modulatory systems (McGaugh et al., 1993). One potential consequence of the action of these modulatory systems might be to relieve repression and thereby prime the memory system. It is therefore of particular interest that these modulatory systems can play a significant role in the CREB-related learning in Aplysia, Drosophila, and mice.
Experimental Procedures
General Methods
Standard manipulations of E. coli, S. cerevisiae, proteins and nucleic acids, were performed essentially as described in Maniatis et al. (1989), Ausubel et al., (1994) and Harlow and Lane (1988).
Plasmids and Cloning
Cloning was generally done by PCR using Ultima DNA polymerase (Perkin Elmer). The Aplysia CNS specific cDNA library was constructed in pGAD10 and the ApC/EBP bZIP domain (amino acids 151-286) was cloned in pMA424 (Ma and Ptashne, 1987). Subsequent subcloning was carried out in pAS1 and pACT2 plasmids (Durfee et al., 1993). The initiation codons of ApCREB-2, ApC/EBP and ApCREB-1 were replaced by an NcoI restriction site by PCR and cloned in the NcoI-SacI site of pGEX-KG (Guan and Dixon, 1991) or pET-30 (Novagen, modified by replacing the NdeI-NcoI fragment by a synthetic oligonucleotide encoding the initiating methionine followed by six histidines). The mammalian expression constructs pRcRSV-ApCREB-2 and pRcRSV-ApCREB-1 were made by subcloning the corresponding cDNAs in pRcRSV (Invitrogen). The reporter pGL3-CRE was made by cloning a single CRE palindrome into a pGL3 promoter luciferase reporter plasmid (Promega). The plasmids pRcRSV-PKA C-α1 expressing the PKA catalytic subunit and pRcRSV-CREB341 expressing the wild type rat CREB were utilized.
Aplysia CNS cDNA Library Construction, Two-Hybrid Screening in Yeast and GAL4 DNA Binding Domain Activation Assay
The Aplysia CNS cDNA library was synthesized in pGAD10 using random hexamers and the BRL cDNA synthesis kit. Two libraries constructed from size fractionated cDNAs with average inserts >2 kb (5×106 independent clones each) were used in the two-hybrid screening as described previously (Fields and Song., 1989, Durfee et al., 1993, Ausubel et al., 1994). The transcriptional activation properties of ApCREB-2 and its interaction with other proteins in the two-hybrid system was analyzed using the full length ApCREB-2 and its deletion mutants subcloned in pAS1 and pACT2 vectors. The transcriptional activity of ApCREB-2/GAL4 DNA binding domain fusions was determined as decribed (Ma and Ptashne, 1987; Durfee et al., 1993). To analyze the protein interactions, ApCREB-2, ApC/EBP, rat CREB, c-fos and deletion mutants of these proteins in pAS1 and PACT2 were cotransformed into S. cerevisiae Y190, and the expressed-β-galactosidase quantified as above.
Purification of Recombinant Proteins
The induction and purification of GST fusion proteins were done as described (Frangioni and Neel, 1993). 6His-ApCREB-2 fusion protein was expressed and purified using the QIAexpress system (Qiagen, denaturing protocol). The bound 6His-ApCREB-2 protein was renatured on the Ni-NTA resin and eluted with 250 mM imidazole.
Antisera Production, Depletion and Affinity Purification
Two rabbit antisera were raised (BABCO) against GST-ApCREB-2 and one against GST-ApC/EBP fusion proteins. The anti-ApCREB-2 antisera were depleted of ApCREB-2 specific antibodies by incubation with an equal volume of glutathione-agarose saturated (3 μg/μl) with GST-ApCREB-2 fusion protein. The matching controls for Western blots and electrophysiological experiments were prepared by parallel incubation of the immune antisera with glutathione-agarose saturated with GST. The antibodies were affinity purified on the GST-ApCREB-2, GST-ApC/EBP proteins coupled to Affi Gel (Bio Rad). Prior to purification, the antisera were peadsorbed on the GST-Affigel.
Western Blotting
20 μg of Aplysia CNS extract were separated on 10% SDS-PAGE, electroblotted to PVDF membranes (Immobilon-P, Millipore) The membranes were probed with affinity purified anti-ApCREB-2, anti-ApC/EBP antibodies or anti rat CREB antiserum (UBI) followed by anti-rabbit-HRP and visualized by chemiluminescence (ECL, Amersham).
Immunoprecipitation
The CNS ganglia removed from anesthetized Aplysia were labeled with 35S-methionine, overnight at 18° C., homogenized in 10 mM Tris pH 7.2, 350 mM NaCl, 0.5% Triton X-100, 50 mM β-glycerophosphate, 25 mM NaF, 1 mM NaVO4, 2 mM DTT, 1 mM PMSF, 5 mM benzamidine and 10 μg/ml each of chymostatin, leupeptin, antipain and pepstatin A. After diluting 1:1 with 2× RIPA, the extract was precleared with Protein A-Sepharose for 1 hr at 4° C., incubated with affinity purified anti-ApCREB-2 antibody for 1 hr at 4° C. followed by Protein A Sepharose(Pharmacia). The immunoprecipitated proteins were resolved by 10% SDS-PAGE, and visualized by fluorography (Amplify, Amersham).
Phosphatase Treatment of Aplysia CNS Extracts
Both phosphatase and mock buffer cocktails contained 20 mM MgCl2, 0.5 mM EGTA, 1 mM PMSF, 5 mM benzamidine and 10 (g/ml each of chymostatin, leupeptin, antipain and pepstatin A. The phosphatase mix contained 2 U of calf intestinal phosphatase, the mock mix 20 mM NaF and 20 mM β-glycerophosphate. These cocktails were added to 40 μg of the CNS extracts and incubated at 37° C. for 30 min. The reactions was stopped by the addition of SDS sample buffer and the proteins were visualized by Western Blotting with affinity purified anti-ApCREB-2 antibodies.
RNA Extraction from Sensory Neuron Cultures and RT-PCR
Cultures of approximately 200 Aplysia sensory neurons, established by the dissociation of the pleural sensory cluster in a single dish, were exposed to 10 μM 5-HT for 5 min once or five times separated by 20 min. After washing with ASW, cells were lysed by 100 μl of the guanidium thiocyanate solution and the RNA was isolated. For RT-PCR, the isolated RNA was treated with RNAse free DNAse (Boehringer), reextracted as above and processed using RT-PCR kit (Boehringer). The sequence of the primers used were TTCCGCTTTCCATAAGTCGA (Seq ID No 6) and ACCTGAAAATGATATTGTAC (Seq ID No 7).
DNA Binding Site Selection
Optimal recognition sequences for DNA binding of ApCREB-2 and ApC/EBP were determined by a PCR assisted binding site selection method (Norby et al. (1992). The oligonucleotides which bound in 150 mM KCl (standard isotonic condition) or 400 mM KCl (resembling Aplysia cell osmolarity) were eluted by 1M KCl, diluted and PCR amplified. After 13 cycles of binding and PCR amplification the amplified products were cloned in Bluescript (Stratagene) and sequenced. In each of the 48 independent clones from both the low and high salt conditions the BS1 binding sequence (for ApCREB-2) or BS2 (for ApC/EBP) was present.
In Vitro Protein Binding Assay
35S methionine-labeled ApCREB-2 and ApC/EBP were translated in the TNT rabbit reticulocyte lysate (Promega). Ten μl of the lysates containing the in vitro translated proteins were mixed with 25 μl of Glutathione-Sepharose beads saturated with Glutathione S-transferase (GST) or GST fusion proteins in 400 μl of PBS and mixed for 1 hour at room temperature. The bound complexes were washed thoroughly with 20 ml of 0.1% Triton X-100 in PBS on a minicolumn (Wizard, Promega), eluted in SDS sample buffer and resolved by 10% SDS-PAGE.
Electrophoretic DNA Mobility Shift Assays (EMSA)
The sequences listed show one strand of the double stranded oligonucleotides used in the gel mobility shift assays. The sequences in capital letters correspond to: the somatostatin gene CRE (SOM CRE) gatccggcGCCTCCTTGGCTGACGTCAGAGAGAGAGA (Seq ID No 8), the palindromic core CRE (CRE) gatccggcTGACGTCAtcaagcta (SEQ ID NO 9), the phosphoenolpyruvate carboxykinase gene CRE-1 (PEPCK CRE) gatccCCTTACGTCAGAGGCGA (SEQ ID NO 10), the enkephalin gene CRE (ENK CRE) gatccggcGCGGGGCTGGCGTAGGGCCTGCGTCAGCTGCA (SEQ ID NO 11), the ApC/EBP gene putative CRE (Ap CRE) GAGTGGCATCTACGTCAAGGCTTC (SEQ ID NO 12), the ApCREB-2 DNA binding sequence (BS1 CRE) gatccggcAGTATTGCGTCATCtcaagcta (SEQ ID NO 13), the composite CRE-CAAT site (CRE-C/EBP) gatccggcTGACGCAATtcaagcta (SEQ ID NO 14), the angiotensin gene acute phase response element (ANG-APRE) gatccACAGTTGTGATTTCACAACCTGACCAGA (SEQ ID NO 15), the ApC/EBP DNA-binding sequence (BS2 C/EBP) gatccggcACTATTGCGCAATCtcaagcta (SEQ ID NO 16) and the C/EBPβ binding sequence of the c-fos promoter (ERE) gatcCATATTAAGGACATGCCG (SEQ ID NO 17).
The EMSA assays were performed as described in Ausubel et al. (1994) using the high ionic strength TGE buffer, 200 ng of recombinant 6His-ApCREB-2, 200 ng of poly (dI-dC) (Pharmacia), and 25 fmol of 32P end-labeled double-stranded oligonucleotide probes.
F9 Cell Culture, Transfections and Reporter Gene Assays
Undifferentiated mouse F9 cells were transfected using Lipofectamine (BRL). The β-galactosidase and luciferase activities were quantitated by chemiluminescence (Galacton Plus, Tropix, and a Luciferase assay kit, Promega) in a Turner 20e luminometer.
Aplysia Cell Culture and Electrophysiology
Aplysia sensory neurons from the pleural ganglia of adult animals (80-100 g) were cocultured with the motor neuron L7 from juvenile animals (0.5-4 g). After 4-5 days in culture, the strength of the synaptic connections between the sensory and motor cell was measured electrophysioldgically, as previously described (Montarolo et al. 1986, Alberini et al., 1994). The motor neuron was impaled with a glass microelectrode filled with 2.5M KCl (10 MΩ (resistance) and its membrane potential was held at 30 mV below its resting value. The EPSP was evoked by extracellular stimulation of the sensory neuron and the data were stored on a 4 channel tape recorder.
Induction of Facilitation and Antisera Injection
Two protocols were used to induce synaptic facilitation in. Aplysia cocultures. In the first, after testing the initial EPSP amplitude, 10 μM 5-HT was applied for 5 min (single pulse). The EPSP was retested 1 min (short-term facilitation), 2 or 24 hr (long-term facilitation) after the washout of the 5-HT. The amount of facilitation was calculated as the percentage change in EPSP amplitude recorded before and at the different time points after the single 5-HT application. In the other group of experiments, long-term facilitation was evoked by five exposures to 10 μM 5-HT for 5 min each, at 20 min intervals (5 pulses). The facilitation was calculated as the percentage change in EPSP amplitude 24 hr after the five pulses of 5-HT. The antisera, adjusted to the osmolarity of Aplysia neurons (Alberini et al., 1994), were pressure injected into the sensory neurons 1 hr before 5-HT treatment. Where indicated, anisomycin (10 μM) or actinomycin D (50 μg/ml) was added to the cocultures 1 hr before the 5-HT pulse and was present continuously during the 5-HT treatment. All data are presented as mean percentage change±SEM in the EPSP amplitude measured after treatment, as compared with its initial pretreatment amplitude. A one way analysis of variance and Newman Keuls multiple range test were used to determine the significance of the EPSP changes.
Dye Injection, Cell Imaging and Quantification of Structural Changes
Individual sensory neuron were cocultivated with a single motor cell. Glass micropipettes were filled with a 6% sterile-filtered solution of the fluorescent dye 5(6)-carboxyfluorescein (chromatographically purified; Molecular Probes) in 0.44 M KOH (pH 7.0, resistance 50-90 M. The dye was injected into the sensory neurons immediately after measuring the initial EPSP amplitude by 0.4-0.6 nA hyperpolarizing current pulses (500 ms duration at 1 Hz) for 4-6 min, phase contrast and fluorescence images of the same view areas were taken both before and 24 hr after treatment as previously described (Glanzman et al., 1990; Bailey et al., 1992).
Varicosities were identified according to criteria previously established for sensory neurons in vivo (Bailey et al., 1979; Bailey and Chen, 1983, 1988), and in vitro (Glanzman et al., 1990;; Bailey et al., 1992) and included all slightly elongated spheres of approximately 2-3 μm or more in diameter.
Sequences:
Accession Number 1123036
Definition: Aplysia californica bZIP transcription factor (ApCREB2) mRNA, complete cds.
GenBank Name: ACU40851, Accession: U40851 NCB Seq ID: 1123036
Citation D Bartsch, M Ghirardi, P Skehel, K Karl, S Herder, M Chen, C Bailey & E Kandel (1995). Aplysia CREB2 represses long-term facilitation: relief of repression converts transient facilitation into long-term functional and structural change.
Cell 83, 979-992. MEDLINE identifier: 96107336
Coding region function: bZIP transcription 1123036: 190 . . . 1326
factor; repressor.
Sequence 1336 nt, linear rna
Accession Number 1123037
Definition ApCREB2
Protein Name: ApCREB2 1123037: [Whole]
NCBI Seq ID: 1123037
Citation D Bartsch, M Ghirardi, P Skehel, K Karl, S Herder, M Chen, C Bailey & E Kandel (1995). Aplysia CREB2 represses long-term Facilitation: relief of repression converts transient facilitation into long-term functional and structural change.
Cell 83, 979-992.
MEDLINE identifier: 96107336
Citation Data Submission: D. Bartsch (1995).
Coding region function: bZIP transcription 1123036: 190 . . . 1326 factor; repressor.
Sequence 378 aa
The blockage of activity of ApCREB2 by antibody paired with a pulse of 5-HT induces long-term facilitation which is accompanied by growth of new synaptic connections. One view of this process is that 5-HT may be functioning as a growth factor and thus may be capable of the induction of synaptic growth. Since neuronal growth involves the migration of growth cones and the establishment of neuronal connections, the induced synaptic growth may be considered a form of neuronal differentiation as known to be present in the early stages of neuronal development. This process may be considered re-differentiation since it is possible that this growth factor-like activity may occur subsequent to the initial development following a trauma situation. This re-differentiation would rebuild the synaptic connections in order to facilitate the formation of long-term memory. Therefore, CREB2 and its mammalian homologue, ATF4, would be a negative regulator in this process.
The above may be tested in a cellular model of neuronal differentiation, specifically the rat pheochromocytoma cells PC12. The cell line is widely used as a model for neuronal differentiation and also for apoptosis, which is programmed neuronal cell death. PC12 cells are undifferentiated in culture and can be differentiated in vitro by exposing them to nerve growth factor (NGF) and cAMP analogs. Withdrawal of these compounds from the cell culture conditions leads to programmed cell death.
It has been investigated whether ATF4 plays a role in the neuronal differentiation of PC12 cells. It has been demonstrated that in the course of PC12 cellular differentiation, the amount of ATF4 is dramatically reduced (likely by reducing its transcription) in cells exposed to NGF or cAMP analogs. In addition, overexpression of ATF4 in PC12 cells by transfecting expression constructs with constitutive CMV promoter and ATF4 cDNA prevents the PC12 cells from undergoing neuronal differentiation. Taken together, these data support the proposal that the ATF4 gene is a regulator (negative regulator) of neuronal differentiation and that a long term memory acquisition may be a particular form of neuronal differentiation. It is important to also study the role of ATF4 in apoptosis. Since both differentiation and cell death in PC12 cell culture involve similar signal transduction pathways, it is reasonable that ATF4 may be involved in this process as well.
Thus, compounds which are capable of interfering with the binding of a protein or a DNA with a cAMP-response-element-binding-protein-2 may be useful in memory improvement and also in neuronal regeneration after injury and potentially cell death in several human diseases including stroke and Alzheimer's disease. If ATF4/CREB2 is a negative regulator in neuronal differentiation, compounds or pharmaceutical compositions which target the action of ATF4/CREB2 could improve neuronal regeneration after injury, either alone or in combination with growth factors like NGF. Furthermore, interfering with ATF4 function could slow down damage induced by stroke and maybe some progressive neuronal diseases with extensive cell death, like Parkinson's diseae or Alzheimer's disease.
REFERENCES
- Alberini, C., Ghirardi, M., Metz, R., and Kandel, E. R. (1994). C/EBP is an immediate-early gene required for the consolidation of long-term facilitation in Aplysia. Cell 76, 1099-1114.
- Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A and Struhl, K. (1994). Current Protocols in Molecular Biology (New York, John Wiley and Sons).
- Bacskai, B. J., Hochner, B., Mahaut-Smith, M., Adams, S. R., Kaang, B.-K., Kandel, E. R., and Tsien, R. Y. (1993). Spatially resolved dynamics of cAMP and protein kinase A subunits in Aplysia sensory neurons. Science 260, 222-226.
- Bailey, C. H., and Chen, M. (1983). Morphological basis of long-term habituation and sensitization in Aplysia. Science 220, 91-93.
- Bailey, C. H. and Chen, M. (1988). Long-term memory in Aplysia modulates the total number of varicosities of singe identified sensory neurons. Proc. Natl. Acad. Sci. USA 85, 2373-2377.
- Bailey, C. H. and Chen, M. (1989). Time course of structural changes at identified sensory neuron synapses during long-term sensitization in Aplysia. J. Neurosci. 9, 1774-1780.
- Bailey, C. H., Montarolo, P., Chen, M., Kandel, E. R., and Schacher, S. (1992). Inhibitors of protein and RNA synthesis block structural changes that accompany long-term heterosynaptic plasticity in Aplysia. Neuron 9, 749-758.
- Bailey, C. H., and Kandel, E. R. (1993). Structural changes accompanying memory storage. Annu. Rev. Physiol. 55, 397-426.
- Bailey, C. H., Thompson, E. B., Castellucci, V. F., and Kandel, E. R. (1979). Ultrastructure of the synapses of sensory neurons that mediate the gill-withdrawal reflex in Aplysia. J. Neurocytol. 8, 415-444.
- Bernier, L., Castellucci, V. F., Kandel, E. R., and Schwartz, J. H. (1982). Facilitatory transmitter causes a selective and prolonged increase in adenosine 3′:5′-monophosphate in sensory neurons mediating the gill and siphon withdrawal reflex in Aplysia. J. Neurosci. 2, 1682-1691.
- Bourtchuladze, R., Frenguelli, B., Blendy, J., Cioffi, D., Schutz, G., and Silva, A. J. (1994). Deficient long-term memory in mice with a targeted mutation of the cAMP responsive element-binding protein. Cell 79, 59-68.
- Brown, E., and Deffenbacher, K. (1995). Forgotten mnemonists. J. Hist. Behav. Sci. 11, 342-349.
- Brown, R., and Kulik, J. (1977). Flashbulb memories. Cognition 5, 73-99.
- Brunelli, M., Castellucci, V., and Kandel, E. R. (1976). Synaptic facilitation and behavioral sensitization in Aplysia: Possible role of serotonin and cyclic AMP. Science 194, 1178-1181.
- Carew, T. J., Castellucci, V. F., and Kandel, E. R. (1971).
An analysis of dishabituation and sensitization of the gill-withdrawal reflex in Aplysia. Int. J. Neurosci. 2, 79-98.
- Carew, T. J., Pinsker, H. M., and Kandel, E. R. (1972). Long-term habituation of a defensive withdrawal reflex in Aplysia. Science 175, 451-454.
- Castellucci, V. F., Blumenfeld, H., Goelet, P., and Kandel, E. R. (1989). Inhibitor of protein synthesis blocks long-term behavioral sensitization in the isolated gill-withdrawal reflex of Aplysia. J. Neurobiol. 20, 1-9.
- Chevray, P. M., and Nathans, D. (1992). Protein interaction cloning in yeast: Identification of mammalian proteins that react with the leucine zipper of Jun. Proc. Natl. Acad. Sci. USA 89, 5789-5793.
- Chien, C. T., Bartel, P. L., Sternglanz, and Fields, S. (1991). The two-hybrid system: A method to identify and clone genes for proteins that interact with a protein of interest. Proc. Natl. Acad. Sci. 88, 9578-9582.
- Conway, M. (1995). Flashbulb Memories (Hillsdale, N.J., Erlbaum).
- Cowell, I. G., Skinner, A., and Hurst, H. C. (1992). Transcriptional repression by a novel member of the bZIP family of transcription factors. Mol. Cell Biol. 12, 3070-3077.
- Dash, P. K., Hochner, B., and Kandel, E. R. (1990). Injection of cAMP-responsive element into the nucleus of Aplysia sensory neurons blocks long-term facilitation. Nature 345, 718-721.
- Davis, H. P., and Squire, L. R. (1984). Protein synthesis and memory: A review. Psychol. Bull. 96. 518-559.
- Durfee, T., Becherer, K., Chen, P.-L., Yeh, S.-H., Yang, Y., Kilburn, A. E., Lee, W.-H., and Elledge, S. J. (1993). The retinoblastoma protein associates with the protein phosphatase type 1 catalytic subunit. Genes Dev. 7, 555-569.
- Ellis, M. J., Lindon, A. C., Flint, K. J., Jones, N. C., and Goodbourn, S. (1995) Activating transcription factor-1 is a specific antagonist of the cyclic adenosine 3′.5′-monophosphate (cAMP) response element-binding protein-1-mediated response to cAMP. Mol Endocrinol 9:255-265.
- Fields, S., and Song, O. K. (1989). A novel genetic system to detect protein-protein interactions. Nature 340, 245-246.
- Flexner, J. B., Flexner, L. B., and Stellar, E. (1963). Memory in mice as affected by intracerebral puromycin. Science 141, 57-59.
- Foulkes, N., and Sassone-Corsi, P. (1992). More is better; Activators and repressors from the same gene. Cell 68, 411-414.
- Frangioni, J. V., and Neel, B. G. (1993). Solubilization and purification of enzymatically active glutathione S-transferase (PGEX) fusion proteins. Analytical Biochemistry 210, 179-187.
- Ghirardi, M., Braha, O., Hochner, B., Montarolo, P. G., Kandel, E. R., and Dale, N. (1992). Roles of PKA and PKC in facilitation of evoked and spontaneous transmitter release at depressed and nondepressed synapses in Aplysia sensory neurons. Neuron 9, 479-489.
- Ghirardi, M., Montarolo, P. G., and Kandel, E. R. (1995). A novel intermediate stage in the transition between short- and long-term facilitation in the sensory-to-motor neuron synapse of Aplysia. Neuron 14, 413-420.
- Glanzman, D. L., Kandel, E. R., and Schacher, S. (1990). Target-dependent structural changes accompanying long-term synaptic facilitation in Aplysia neurons. Science 249, 799-802.
- Guan, K.-L., and Dixon, J. E. (1991). Eukaryotic proteins expressed in Escherichia coli: An improved thrombin cleavage and purification procedure of fusion proteins with glutathione S-transferase. Analyt. Biochem. 192, 262-267.
- Hai, T. W., Liu, F., Coukos, W. J., and Green, M. R. (1989). Transcription factor ATF cDNA clones: An extensive family of leucine zipper proteins able to selectively form DNA binding heterodimers. Genes Dev. 3, 2083-2090.
- Harlow, E., and Lane, D. (eds.) (1988). Antibodies. (Cold Spring Harbor, N.Y., Cold Spring Harbor Press).
- Johnson, A. D. (1995). The price of repression. Cell 81, 655-658.
- Jungling, S., Cibelli, G., Czardybon, M., Gerdes, H. H., and Thiel, G. (1994). Differential regulation of chromogranin B and synapsin I gene promoter activity by cAMP and cAMP-dependent protein kinase. Eur. J. Biochem. 226, 925-935.
- Kaang, B.-K., Kandel, E. R., and Grant, S. G. N. (1993). Activation of cAMP-responsive genes by stimuli that produce long-term facilitation in Aplysia sensory neurons. Neuron 10, 427-435.
- Karpinski, B. A., Morle, G. D., Huggenvik, J., Uhler, M. D., and Leiden, J. M. (1992). Molecular cloning of human CREB-2: An ATF/CREB transcription factor that can negatively regulate transcription from the cAMP response element. Proc. Natl. Acad. Sci. USA 89, 4820-4824.
- Landschulz, W. H., Johnson, P. F., and McKnight, S. L. (1988). The leucine zipper: A hypothetical structure common to a new class of DNA binding proteins. Science 240, 1759-1764.
- Lemaigre, F. P., Ace. C. I., and Green, M. R. (1993). The cAMP response element binding protein, CREB, is a potent inhibitor of diverse transcriptional activators. Nucleic Acids Res. 21, 2907-2911.
- Luria, A. R. (1968). The Mind of a Mnemonist (London, Basic Books).
- Ma, J., and Ptashne, M. (1987). A new class of yeast transcriptional activators. Cell 51, 113-119.
- Maniatis, T., Sambrook, Z., and Fritsch, E. F. (1989). Molecular Cloning. (Cold Spring Harbor, N.Y., Cold Spring Harbor Press)
- McGaugh, J., Introini-Collison, Il, Cahill, L., Castellano, C., Dalmaz, C., Parent, M., and Williams, C. (1993). Neuromodulatory systems and memory storage: Role of the amygdala. Behav. Brain Res. 58, 81-90.
- Mielnicki, L. M., and Pruitt, S. C. (1991). Isolation and nucleotide sequence of a murine cDNA homologous to human activating transcription factor 4. Nucleic Acids Res. 19, 6332.
- Molina, C. A., Foulkes, N. S., Lalli, E., and Sassone-Corsi, P. (1993). Inducibility and negative autoregulation of CREM: An alternative promoter directs the expression of ICER, an early response repressor. Cell 75, 875-886.
- Montarolo, P. G., Goelet, P., Castellucci, V. F., Morgan, J., Kandel, E. R., and Schacher, S. (1986). A critical period for macromolecular synthesis in long-term heterosynaptic facilitation in Aplysia. Science 234, 1249-1254.
- Neisser, V. (1982). Snapshots or benchmarks? In Memory Observed: Remembering in Natural Contexts, V. Neisser, ed. (San Francisco, Freeman), pp. 43-48.
- Norby, P. L., Pallisgaard, N., Pedersen, F. S., and Jorgensen, P. (1992). Determination of recognition-sequences for DNA-binding proteins by a polymerase chain reaction assisted binding site selection method (BSS) using nitrocellulose immobilized DNA binding protein. Nucleic Acids Res. 20, 6317-6321.
- Petersen, R., Smith, G., Kokmen, E., Ivnik, R., and Tangalos, E. (1992). Memory function in normal aging. Neurology 42, 396-401.
- Petrij, F., Giles, R. H., Dauwerse, H. G., Saris, J. J., Hennekam, R. C. M., Masuno, M., Tommerup, N., Van Ommen, G. J. B., Goodman, R. H., Peters, D. J. M., and Bruening, M. H. (1995). Rubinstein-Taybi syndrome caused by mutations in the transcriptional co-activator CBP. Nature 376, 348-351.
- Pinsker, H., Kupfermann, I., Castellucci, V., and Kandel, E. R. (1970). Habituation and dishabituation of the gill-withdrawal reflex in Aplysia. Science 167, 1740-1742.
- Pinsker, H. M., Hening, W. A., Carew, T. J., and Kandel, E. R. (1973); Long-term sensitization of a defensive withdrawal reflex in Aplysia. Science 182, 1039-1042.
- Rayport, S. G., and Schacher, S. (1986). Synaptic plasticity in vitro: Cell culture of identified neurons mediating short-term habituation and sensitization. J. Neurosci. 6, 759-763.
- Schacher, S., Castellucci, V. F., and Kandel, E. R. (1988). cAMP evokes long-term facilitation in Aplysia sensory neurons that requires new protein synthesis. Science 240, 1667-1669.
- Scholz, K. P., and Byrne, J. H. (1988). Intracellular injection of cyclic AMP induces a long-term reduction of neuronal potassium currents. Science 240, 1664-1667.
- Skehel, P. A., and Bartsch, D. (1994). Characterization of a Y-box factor from Aplysia californica. Gene 145, 231-235.
- Tsujimoto, A., Nyunoya, H., Morita, T., Sato, T., and Shimotohno, K. (1991). Isolation of cDNAs for DNA-binding proteins which specifically bind to a tax-responsive enhancer element in the long terminal repeat of human T-cell leukemia virus type I. J. Virol. 65, 1420-1426.
- Vallejo, M., Ron, D., Miller, C. P., and Habener, J. F. (1993). C/ATF, a member of the activating transcription factor family of DNA-binding proteins, dimerizes with CAAT/enhancer-binding proteins and directs their binding to cAMP response elements. Proc. Natl. Acad. Sci. USA 90, 4679-4683.
- Vinson, C. R., Hai, T., and Boyd, S. M. (1993). Dimerization specificity of the leucine zipper-containing bZIP motif on DNA binding; Prediction and rational design. Genes Dev. 7, 1047-1058.
- Vinson, C. R., Sigler, B., and McKnight, S. L. (1989). Scissors-grip model for DNA recognition by a family of leucine zipper proteins. Science 246, 911-916.
- Yin, J. C. P., Del Vecchio, M., Zhou, H., and Tully, T. (1995). CREB as a memory modulator: Induced expression of a dCREB2 activator isoform enhances long-term memory in Drosophila. Cell 81, 107-115.
- Yin, J. C. P., Wallach, J. S., Del Vecchio, M., Wilder, E. L., Zhou, H., Quinn, W. G., and Tully, T. (1994). Induction of a dominant negative CREB transgene specifically blocks long-term memory in Drosophila. Cell 79, 49-58.
Claims
1-6. (canceled)
7. A method for evaluating the ability of a compound to interfere with binding of a cAMP-response-element-binding-protein-2 to a protein associated with cAMP-responsive gene expression in a cell which comprises:
- (a) contacting the cell with the compound under suitable cell culture conditions;
- (b) measuring the amount of unbound protein associated with cAMP-responsive gene expression in the cell;
- (c) comparing the amount in step (b) with the amount of unbound protein associated with cAMP-responsive gene expression in the absence of the compound, so as to thereby evaluate the ability of the compound to interfere with binding of the cAMP-response-element-binding-protein-2 to the protein.
8. The method of claim 7, wherein the compound is an anti-cAMP-response-element-binding-protein-2 antibody.
9. The method of claim 7, wherein the compound is capable of altering phosphorylation of the cAMP-response-element-binding-protein-2.
10. The method of claim 7, wherein the compound is an organic compound, a peptide, a peptide mimetic, a small molecule, or a nucleic acid.
11. A method for evaluating the ability of a compound to interfere with binding of a cAMP-response-element-binding-protein-2 to a DNA associated with cAMP-responsive gene expression in a cell which comprises:
- (a) contacting the cell with the compound under suitable cell culture conditions;
- (b) measuring the amount of unbound DNA associated with cAMP-responsive gene expression in the cell;
- (c) comparing the amount in step (b) with the amount of unbound DNA associated with cAMP-responsive gene expression in the absence of the compound, so as to thereby evaluate the ability of the compound to interfere with binding of the cAMP-response-element-binding-protein-2 to the DNA.
12. The method of claim 11, wherein the compound is an anti-cAMP-response-element-binding-protein-2 antibody.
13. The method of claim 11, wherein the compound is capable of altering phosphorylation of the cAMP-response-element-binding-protein-2.
14. The method of claim 11, wherein the compound is an organic compound, a peptide, a peptide mimetic, a small molecule, or a nucleic acid.
15-27. (canceled)
Type: Application
Filed: Dec 13, 2005
Publication Date: Apr 27, 2006
Applicant: The Trustees of Columbia University (New York, NY)
Inventors: Dusan Bartsch (New York, NY), Eric Kandel (Riverdale, NY), Mirella Ghirardi (Torino)
Application Number: 11/301,602
International Classification: A61K 39/395 (20060101); A61K 31/52 (20060101); A61K 48/00 (20060101);