Novel full-length cDNA


Novel full-length cDNAs are provided. 2443 cDNA derived from human have been isolated. The full-length nucleotide sequences of the cDNA and amino acid sequences encoded by the nucleotide sequences have been determined. Because the cDNA of the present invention are full-length and contain the translation start site, they provide information useful for analyzing the functions of the polypeptide.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History

The present invention relates to polynucleotides encoding novel polypeptides, polypeptides encoded by the polynucleotides, and new uses of these.


Currently, the sequencing projects, the determination and analysis of the genomic DNA of various living organisms have been in progress all over the world. The whole genomic sequences of more than 40 species of prokaryotes, a lower eukaryote, yeast, a multicellular eukaryote, C. elegans, and a higher plants, arabidopsis, etc. are already determined. For human genome, presumably having 3 billion base pairs, the analysis was advanced under global cooperative organization, and a draft sequence was disclosed in 2001. Moreover, all the structures are to be clear and to be disclosed in 2002-2003. The aim of the determination of genomic sequence is to reveal the functions of all genes and their regulation and to understand living organisms as a network of interactions between genes, proteins, cells or individuals through deducing the information in a genome, which is a blueprint of the highly complicated living organisms. To understand living organisms by utilizing the genomic information from various species is not only important as an academic subject, but also socially significant from the viewpoint of industrial application.

However, determination of genomic sequences itself cannot identify the functions of all genes. For example, as for yeast, only the function of approximately half of the 6000 genes, which is predicted based on the genomic sequence, was able to be deduced. On the other hand, the human genome has been estimated to contain about 30,000-40,000 genes. Further, 100,000 or more types of mRNAs are said to exist when variants produced by alternative splicing are taken into consideration. Therefore, it is desirable to establish “a high throughput analysis system of the gene functions” which allows us to identify rapidly and efficiently the functions of vast amounts of the genes obtained by the genomic sequencing.

Many genes in the eukaryotic genome are split by introns into multiple exons. Thus, it is difficult to predict correctly the structure of encoded protein solely based on genomic information. In contrast, cDNA, which is produced from mRNA that lacks introns, encodes a protein as a single continuous amino acid sequence and allows us to identify the primary structure of the protein easily. In human cDNA research, to date, more than three million ESTs (Expression Sequence Tags) are publicly available, and the ESTs presumably cover not less than 80% of all human genes.

The information of ESTs is utilized for analyzing the structure of human genome, or for predicting the exon-regions of genomic sequences or their expression profile. However, many human ESTs have been derived from proximal regions to the 3′-end of cDNA, and information around the 5′-end of mRNA is extremely little. Among human cDNAs, the number of the corresponding mRNAs whose encoding full-length protein sequences are deduced is approximately 13,000.

It is possible to identify the transcription start site of mRNA on the genomic sequence based on the 5′-end sequence of a full-length cDNA, and to analyze factors involved in the stability of mRNA that is contained in the cDNA, or in its regulation of expression at the translation stage. Also, since a full-length cDNA contains atg codon, the translation start site, in the 5′-region, it can be translated into a protein in a correct frame. Therefore, it is possible to produce a large amount of the protein encoded by the cDNA or to analyze biological activity of the expressed protein by utilizing an appropriate expression system. Thus, analysis of a full-length cDNA provides valuable information which complements the information from genome sequencing. Also, full-length cDNA clones that can be expressed are extremely valuable in empirical analysis of gene function and in industrial application.

Therefore, if a novel human full-length cDNA is isolated, it can be used for developing medicines for diseases in which the gene is involved. The protein encoded by the gene can be used as a drug by itself. Thus, it has great significance to obtain a full-length cDNA encoding a novel human protein.

In particular, human secretory proteins or membrane proteins would be useful by itself as a medicine like tissue plasminogen activator (TPA), or as a target of medicines like membrane receptors. In addition, genes for signal transduction-related proteins (protein kinases, etc.), glycoprotein-related proteins, transcription-related proteins, etc. are genes whose relationships to human diseases have been elucidated. Moreover, genes for disease-related proteins form a gene group rich in genes whose relationships to human diseases have been elucidated.

Therefore, it has great significance to isolate novel full-length cDNA clones of human, only few of which has been isolated. Especially, isolation of a novel cDNA clone encoding a secretory protein or membrane protein is desired since the protein itself would be useful as a medicine, and also the clones potentially include a gene involved in diseases. In addition, genes encoding proteins that are involved in signal transduction, glycoprotein, transcription, or diseases are expected to be useful as target molecules for therapy, or as medicines themselves. These genes form a gene group predicted to be strongly involved in diseases. Thus, identification of the full-length cDNA clones encoding those proteins has great significance.


An objective of the present invention is to provide polynucleotides encoding novel polypeptides, polypeptides encoded by the polynucleotides, and novel usages of these.

The inventors have developed a method for efficiently cloning, from a cDNA library having very high fullness-ratio, a human full-length cDNA that is predicted to be a full-length cDNA clone, where the cDNA library is synthesized by an improved method (WO 01/04286) of the oligo-capping method (K. Maruyama and S. Sugano, Gene, 138: 171-174 (1994); Y. Suzuki et al., Gene, 200: 149-156 (1997)). Then, the nucleotide sequences of cDNA clones whose fullness ratio is high, obtained by this method, were determined mainly from their 5′-ends, and, if required, from 3′-ends.

Further, representative clones, which were estimated to be novel and full-length, among the clones obtained, were analyzed for their full-length nucleotide sequences. The determined full-length nucleotide sequences were analyzed by BLAST homology search of the databases shown below. Because the homology search of the present invention is carried out based on the information of full-length cDNAs including the entire coding regions, homology to every part of a polypeptide can be analyzed. Thus, in the present invention, the reliability of homology search has been greatly improved.

[1] SwissProt (,

[2] GenBank (,

[3] UniGene (Human) (, and

[4] nr (a protein database, which has been constructed by combining data of coding sequences (CDS) in nucleotide sequences deposited in GenBank, and data of SwissProt, PDB (, PIR (, and PRF (; overlapping sequences have been removed.)

Further, the gene expression profiles of cDNA clones whose full-length nucleotide sequence had been determined were studied by analyzing the large-scale cDNA database constructed based on the 5′-end nucleotide sequences of cDNAs obtained. In addition to the analysis for the expression profile by computer, the profiles of gene expression in living cells were also determined by PCR. The present inventors revealed the usefulness of the genes of the present invention based on these analysis results.

In the present invention, gene functions were revealed by the analysis of expression profiles in silico based on the information of full-length nucleotide sequences. The expression profiles used in the expression frequency analysis were studied based on the database containing sufficient amount of fragment sequence data. The expression frequency analysis was carried out by referring, for these expression profiles, to the full-length nucleotide sequences of many cDNA clones obtained in the present invention. Thus, a highly reliable analysis can be achieved by referring to the full-length nucleotide sequences of a wide variety of genes for the sufficiently large population for analysis (expression profiles). Namely, the results of expression frequency analysis using the full-length sequences of the present invention more precisely reflect the gene expression frequency in tissues and cells from which a certain cDNA library was derived. In other words, the information of full-length cDNA nucleotide sequence of the present invention made it possible to achieve the highly reliable expression frequency analysis.

The full-length cDNA clones of this invention were obtained by the method comprising the steps of [1] preparing libraries containing cDNAs with the high fullness ratio by oligo-capping, and [2] assembling 5′-end sequences and selecting one with the highest probability of completeness in length in the cluster formed (there are many clones longer in the 5′-end direction). However, the uses of primers designed based on the 5′- and 3′-end sequences of polynucleotides provided by the present invention enable readily obtaining full-length cDNAs without such a special technique. The primer, which is designed to be used for obtaining cDNAs capable of being expressed, is not limited to the 5′- and 3′-end sequences of polynucleotide.

Specifically, the present invention relates to a polynucleotide selected from the group consisting of the following (a) to (g):

(a) a polynucleotide comprising a protein-coding region of the nucleotide sequence of any one of SEQ ID NOs shown in Table 1;

(b) a polynucleotide encoding a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs shown in Table 1;

(c) a polynucleotide comprising a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs shown in Table 1, wherein, in said amino acid sequence, one or more amino acids have been substituted, deleted, inserted, and/or added, and wherein said nucleotide sequence encodes a polypeptide functionally equivalent to a polypeptide comprising the selected amino acid sequence;

(d) a polynucleotide hybridizing under stringent conditions to a polynucleotide comprising the nucleotide sequence of any one of SEQ ID NOs shown in Table 1, wherein said nucleotide sequence encodes a polypeptide functionally equivalent to a polypeptide encoded by the selected nucleotide sequence;

(e) a polynucleotide comprising a′ nucleotide sequence encoding a partial amino acid sequence of a polypeptide encoded by the polynucleotide according to any one of (a) to (d);

(f) a polynucleotide comprising a nucleotide sequence having at least 70% identity to the nucleotide sequence of (a); and

(g) a polynucleotide comprising a nucleotide sequence having at least 90% identity to the nucleotide sequence of (a).

The present invention also relates to a polypeptide encoded by the above-mentioned polynucleotide or a partial peptide thereof, an antibody binding to the polypeptide or the peptide, and a method for immunologically assaying the polypeptide or the peptide, which comprises the steps of contacting the polypeptide or the peptide with the antibody, and observing the binding between the two.

Furthermore, the present invention features a vector comprising the above-mentioned polynucleotide, a transformant carrying the polynucleotide or the vector, a transformant carrying the polynucleotide or the vector in an expressible manner, and a method for producing the polypeptide or the peptide, which comprises the steps of culturing the transformant and recovering an expression product.

Another feature of the present invention is an oligonucleotide comprising at least 15 nucleotides, said oligonucleotide comprising a nucleotide sequence complementary to the nucleotide sequence of any one of SEQ ID NOs: 1 to 2443 or to a complementary strand thereof. This oligonucleotide can be used as a primer for synthesizing the above-mentioned polynucleotide or used as a probe for detecting the polynucleotide. The present invention includes an antisense polynucleotide against the polynucleotide or a part thereof, and a method for detecting the polynucleotide, which comprises the following steps of:

a) incubating a target polynucleotide with the oligonucleotide under hybridizable conditions, and

b) detecting hybridization of the target polynucleotide with the oligonucleotide.

Still another feature of the present invention is database of polynucleotides and/or polypeptides, said database comprising information on at least one of the nucleotide sequences of SEQ ID NOs: 1 to 2443 and/or on at least one of the amino acid sequences of SEQ ID NOs: 2444 to 4886.

Herein, “polynucleotide” is defined as a molecule, such as DNA and RNA, in which multiple nucleotides are polymerized. There are no limitations on the number of the polymerized nucleotides. In case that the polymer contains relatively low number of nucleotides, it is also described as an “oligonucleotide”, which is included in the “polynucleotide” of the present invention. The polynucleotide or the oligonucleotide of the present invention can be a natural or chemically synthesized product. Alternatively, it can be synthesized using a template polynucleotide by an enzymatic reaction such as PCR. Furthermore, the polynucleotide of the present invention may be modified chemically. Moreover, not only a single-strand polynucleotide but also a double-strand polynucleotide is included in the present invention. In this specification, especially in claims, when the polynucleotide is described merely as “polynucleotide”, it means not only a single-strand polynucleotide but also a double-strand polynucleotide. When it means double-strand polynucleotide, the nucleotide sequence of only one chain is indicated. However, based on the nucleotide sequence of a sense chain, the nucleotide sequence of the complementary strand thereof is essentially determined.

As used herein, an “isolated polynucleotide” is a polynucleotide the structure of which is not identical to that of any naturally occurring polynucleotide or to that of any fragment of a naturally occurring genomic polynucleotide spanning more than three separate genes. The term therefore includes, for example, (a) a DNA which has the sequence of part of a naturally occurring genomic DNA molecule in the genome of the organism in which it naturally occurs; (b) a polynucleotide incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion polypeptide. Specifically excluded from this definition are polynucleotides of DNA molecules present in mixtures of different (i) DNA molecules, (ii) transfected cells, or (iii) cell clones; e.g., as these occur in a DNA library such as a cDNA or genomic DNA library.

The term “substantially pure” as used herein in reference to a given protein or polypeptide means that the protein or polypeptide is substantially free from other biological macromolecules. For example, the substantially pure protein or polypeptide is at least 75%, 80%, 85%, 95%, or 99% pure by dry weight. Purity can be measured by any appropriate standard method known in the art, for example, by column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.

All the cDNAs provided by the present invention are full-length cDNAs. The “full-length cDNA” herein means that the cDNA contains the ATG codon, which is the start point of translation therein. The untranslated regions upstream and downstream of the protein-coding region, both of which are naturally contained in natural mRNAs, are not indispensable. It is preferable that the full-length cDNAs of the present invention contain the stop codon.


FIG. 1 shows the restriction map of the vector pME18SFL3.


All the clones (2443 clones) of the present invention are novel and encode the full-length polypeptides. Further, all the clones are cDNAs with the high fullness ratio, which were obtained by oligo-capping method, and also clones which are not identical to any of known human mRNAs (namely, novel clones) selected by searching, for the 5′-end sequences, mRNA sequences with the annotation of “complete cds” in the GenBank and UniGene databases by using the BLAST homology search [S. F. Altschul, W. Gish, W. Miller, E. W. Myers & D. J. Lipman, J. Mol. Biol., 215: 403-410 (1990); W. Gish & D. J. States, Nature Genet., 3: 266-272 (1993)]; they are also clones that were assumed to have higher fullness ratio among the members in the cluster formed by assembling. Most of the clones assessed to have high fullness ratio in the cluster had the nucleotide sequences longer in the 5′-end direction.

All the full-length cDNAs of the present invention can be synthesized by a method such as PCR (Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley & Sons Section 6.1-6.4) using primer sets designed based on the 5′-end and 3′-end sequences or using primer sets of primers designed based on the 5′-end sequences and a primer of oligo dT sequence corresponding to poly A sequence. Table 1 contains the clone names of full-length cDNA of 2443 clones of the present invention, SEQ ID NOs of the full-length nucleotide sequences, CDS portions deduced from the full-length nucleotide sequences, and SEQ ID NOs of the translated amino acids. The positions of CDS are shown according to the rule of “DDBJ/EMBL/GenBank Feature Table Definition” ( The start position number corresponds to the first letter of “ATG” that is the nucleotide triplet encoding methionine; the termination position number corresponds to the third letter of the stop codon. These are indicated being flanked with the mark “..”. However, with respect to the clones having no stop codon, the termination position is indicated by the mark “>” according to the above rule.

TABLE 1 SEQ ID NO. SEQ ID NO. Clone of nucleotide Position of amino acid name sequence of CDS sequence 3NB6910001910 1 30..1661 2444 3NB6920014080 2 80..922 2445 3NB6920014590 3 1..693 2446 ADIPS10000640 4 127..1098 2447 ADIPS20004250 5 170..2212 2448 ADRGL10001470 6 368..829 2449 ADRGL20000640 7 599..1345 2450 ADRGL20011190 8 61..>2254 2451 ADRGL20012870 9 827..1300 2452 ADRGL20013010 10 1127..1444 2453 ADRGL20013520 11 226..837 2454 ADRGL20018300 12 320..2233 2455 ADRGL20018540 13 55..363 2456 ADRGL20028570 14 218..976 2457 ADRGL20035850 15 55..522 2458 ADRGL20044590 16 692..1042 2459 ADRGL20048330 17 189..2204 2460 ADRGL20061930 18 293..>1899 2461 ADRGL20067670 19 108..512 2462 ADRGL20068170 20 217..615 2463 ADRGL20068460 21 576..1280 2464 ADRGL20073570 22 556..891 2465 ADRGL20076360 23 159..515 2466 ADRGL20078100 24 418..1563 2467 ADRGL20083310 25 871..1368 2468 ASTRO10001650 26 369..2168 2469 ASTRO20001410 27 319..744 2470 ASTRO20005330 28 196..642 2471 ASTRO20008010 29 735..1169 2472 ASTRO20012490 30 286..783 2473 ASTRO20027430 31 129..848 2474 ASTRO20032120 32 860..1189 2475 ASTRO20033160 33 139..1014 2476 ASTRO20055750 34 16..2007 2477 ASTRO20058630 35 28..957 2478 ASTRO20064750 36 1381..>2654 2479 ASTRO20072210 37 274..>1868 2480 ASTRO20084250 38 35..1381 2481 ASTRO20100720 39 394..714 2482 ASTRO20105820 40 205..1368 2483 ASTRO20106150 41 138..1811 2484 ASTRO20108190 42 791..2539 2485 ASTRO20111490 43 517..921 2486 ASTRO20114370 44 145..1782 2487 ASTRO20114610 45 53..433 2488 ASTRO20125520 46 1674..2456 2489 ASTRO20130500 47 15..2417 2490 ASTRO20136710 48 319..657 2491 ASTRO20138020 49 285..995 2492 ASTRO20141350 50 394..1767 2493 ASTRO20143630 51 103..1305 2494 ASTRO20145760 52 347..2008 2495 ASTRO20152140 53 760..1233 2496 ASTRO20155290 54 208..2298 2497 ASTRO20166810 55 7..381 2498 ASTRO20168470 56 334..1329 2499 ASTRO20173480 57 119..724 2500 ASTRO20181690 58 84..1967 2501 ASTRO20190390 59 2282..2662 2502 BEAST20004540 60 1022..1513 2503 BGGI110000240 61 123..1649 2504 BGGI110001930 62 81..1307 2505 BGGI120006160 63 6..680 2506 BLADE20003400 64 17..1876 2507 BLADE20003890 65 555..2405 2508 BLADE20004630 66 58..405 2509 BNGH420088500 67 2..1270 2510 BRACE20003070 68 310..1563 2511 BRACE20006400 69 32..364 2512 BRACE20011070 70 21..1553 2513 BRACE20019540 71 538..993 2514 BRACE20027620 72 24..1289 2515 BRACE20037660 73 143..469 2516 BRACE20038000 74 646..2187 2517 BRACE20038470 75 963..1307 2518 BRACE20038480 76 1838..2626 2519 BRACE20038850 77 1099..1413 2520 BRACE20039040 78 1273..1671 2521 BRACE20039440 79 216..797 2522 BRACE20039540 80 1153..1905 2523 BRACE20050900 81 115..1788 2524 BRACE20051380 82 1433..1783 2525 BRACE20051690 83 380..742 2526 BRACE20052160 84 20..1024 2527 BRACE20053280 85 736..1524 2528 BRACE20053480 86 24..875 2529 BRACE20053630 87 81..950 2530 BRACE20054500 88 364..669 2531 BRACE20055180 89 156..656 2532 BRACE20056810 90 338..940 2533 BRACE20057190 91 1016..1660 2534 BRACE20057420 92 539..856 2535 BRACE20057620 93 1226..1588 2536 BRACE20057730 94 819..1592 2537 BRACE20058580 95 146..1330 2538 BRACE20058810 96 40..345 2539 BRACE20059370 97 192..1574 2540 BRACE20060550 98 197..1687 2541 BRACE20060720 99 220..618 2542 BRACE20060840 100 37..927 2543 BRACE20060890 101 170..964 2544 BRACE20061050 102 1130..1573 2545 BRACE20061740 103 434..865 2546 BRACE20062400 104 1310..1732 2547 BRACE20062640 105 278..2089 2548 BRACE20062740 106 753..1151 2549 BRACE20063630 107 414..800 2550 BRACE20063780 108 11..892 2551 BRACE20063800 109 70..435 2552 BRACE20063930 110 1795..2433 2553 BRACE20064880 111 365..1420 2554 BRACE20067430 112 875..1189 2555 BRACE20068590 113 260..1759 2556 BRACE20069090 114 1484..1960 2557 BRACE20081720 115 1182..1565 2558 BRACE20082950 116 1713..2018 2559 BRACE20090440 117 58..444 2560 BRACE20096200 118 168..1130 2561 BRACE20096540 119 43..729 2562 BRACE20097320 120 51..509 2563 BRACE20099570 121 3..425 2564 BRACE20101700 122 579..968 2565 BRACE20101710 123 187..681 2566 BRACE20106690 124 335..691 2567 BRACE20106840 125 19..402 2568 BRACE20107530 126 437..1063 2569 BRACE20108130 127 927..1229 2570 BRACE20108880 128 417..782 2571 BRACE20109370 129 1197..1778 2572 BRACE20109830 130 747..1382 2573 BRACE20111830 131 366..737 2574 BRACE20114780 132 515..886 2575 BRACE20115450 133 399..764 2576 BRACE20115920 134 41..937 2577 BRACE20116110 135 830..1150 2578 BRACE20116460 136 84..509 2579 BRACE20118380 137 657..1421 2580 BRACE20121850 138 474..857 2581 BRACE20136240 139 111..518 2582 BRACE20141080 140 148..534 2583 BRACE20142320 141 164..499 2584 BRACE20142570 142 591..926 2585 BRACE20147800 143 133..513 2586 BRACE20148210 144 1101..1541 2587 BRACE20148240 145 713..2128 2588 BRACE20150310 146 94..408 2589 BRACE20151320 147 137..1189 2590 BRACE20152870 148 207..653 2591 BRACE20153680 149 87..956 2592 BRACE20154120 150 351..989 2593 BRACE20163150 151 699..1085 2594 BRACE20163350 152 443..1597 2595 BRACE20165830 153 401..709 2596 BRACE20171240 154 62..439 2597 BRACE20172980 155 20..445 2598 BRACE20175870 156 67..396 2599 BRACE20177200 157 1178..1675 2600 BRACE20179340 158 47..1171 2601 BRACE20185680 159 880..1341 2602 BRACE20188470 160 1247..2926 2603 BRACE20190040 161 6..464 2604 BRACE20190440 162 382..1287 2605 BRACE20192440 163 1199..2062 2606 BRACE20195100 164 251..736 2607 BRACE20201570 165 661..1056 2608 BRACE20210140 166 248..550 2609 BRACE20220300 167 1057..1392 2610 BRACE20223280 168 6..1976 2611 BRACE20223330 169 97..2373 2612 BRACE20224480 170 1568..1924 2613 BRACE20224500 171 1674..2081 2614 BRACE20228480 172 1268..2176 2615 BRACE20229280 173 239..700 2616 BRACE20230700 174 354..752 2617 BRACE20232840 175 79..2019 2618 BRACE20235400 176 213..593 2619 BRACE20237270 177 3..494 2620 BRACE20238000 178 135..437 2621 BRACE20240740 179 83..1546 2622 BRACE20248260 180 682..1533 2623 BRACE20253160 181 26..559 2624 BRACE20253330 182 220..1041 2625 BRACE20257100 183 1638..2021 2626 BRACE20262930 184 256..681 2627 BRACE20262940 185 259..591 2628 BRACE20266750 186 58..1143 2629 BRACE20267250 187 139..612 2630 BRACE20269200 188 4..408 2631 BRACE20269710 189 338.1063 2632 BRACE20273890 190 1365..1766 2633 BRACE20274080 191 350..655 2634 BRACE20276430 192 232..>2028 2635 BRACE20283920 193 717..1025 2636 BRACE20284100 194 1026..1865 2637 BRACE20286360 195 170..727 2638 BRACE20287410 196 603..956 2639 BRALZ20013500 197 215..640 2640 BRALZ20014450 198 6..374 2641 BRALZ20017430 199 232..747 2642 BRALZ20018340 200 879..1481 2643 BRALZ20019660 201 180..773 2644 BRALZ20054710 202 135..1223 2645 BRALZ20058880 203 102..1607 2646 BRALZ20059500 204 722..1081 2647 BRALZ20064740 205 24..350 2648 BRALZ20065600 206 25..624 2649 BRALZ20069760 207 14..319 2650 BRALZ20073760 208 576..1124 2651 BRALZ20075450 209 775..1200 2652 BRALZ20075760 210 148..726 2653 BRALZ20077900 211 1900..2529 2654 BRALZ20077930 212 50..2077 2655 BRALZ20080310 213 1304..2005 2656 BRALZ20088690 214 104..661 2657 BRAMY10001300 215 2352..2795 2658 BRAMY20001570 216 696..1604 2659 BRAMY20000520 217 329..1204 2660 BRAMY20000860 218 246..548 2661 BRAMY20002770 219 76..447 2662 BRAMY20004110 220 145..540 2663 BRAMY20011140 221 2661..3011 2664 BRAMY20025840 222 1058..2002 2665 BRAMY20039260 223 101..424 2666 BRAMY20045240 224 662..1792 2667 BRAMY20054880 225 508..981 2668 BRAMY20060920 226 110..439 2669 BRAMY20063970 227 246..551 2670 BRAMY20071850 228 178..705 2671 BRAMY20102080 229 513..1136 2672 BRAMY20103570 230 114..1001 2673 BRAMY20104640 231 334..1410 2674 BRAMY20110640 232 1400.1735 2675 BRAMY20111960 233 534..854 2676 BRAMY20112800 234 31..606 2677 BRAMY20116790 235 2348..2794 2678 BRAMY20120910 236 182..976 2679 BRAMY20121190 237 81..398 2680 BRAMY20121620 238 51..1688 2681 BRAMY20124260 239 95..1759 2682 BRAMY20134140 240 1..510 2683 BRAMY20135900 241 4..1053 2684 BRAMY20136210 242 1810..2145 2685 BRAMY20137560 243 2220..2795 2686 BRAMY20144620 244 892..1326 2687 BRAMY20147540 245 147..611 2688 BRAMY20148130 246 204..2138 2689 BRAMY20152110 247 1257..1580 2690 BRAMY20153110 248 11..763 2691 BRAMY20157820 249 94..1740 2692 BRAMY20160700 250 1686..2015 2693 BRAMY20162510 251 186..1757 2694 BRAMY20163250 252 96..719 2695 BRAMY20163270 253 531..1010 2696 BRAMY20167060 254 347..865 2697 BRAMY20167710 255 900..1532 2698 BRAMY20168920 256 91..1275 2699 BRAMY20170140 257 115..681 2700 BRAMY20174550 258 74..2179 2701 BRAMY20178640 259 226..2025 2702 BRAMY20181220 260 678..980 2703 BRAMY20182730 261 208..738 2704 BRAMY20183080 262 213..653 2705 BRAMY20184670 263 871..1548 2706 BRAMY20195090 264 2087..2476 2707 BRAMY20196000 265 50..439 2708 BRAMY20204450 266 34..462 2709 BRAMY20205740 267 177..554 2710 BRAMY20210400 268 131..703 2711 BRAMY20211390 269 1407..2303 2712 BRAMY20211420 270 131..2407 2713 BRAMY20213100 271 245..2026 2714 BRAMY20215230 272 207..515 2715 BRAMY20217460 273 612..1217 2716 BRAMY20218250 274 161..2167 2717 BRAMY20218670 275 338..652 2718 BRAMY20229800 276 1270..1662 2719 BRAMY20229840 277 1022..1678 2720 BRAMY20230600 278 614..1840 2721 BRAMY20231720 279 429..773 2722 BRAMY20240040 280 693..2660 2723 BRAMY20242470 281 1527..2243 2724 BRAMY20245300 282 59..2482 2725 BRAMY20247110 283 321..1382 2726 BRAMY20247280 284 611..925 2727 BRAMY20248490 285 1723..2079 2728 BRAMY20250240 286 1179..1619 2729 BRAMY20250320 287 18..323 2730 BRAMY20252180 288 1150..1506 2731 BRAMY20252720 289 595..1113 2732 BRAMY20260910 290 67..2646 2733 BRAMY20261680 291 298..1041 2734 BRAMY20266850 292 26..685 2735 BRAMY20267130 293 235..708 2736 BRAMY20268990 294 137..460 2737 BRAMY20270730 295 124..2118 2738 BRAMY20271400 296 177..>3011 2739 BRAMY20273960 297 48..1826 2740 BRAMY20277140 298 1135..1485 2741 BRAMY20277170 299 545..2221 2742 BRAMY20280720 300 103..489 2743 BRAMY20284910 301 1059..1415 2744 BRAMY20285160 302 1483..1977 2745 BRAMY20285930 303 811..1143 2746 BRAMY20286820 304 1463..1777 2747 BRAWH10000930 305 843..1454 2748 BRAWH20002320 306 162..716 2749 BRAWH20004600 307 66..1361 2750 BRAWH20011710 308 229..1872 2751 BRAWH20012390 309 71..562 2752 BRAWH20012410 310 291..593 2753 BRAWH20014920 311 353..1378 2754 BRAWH20015350 312 1285..1641 2755 BRAWH20015890 313 806..1837 2756 BRAWH20016620 314 1721..2254 2757 BRAWH20016660 315 51..1205 2758 BRAWH20016860 316 548..877 2759 BRAWH20017010 317 155..628 2760 BRAWH20018730 318 56..1570 2761 BRAWH20028110 319 123..1718 2762 BRAWH20029630 320 929..1276 2763 BRAWH20030250 321 264..1421 2764 BRAWH20064050 322 272..1591 2765 BRAWH20075700 323 349..1407 2766 BRAWH20096780 324 272..1840 2767 BRAWH20100690 325 1430..1849 2768 BRAWH20101360 326 163..852 2769 BRAWH20103180 327 1081..1659 2770 BRAWH20103290 328 71..2626 2771 BRAWH20105840 329 139..1083 2772 BRAWH20106180 330 628..933 2773 BRAWH20107540 331 1..540 2774 BRAWH20110660 332 156..578 2775 BRAWH20110790 333 1994..2338 2776 BRAWH20110960 334 74..1210 2777 BRAWH20111550 335 569..949 2778 BRAWH20112940 336 850..1968 2779 BRAWH20113430 337 135..869 2780 BRAWH20114000 338 72..1619 2781 BRAWH20117950 339 465..1568 2782 BRAWH20118230 340 146..565 2783 BRAWH20121640 341 98..1516 2784 BRAWH20122580 342 104..721 2785 BRAWH20122770 343 1283..1612 2786 BRAWH20125380 344 382..918 2787 BRAWH20126190 345 154..459 2788 BRAWH20126980 346 222..686 2789 BRAWH20128270 347 295..1020 2790 BRAWH20132190 348 157..561 2791 BRAWH20137480 349 273..1313 2792 BRAWH20138660 350 261..1376 2793 BRAWH20139410 351 13..354 2794 BRAWH20142340 352 99..413 2795 BRAWH20147290 353 460..810 2796 BRAWH20149340 354 442..1620 2797 BRAWH20155950 355 8..2074 2798 BRAWH20158530 356 138..1136 2799 BRAWH20160280 357 2093..2587 2800 BRAWH20162690 358 33..1085 2801 BRAWH20164460 359 345..>2067 2802 BRAWH20166790 360 224..571 2803 BRAWH20171030 361 152..1996 2804 BRAWH20173050 362 1272..1604 2805 BRAWH20182060 363 118..1740 2806 BRAWH20185060 364 248..607 2807 BRCAN10001490 365 60..452 2808 BRCAN20003460 366 239..1030 2809 BRCAN20006200 367 908..1234 2810 BRCAN20006390 368 252..743 2811 BRCAN20054490 369 345..1067 2812 BRCAN20060190 370 206..595 2813 BRCAN20064010 371 134..685 2814 BRCAN20071190 372 192..1586 2815 BRCAN20091560 373 190..2004 2816 BRCAN20103740 374 207..530 2817 BRCAN20124080 375 187..2079 2818 BRCAN20126130 376 580..897 2819 BRCAN20143700 377 14..817 2820 BRCAN20147880 378 121..519 2821 BRCAN20216690 379 66..383 2822 BRCAN20224720 380 549..1544 2823 BRCAN20237240 381 23..796 2824 BRCAN20263400 382 316..729 2825 BRCAN20273100 383 76..468 2826 BRCAN20273340 384 50..352 2827 BRCAN20273550 385 652..1848 2828 BRCAN20273640 386 131..1201 2829 BRCAN20275130 387 374..847 2830 BRCAN20279700 388 2372..2839 2831 BRCAN20280210 389 644..1393 2832 BRCAN20280360 390 265..1548 2833 BRCAN20280400 391 1280..1618 2834 BRCAN20283190 392 416..1321 2835 BRCAN20283380 393 93..533 2836 BRCAN20284600 394 97..549 2837 BRCAN20285450 395 118..567 2838 BRCOC10000870 396 186..602 2839 BRCOC20001860 397 1061..2179 2840 BRCOC20004040 398 383..1171 2841 BRCOC20004870 399 199..765 2842 BRCOC20006370 400 21..455 2843 BRCOC20008160 401 166..>2490 2844 BRCOC20008500 402 151..>2854 2845 BRCOC20020850 403 1371..1820 2846 BRCOC20021550 404 1121..2110 2847 BRCOC20023230 405 682..1500 2848 BRCOC20026640 406 148..516 2849 BRCOC20027510 407 369..1088 2850 BRCOC20031000 408 207..581 2851 BRCOC20031250 409 799..1122 2852 BRCOC20031870 410 375..1031 2853 BRCOC20035130 411 171..527 2854 BRCOC20037320 412 547..3384 2855 BRCOC20037400 413 152..493 2856 BRCOC20041750 414 230..535 2857 BRCOC20055420 415 99..1556 2858 BRCOC20059510 416 199..582 2859 BRCOC20074760 417 10..>1918 2860 BRCOC20077690 418 867..1202 2861 BRCOC20078640 419 849..1208 2862 BRCOC20090520 420 1157..1663 2863 BRCOC20091960 421 1371..1895 2864 BRCOC20093800 422 204..590 2865 BRCOC20099370 423 1..1890 2866 BRCOC20101230 424 94..810 2867 BRCOC20105100 425 2393..2716 2868 BRCOC20107300 426 709..1086 2869 BRCOC20110100 427 369..713 2870 BRCOC20114180 428 167..487 2871 BRCOC20117690 429 152..781 2872 BRCOC20119960 430 147..500 2873 BRCOC20121720 431 26..2983 2874 BRCOC20122290 432 92..448 2875 BRCOC20128130 433 150..1364 2876 BRCOC20134480 434 587..1060 2877 BRCOC20135730 435 1603..2064 2878 BRCOC20136750 436 2876..3229 2879 BRCOC20144000 437 64..459 2880 BRCOC20147480 438 228..578 2881 BRCOC20148330 439 169..1290 2882 BRCOC20155970 440 111..632 2883 BRCOC20158240 441 1357..2178 2884 BRCOC20176520 442 185..1153 2885 BRCOC20178270 443 244..1257 2886 BRCOC20178560 444 65..1000 2887 BRHIP10001290 445 838..1731 2888 BRHIP10001740 446 148..594 2889 BRHIP20000870 447 1235..1540 2890 BRHIP20001630 448 287..1486 2891 BRHIP20003120 449 170..1951 2892 BRHIP20005340 450 597..1853 2893 BRHIP20005530 451 30..1052 2894 BRHIP20096170 452 119..817 2895 BRHIP20096850 453 311..1582 2896 BRHIP20103090 454 1345..1737 2897 BRHIP20104440 455 166..576 2898 BRHIP20105710 456 1056..1466 2899 BRHIP20106100 457 314..1060 2900 BRHIP20107440 458 827..1528 2901 BRHIP20110800 459 577..1083 2902 BRHIP20111200 460 261..578 2903 BRHIP20115080 461 762..1751 2904 BRHIP20115760 462 877..1182 2905 BRHIP20118380 463 2..316 2906 BRHIP20118910 464 82..426 2907 BRHIP20119330 465 420..2564 2908 BRHIP20121410 466 68..505 2909 BRHIP20123140 467 73..432 2910 BRHIP20129720 468 934..1809 2911 BRHIP20132860 469 1..897 2912 BRHIP20135100 470 423..743 2913 BRHIP20137230 471 71..1180 2914 BRHIP20139720 472 33..3254 2915 BRHIP20140630 473 3521..3922 2916 BRHIP20142850 474 259..612 2917 BRHIP20143730 475 229..1638 2918 BRHIP20143860 476 1159..1638 2919 BRHIP20149540 477 155..544 2920 BRHIP20153560 478 1134..1445 2921 BRHIP20153600 479 40..675 2922 BRHIP20167880 480 183..656 2923 BRHIP20169680 481 27..347 2924 BRHIP20169900 482 68..502 2925 BRHIP20170100 483 166..936 2926 BRHIP20173150 484 494..820 2927 BRHIP20174040 485 71..2923 2928 BRHIP20175420 486 3..872 2929 BRHIP20176420 487 914..1756 2930 BRHIP20179200 488 2532..2870 2931 BRHIP20180140 489 1028..1345 2932 BRHIP20183690 490 148..1620 2933 BRHIP20186120 491 322..723 2934 BRHIP20186500 492 3089..3727 2935 BRHIP20189980 493 247..1002 2936 BRHIP20190070 494 65..433 2937 BRHIP20191490 495 1929..2270 2938 BRHIP20191770 496 191..502 2939 BRHIP20191860 497 282..2084 2940 BRHIP20194940 498 119..1312 2941 BRHIP20195890 499 1002..1376 2942 BRHIP20196410 500 2371..2706 2943 BRHIP20198190 501 2979..3407 2944 BRHIP20205090 502 270..593 2945 BRHIP20207430 503 370..687 2946 BRHIP20207990 504 90..1628 2947 BRHIP20208270 505 967..1353 2948 BRHIP20208420 506 103..462 2949 BRHIP20208590 507 212..607 2950 BRHIP20214950 508 1637..2020 2951 BRHIP20217620 509 2731..3087 2952 BRHIP20218580 510 1930..2589 2953 BRHIP20222280 511 269..1768 2954 BRHIP20227080 512 1613..2011 2955 BRHIP20230710 513 198..554 2956 BRHIP20232290 514 110..502 2957 BRHIP20233090 515 1782..2105 2958 BRHIP20234380 516 15..1079 2959 BRHIP20236950 517 29..>2580 2960 BRHIP20238600 518 154..729 2961 BRHIP20238690 519 51..383 2962 BRHIP20238880 520 13..2625 2963 BRHIP20240460 521 2151..2540 2964 BRHIP20243470 522 2929..3579 2965 BRHIP20249110 523 134..2887 2966 BRHIP20252450 524 123..>3738 2967 BRHIP20253660 525 255..1031 2968 BRHIP20254480 526 362..994 2969 BRHIP20277620 527 124..1074 2970 BRHIP20283030 528 219..4088 2971 BRHIP20284800 529 217..606 2972 BRHIP20285830 530 611..1321 2973 BRHIP20285930 531 105..779 2974 BRHIP30001110 532 1740..2294 2975 BRHIP30004570 533 189..1034 2976 BRHIP30004880 534 191..2902 2977 BRSSN10000920 535 1850..2215 2978 BRSSN20003120 536 359..>2933 2979 BRSSN20006340 537 937..1401 2980 BRSSN20013420 538 111..2741 2981 BRSSN20014260 539 167..1069 2982 BRSSN20015030 540 105..458 2983 BRSSN20015790 541 542..1639 2984 BRSSN20018690 542 110..463 2985 BRSSN20021600 543 13..1497 2986 BRSSN20028570 544 424..726 2987 BRSSN20038200 545 86..1555 2988 BRSSN20038410 546 187..852 2989 BRSSN20039370 547 900..1628 2990 BRSSN20043040 548 1959..2342 2991 BRSSN20046570 549 18..368 2992 BRSSN20046790 550 253..1014 2993 BRSSN20046860 551 406..1461 2994 BRSSN20066110 552 725..1165 2995 BRSSN20097020 553 1352..2092 2996 BRSSN20101100 554 1851..2330 2997 BRSSN20105870 555 8..3064 2998 BRSSN20105960 556 183..497 2999 BRSSN20108300 557 92..415 3000 BRSSN20117990 558 733..1428 3001 BRSSN20120810 559 770..1687 3002 BRSSN20121030 560 18..890 3003 BRSSN20137020 561 1097..1429 3004 BRSSN20142940 562 1411..1803 3005 BRSSN20146100 563 181..2376 3006 BRSSN20151990 564 15..401 3007 BRSSN20152380 565 17..418 3008 BRSSN20159070 566 393..728 3009 BRSSN20159820 567 867..1661 3010 BRSSN20169050 568 118..636 3011 BRSSN20176820 569 13..1917 3012 BRSSN20177570 570 303..2651 3013 BRSSN20187310 571 163..1332 3014 BRSTN10000830 572 216..959 3015 BRSTN20000580 573 617..1672 3016 BRSTN20002200 574 159..515 3017 BRSTN20005360 575 43..1173 3018 BRTHA20000570 576 641..988 3019 BRTHA20004740 577 192..1082 3020 BRTHA20046290 578 1657..2298 3021 BRTHA20046390 579 191..571 3022 BRTHA20046420 580 446..835 3023 CD34C30001250 581 59..>3188 3024 CD34C30003140 582 458..2803 3025 CD34C30004240 583 430..1290 3026 CD34C30004940 584 970..1299 3027 COLON10001350 585 18..1544 3028 COLON20043180 586 451..867 3029 COLON20093370 587 1261..1779 3030 CTONG10000100 588 90..1118 3031 CTONG10000220 589 191..847 3032 CTONG10000620 590 94..2943 3033 CTONG10000930 591 18..2621 3034 CTONG10000940 592 182..868 3035 CTONG10001650 593 1916..2512 3036 CTONG10002770 594 182..>3049 3037 CTONG20002180 595 90..554 3038 CTONG20004690 596 301..885 3039 CTONG20009770 597 321..3287 3040 CTONG20014280 598 176..1723 3041 CTONG20027090 599 280..2370 3042 CTONG20028410 600 600..2936 3043 CTONG20038890 601 961..1371 3044 CTONG20049410 602 157..669 3045 CTONG20050280 603 157..1944 3046 CTONG20052650 604 1210..1647 3047 CTONG20052900 605 130..1548 3048 CTONG20075860 606 63..1391 3049 CTONG20076130 607 11..994 3050 CTONG20077790 608 270..635 3051 CTONG20082690 609 75..896 3052 CTONG20085950 610 905..2125 3053 CTONG20091080 611 166..717 3054 CTONG20091320 612 1223..1627 3055 CTONG20092570 613 690..1601 3056 CTONG20092580 614 1555..1920 3057 CTONG20092680 615 365..823 3058 CTONG20092700 616 224..928 3059 CTONG20093950 617 205..2388 3060 CTONG20095270 618 1147..1611 3061 CTONG20095290 619 312..749 3062 CTONG20095340 620 109..2631 3063 CTONG20096430 621 311..1384 3064 CTONG20096750 622 738..1184 3065 CTONG20097660 623 133..876 3066 CTONG20098440 624 206..1132 3067 CTONG20099380 625 1417..1806 3068 CTONG20099550 626 74..1939 3069 CTONG20099630 627 99..2060 3070 CTONG20100240 628 620..2155 3071 CTONG20101480 629 13..411 3072 CTONG20103480 630 30..356 3073 CTONG20105080 631 28..1260 3074 CTONG20105660 632 75..674 3075 CTONG20106230 633 2015..>3067 3076 CTONG20106520 634 1693..3147 3077 CTONG20108210 635 234..1319 3078 CTONG20114290 636 388..3225 3079 CTONG20114740 637 1191..1832 3080 CTONG20118150 638 144..2831 3081 CTONG20118250 639 52..840 3082 CTONG20119200 640 2128..2637 3083 CTONG20120770 641 2946..3341 3084 CTONG20121010 642 143..1732 3085 CTONG20121580 643 97..>2930 3086 CTONG20124010 644 206..1369 3087 CTONG20124220 645 177..2477 3088 CTONG20124470 646 701..1237 3089 CTONG20124730 647 894..1280 3090 CTONG20125540 648 616..1071 3091 CTONG20125640 649 756..1688 3092 CTONG20126070 650 42..2843 3093 CTONG20127450 651 2271..2624 3094 CTONG20128430 652 330..2180 3095 CTONG20128470 653 916..1479 3096 CTONG20129960 654 118..3249 3097 CTONG20131490 655 1191..1553 3098 CTONG20131560 656 242..>2879 3099 CTONG20132220 657 1155..1598 3100 CTONG20133390 658 679..2304 3101 CTONG20133480 659 86..391 3102 CTONG20133520 660 128..2140 3103 CTONG20136300 661 1078..1521 3104 CTONG20138030 662 3061..3396 3105 CTONG20139070 663 2508..2819 3106 CTONG20139340 664 1182..1535 3107 CTONG20139860 665 28..2169 3108 CTONG20140320 666 2454..2786 3109 CTONG20140580 667 74..1180 3110 CTONG20141650 668 190..570 3111 CTONG20143690 669 169..2583 3112 CTONG20146300 670 1195..1674 3113 CTONG20146970 671 1201..1536 3114 CTONG20147050 672 1304..1648 3115 CTONG20149460 673 149..1942 3116 CTONG20149950 674 42..371 3117 CTONG20150910 675 792..1130 3118 CTONG20153300 676 755..2338 3119 CTONG20153580 677 488..1858 3120 CTONG20155180 678 486..>3005 3121 CTONG20155400 679 1940..2458 3122 CTONG20156780 680 33..3104 3123 CTONG20158040 681 152..1297 3124 CTONG20158150 682 66..2057 3125 CTONG20158660 683 171..2258 3126 CTONG20159530 684 231..1094 3127 CTONG20160560 685 79..>2796 3128 CTONG20161850 686 27..734 3129 CTONG20162170 687 156..734 3130 CTONG20163550 688 772..1134 3131 CTONG20164990 689 1343..1753 3132 CTONG20165050 690 1575..2018 3133 CTONG20186320 691 78..1595 3134 CTONG20200310 692 2..2254 3135 CTONG20265130 693 419..892 3136 CTONG20267700 694 2046..2432 3137 CTONG20273610 695 513..923 3138 D3OST10001090 696 50..1462 3139 D3OST10002670 697 77..853 3140 D3OST10002700 698 84..461 3141 D3OST20006180 699 148..2259 3142 D3OST20006540 700 140..442 3143 D3OST20007340 701 369..1220 3144 D3OST20013280 702 756..1118 3145 D3OST20024170 703 1373..1714 3146 D3OST20024360 704 1984..2361 3147 D3OST20024520 705 3..422 3148 D3OST20036070 706 122..1039 3149 D3OST20037970 707 256..735 3150 D3OST20038560 708 1976..2350 3151 D3OST30002580 709 1509..2957 3152 D3OST30002910 710 1811..2248 3153 D6OST20003580 711 1760..2167 3154 D6OST20004450 712 1513..2547 3155 D6OST20005070 713 2835..3398 3156 D9OST20000310 714 239..637 3157 D9OST20002780 715 644..1360 3158 D9OST20015470 716 187..1386 3159 D9OST20023970 717 872..1327 3160 D9OST20026730 718 145..3159 3161 D9OST20031370 719 616..1251 3162 D9OST20033970 720 24..1181 3163 D9OST20035800 721 524..1057 3164 D9OST20035940 722 217..867 3165 D9OST20040180 723 189..1127 3166 DFNES10000030 724 897..1322 3167 DFNES10001850 725 471..899 3168 DFNES20001530 726 26..382 3169 DFNES20010910 727 159..1136 3170 DFNES20014040 728 148..1272 3171 DFNES20025880 729 1080..1415 3172 DFNES20031920 730 631..1104 3173 DFNES20037420 731 186..2090 3174 DFNES20055270 732 159..818 3175 DFNES20071130 733 248..1156 3176 DFNES20082800 734 258..698 3177 FCBBF10000240 735 507..2942 3178 FCBBF10000380 736 1024..1344 3179 FCBBF10000630 737 533..1654 3180 FCBBF10000770 738 56..1810 3181 FCBBF10001150 739 351..2555 3182 FCBBF10001210 740 38..1066 3183 FCBBF10001550 741 60..653 3184 FCBBF10001710 742 322..2133 3185 FCBBF10001820 743 10..1032 3186 FCBBF10002430 744 349..1158 3187 FCBBF10002700 745 189..551 3188 FCBBF10002800 746 485..2818 3189 FCBBF10003220 747 479..832 3190 FCBBF10003670 748 139..1266 3191 FCBBF10003740 749 407..2365 3192 FCBBF10003760 750 1044..1358 3193 FCBBF10003770 751 242..>3001 3194 FCBBF10004120 752 142..816 3195 FCBBF10004370 753 432..1511 3196 FCBBF10005060 754 1340..2323 3197 FCBBF10005460 755 179..2092 3198 FCBBF10005500 756 1518..2123 3199 FCBBF10005740 757 954..1667 3200 FCBBF20006780 758 356..679 3201 FCBBF20014270 759 49..315 3202 FCBBF20023700 760 251..589 3203 FCBBF20032970 761 845..1186 3204 FCBBF20035280 762 13..393 3205 FCBBF20042170 763 186..1337 3206 FCBBF20042560 764 115..576 3207 FCBBF20049300 765 32..631 3208 FCBBF20051220 766 523..948 3209 FCBBF20054280 767 119..535 3210 FCBBF20056370 768 57..704 3211 FCBBF20059090 769 928..1245 3212 FCBBF20064520 770 368..1243 3213 FCBBF20067810 771 68..1231 3214 FCBBF20068820 772 74..712 3215 FCBBF20071860 773 384..911 3216 FCBBF20072650 774 1471..1944 3217 FCBBF20075560 775 730..1086 3218 FCBBF20076330 776 684..998 3219 FCBBF30001840 777 1503..1832 3220 FCBBF30007680 778 9..2117 3221 FCBBF30008470 779 1157..1504 3222 FCBBF30010810 780 149..1483 3223 FCBBF30012350 781 419..1507 3224 FCBBF30012810 782 372..>2409 3225 FCBBF30013770 783 375..2795 3226 FCBBF30015940 784 24..>2507 3227 FCBBF30016320 785 990..1877 3228 FCBBF30016570 786 574..999 3229 FCBBF30018550 787 231..>3402 3230 FCBBF30019120 788 54..398 3231 FCBBF30024750 789 126..560 3232 FCBBF30025560 790 171..1301 3233 FCBBF30028180 791 258..830 3234 FCBBF30033050 792 7..1089 3235 FCBBF30039020 793 955..2727 3236 FCBBF30049550 794 222..>4213 3237 FCBBF30052180 795 2829..4214 3238 FCBBF30054440 796 33..2822 3239 FCBBF30057290 797 143..2068 3240 FCBBF30062880 798 1135..>3256 3241 FCBBF30070770 799 1049..2113 3242 FCBBF30071520 800 280..735 3243 FCBBF30078290 801 280..1875 3244 FCBBF30083620 802 125..1159 3245 FCBBF30083820 803 298..774 3246 FCBBF30086440 804 192..863 3247 FCBBF30090690 805 545..1657 3248 FCBBF30095260 806 204..686 3249 FCBBF30123470 807 1084..1614 3250 FCBBF30129630 808 257..973 3251 FCBBF30170590 809 1313..1672 3252 FCBBF30172550 810 1350..1703 3253 FCBBF30175310 811 120..1280 3254 FCBBF30178730 812 348..833 3255 FCBBF30189490 813 1935..2468 3256 FCBBF30190850 814 43..1560 3257 FCBBF30195640 815 577..>2751 3258 FCBBF30199610 816 972..1391 3259 FCBBF30215060 817 42..446 3260 FCBBF30225660 818 231..2750 3261 FCBBF30233680 819 28..>4395 3262 FCBBF30238870 820 587..2761 3263 FCBBF30240020 821 248..1747 3264 FCBBF30240960 822 465..1520 3265 FCBBF30242250 823 271..>2723 3266 FCBBF30243640 824 339..665 3267 FCBBF30246230 825 1893..2357 3268 FCBBF30246630 826 19..2070 3269 FCBBF30247930 827 558..1187 3270 FCBBF30250730 828 116..>2647 3271 FCBBF30251420 829 2590..2904 3272 FCBBF30252520 830 27..380 3273 FCBBF30252800 831 139..1110 3274 FCBBF30252850 832 45..1022 3275 FCBBF30262360 833 51..446 3276 FCBBF30262510 834 36..2327 3277 FCBBF30266780 835 2080..2382 3278 FCBBF30266920 836 5..316 3279 FCBBF30278630 837 492..821 3280 FCBBF30279030 838 1653..2447 3281 FCBBF30281880 839 83..2221 3282 FCBBF30284720 840 230..751 3283 FCBBF30285280 841 185..3043 3284 FCBBF40001420 842 364..681 3285 FCBBF40001730 843 105..932 3286 FCBBF40005480 844 119..589 3287 FEBRA10001880 845 494..2236 3288 FEBRA10001900 846 6..389 3289 FEBRA20002100 847 375..1064 3290 FEBRA20003210 848 10..414 3291 FEBRA20004620 849 297..1568 3292 FEBRA20007620 850 61..2400 3293 FEBRA20009090 851 667..1032 3294 FEBRA20010120 852 608..1216 3295 FEBRA20017050 853 1775..2197 3296 FEBRA20018280 854 16..678 3297 FEBRA20018690 855 664..981 3298 FEBRA20024100 856 68..2659 3299 FEBRA20025270 857 116..>2317 3300 FEBRA20025520 858 669..1133 3301 FEBRA20026110 859 233..2692 3302 FEBRA20026280 860 54..623 3303 FEBRA20027810 861 155..2740 3304 FEBRA20029860 862 29..757 3305 FEBRA20034360 863 1288..2013 3306 FEBRA20034680 864 240..1955 3307 FEBRA20037260 865 2376..2702 3308 FEBRA20037500 866 10..1308 3309 FEBRA20040530 867 76..1407 3310 FEBRA20042190 868 1590..1925 3311 FEBRA20052910 869 1136..1486 3312 FEBRA20060610 870 599..1201 3313 FEBRA20072120 871 106..2877 3314 FEBRA20079310 872 2384..2806 3315 FEBRA20080810 873 679..1401 3316 FEBRA20082010 874 106..1779 3317 FEBRA20082100 875 1042..1524 3318 FEBRA20086620 876 215..1591 3319 FEBRA20088360 877 2964..3521 3320 FEBRA20090290 878 383..823 3321 FEBRA20092890 879 198..2297 3322 FEBRA20093520 880 651..1070 3323 FEBRA20095140 881 264..>2245 3324 FEBRA20095880 882 1872..2186 3325 FEBRA20097310 883 74..2101 3326 FEBRA20098460 884 291..686 3327 FEBRA20111460 885 859..1221 3328 FEBRA20113560 886 22..558 3329 FEBRA20125070 887 10..1002 3330 FEBRA20130190 888 131..1192 3331 FEBRA20132740 889 770..1111 3332 FEBRA20140100 890 1664..2377 3333 FEBRA20144170 891 342..1976 3334 FEBRA20145780 892 1262..1564 3335 FEBRA20161120 893 173..484 3336 FEBRA20166540 894 101..511 3337 FEBRA20167390 895 429..869 3338 FEBRA20171380 896 338..2002 3339 FEBRA20174410 897 125..2029 3340 FEBRA20176800 898 1320..1877 3341 FEBRA20184330 899 36..533 3342 FEBRA20192420 900 2120..3799 3343 FEBRA20195820 901 175..678 3344 FEBRA20196370 902 353..2032 3345 FEBRA20196630 903 482..2359 3346 FEBRA20197110 904 632..1222 3347 FEBRA20204000 905 1958..2482 3348 FEBRA20204060 906 366..728 3349 FEBRA20211710 907 282..929 3350 FEBRA20214970 908 620..1264 3351 FEBRA20215500 909 726..1256 3352 FEBRA20216360 910 1398..1904 3353 FEBRA20222040 911 954..1391 3354 FEBRA20223220 912 1254..1898 3355 FEBRA20225040 913 13..1692 3356 FEBRA20226010 914 1439..1933 3357 FEBRA20229560 915 37..381 3358 FEBRA20229630 916 184..987 3359 FEBRA20232850 917 774..1193 3360 FEBRA20233770 918 64..636 3361 FEBRA20235500 919 1206..>2520 3362 FEBRA20237640 920 331..933 3363 FEHRT20003250 921 173..1243 3364 FELNG20002410 922 1257..1577 3365 HCASM10000500 923 300..1754 3366 HCHON10001760 924 238..1182 3367 HCHON20000380 925 210..644 3368 HCHON20001560 926 565..1611 3369 HCHON20002260 927 694..1389 3370 HCHON20003220 928 23..>2278 3371 HCHON20003440 929 1982..>2519 3372 HCHON20007380 930 163..1248 3373 HCHON20007510 931 189..2636 3374 HCHON20008150 932 204..>2358 3375 HCHON20008180 933 671..1087 3376 HCHON20008320 934 1240..>2284 3377 HCHON20008980 935 578..904 3378 HCHON20009350 936 63..422 3379 HCHON20009560 937 1644..2489 3380 HCHON20010990 938 531..1085 3381 HCHON20011160 939 839..1156 3382 HCHON20014970 940 302..2143 3383 HCHON20015230 941 950..1453 3384 HCHON20015350 942 647..>2887 3385 HCHON20015980 943 100..1413 3386 HCHON20016040 944 3..323 3387 HCHON20016650 945 44..3418 3388 HCHON20022470 946 1526..1978 3389 HCHON20035130 947 1192..1614 3390 HCHON20036420 948 356..811 3391 HCHON20036760 949 228..647 3392 HCHON20040020 950 257..1288 3393 HCHON20043590 951 263..712 3394 HCHON20059870 952 198..2297 3395 HCHON20064590 953 66..2063 3396 HCHON20067220 954 313..642 3397 HCHON20067700 955 160..591 3398 HCHON20068410 956 116..>2811 3399 HCHON20068710 957 335..688 3400 HCHON20074820 958 19..735 3401 HCHON20076500 959 1778..2473 3402 HCHON20086720 960 133..864 3403 HCHON20097490 961 1434..2819 3404 HCHON20100740 962 138..1277 3405 HEART20003060 963 109..1407 3406 HEART20005410 964 302..784 3407 HEART20017730 965 19..2064 3408 HEART20021840 966 22..507 3409 HEART20025980 967 293..1180 3410 HEART20034320 968 31..2013 3411 HEART20037810 969 803..1108 3412 HEART20049400 970 178..549 3413 HEART20049410 971 44..613 3414 HEART20049800 972 15..509 3415 HEART20061950 973 153..1961 3416 HEART20063340 974 220..1281 3417 HEART20067870 975 256..855 3418 HEART20067890 976 3..338 3419 HEART20072310 977 47..1057 3420 HEART20074430 978 205..540 3421 HEART20077670 979 90..1223 3422 HEART20083640 980 192..1376 3423 HEART20089940 981 150..1523 3424 HEART20090000 982 197..2116 3425 HEART20095990 983 523..1077 3426 HHDPC10000650 984 920..1531 3427 HHDPC10000830 985 110..520 3428 HHDPC20001040 986 2080..2442 3429 HHDPC20006920 987 1758..2066 3430 HHDPC20014320 988 5..526 3431 HHDPC20030490 989 71..529 3432 HHDPC20031130 990 369..2249 3433 HHDPC20034390 991 94..705 3434 HHDPC20034720 992 167..868 3435 HHDPC20057420 993 44..484 3436 HHDPC20057940 994 1..393 3437 HHDPC20064600 995 231..1493 3438 HHDPC20068620 996 515..1816 3439 HHDPC20084140 997 163..2109 3440 HHDPC20091140 998 160..504 3441 HHDPC20091780 999 49..1623 3442 HHDPC20092080 1000 133..702 3443 HHDPC20095280 1001 332..745 3444 HLUNG10000550 1002 729..1058 3445 HLUNG20016330 1003 86..>1958 3446 HLUNG20016770 1004 919..1242 3447 HLUNG20017120 1005 644..1144 3448 HLUNG20023340 1006 228..1181 3449 HLUNG20033780 1007 156..2285 3450 HLUNG20084390 1008 542..997 3451 IMR3220002430 1009 34..1176 3452 KIDNE20002520 1010 22..1593 3453 KIDNE20003940 1011 187..1986 3454 KIDNE20006780 1012 164..829 3455 KIDNE20007210 1013 27..350 3456 KIDNE20007770 1014 27..1415 3457 KIDNE20008010 1015 127..>1986 3458 KIDNE20009470 1016 9..>2664 3459 KIDNE20011170 1017 347..817 3460 KIDNE20011400 1018 1798..2334 3461 KIDNE20013730 1019 373..777 3462 KIDNE20017130 1020 226..1740 3463 KIDNE20018730 1021 35..631 3464 KIDNE20018970 1022 232..546 3465 KIDNE20020150 1023 215..1645 3466 KIDNE20021680 1024 140..1096 3467 KIDNE20021910 1025 15..2018 3468 KIDNE20021980 1026 1578..1910 3469 KIDNE20022620 1027 112..2277 3470 KIDNE20024830 1028 1912..>2715 3471 KIDNE20027250 1029 359..955 3472 KIDNE20027950 1030 97..543 3473 KIDNE20028390 1031 31..519 3474 KIDNE20028720 1032 70..1122 3475 KIDNE20028830 1033 107..1258 3476 KIDNE20029800 1034 1056..1358 3477 KIDNE20067330 1035 930..1865 3478 KIDNE20079440 1036 192..539 3479 KIDNE20096280 1037 266..1354 3480 KIDNE20096470 1038 31..639 3481 KIDNE20100070 1039 471..2204 3482 KIDNE20100840 1040 167..778 3483 KIDNE20101370 1041 9..503 3484 KIDNE20101510 1042 62..1795 3485 KIDNE20102650 1043 322..1614 3486 KIDNE20102710 1044 791..1501 3487 KIDNE20104300 1045 188..>1957 3488 KIDNE20106740 1046 55..411 3489 KIDNE20107390 1047 85..399 3490 KIDNE20107500 1048 180..641 3491 KIDNE20107620 1049 222..2213 3492 KIDNE20109730 1050 57..1121 3493 KIDNE20109890 1051 254..>2578 3494 KIDNE20112000 1052 430..750 3495 KIDNE20115080 1053 76..1092 3496 KIDNE20118580 1054 962..1387 3497 KIDNE20120090 1055 1334..1813 3498 KIDNE20121880 1056 192..866 3499 KIDNE20122910 1057 1623..2006 3500 KIDNE20124400 1058 532..2499 3501 KIDNE20125630 1059 67..504 3502 KIDNE20126010 1060 991..1407 3503 KIDNE20126130 1061 285..701 3504 KIDNE20127100 1062 265..1944 3505 KIDNE20127450 1063 570..1088 3506 KIDNE20127750 1064 175..1488 3507 KIDNE20130450 1065 177..512 3508 KIDNE20131580 1066 194..1912 3509 KIDNE20132180 1067 894..1256 3510 KIDNE20137340 1068 889..1710 3511 KIDNE20138010 1069 1564..2046 3512 KIDNE20141190 1070 71..856 3513 KIDNE20144890 1071 385..738 3514 KIDNE20148900 1072 487..981 3515 KIDNE20163880 1073 327..1364 3516 KIDNE20180710 1074 379..855 3517 KIDNE20181660 1075 1109..1564 3518 KIDNE20182690 1076 553..2019 3519 KIDNE20186780 1077 837..1541 3520 KIDNE20190740 1078 321..653 3521 LIVER10001260 1079 1413..1748 3522 LIVER10004790 1080 112..1113 3523 LIVER20002160 1081 79..1944 3524 LIVER20011130 1082 898..1569 3525 LIVER20011910 1083 27..425 3526 LIVER20028420 1084 1305..1724 3527 LIVER20035110 1085 551..940 3528 LIVER20035680 1086 873..1283 3529 LIVER20038540 1087 6..308 3530 LIVER20045650 1088 2359..2886 3531 LIVER20055200 1089 82..618 3532 LIVER20055440 1090 1611..2240 3533 LIVER20059810 1091 1597..1899 3534 LIVER20062510 1092 631..999 3535 LIVER20064100 1093 279..785 3536 LIVER20064690 1094 172..1161 3537 LIVER20075680 1095 2568..2939 3538 LIVER20080530 1096 44..1426 3539 LIVER20084730 1097 240..788 3540 LIVER20085800 1098 99..416 3541 LIVER20087060 1099 140..2056 3542 LIVER20087510 1100 478..1200 3543 LIVER20091180 1101 18..374 3544 MAMGL10000830 1102 40..1551 3545 MESAN10001260 1103 80..2137 3546 MESAN20004570 1104 354..>2589 3547 MESAN20014500 1105 78..1976 3548 MESAN20025190 1106 1679..2323 3549 MESAN20027090 1107 144..653 3550 MESAN20029400 1108 210..>2998 3551 MESAN20031900 1109 138..2348 3552 MESAN20035290 1110 99..797 3553 MESAN20036460 1111 1203..1844 3554 MESAN20038510 1112 639..1016 3555 MESAN20089360 1113 386..802 3556 MESAN20101140 1114 250..504 3557 MESAN20103120 1115 143..1201 3558 MESAN20106640 1116 71..712 3559 MESAN20115970 1117 234..644 3560 MESAN20121130 1118 7..942 3561 MESAN20125860 1119 1396..1875 3562 MESAN20127350 1120 297..1724 3563 MESAN20130220 1121 106..1626 3564 MESAN20132110 1122 1363..2433 3565 MESAN20136110 1123 188..1582 3566 MESAN20138450 1124 249..647 3567 MESAN20139360 1125 195..611 3568 MESAN20141920 1126 250..2724 3569 MESAN20152770 1127 64..585 3570 MESAN20153910 1128 141..443 3571 MESAN20154010 1129 24..620 3572 MESAN20157080 1130 1336..1677 3573 MESAN20161590 1131 767..1081 3574 MESAN20164090 1132 273..2471 3575 MESAN20171520 1133 103..774 3576 MESAN20174170 1134 1375..1743 3577 MESAN20182090 1135 5..>2440 3578 MESAN20186700 1136 1333..>3058 3579 NESOP10001080 1137 149..1489 3580 NOVAR10000150 1138 1470..1895 3581 NOVAR10000910 1139 247..1482 3582 NOVAR10001020 1140 136..519 3583 NOVAR20000380 1141 422..844 3584 NOVAR20003520 1142 898..1377 3585 NT2NE20003740 1143 28..555 3586 NT2NE20010050 1144 1240..1725 3587 NT2NE20010210 1145 231..626 3588 NT2NE20010400 1146 923..1546 3589 NT2NE20010490 1147 105..1499 3590 NT2NE20015240 1148 251..646 3591 NT2NE20021620 1149 785..2266 3592 NT2NE20043780 1150 815..1285 3593 NT2NE20053580 1151 9..413 3594 NT2NE20068130 1152 237..1601 3595 NT2NE20072200 1153 94..855 3596 NT2NE20074250 1154 9..377 3597 NT2NE20080170 1155 129..2219 3598 NT2NE20089610 1156 1976..2329 3599 NT2NE20089970 1157 150..488 3600 NT2NE20108540 1158 504..806 3601 NT2NE20110360 1159 44..415 3602 NT2NE20118960 1160 197..2044 3603 NT2NE20122430 1161 1474..2016 3604 NT2NE20124480 1162 135..482 3605 NT2NE20125050 1163 59..1462 3606 NT2NE20130190 1164 728..1438 3607 NT2NE20131890 1165 2276..2611 3608 NT2NE20132170 1166 585..1694 3609 NT2NE20142210 1167 177..2585 3610 NT2NE20146810 1168 387..707 3611 NT2NE20152750 1169 190..726 3612 NT2NE20155110 1170 486..893 3613 NT2NE20156260 1171 286..633 3614 NT2NE20157470 1172 222..1199 3615 NT2NE20158600 1173 348..749 3616 NT2NE20159740 1174 68..664 3617 NT2NE20172590 1175 799..1131 3618 NT2NE20174800 1176 525..860 3619 NT2NE20174920 1177 53..538 3620 NT2NE20177520 1178 636..2108 3621 NT2NE20181650 1179 496..1605 3622 NT2NE20183760 1180 1087..1548 3623 NT2NE20184900 1181 2947..>3371 3624 NT2NE20187390 1182 170..580 3625 NT2RI20001330 1183 84..1901 3626 NT2RI20003480 1184 166..1905 3627 NT2RI20005750 1185 66..1088 3628 NT2RI20009870 1186 127..1053 3629 NT2RI20022600 1187 1040..1621 3630 NT2RI20023160 1188 165..947 3631 NT2RI20023590 1189 666..1058 3632 NT2RI20023910 1190 546..2945 3633 NT2RI20025400 1191 315..902 3634 NT2RI20025640 1192 989..1660 3635 NT2RI20028470 1193 140..1297 3636 NT2RI20036670 1194 334..852 3637 NT2RI20040930 1195 362..1075 3638 NT2RI20040990 1196 124..2169 3639 NT2RI20041880 1197 79..1368 3640 NT2RI20046080 1198 36..824 3641 NT2RI20048840 1199 330..1349 3642 NT2RI20050960 1200 223..1701 3643 NT2RI20054050 1201 172..2154 3644 NT2RI20055790 1202 489..1178 3645 NT2RI20056700 1203 115..1491 3646 NT2RI20069730 1204 607..1209 3647 NT2RI20076290 1205 145..1197 3648 NT2RI20086220 1206 67..1068 3649 NT2RI20091730 1207 113..>2585 3650 NT2RI20091940 1208 699..1181 3651 NT2RI20198260 1209 70..372 3652 NT2RI20203900 1210 176..481 3653 NT2RI20207030 1211 33..1181 3654 NT2RI20216250 1212 812..1312 3655 NT2RI20240080 1213 176..1090 3656 NT2RI20244600 1214 195..1010 3657 NT2RI20244960 1215 161..595 3658 NT2RI20250750 1216 263..1186 3659 NT2RI20252550 1217 927..1622 3660 NT2RI20273230 1218 40..1215 3661 NT2RP60000770 1219 1147..2223 3662 NT2RP60000850 1220 44..>2927 3663 NT2RP70010740 1221 23..466 3664 NT2RP70027380 1222 86..3466 3665 NT2RP70032610 1223 1348..2514 3666 NT2RP70036880 1224 145..1491 3667 NT2RP70037240 1225 221..2002 3668 NT2RP70043480 1226 134..1912 3669 NT2RP70044280 1227 91..1506 3670 NT2RP70045590 1228 29..877 3671 NT2RP70056750 1229 177..3578 3672 NT2RP70062230 1230 310..2748 3673 NT2RP70063950 1231 499..3750 3674 NT2RP70072690 1232 1108..1545 3675 NT2RP70075240 1233 308..814 3676 NT2RP70077660 1234 2025..2441 3677 NT2RP70078420 1235 622..2025 3678 NT2RP70080850 1236 59..4003 3679 NT2RP70081610 1237 41..730 3680 NT2RP70085440 1238 1856..2317 3681 NT2RP70102350 1239 225..1043 3682 NT2RP70105210 1240 132..1880 3683 NT2RP70110860 1241 803..1129 3684 NT2RP70111320 1242 271..627 3685 NT2RP70122910 1243 789..1112 3686 NT2RP70125160 1244 10..624 3687 NT2RP70130020 1245 372..692 3688 NT2RP70133740 1246 109..972 3689 NT2RP70134990 1247 24..392 3690 NT2RP70137290 1248 10..381 3691 NT2RP70137640 1249 315..>2113 3692 NT2RP70143480 1250 482..1177 3693 NT2RP70147210 1251 258..566 3694 NT2RP70150800 1252 32..445 3695 NT2RP70157890 1253 170..1006 3696 NT2RP70159960 1254 308..967 3697 NT2RP70169110 1255 123..485 3698 NT2RP70175670 1256 89..421 3699 NT2RP70179710 1257 94..2604 3700 NT2RP70181970 1258 59..364 3701 NT2RP70188020 1259 380..796 3702 NT2RP70188710 1260 491..1024 3703 NT2RP70190640 1261 72..1880 3704 NT2RP70192730 1262 180..1253 3705 NT2RP70194450 1263 1074..1901 3706 NT2RP70195430 1264 201..1256 3707 NT2RP70198350 1265 131..832 3708 NT2RP70203790 1266 2156..>2479 3709 NTONG20009770 1267 124..1947 3710 NTONG20013620 1268 1798..2325 3711 NTONG20015870 1269 65..1627 3712 NTONG20028070 1270 9..545 3713 NTONG20029480 1271 318..1898 3714 NTONG20029700 1272 242..1693 3715 NTONG20046140 1273 308..1108 3716 NTONG20048060 1274 1488..1961 3717 NTONG20049910 1275 47..679 3718 NTONG20050620 1276 141..521 3719 NTONG20050860 1277 59..877 3720 NTONG20051530 1278 78..1697 3721 NTONG20052650 1279 84..>2351 3722 NTONG20056570 1280 226..1326 3723 NTONG20061870 1281 100..996 3724 NTONG20063010 1282 219..1856 3725 NTONG20064400 1283 11..1330 3726 NTONG20064840 1284 1500..2447 3727 NTONG20065010 1285 156..494 3728 NTONG20066460 1286 121..1458 3729 NTONG20067090 1287 1046..1513 3730 NTONG20067830 1288 17..1006 3731 NTONG20070200 1289 318..1418 3732 NTONG20070340 1290 284..1228 3733 NTONG20075220 1291 242..>2591 3734 NTONG20076930 1292 26..1534 3735 NTONG20077560 1293 241..567 3736 NTONG20083650 1294 242..1711 3737 NTONG20088620 1295 60..>2536 3738 NTONG20090600 1296 517..1134 3739 NTONG20090680 1297 673..1389 3740 NTONG20092290 1298 307..1539 3741 NTONG20092330 1299 229..2235 3742 OCBBF10000540 1300 858..1916 3743 OCBBF10001750 1301 245..1144 3744 OCBBF10001850 1302 419..2233 3745 OCBBF20005230 1303 56..640 3746 OCBBF20006770 1304 29..2275 3747 OCBBF20013890 1305 1978..2289 3748 OCBBF20019380 1306 69..1364 3749 OCBBF20019830 1307 325..1536 3750 OCBBF20020150 1308 2507..2917 3751 OCBBF20020830 1309 92..2869 3752 OCBBF20022900 1310 88..1779 3753 OCBBF20023570 1311 47..1276 3754 OCBBF20026630 1312 18..455 3755 OCBBF20028050 1313 128..1108 3756 OCBBF20028650 1314 706..2286 3757 OCBBF20029800 1315 334..699 3758 OCBBF20030280 1316 263..898 3759 OCBBF20030910 1317 383..1258 3760 OCBBF20032460 1318 347..805 3761 OCBBF20035930 1319 65..895 3762 OCBBF20037440 1320 413..1024 3763 OCBBF20039250 1321 24..821 3764 OCBBF20041680 1322 967..1278 3765 OCBBF20045330 1323 1407..1886 3766 OCBBF20046120 1324 82..1641 3767 OCBBF20046470 1325 400..1137 3768 OCBBF20046690 1326 156..1730 3769 OCBBF20047570 1327 182..577 3770 OCBBF20048660 1328 292..663 3771 OCBBF20049300 1329 721..2553 3772 OCBBF20049840 1330 246..>2607 3773 OCBBF20050770 1331 724..>2679 3774 OCBBF20051610 1332 41..493 3775 OCBBF20053430 1333 586..2478 3776 OCBBF20053490 1334 736..1068 3777 OCBBF20053730 1335 87..2090 3778 OCBBF20054200 1336 315..869 3779 OCBBF20054760 1337 195..1016 3780 OCBBF20059560 1338 224..>3045 3781 OCBBF20060300 1339 1389..2171 3782 OCBBF20061720 1340 711..1139 3783 OCBBF20062140 1341 444..749 3784 OCBBF20062410 1342 1920..2240 3785 OCBBF20063320 1343 145..519 3786 OCBBF20066390 1344 2159..2713 3787 OCBBF20068490 1345 15..2702 3788 OCBBF20071210 1346 2029..3486 3789 OCBBF20071840 1347 45..1670 3790 OCBBF20071960 1348 1294..1698 3791 OCBBF20072240 1349 335..1432 3792 OCBBF20072320 1350 1749..2087 3793 OCBBF20073540 1351 56..1132 3794 OCBBF20074140 1352 81..>3793 3795 OCBBF20076220 1353 1552..2013 3796 OCBBF20078920 1354 849..1340 3797 OCBBF20079310 1355 240..1349 3798 OCBBF20079460 1356 12..2099 3799 OCBBF20080050 1357 159..2150 3800 OCBBF20080410 1358 122..1672 3801 OCBBF20081380 1359 742..1140 3802 OCBBF20082830 1360 139..1209 3803 OCBBF20084660 1361 74..1621 3804 OCBBF20085200 1362 659..1207 3805 OCBBF20086400 1363 63..797 3806 OCBBF20086910 1364 541..2304 3807 OCBBF20087010 1365 325..633 3808 OCBBF20088140 1366 1575..1916 3809 OCBBF20088220 1367 2505..2915 3810 OCBBF20091150 1368 256..648 3811 OCBBF20094240 1369 82..1122 3812 OCBBF20097720 1370 471..815 3813 OCBBF20100400 1371 407..3043 3814 OCBBF20103130 1372 114..1439 3815 OCBBF20104040 1373 310..612 3816 OCBBF20105570 1374 2404..2874 3817 OCBBF20107090 1375 127..1935 3818 OCBBF20107920 1376 1692..2018 3819 OCBBF20108190 1377 278..1591 3820 OCBBF20108430 1378 832..1851 3821 OCBBF20108580 1379 1152..2354 3822 OCBBF20108630 1380 249..1133 3823 OCBBF20109310 1381 34..2355 3824 OCBBF20111770 1382 291..629 3825 OCBBF20116850 1383 117..2354 3826 OCBBF20118970 1384 361..855 3827 OCBBF20120390 1385 129..2282 3828 OCBBF20121390 1386 524..2254 3829 OCBBF20122620 1387 990..1544 3830 OCBBF20124360 1388 1223..1951 3831 OCBBF20125530 1389 379..2310 3832 OCBBF20126780 1390 1270..1599 3833 OCBBF20127040 1391 177..2327 3834 OCBBF20127140 1392 1018..1530 3835 OCBBF20127550 1393 103..>2362 3836 OCBBF20128120 1394 118..1311 3837 OCBBF20129360 1395 378..>3283 3838 OCBBF20130110 1396 132..452 3839 OCBBF20130910 1397 2527..2892 3840 OCBBF20132850 1398 1172..3331 3841 OCBBF20139260 1399 772..2592 3842 OCBBF20140640 1400 241..894 3843 OCBBF20140890 1401 39..>4369 3844 OCBBF20145760 1402 894..1757 3845 OCBBF20148280 1403 87..1787 3846 OCBBF20148730 1404 50..1855 3847 OCBBF20149280 1405 1385..2035 3848 OCBBF20151150 1406 135..2216 3849 OCBBF20153340 1407 135..>2621 3850 OCBBF20153350 1408 1616..1942 3851 OCBBF20155060 1409 102..3245 3852 OCBBF20164050 1410 50..370 3853 OCBBF20164670 1411 40..1077 3854 OCBBF20170690 1412 159..503 3855 OCBBF20173060 1413 63..383 3856 OCBBF20173250 1414 315..692 3857 OCBBF20173980 1415 262..1857 3858 OCBBF20178150 1416 1245..2231 3859 OCBBF20178880 1417 2740..3207 3860 OCBBF20178990 1418 1328..1819 3861 OCBBF20180120 1419 218..1780 3862 OCBBF20180840 1420 1169..1540 3863 OCBBF20186870 1421 1278..1736 3864 OCBBF20188730 1422 320..766 3865 OCBBF20189560 1423 1512..2165 3866 PANCR10000910 1424 1219..>1943 3867 PEBLM10000240 1425 306..674 3868 PEBLM10000710 1426 1719..1940 3869 PEBLM20013120 1427 26..952 3870 PEBLM20024320 1428 612..1406 3871 PEBLM20024550 1429 1179..1499 3872 PEBLM20040150 1430 1731..2165 3873 PEBLM20042900 1431 226..>2439 3874 PEBLM20044520 1432 922..1974 3875 PEBLM20052820 1433 411..782 3876 PEBLM20060310 1434 1731..>2083 3877 PEBLM20060360 1435 58..330 3878 PEBLM20060490 1436 431..892 3879 PEBLM20071880 1437 497..814 3880 PEBLM20072960 1438 128..1093 3881 PEBLM20074370 1439 60..458 3882 PEBLM20075980 1440 53..1153 3883 PEBLM20078320 1441 5..1672 3884 PEBLM20085760 1442 122..763 3885 PERIC10000250 1443 689..1516 3886 PERIC20002140 1444 151..1239 3887 PERIC20003860 1445 33..359 3888 PERIC20003870 1446 40..2817 3889 PERIC20004220 1447 130..1935 3890 PERIC20004780 1448 132..956 3891 PLACE50000660 1449 329..2527 3892 PLACE60003480 1450 35..877 3893 PLACE60004630 1451 216..533 3894 PLACE60060420 1452 34..246 3895 PLACE60079250 1453 336..>3307 3896 PLACE60086400 1454 279..764 3897 PLACE60119750 1455 28..570 3898 PLACE60121080 1456 769..1182 3899 PLACE60136500 1457 1900..2241 3900 PLACE60136720 1458 78..2519 3901 PLACE60138830 1459 750..1202 3902 PLACE60153220 1460 247..561 3903 PLACE60155130 1461 833..1171 3904 PLACE60161600 1462 77..1099 3905 PLACE60169420 1463 165..1097 3906 PLACE60177140 1464 1321..2190 3907 PLACE60181070 1465 1355..1708 3908 PLACE60187690 1466 1606..1941 3909 PLACE60188340 1467 430..1224 3910 PROST10003220 1468 187..933 3911 PROST10004800 1469 87..419 3912 PROST20005050 1470 673..1164 3913 PROST20005670 1471 1132..>2293 3914 PROST20021010 1472 612..926 3915 PROST20024890 1473 14..514 3916 PROST20029270 1474 1016..1363 3917 PROST20047270 1475 1300..2250 3918 PROST20047390 1476 163..2283 3919 PROST20050670 1477 1622..2074 3920 PROST20052280 1478 326..634 3921 PROST20057930 1479 237..>2116 3922 PROST20059040 1480 1047..1355 3923 PROST20066880 1481 1937..2521 3924 PROST20079500 1482 863..1957 3925 PROST20083600 1483 209..1087 3926 PROST20087700 1484 481..1287 3927 PROST20097950 1485 91..405 3928 PROST20100460 1486 63..1796 3929 PROST20104000 1487 1059..2012 3930 PROST20107820 1488 304..1524 3931 PROST20111050 1489 772..1281 3932 PROST20112970 1490 66..671 3933 PROST20114390 1491 1291..1749 3934 PROST20116600 1492 4..339 3935 PROST20120050 1493 176..589 3936 PROST20120160 1494 283..597 3937 PROST20121900 1495 68..385 3938 PROST20123530 1496 1619..2044 3939 PROST20127400 1497 1156..1524 3940 PROST20127800 1498 942..2120 3941 PROST20130530 1499 416..1588 3942 PROST20132600 1500 1447..2040 3943 PROST20133270 1501 2..529 3944 PROST20144220 1502 1011..1367 3945 PROST20146010 1503 298..1953 3946 PROST20149160 1504 1677..1991 3947 PROST20149250 1505 635..1201 3948 PROST20151240 1506 300..938 3949 PROST20152460 1507 1542..2084 3950 PROST20153320 1508 184..540 3951 PROST20159240 1509 286..612 3952 PROST20161950 1510 90..716 3953 PROST20164440 1511 2570..3004 3954 PROST20166680 1512 53..874 3955 PROST20168290 1513 1757..2143 3956 PROST20169800 1514 168..1763 3957 PROST20170980 1515 28..1245 3958 PROST20171280 1516 306..1493 3959 PROST20175290 1517 1538..2323 3960 PROST20176170 1518 998..2053 3961 PROST20178360 1519 72..566 3962 PROST20185830 1520 1200..2015 3963 PROST20189770 1521 219..2018 3964 PROST20191640 1522 318..1229 3965 PUAEN10000850 1523 121..2040 3966 PUAEN20003740 1524 104..409 3967 PUAEN20011880 1525 28..2028 3968 PUAEN20015260 1526 141..881 3969 PUAEN20015860 1527 71..1846 3970 PUAEN20018820 1528 41..1870 3971 PUAEN20025680 1529 667..1584 3972 PUAEN20027580 1530 36..512 3973 PUAEN20030180 1531 127..978 3974 PUAEN20040670 1532 326..2644 3975 PUAEN20044000 1533 541..957 3976 PUAEN20045110 1534 335..886 3977 PUAEN20045250 1535 335..1054 3978 PUAEN20051100 1536 228..1319 3979 PUAEN20052470 1537 1699..2046 3980 PUAEN20055020 1538 295..2553 3981 PUAEN20078980 1539 6..989 3982 PUAEN20081230 1540 62..469 3983 PUAEN20083140 1541 104..1687 3984 PUAEN20085150 1542 167..502 3985 PUAEN20108240 1543 2..1993 3986 RECTM10001410 1544 426..1631 3987 RECTM20003490 1545 876..1193 3988 RECTM20005100 1546 149..1273 3989 SALGL10001710 1547 271..1722 3990 SKMUS20001980 1548 75..1034 3991 SKMUS20003610 1549 86..910 3992 SKMUS20007010 1550 24..977 3993 SKMUS20007800 1551 708..>1835 3994 SKMUS20011640 1552 16..408 3995 SKMUS20012010 1553 300..1019 3996 SKMUS20016220 1554 80..1267 3997 SKMUS20018230 1555 98..442 3998 SKMUS20018500 1556 273..1172 3999 SKMUS20020840 1557 79..1014 4000 SKMUS20021530 1558 432..2135 4001 SKMUS20024750 1559 201..1208 4002 SKMUS20028210 1560 358..753 4003 SKMUS20028400 1561 18..644 4004 SKMUS20029200 1562 174..1130 4005 SKMUS20031680 1563 171..485 4006 SKMUS20046670 1564 234..617 4007 SKMUS20048970 1565 104..1132 4008 SKMUS20049030 1566 191..1096 4009 SKMUS20077400 1567 170..772 4010 SKMUS20084740 1568 83..>1516 4011 SKNMC20006220 1569 1176..1856 4012 SKNSH20008190 1570 490..2289 4013 SKNSH20020540 1571 2184..2924 4014 SKNSH20028660 1572 192..581 4015 SKNSH20031740 1573 120..563 4016 SKNSH20034660 1574 562..996 4017 SKNSH20051940 1575 1006..1488 4018 SKNSH20062340 1576 85..453 4019 SKNSH20063040 1577 91..768 4020 SKNSH20080430 1578 81..524 4021 SKNSH20087770 1579 107..>1808 4022 SKNSH20089400 1580 34..1092 4023 SKNSH20091970 1581 181..489 4024 SMINT20001760 1582 267..1706 4025 SMINT20005410 1583 138..557 4026 SMINT20008240 1584 1123..1500 4027 SMINT20009840 1585 31..750 4028 SMINT20011140 1586 1254..1664 4029 SMINT20011580 1587 131..811 4030 SMINT20011990 1588 132..512 4031 SMINT20013480 1589 87..686 4032 SMINT20014580 1590 57..410 4033 SMINT20015590 1591 1375..1818 4034 SMINT20022020 1592 133..726 4035 SMINT20023280 1593 890..1345 4036 SMINT20024570 1594 1852..2370 4037 SMINT20026890 1595 541..2790 4038 SMINT20028820 1596 1240..1749 4039 SMINT20029760 1597 236..1282 4040 SMINT20033170 1598 539..931 4041 SMINT20033400 1599 20..778 4042 SMINT20035690 1600 11..1411 4043 SMINT20040860 1601 39..1169 4044 SMINT20042990 1602 397..750 4045 SMINT20047810 1603 109..588 4046 SMINT20049090 1604 99..641 4047 SMINT20050750 1605 101..907 4048 SMINT20051610 1606 56..1513 4049 SMINT20053300 1607 1251..1598 4050 SMINT20053870 1608 85..894 4051 SMINT20056210 1609 356..754 4052 SMINT20058000 1610 200..565 4053 SMINT20060780 1611 18..554 4054 SMINT20065960 1612 859..1314 4055 SMINT20068010 1613 136..1026 4056 SMINT20071400 1614 212..1183 4057 SMINT20073650 1615 59..1549 4058 SMINT20076470 1616 1678..1983 4059 SMINT20080540 1617 1280..1606 4060 SMINT20089170 1618 54..530 4061 SMINT20092330 1619 169..858 4062 SMINT20092720 1620 1640..2293 4063 SMINT20095050 1621 733..1107 4064 SMINT20098320 1622 112..465 4065 SMINT20100680 1623 237..614 4066 SMINT20101440 1624 187..2109 4067 SMINT20102780 1625 26..1642 4068 SMINT20103690 1626 208..960 4069 SMINT20105000 1627 194..514 4070 SMINT20105330 1628 1580..2020 4071 SMINT20106290 1629 501..1802 4072 SMINT20106720 1630 80..1498 4073 SMINT20108530 1631 185..523 4074 SMINT20109970 1632 1444..>1974 4075 SMINT20110330 1633 1398..2222 4076 SMINT20110660 1634 1108..1500 4077 SMINT20112730 1635 80..1564 4078 SMINT20115880 1636 679..1746 4079 SMINT20121220 1637 263..>1798 4080 SMINT20121950 1638 6..443 4081 SMINT20122850 1639 454..777 4082 SMINT20122910 1640 1516..2094 4083 SMINT20127350 1641 622..1449 4084 SMINT20127930 1642 67..1554 4085 SMINT20130320 1643 178..2601 4086 SMINT20131810 1644 583..1257 4087 SMINT20132280 1645 293..655 4088 SMINT20136130 1646 1291..1752 4089 SMINT20138900 1647 87..1439 4090 SMINT20144430 1648 54..647 4091 SMINT20144800 1649 171..1394 4092 SMINT20144890 1650 209..520 4093 SMINT20152940 1651 386..985 4094 SMINT20153260 1652 135..1838 4095 SMINT20153530 1653 1186..1524 4096 SMINT20154540 1654 107..1339 4097 SMINT20155180 1655 20..763 4098 SMINT20157450 1656 669..1118 4099 SMINT20158100 1657 30..587 4100 SMINT20161220 1658 397..1977 4101 SMINT20162860 1659 36..494 4102 SMINT20163960 1660 665..1036 4103 SMINT20164400 1661 125..706 4104 SMINT20164770 1662 529..870 4105 SMINT20168570 1663 1593..2069 4106 SMINT20173190 1664 251..829 4107 SMINT20173240 1665 253..582 4108 SMINT20174360 1666 978..1733 4109 SMINT20177360 1667 172..771 4110 SMINT20178550 1668 51..692 4111 SMINT20179740 1669 78..1865 4112 SMINT20183530 1670 1130..2530 4113 SMINT20190170 1671 80..1567 4114 SMINT20191420 1672 49..1365 4115 SMINT20191530 1673 40..2040 4116 SMINT20192000 1674 49..435 4117 SPLEN10000830 1675 1586..2053 4118 SPLEN20000640 1676 27..755 4119 SPLEN20002220 1677 87..434 4120 SPLEN20003070 1678 684..1046 4121 SPLEN20006070 1679 78..2837 4122 SPLEN20008390 1680 375..2378 4123 SPLEN20008740 1681 66..1547 4124 SPLEN20008820 1682 31..1872 4125 SPLEN20011410 1683 199..2394 4126 SPLEN20013540 1684 978..1310 4127 SPLEN20016260 1685 906..1748 4128 SPLEN20019450 1686 180..680 4129 SPLEN20020070 1687 65..451 4130 SPLEN20021660 1688 130..771 4131 SPLEN20022230 1689 133..1026 4132 SPLEN20023140 1690 1153..1605 4133 SPLEN20026950 1691 855..3383 4134 SPLEN20027440 1692 29..2488 4135 SPLEN20029310 1693 70..585 4136 SPLEN20031600 1694 1658..2083 4137 SPLEN20032040 1695 357..746 4138 SPLEN20032190 1696 441..785 4139 SPLEN20033960 1697 16..1026 4140 SPLEN20039240 1698 1177..1929 4141 SPLEN20040600 1699 60..368 4142 SPLEN20054290 1700 187..2421 4143 SPLEN20076530 1701 254..586 4144 SPLEN20077500 1702 79..1941 4145 SPLEN20079260 1703 535..1506 4146 SPLEN20079510 1704 1880..>2197 4147 SPLEN20084600 1705 13..1878 4148 SPLEN20095410 1706 816..1541 4149 SPLEN20095550 1707 193..>2558 4150 SPLEN20095810 1708 248..670 4151 SPLEN20097330 1709 1448..1849 4152 SPLEN20099700 1710 91..>3025 4153 SPLEN20101190 1711 1864..2250 4154 SPLEN20103950 1712 25..507 4155 SPLEN20106250 1713 295..711 4156 SPLEN20117660 1714 662..1099 4157 SPLEN20118300 1715 332..1486 4158 SPLEN20119810 1716 526..1644 4159 SPLEN20121750 1717 464..1021 4160 SPLEN20126190 1718 274..2688 4161 SPLEN20128000 1719 96..1664 4162 SPLEN20129610 1720 207..557 4163 SPLEN20140800 1721 387..2144 4164 SPLEN20141360 1722 491..799 4165 SPLEN20141990 1723 443..745 4166 SPLEN20142100 1724 301..996 4167 SPLEN20143180 1725 50..448 4168 SPLEN20144520 1726 2002..2463 4169 SPLEN20145720 1727 1205..>1939 4170 SPLEN20146450 1728 362..862 4171 SPLEN20146690 1729 1966..2550 4172 SPLEN20147110 1730 313..2067 4173 SPLEN20147390 1731 169..1479 4174 SPLEN20149110 1732 2..769 4175 SPLEN20149190 1733 26..364 4176 SPLEN20149240 1734 787..2490 4177 SPLEN20150940 1735 79..2385 4178 SPLEN20151210 1736 66..1715 4179 SPLEN20152610 1737 986..1453 4180 SPLEN20152760 1738 284..628 4181 SPLEN20157300 1739 426..728 4182 SPLEN20157880 1740 35..769 4183 SPLEN20158900 1741 1643..2032 4184 SPLEN20158990 1742 843..1172 4185 SPLEN20160450 1743 552..1115 4186 SPLEN20160690 1744 734..1099 4187 SPLEN20160980 1745 124..456 4188 SPLEN20162680 1746 646..2007 4189 SPLEN20163560 1747 86..2173 4190 SPLEN20165310 1748 80..1492 4191 SPLEN20166270 1749 1134..1814 4192 SPLEN20167200 1750 223..570 4193 SPLEN20169220 1751 160..576 4194 SPLEN20169720 1752 72..2492 4195 SPLEN20170310 1753 125..1039 4196 SPLEN20171210 1754 7..837 4197 SPLEN20171470 1755 41..2272 4198 SPLEN20171890 1756 1312..1716 4199 SPLEN20172120 1757 138..500 4200 SPLEN20173510 1758 235..1785 4201 SPLEN20174260 1759 99..428 4202 SPLEN20176200 1760 36..431 4203 SPLEN20179180 1761 173..1201 4204 SPLEN20179810 1762 1374..3224 4205 SPLEN20181810 1763 641..1183 4206 SPLEN20186430 1764 80..979 4207 SPLEN20193110 1765 1744..2118 4208 SPLEN20194050 1766 1351..2331 4209 SPLEN20198110 1767 1260..1562 4210 SPLEN20204170 1768 202..594 4211 SPLEN20211220 1769 601..1500 4212 SPLEN20211570 1770 174..521 4213 SPLEN20211940 1771 241..1155 4214 SPLEN20212730 1772 979..1830 4215 SPLEN20212950 1773 283..2055 4216 SPLEN20213830 1774 137..460 4217 SPLEN20214400 1775 28..387 4218 SPLEN20214580 1776 300..602 4219 SPLEN20222270 1777 241..927 4220 SPLEN20225220 1778 672..1199 4221 SPLEN20242320 1779 136..522 4222 SPLEN20242730 1780 2343..2732 4223 SPLEN20243830 1781 197..556 4224 SPLEN20245300 1782 945..1529 4225 SPLEN20249560 1783 889..1584 4226 SPLEN20250170 1784 457..3012 4227 SPLEN20250390 1785 1327..1788 4228 SPLEN20252190 1786 1413..2609 4229 SPLEN20261440 1787 511..894 4230 SPLEN20264110 1788 1195..1662 4231 SPLEN20267650 1789 39..1331 4232 SPLEN20273950 1790 608..1222 4233 SPLEN20279950 1791 1874..2518 4234 SPLEN20280660 1792 1286..1612 4235 SPLEN20283650 1793 13..621 4236 SPLEN20284240 1794 282..1175 4237 SPLEN20292950 1795 9..2456 4238 SPLEN20293800 1796 73..858 4239 SPLEN20303970 1797 778..1104 4240 SPLEN20304950 1798 7..1011 4241 SPLEN20305620 1799 1356..1853 4242 SPLEN20329240 1800 5..361 4243 STOMA20001830 1801 81..1574 4244 STOMA20005390 1802 59..1567 4245 STOMA20005670 1803 81..1478 4246 STOMA20006400 1804 80..1687 4247 STOMA20006780 1805 41..1975 4248 STOMA20006860 1806 1272..1988 4249 STOMA20008880 1807 112..1485 4250 STOMA20010250 1808 66..419 4251 STOMA20013890 1809 2151..2486 4252 STOMA20026880 1810 548..874 4253 STOMA20032890 1811 1710..2600 4254 STOMA20034770 1812 81..1583 4255 STOMA20036460 1813 311..772 4256 STOMA20046680 1814 768..1154 4257 STOMA20048520 1815 160..663 4258 STOMA20048840 1816 936..1487 4259 STOMA20051200 1817 140..619 4260 STOMA20056640 1818 49..555 4261 STOMA20056670 1819 81..1556 4262 STOMA20057820 1820 60..1226 4263 STOMA20062130 1821 35..427 4264 STOMA20062290 1822 289..693 4265 STOMA20063250 1823 109..438 4266 STOMA20063980 1824 97..480 4267 STOMA20064470 1825 78..1118 4268 STOMA20067800 1826 35..397 4269 STOMA20069040 1827 364..792 4270 STOMA20072690 1828 351..701 4271 STOMA20076800 1829 311..784 4272 STOMA20077450 1830 780..2300 4273 STOMA20080500 1831 59..1735 4274 STOMA20083610 1832 80..1564 4275 STOMA20086140 1833 201..746 4276 STOMA20088380 1834 48..1535 4277 STOMA20092530 1835 80..1501 4278 STOMA20092560 1836 68..439 4279 STOMA20092890 1837 105..1223 4280 SYNOV20001520 1838 25..735 4281 SYNOV20001730 1839 56..1480 4282 SYNOV20002510 1840 79..1629 4283 SYNOV20002790 1841 59..1480 4284 SYNOV20002970 1842 56..1471 4285 SYNOV20003970 1843 357..881 4286 SYNOV20004260 1844 80..1489 4287 SYNOV20007000 1845 55..1485 4288 SYNOV20008240 1846 61..1494 4289 SYNOV20009230 1847 40..1515 4290 SYNOV20010880 1848 61..1479 4291 SYNOV20011110 1849 56..1468 4292 SYNOV20013000 1850 30..1433 4293 SYNOV20013560 1851 79..1494 4294 SYNOV20013900 1852 81..1499 4295 SYNOV20017080 1853 466..1905 4296 SYNOV30001840 1854 146..2443 4297 TBAES20000590 1855 1697..>2237 4298 TBAES20002550 1856 16..1896 4299 TBAES20003150 1857 42..1064 4300 TBAES20003770 1858 117..3437 4301 TCOLN20001390 1859 237..1106 4302 TESOP20000900 1860 110..448 4303 TESOP20003120 1861 42..929 4304 TESOP20004000 1862 295..1125 4305 TESOP20005270 1863 568..921 4306 TESOP20005690 1864 230..574 4307 TESTI10000940 1865 127..1752 4308 TESTI20001000 1866 129..944 4309 TESTI20001170 1867 107..1291 4310 TESTI20001720 1868 204..722 4311 TESTI20002720 1869 92..>2187 4312 TESTI20002780 1870 821..1471 4313 TESTI20004890 1871 140..1231 4314 TESTI20011200 1872 1615..1968 4315 TESTI20017950 1873 62..2023 4316 TESTI20018230 1874 506..1024 4317 TESTI20023510 1875 100..1935 4318 TESTI20029930 1876 597..1847 4319 TESTI20030310 1877 1362..1757 4320 TESTI20030890 1878 1736..2167 4321 TESTI20031270 1879 820..1332 4322 TESTI20031810 1880 235..1926 4323 TESTI20035960 1881 80..1327 4324 TESTI20036380 1882 125..2110 4325 TESTI20037560 1883 16..1986 4326 TESTI20038270 1884 42..347 4327 TESTI20039400 1885 63..1430 4328 TESTI20041690 1886 194..2320 4329 TESTI20044230 1887 76..1308 4330 TESTI20044310 1888 307..1899 4331 TESTI20046750 1889 56..871 4332 TESTI20057750 1890 154..495 4333 TESTI20060400 1891 102..1754 4334 TESTI20061110 1892 102..1574 4335 TESTI20063830 1893 186..1793 4336 TESTI20066670 1894 345..1823 4337 TESTI20066770 1895 867..1937 4338 TESTI20067200 1896 25..1149 4339 TESTI20076850 1897 864..1307 4340 TESTI20082330 1898 12..2249 4341 TESTI20083200 1899 80..967 4342 TESTI20083940 1900 60..1973 4343 TESTI20086210 1901 65..1465 4344 TESTI20087620 1902 116..2191 4345 TESTI20088220 1903 318..2435 4346 TESTI20094020 1904 341..1885 4347 TESTI20094120 1905 402..1184 4348 TESTI20094230 1906 1397..2158 4349 TESTI20094470 1907 428..1540 4350 TESTI20098350 1908 137..1849 4351 TESTI20098530 1909 220..564 4352 TESTI20102800 1910 278..640 4353 TESTI20105720 1911 1542..1901 4354 TESTI20108720 1912 101..1123 4355 TESTI20110280 1913 212..1396 4356 TESTI20112940 1914 579..899 4357 TESTI20114070 1915 1575..1937 4358 TESTI20116650 1916 43..387 4359 TESTI20116830 1917 825..1208 4360 TESTI20121550 1918 191..1900 4361 TESTI20122310 1919 149..826 4362 TESTI20123080 1920 432..767 4363 TESTI20123560 1921 249..>816 4364 TESTI20127760 1922 149..1141 4365 TESTI20128350 1923 178..591 4366 TESTI20129150 1924 241..969 4367 TESTI20129220 1925 366..773 4368 TESTI20130010 1926 866..1420 4369 TESTI20130120 1927 119..748 4370 TESTI20135660 1928 961..1374 4371 TESTI20136100 1929 71..406 4372 TESTI20136710 1930 14..>1826 4373 TESTI20136990 1931 1903..2292 4374 TESTI20137370 1932 37..339 4375 TESTI20137670 1933 181..561 4376 TESTI20143240 1934 486..908 4377 TESTI20143390 1935 52..1068 4378 TESTI20143620 1936 970..1332 4379 TESTI20148000 1937 250..2004 4380 TESTI20152460 1938 222..1499 4381 TESTI20155900 1939 1095..1499 4382 TESTI20156100 1940 31..1200 4383 TESTI20157100 1941 481..1149 4384 TESTI20157520 1942 55..>1880 4385 TESTI20159140 1943 424..>1611 4386 TESTI20161970 1944 138..1658 4387 TESTI20164100 1945 60..470 4388 TESTI20168480 1946 91..1341 4389 TESTI20168630 1947 1219..1608 4390 TESTI20168960 1948 37..570 4391 TESTI20169960 1949 801..1139 4392 TESTI20170350 1950 1106..1429 4393 TESTI20171020 1951 11..>2194 4394 TESTI20178160 1952 1084..1452 4395 TESTI20179320 1953 191..664 4396 TESTI20183370 1954 190..870 4397 TESTI20184620 1955 123..2417 4398 TESTI20185650 1956 75..1904 4399 TESTI20185810 1957 243..587 4400 TESTI20189410 1958 16..>1759 4401 TESTI20192280 1959 10..906 4402 TESTI20192800 1960 193..>2366 4403 TESTI20193360 1961 66..854 4404 TESTI20194300 1962 70..576 4405 TESTI20194810 1963 78..473 4406 TESTI20197940 1964 771..>1987 4407 TESTI20199170 1965 244..558 4408 TESTI20199750 1966 92..1957 4409 TESTI20200260 1967 307..846 4410 TESTI20200710 1968 190..1749 4411 TESTI20202650 1969 55..1299 4412 TESTI20203440 1970 1109..1600 4413 TESTI20204450 1971 417..1916 4414 TESTI20208400 1972 1027..1782 4415 TESTI20208710 1973 70..2046 4416 TESTI20209460 1974 1035..1400 4417 TESTI20209810 1975 872..1405 4418 TESTI20209990 1976 106..549 4419 TESTI20211160 1977 627..1424 4420 TESTI20211220 1978 1561..1944 4421 TESTI20211240 1979 150..>1469 4422 TESTI20213150 1980 380..1303 4423 TESTI20213580 1981 338..697 4424 TESTI20214250 1982 46..933 4425 TESTI20215990 1983 428..2635 4426 TESTI20216370 1984 572..1195 4427 TESTI20220100 1985 539..1264 4428 TESTI20220650 1986 164..481 4429 TESTI20224620 1987 221..532 4430 TESTI20226230 1988 335..>1500 4431 TESTI20226490 1989 1044..1367 4432 TESTI20229600 1990 342..2669 4433 TESTI20230250 1991 1310..1693 4434 TESTI20230850 1992 246..2567 4435 TESTI20231920 1993 949..1392 4436 TESTI20231940 1994 382..975 4437 TESTI20232140 1995 26..1237 4438 TESTI20234140 1996 182..1738 4439 TESTI20234270 1997 334..642 4440 TESTI20234360 1998 23..460 4441 TESTI20237520 1999 172..1734 4442 TESTI20238000 2000 978..1322 4443 TESTI20238610 2001 150..1373 4444 TESTI20239470 2002 132..2294 4445 TESTI20239510 2003 701..1333 4446 TESTI20240090 2004 10..1179 4447 TESTI20241530 2005 594..1985 4448 TESTI20241920 2006 1309..1632 4449 TESTI20242830 2007 42..2306 4450 TESTI20242990 2008 968..1330 4451 TESTI20244190 2009 80..1630 4452 TESTI20244760 2010 1258..1647 4453 TESTI20249990 2011 698..1960 4454 TESTI20254220 2012 81..1376 4455 TESTI20254540 2013 997..1830 4456 TESTI20254860 2014 205..>2004 4457 TESTI20255820 2015 120..1565 4458 TESTI20258460 2016 37..1212 4459 TESTI20262330 2017 928..1521 4460 TESTI20262910 2018 335..1336 4461 TESTI20265250 2019 1751..2095 4462 TESTI20265370 2020 46..378 4463 TESTI20265970 2021 258..1961 4464 TESTI20266740 2022 88..1203 4465 TESTI20269570 2023 643..1047 4466 TESTI20271850 2024 202..504 4467 TESTI20272060 2025 1379..3253 4468 TESTI20272390 2026 123..767 4469 TESTI20272960 2027 982..1932 4470 TESTI20275030 2028 98..583 4471 TESTI20275620 2029 1508..1840 4472 TESTI20277360 2030 298..1704 4473 TESTI20278200 2031 48..698 4474 TESTI20278400 2032 70..>1856 4475 TESTI20280980 2033 619..1071 4476 TESTI20282540 2034 310..1356 4477 TESTI20284880 2035 683..1114 4478 TESTI20285830 2036 494..853 4479 TESTI20288110 2037 234..899 4480 TESTI20288910 2038 51..965 4481 TESTI20289850 2039 198..698 4482 TESTI20291310 2040 106..2034 4483 TESTI20291620 2041 1611..2021 4484 TESTI20291960 2042 809..1921 4485 TESTI20294700 2043 898..1236 4486 TESTI20297850 2044 1..837 4487 TESTI20301360 2045 114..506 4488 TESTI20303220 2046 288..2711 4489 TESTI20303360 2047 767..2050 4490 TESTI20303420 2048 34..768 4491 TESTI20305540 2049 97..2949 4492 TESTI20305560 2050 49..582 4493 TESTI20307540 2051 88..513 4494 TESTI20307700 2052 32..412 4495 TESTI20308600 2053 72..1307 4496 TESTI20309170 2054 722..2233 4497 TESTI20310070 2055 205..2097 4498 TESTI20311290 2056 940..1398 4499 TESTI20314180 2057 1073..1744 4500 TESTI20316870 2058 25..813 4501 TESTI20317600 2059 107..1420 4502 TESTI20318090 2060 1012..1644 4503 TESTI20319190 2061 384..1481 4504 TESTI20320440 2062 200..1861 4505 TESTI20320670 2063 259..1257 4506 TESTI20326810 2064 832..1377 4507 TESTI20327680 2065 135..1730 4508 TESTI20327740 2066 132..518 4509 TESTI20328280 2067 87..2135 4510 TESTI20330310 2068 315..1307 4511 TESTI20332420 2069 682..1461 4512 TESTI20333000 2070 366..1586 4513 TESTI20333950 2071 76..1500 4514 TESTI20334410 2072 167..1630 4515 TESTI20335050 2073 340..1389 4516 TESTI20335200 2074 612..968 4517 TESTI20336410 2075 17..325 4518 TESTI20337100 2076 40..384 4519 TESTI20342430 2077 322..642 4520 TESTI20343070 2078 530..2563 4521 TESTI20343570 2079 900..1568 4522 TESTI20345060 2080 15..1382 4523 TESTI20347180 2081 3..710 4524 TESTI20347300 2082 623..931 4525 TESTI20347740 2083 100..1599 4526 TESTI20347770 2084 37..351 4527 TESTI20351830 2085 919..1773 4528 TESTI20352620 2086 182..907 4529 TESTI20355020 2087 8..1651 4530 TESTI20357750 2088 547..951 4531 TESTI20357930 2089 1148..1498 4532 TESTI20357960 2090 363..725 4533 TESTI20358980 2091 85..1332 4534 TESTI20361140 2092 801..1514 4535 TESTI20366910 2093 5..1396 4536 TESTI20367360 2094 324..629 4537 TESTI20368330 2095 201..1856 4538 TESTI20369130 2096 243..611 4539 TESTI20369220 2097 118..441 4540 TESTI20369650 2098 633..2204 4541 TESTI20369690 2099 306..1208 4542 TESTI20370020 2100 346..1830 4543 TESTI20370550 2101 160..462 4544 TESTI20370810 2102 223..2334 4545 TESTI20371030 2103 209..1180 4546 TESTI20371060 2104 140..1177 4547 TESTI20373820 2105 237..1109 4548 TESTI20375340 2106 387..1559 4549 TESTI20377230 2107 574..1314 4550 TESTI20378190 2108 380..1795 4551 TESTI20378450 2109 489..>2419 4552 TESTI20380650 2110 961..1272 4553 TESTI20381040 2111 339..1394 4554 TESTI20382750 2112 1159..1797 4555 TESTI20383880 2113 419..988 4556 TESTI20385960 2114 684..1637 4557 TESTI20386230 2115 748..1059 4558 TESTI20386440 2116 185..514 4559 TESTI20388580 2117 405..788 4560 TESTI20390260 2118 142..522 4561 TESTI20390410 2119 1604..1969 4562 TESTI20391130 2120 185..2224 4563 TESTI20391210 2121 1259..1801 4564 TESTI20391770 2122 237..1634 4565 TESTI20392090 2123 405..881 4566 TESTI20392250 2124 1057..1941 4567 TESTI20392270 2125 316..1185 4568 TESTI20392760 2126 306..2279 4569 TESTI20393530 2127 194..1198 4570 TESTI20396130 2128 338..682 4571 TESTI20397760 2129 371..1129 4572 TESTI20400940 2130 231..2705 4573 TESTI20401020 2131 583..1281 4574 TESTI20401280 2132 53..379 4575 TESTI20401430 2133 340..651 4576 TESTI20404240 2134 1110..1550 4577 TESTI20406420 2135 186..1340 4578 TESTI20408150 2136 195..752 4579 TESTI20408970 2137 247..1170 4580 TESTI20409440 2138 17..337 4581 TESTI20409890 2139 120..1082 4582 TESTI20413300 2140 66..503 4583 TESTI20415170 2141 45..419 4584 TESTI20415640 2142 1..324 4585 TESTI20416640 2143 1092..1574 4586 TESTI20417300 2144 107..1807 4587 TESTI20419560 2145 5..331 4588 TESTI20420620 2146 334..2139 4589 TESTI20421490 2147 2188..2628 4590 TESTI20422640 2148 974..2149 4591 TESTI20423020 2149 252..>1770 4592 TESTI20424000 2150 339..842 4593 TESTI20424730 2151 928..1263 4594 TESTI20425070 2152 1145..1726 4595 TESTI20427830 2153 42..380 4596 TESTI20428060 2154 230..598 4597 TESTI20429280 2155 925..1551 4598 TESTI20429580 2156 970..1458 4599 TESTI20432750 2157 56..1399 4600 TESTI20432820 2158 18..1232 4601 TESTI20433130 2159 247..549 4602 TESTI20436560 2160 103..1578 4603 TESTI20438570 2161 1252..1719 4604 TESTI20438660 2162 2227..2622 4605 TESTI20441940 2163 613..1596 4606 TESTI20442760 2164 82..>2054 4607 TESTI20443090 2165 201..1019 4608 TESTI20444130 2166 79..417 4609 TESTI20444180 2167 26..547 4610 TESTI20447540 2168 184..516 4611 TESTI20449200 2169 672..1766 4612 TESTI20451710 2170 429..731 4613 TESTI20451990 2171 210..2264 4614 TESTI20455090 2172 489..1268 4615 TESTI20455620 2173 110..1351 4616 TESTI20456110 2174 4..1191 4617 TESTI20458190 2175 235..579 4618 TESTI20463520 2176 998..1402 4619 TESTI20463580 2177 577..2037 4620 TESTI20465350 2178 317..1258 4621 TESTI20465520 2179 535..1026 4622 TESTI20465690 2180 214..1074 4623 TESTI20467210 2181 435..1613 4624 TESTI20467320 2182 951..1922 4625 TESTI20467970 2183 332..1690 4626 TESTI20468630 2184 380..688 4627 TESTI20471410 2185 97..1464 4628 TESTI20471470 2186 31..369 4629 TESTI20471530 2187 2264..2641 4630 TESTI20472120 2188 517..876 4631 TESTI20473420 2189 140..607 4632 TESTI20473830 2190 951..1532 4633 TESTI20477920 2191 1387..1860 4634 TESTI20478010 2192 169..558 4635 TESTI20478180 2193 428..754 4636 TESTI20478850 2194 949..1323 4637 TESTI20479300 2195 663..1205 4638 THYMU10005360 2196 48..899 4639 THYMU10005540 2197 84..1508 4640 THYMU20000570 2198 216..728 4641 THYMU20011950 2199 45..626 4642 THYMU20015210 2200 1003..1314 4643 THYMU20018190 2201 336..758 4644 THYMU20023380 2202 1426..1728 4645 THYMU20027560 2203 63..602 4646 THYMU20029100 2204 215..928 4647 THYMU20032870 2205 1042..1404 4648 THYMU20039810 2206 54..2204 4649 THYMU20045120 2207 66..425 4650 THYMU20058070 2208 984..1388 4651 THYMU20061700 2209 40..435 4652 THYMU20066100 2210 188..814 4653 THYMU20070360 2211 1333..1635 4654 THYMU20075320 2212 1186..1767 4655 THYMU20081490 2213 127..>2055 4656 THYMU20095960 2214 304..945 4657 THYMU20100410 2215 219..1415 4658 THYMU20101610 2216 1087..1446 4659 THYMU20101920 2217 765..1310 4660 THYMU20105190 2218 850..1713 4661 THYMU20106710 2219 89..493 4662 THYMU20108310 2220 97..642 4663 THYMU20111180 2221 33..1367 4664 THYMU20111420 2222 914..1303 4665 THYMU20111830 2223 38..796 4666 THYMU20114470 2224 122..502 4667 THYMU20115850 2225 1500..1805 4668 THYMU20118060 2226 355..687 4669 THYMU20118520 2227 220..567 4670 THYMU20119390 2228 118..525 4671 THYMU20122730 2229 343..1140 4672 THYMU20126900 2230 163..1446 4673 THYMU20128070 2231 2..349 4674 THYMU20128260 2232 76..411 4675 THYMU20130890 2233 221..757 4676 THYMU20141670 2234 196..1152 4677 THYMU20142040 2235 24..653 4678 THYMU20142970 2236 495..1499 4679 THYMU20143270 2237 524..1549 4680 THYMU20147770 2238 80..1501 4681 THYMU20153160 2239 1303..1920 4682 THYMU20158250 2240 117..488 4683 THYMU20159430 2241 79..1581 4684 THYMU20161640 2242 110..679 4685 THYMU20162190 2243 299..646 4686 THYMU20169680 2244 718..1395 4687 THYMU20172150 2245 375..956 4688 THYMU20173980 2246 355..813 4689 THYMU20180280 2247 1352..1699 4690 THYMU20186390 2248 461..1495 4691 THYMU20186730 2249 194..535 4692 THYMU20187720 2250 284..661 4693 THYMU20193640 2251 659..1165 4694 THYMU20194360 2252 257..955 4695 THYMU20194420 2253 1080..1403 4696 THYMU20195990 2254 344..673 4697 THYMU20201980 2255 1094..2023 4698 THYMU20202890 2256 935..2188 4699 THYMU20204160 2257 654..1199 4700 THYMU20204990 2258 65..385 4701 THYMU20208300 2259 144..542 4702 THYMU20209590 2260 193..2061 4703 THYMU20215090 2261 862..1380 4704 THYMU20215970 2262 1004..1552 4705 THYMU20216840 2263 605..2074 4706 THYMU20222890 2264 1896..2198 4707 THYMU20226600 2265 246..1232 4708 THYMU20228540 2266 109..426 4709 THYMU20229220 2267 259..894 4710 THYMU20232090 2268 111..539 4711 THYMU20235760 2269 357..674 4712 THYMU20239000 2270 44..1672 4713 THYMU20239430 2271 656..982 4714 THYMU20240710 2272 680..2077 4715 THYMU20241210 2273 77..511 4716 THYMU20241850 2274 63..890 4717 THYMU20246840 2275 110..415 4718 THYMU20247480 2276 4..1176 4719 THYMU20250420 2277 222..707 4720 THYMU20251890 2278 1433..1777 4721 THYMU20253250 2279 713..1540 4722 THYMU20255570 2280 882..1550 4723 THYMU20255720 2281 88..645 4724 THYMU20259090 2282 1763..2092 4725 THYMU20265300 2283 60..1949 4726 THYMU20271250 2284 681..1628 4727 THYMU20272490 2285 174..560 4728 THYMU20277390 2286 930..1541 4729 THYMU20279750 2287 716..1114 4730 THYMU20283790 2288 253..804 4731 THYMU20284120 2289 178..525 4732 THYMU20286290 2290 287..1981 4733 THYMU20286320 2291 1214..1594 4734 TKIDN10000010 2292 386..838 4735 TKIDN20004640 2293 549..1172 4736 TKIDN20005210 2294 294..1133 4737 TKIDN20030590 2295 143..1558 4738 TKIDN20030620 2296 25..531 4739 TKIDN20047480 2297 1038..1460 4740 TOVAR20004760 2298 675..1454 4741 TOVAR20005750 2299 348..713 4742 TRACH20002870 2300 77..613 4743 TRACH20003590 2301 244..1773 4744 TRACH20005020 2302 75..1463 4745 TRACH20005400 2303 57..728 4746 TRACH20007020 2304 271..1830 4747 TRACH20016210 2305 122..1132 4748 TRACH20019960 2306 112..1410 4749 TRACH20027840 2307 61..384 4750 TRACH20028030 2308 161..1441 4751 TRACH20029540 2309 1410..1859 4752 TRACH20032720 2310 830..1354 4753 TRACH20033230 2311 560..2110 4754 TRACH20034840 2312 1985..>3328 4755 TRACH20037360 2313 1..309 4756 TRACH20041830 2314 424..1035 4757 TRACH20042920 2315 77..1540 4758 TRACH20048450 2316 511..1845 4759 TRACH20050040 2317 70..594 4760 TRACH20056980 2318 405..1055 4761 TRACH20057690 2319 1448..1993 4762 TRACH20060150 2320 3..329 4763 TRACH20067620 2321 166..603 4764 TRACH20068660 2322 63..890 4765 TRACH20068700 2323 144..1811 4766 TRACH20069180 2324 63..1625 4767 TRACH20076740 2325 779..1669 4768 TRACH20076760 2326 1737..2183 4769 TRACH20077540 2327 1859..2455 4770 TRACH20079690 2328 144..2144 4771 TRACH20082780 2329 1675..2103 4772 TRACH20084720 2330 38..1819 4773 TRACH20085400 2331 223..2346 4774 TRACH20085830 2332 41..1567 4775 TRACH20091230 2333 1660..2067 4776 TRACH20092680 2334 56..457 4777 TRACH20096610 2335 417..935 4778 TRACH20099340 2336 156..494 4779 TRACH20105870 2337 1418..2176 4780 TRACH20107710 2338 13..474 4781 TRACH20109650 2339 1421..1849 4782 TRACH20111130 2340 1548..1937 4783 TRACH20115740 2341 507..893 4784 TRACH20118940 2342 1781..2083 4785 TRACH20121380 2343 795..1808 4786 TRACH20128110 2344 1233..1796 4787 TRACH20128230 2345 80..1657 4788 TRACH20134950 2346 675..1001 4789 TRACH20135520 2347 425..2335 4790 TRACH20136710 2348 42..545 4791 TRACH20139820 2349 1630..1998 4792 TRACH20140820 2350 196..738 4793 TRACH20141240 2351 270..875 4794 TRACH20145440 2352 243..1511 4795 TRACH20147250 2353 834..1196 4796 TRACH20149970 2354 124..1776 4797 TRACH20153810 2355 216..635 4798 TRACH20154860 2356 3..1439 4799 TRACH20162860 2357 98..364 4800 TRACH20163170 2358 267..1028 4801 TRACH20164980 2359 657..2165 4802 TRACH20167220 2360 986..2422 4803 TRACH20168350 2361 200..589 4804 TRACH20169800 2362 1922..2359 4805 TRACH20180840 2363 1288..1593 4806 TRACH20183170 2364 1029..2252 4807 TRACH20184490 2365 214..1596 4808 TRACH20187180 2366 1322..1639 4809 TRACH20190240 2367 1624..2313 4810 TSTOM10001860 2368 96..1859 4811 TSTOM20001390 2369 241..1671 4812 TSTOM20003150 2370 103..1245 4813 TSTOM20005690 2371 370..1626 4814 TUTER20002830 2372 172..930 4815 UMVEN10001560 2373 130..669 4816 UMVEN10001860 2374 198..>2048 4817 UMVEN20000690 2375 6..1118 4818 UMVEN20003540 2376 4..519 4819 UTERU20000740 2377 2062..2400 4820 UTERU20004240 2378 38..385 4821 UTERU20006290 2379 101..406 4822 UTERU20006960 2380 106..555 4823 UTERU20020010 2381 54..431 4824 UTERU20022940 2382 735..1232 4825 UTERU20030570 2383 184..1737 4826 UTERU20040610 2384 92..409 4827 UTERU20046640 2385 15..2699 4828 UTERU20046980 2386 216..926 4829 UTERU20050690 2387 619..924 4830 UTERU20054460 2388 557..>2294 4831 UTERU20055330 2389 45..632 4832 UTERU20055480 2390 92..1765 4833 UTERU20055930 2391 90..869 4834 UTERU20056010 2392 65..484 4835 UTERU20059050 2393 809..1459 4836 UTERU20061030 2394 994..1389 4837 UTERU20064000 2395 153..479 4838 UTERU20064860 2396 26..1780 4839 UTERU20065930 2397 37..2097 4840 UTERU20067050 2398 641..952 4841 UTERU20068990 2399 945..1319 4842 UTERU20070040 2400 36..383 4843 UTERU20070810 2401 761..1219 4844 UTERU20076390 2402 71..499 4845 UTERU20081300 2403 2063..2464 4846 UTERU20084260 2404 494..1321 4847 UTERU20094350 2405 293..802 4848 UTERU20095380 2406 872..1213 4849 UTERU20095400 2407 737..1456 4850 UTERU20097760 2408 1232..1759 4851 UTERU20099720 2409 201..746 4852 UTERU20101240 2410 210..602 4853 UTERU20114100 2411 538..963 4854 UTERU20115740 2412 469..933 4855 UTERU20116570 2413 327..1694 4856 UTERU20118110 2414 87..485 4857 UTERU20118970 2415 229..549 4858 UTERU20119060 2416 1192..2436 4859 UTERU20119680 2417 676..1185 4860 UTERU20120310 2418 68..1066 4861 UTERU20124070 2419 368..733 4862 UTERU20126880 2420 524..1045 4863 UTERU20134910 2421 1070..1489 4864 UTERU20135860 2422 676..1965 4865 UTERU20143980 2423 68..370 4866 UTERU20144640 2424 231..1148 4867 UTERU20145480 2425 172..2193 4868 UTERU20146310 2426 114..1580 4869 UTERU20146680 2427 524..1045 4870 UTERU20150870 2428 47..499 4871 UTERU20151980 2429 220..981 4872 UTERU20158300 2430 342..686 4873 UTERU20158800 2431 161..1318 4874 UTERU20161570 2432 295..1209 4875 UTERU20164260 2433 54..890 4876 UTERU20168220 2434 835..1530 4877 UTERU20176130 2435 27..1184 4878 UTERU20176320 2436 108..1364 4879 UTERU20178100 2437 2178..2528 4880 UTERU20179880 2438 172..2379 4881 UTERU20183640 2439 2289..2828 4882 UTERU20185230 2440 125..1927 4883 UTERU20186740 2441 851..1156 4884 UTERU20188110 2442 125..1135 4885 UTERU20188810 2443 84..389 4886

Namely, primers used to synthesize polynucleotides can be designed based on the nucleotide sequences of polynucleotides of the present invention shown in SEQ ID NOs in the above Table 1. When one intends to synthesize full-length cDNAs, an oligo dT primer can be used as the 3′-end primer. The length of the primers is usually 15-100 bp, and favorably between 15-35 bp. In case of LA PCR, which is described below, the primer length of 25-35 bp may provide a good result.

A method to design a primer that enables a specific amplification based on the aimed nucleotide sequence is known to those skilled in the art (Current Protocols in Molecular Biology, Ausubel et al. edit, (1987) John Wiley & Sons, Section 6.1-6.4). In designing a primer based on the 5′-end sequence, the primer is designed so as that, in principle, the amplification products will include the translation start site. Accordingly, for example, when the 5′-end primer is designed based on the nucleotide sequence of 5′ untranslated region (5′UTR), any part of the 5′-end, which ensures the specificity to the cDNA of interest, can be selected as the primer.

When synthesizing a full-length cDNA, the target nucleotide sequence to be amplified can extend to several thousand bp in some cDNA. However, it is possible to amplify such a long nucleotides by using such as LA PCR (Long and Accurate PCR). It is advantageous to use LA PCR when synthesizing long DNA. In LA PCR, in which a special DNA polymerase having 3′->5′ exonuclease activity is used, misincorporated nucleotides can be removed. Accordingly, accurate synthesis of the complementary strand can be achieved even with a long nucleotide sequence. By using LA PCR, it is reported that amplification of a nucleotide with 20 kb longer can be achieved under desirable conditions (Takeshi Hayashi (1996) Jikken-Igaku Bessatsu, “Advanced Technologies in PCR” Youdo-sha).

A template DNA for synthesizing the full-length cDNA of the present invention can be obtained by using cDNA libraries that are prepared by various methods. The full-length cDNA clones of the present invention are clones with high probability of completeness in length, which were obtained by the method comprising the steps of [1] preparing libraries containing cDNAs with the very high fullness ratio by oligo-capping, and [2] assembling the 5′-end sequences and selecting one with the highest probability of completeness in length in the cluster formed (there are many clones longer in the 5′-end direction).

However, the uses of primers designed based on the full-length nucleotide sequences provided by the present invention enable easily obtaining full-length cDNAs without such a special technique.

The problem with the cDNA libraries prepared by the known methods or commercially available is that mRNA contained in the libraries has very low fullness ratio. Thus, it is difficult to screen full-length cDNA clone directly from the library using ordinary cloning methods. The present invention has revealed a nucleotide sequence of novel full-length cDNA. If a full-length nucleotide sequence is provided, it is possible to synthesize a target full-length cDNA by using enzymatic reactions such as PCR. In particular, a full-length-enriched cDNA library, synthesized by methods such as oligo-capping, is desirable to synthesize a full-length cDNA with more reliability.

The 5′-end sequence of the full-length cDNA clones of the invention can be used to isolate the regulatory element of transcription including the promoter on the genome. A rough draft of the human genome (analysis of human genomic sequence with lower accuracy), which covers 90% of the genome, has been reported (Nature, Vol. 409, 814-823, 2001), and by the year 2003, analysis of the entire human genomic sequence is going to be finished. However, it is hard to analyze with software the transcription start sites on the human genome, in which long introns exist. By contrast, it is easy to specify the transcription start site on the genomic sequence using the nucleotide sequence which includes the 5′-end of the full-length cDNA clone of the present invention, and thus it is easy to obtain the genomic region involved in transcription regulation, which includes the promoter that is contained in the upstream of the transcription start site.

The polypeptide encoded by the full-length cDNA of the invention can be prepared as a recombinant polypeptide or as a natural polypeptide. For example, the recombinant polypeptide can be prepared by inserting the polynucleotide encoding the polypeptide of the invention into a vector, introducing the vector into an appropriate host cell and purifying the polypeptide expressed within the transformed host cell, as described below. In contrast, the natural polypeptide can be prepared, for example, by utilizing an affinity column to which an antibody against the polypeptide of the invention (Current Protocols in Molecular Biology (1987) Ausubel et al. edit, John Wiley & Sons, Section 16.1-16.19) is attached. The antibody used for affinity purification may be either a polyclonal antibody, or a monoclonal antibody. Alternatively, in vitro translation (See, for example, “On the fidelity of mRNA translation in the nuclease-treated rabbit reticulocyte lysate system.” Dasso M. C., and Jackson R. J. (1989) Nucleic Acids Res. 17: 3129-3144) may be used for preparing the polypeptide of the invention.

Polypeptides functionally equivalent to the polypeptides of the present invention can be prepared based on the activities, which were clarified in the above-mentioned manner, of the polypeptides of the present invention. Using the biological activity possessed by the polypeptide of the invention as an index, it is possible to verify whether or not a particular polypeptide is functionally equivalent to the polypeptide of the invention by examining whether or not the polypeptide has said activity.

Polypeptides functionally equivalent to the polypeptides of the present invention can be prepared by those skilled in the art, for example, by using a method for introducing mutations into an amino acid sequence of a polypeptide (for example, site-directed mutagenesis (Current Protocols in Molecular Biology, edit, Ausubel et al., (1987) John Wiley & Sons, Section 8.1-8.5) Besides, such polypeptides can be generated by spontaneous mutations. The present invention also includes a polypeptide comprising the amino acid sequence shown in Table 1 in which one or more amino acids are substituted, deleted, inserted, and/or added, as long as the polypeptides have the equivalent functions to those of the polypeptides identified in the present Examples described later.

There are no limitations on the number and sites of amino acid mutations, as long as the polypeptides maintain the functions thereof. The number of mutations typically corresponds to 30% or less, or 20% or less, or 10% or less, preferably 5% or less, or 3% or less of the total amino acids, more preferably 2% or less or 1% or less of the total amino acids. Alternatively, herein, substitution of one or more amino acids includes substitution of several amino acids. As used herein, the term “several amino acids” means, for example, 5 amino acids, preferably 4 or 3 amino acids, more preferably 2 amino acids, and further preferably 1 amino acid.

From the viewpoint of maintaining the polypeptide function, it is preferable that a substituted amino acid has a similar property to that of the original amino acid. For example, Ala, Val, Leu, Ile, Pro, Met, Phe and Trp are assumed to have similar properties to one another because they are all classified into a group of non-polar amino acids. Similarly, substitution can be performed among non-charged amino acid such as Gly, Ser, Thr, Cys, Tyr, Asn, and Gln, acidic amino acids such as Asp and Glu, and basic amino acids such as Lys, Arg, and His.

In addition, polypeptides functionally equivalent to the polypeptides of the present invention can be isolated by using techniques of hybridization or gene amplification known to those skilled in the art. Specifically, using the hybridization technique (Current Protocols in Molecular Biology, edit, Ausubel et al., (1987) John Wiley & Sons, Section 6.3-6.4)), those skilled in the art can usually isolate a polynucleotide highly homologous to the polynucleotide encoding the polypeptide identified in the present Example based on the identified nucleotide sequence (Table 1) or a portion thereof and obtain the functionally equivalent polypeptide from the isolated polynucleotide. The present invention include polypeptides encoded by the polynucleotides hybridizing with the polynucleotides encoding the polypeptides identified in the present Example, as long as the polypeptides are functionally equivalent to the polypeptides identified in the present Example. Organisms from which the functionally equivalent polypeptides are isolated are illustrated by vertebrates such as human, mouse, rat, rabbit, pig and bovine, but are not limited to these animals.

Washing conditions of hybridization for the isolation of polynucleotides encoding the functionally equivalent polypeptides are usually “1×SSC, 0.1% SDS, 37° C.”; more stringent conditions are “0.5×SSC, 0.1% SDS, 42° C.”; and still more stringent conditions are “0.1×SSC, 0.1% SDS, 65° C.”. Alternatively, the following conditions can be given as hybridization conditions of the present invention. Namely, conditions in which the hybridization is done at “6×SSC, 40% Formamide, 25° C.”, and the washing at “1×SSC, 55° C.” can be given. More preferable conditions are those in which the hybridization is done at “6×SSC, 40% Formamide, 37° C.”, and the washing at “0.2×SSC, 55° C.”. Even more preferable are those in which the hybridization is done at “6×SSC, 50% Formamide, 37° C.”, and the washing at “0.1×SSC, 62° C.”. The more stringent the conditions of hybridization are, the more frequently the polynucleotides highly homologous to the probe sequence are isolated. Therefore, it is preferable to conduct hybridization under stringent conditions. Examples of stringent conditions in the present invention are, washing conditions of “0.5×SSC, 0.1% SDS, 42° C.”, or alternatively, hybridization conditions of “6×SSC, 40% Formamide, 37° C.”, and the washing at “0.2×SSC, 55° C.”.

One skilled in the art can suitably select various conditions, such as dilution ratios of SSC, formamide concentrations, and temperatures to accomplish a similar stringency.

However, the above-mentioned combinations of SSC, SDS and temperature conditions are indicated just as examples. Those skilled in the art can select the hybridization conditions with similar stringency to those mentioned above by properly combining the above-mentioned or other factors (for example, probe concentration, probe length and duration of hybridization reaction) that determines the stringency of hybridization.

The amino acid sequences of polypeptides isolated by using the hybridization techniques usually have high identity to those of the polypeptides of the present invention, which are shown in Table 1. The present invention encompasses a polynucleotide comprising a nucleotide sequence that has a high identity to the nucleotide sequence of claim 1(a). Furthermore, the present invention encompasses a peptide, or polypeptide comprising an amino acid sequence that has a high identity to the amino acid sequence encoded by the polynucleotide of claim 1(b). The term “high identity” indicates sequence identity of at least 40% or more; preferably 60% or more; and more preferably 70% or more. Alternatively, more preferable is identity of 90% or more, or 93% or more, or 95% or more, furthermore, 97% or more, or 99% or more. The identity can be determined by using the BLAST search algorithm.

As used herein, “percent identity” of amino acid sequences or nucleic acids is determined using the algorithm BLAST of Karlin and Altschul (Proc. Natl. Acad. Sci. USA 90:5873-5877, 1993). Such an algorithm is incorporated into the BLASTN and BLASTX programs of Altschul et al. (J. Mol. Biol.215:403-410, 1990). BLAST nucleotide searches are performed with the BLASTN program, for example, score=100, wordlength=12. BLAST protein searches are performed with the BLASTX program, for example, score=50, wordlength=3. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs are used. See

With the gene amplification technique (PCR) (Current Protocols in Molecular Biology, edit, Ausubel et al., (1987) John Wiley & Sons, Section 6.1-6.4)) using primers designed based on the nucleotide sequence (Table 1) or a portion thereof identified in the present Example, it is possible to isolate a polynucleotide fragment highly homologous to the polynucleotide sequence or a portion thereof and to obtain functionally equivalent polypeptide to a particular polypeptide identified in the present Example based on the isolated polynucleotide fragment.

The present invention also provides a polynucleotide containing at least 15 nucleotides complementary to a polynucleotide comprising a nucleotide sequence of SEQ ID NOs shown in Table 1 or the complementary strand thereof. Herein, the term “complementary strand” is defined as one strand of a double strand DNA composed of A:T and G:C base pair to the other strand. Also, “complementary” is defined as not only those completely matching within a continuous region of at least 15 nucleotides, but also having a identity of at least 70%, favorably 80% or higher, more favorably 90% or higher, and most favorably 95% or higher within that region. The identity may be determined using the algorithm described herein.

Such a polynucleotide includes probes and primers used for the detection and amplification of a polynucleotide encoding the inventive polypeptide. When used as a primer, the polynucleotide usually comprises 15 to 100 bp, and preferably of 15 to 35 bp. When used as a probe, the polynucleotide comprises the whole or a part of the sequence of a polynucleotide of the invention, and comprises at least 15 bp. When used as primers, such polynucleotides are complementary at the 3′-end, and restriction enzyme recognition sequences or tags can be added to the 5′-end.

Furthermore, polynucleotides of the present invention include an antisense polynucleotide for suppressing the expression of a polypeptide of the invention, which comprises an amino acid sequence of SEQ ID NOs shown in Table 1. To exert an antisense effect, an antisense polynucleotide has at least 15 bp or more, for example 50 bp or more, preferably 100 bp or more, and more preferably 500 bp or more, and usually has 3000 bp or less, and preferably 2000 bp or less. Antisense polynucleotides can be used in the gene therapy of diseases caused by abnormalities of the polypeptides of the invention (abnormal function or abnormal expression). An antisense polynucleotide can be prepared, for example, by the phosphorothioate method (“Physicochemical properties of phosphorothioate oligodeoxynucleotides.” Stein (1988) Nucleic Acids Res. 16: 3209-3221) based on the sequence information of polynucleotide encoding a polypeptide of the invention (for example, the nucleotide sequences of SEQ ID NO: 1 to 2443).

The polynucleotides or antisense polynucleotides of the present invention can be used in, for example, gene therapy. As target diseases, for example, cancers or various inflammatory diseases may be preferable. These molecules can be used for gene therapy, for example, by administrating them to patients by the in vivo or ex vivo method using virus vectors such as retrovirus vectors, adenovirus vectors, and adeno-related virus vectors, or non-virus vectors such as liposomes.

The present invention also includes a partial peptide of the polypeptides of the invention. The partial peptide comprises a polypeptide generated as a result that a signal peptide has been removed from a secretory protein. If the polypeptide of the present invention has an activity as a receptor or a ligand, the partial peptide may function as a competitive inhibitor of the polypeptide and may bind to the receptor (or ligand). In addition, the present invention includes an antigen peptide for raising antibodies. For the peptides to be specific for the polypeptide of the invention, the peptides comprise at least 7 amino acids, preferably 8 amino acids or more, more preferably 9 amino acids or more, and even more preferably 10 amino acids or more. The peptide can be used for preparing antibodies against the polypeptide of the invention, or competitive inhibitors of them, and also screening for a receptor that binds to the polypeptide of the invention. The partial peptides of the invention can be produced, for example, by genetic engineering methods, known methods for synthesizing peptides, or digesting the polypeptide of the invention with an appropriate peptidase.

The present invention also relates to a vector into which a polynucleotide of the invention is inserted. The vector of the invention is not limited as long as it contains the inserted polynucleotide stably. For example, if E. coli is used as a host, vectors such as pBluescript vector (Stratagene) are preferable as a cloning vector. To produce the polypeptide of the invention, expression vectors are especially useful. Any expression vector can be used as long as it is capable of expressing the polypeptide in vitro, in E. coli, in cultured cells, or in vivo. For example, PBEST vector (Promega) is preferable for in vitro expression, pET vector (Invitrogen) for E. coli, pME18S-FL3 vector (GenBank Accession No. AB009864) for cultured cells, and pME18S vector (Mol. Cell. Biol. (1988) 8: 466-472) for in vivo expression. To insert the polynucleotide of the invention, ligation utilizing restriction sites can be performed according to the standard method (Current Protocols in Molecular Biology (1987) Ausubel et al. edit, John Wiley & Sons, Section 11.4-11.11).

Recently, the technique of GATEWAY™ system (Invitrogen), which is an expression vector construction system for polypeptide expression, has been developed (Experimental Medicine, Vol. 18, No. 19 (December), p2716-2717, 2000). This system includes two types of site-specific recombinases (BP CLONASE™ and LR CLONASE™) derived from lambda phage and uses BP CLONASE™-specific recombination sites for an Entry Vector and LR CLONASE™-specific recombination sites for a Destination Vector, which may comprise a tag useful for polypeptide purification. With this system, an expression vector can be obtained by using homologous recombination.

First, a polynucleotide fragment of interest is inserted into the entry vector using the first recombination. Then, the secondary recombination is allowed to take place between the entry vector, where the polynucleotide fragment of interest has been inserted, and the destination vector. Thus, the expression vector can be prepared rapidly and highly efficiently. With the above-mentioned typical method using restriction enzyme and ligase reactions, the step of expression vector construction and expression of polypeptide of interest takes about 7 to 10 days. However, with the GATEWAY™ system, the polypeptide of interest can be expressed and prepared in only 3 to 4 days. Thus, the system ensures a high-throughput functional analysis for expressed polypeptides (

The present invention also relates to a transformant carrying the vector of the invention. Any cell can be used as a host into which the vector of the invention is inserted, and various kinds of host cells can be used depending on the purposes. For strong expression of the polypeptide in eukaryotic cells, COS cells or CHO cells can be used, for example.

Introduction of the vector into host cells can be performed, for example, by calcium phosphate precipitation method, electroporation method (Current Protocols in Molecular Biology (1987) Ausubel et al. edit, John Wiley & Sons, Section 9.1-9.9), lipofectamine method (GIBCO-BRL), or microinjection method, etc.

Further, a polynucleotide containing at least 15 nucleotides comprising a nucleotide sequence of any one of the polynucleotides comprising the nucleotide sequences of SEQ ID NOs shown in Table 1 or the complementary strand thereof can be used not only as a primer for synthesizing full-length cDNAs but also for testing and diagnosing the abnormalities of the polypeptide encoded by the full-length cDNA of the present invention. For example, by utilizing polymerase chain reaction (genomic DNA-PCR, or RT-PCR) using the polynucleotide of the invention as a primer, polynucleotide encoding the polypeptide of the invention can be amplified. It is also possible to obtain the regulatory region of expression in the 5′-upstream by using PCR or hybridization since the transcription start site within the genomic sequence can be easily specified based on the 5′-end sequence of the full-length cDNA. The obtained genomic region can be used for detection and/or diagnosis of the abnormality of the sequence by RFLP analysis, SSCP, or sequencing. Especially, in the case where expression of the mRNA of the present invention varies according to a specific disease, analysis of the amount of expression of the mRNA using the polynucleotide of the present invention as a probe or a primer enables detection and diagnosis of the disease.

The present invention also relates to antibodies that bind to the polypeptide of the invention. There are no limitations in the form of the antibodies of the invention. They include polyclonal antibodies, monoclonal antibodies, or their portions that can bind to an antigen. They also include antibodies of all classes. Furthermore, special antibodies such as humanized antibodies and chimeric antibodies are also included.

The polyclonal antibody of the invention can be obtained according to the standard method by synthesizing an oligopeptide corresponding to the amino acid sequence and immunizing rabbits with the peptide (Current Protocols in Molecular Biology (1987) Ausubel et al. edit, John Wiley & Sons, Section 11.12-11.13). The monoclonal antibody of the invention can be obtained according to the standard method by purifying the polypeptide expressed in E. coli, immunizing mice with the polypeptide, and producing a hybridoma cell by fusing the spleen cells and myeloma cells (Current Protocols in Molecular Biology (1987) Ausubel et al. edit, John Wiley & Sons, Section 11.4-11.11).

The antibody binding to the polypeptide of the present invention can be used for purification of the polypeptide of the invention, and also for detection and/or diagnosis of the abnormalities of the expression and structure of the polypeptide. Specifically, polypeptides can be extracted, for example, from tissues, blood, or cells, and the polypeptide of the invention is detected by Western blotting, immunoprecipitation, or ELISA, etc. for the above purpose.

Furthermore, the antibody binding to the polypeptide of the present invention can be utilized for treating the diseases that associates with the polypeptide of the invention. If the antibodies are used for treating patients, human antibodies, humanized antibodies, or chimeric antibodies are preferable in terms of their low antigenicity. The human antibodies can be prepared by immunizing a mouse whose immune system is replaced with that of human (e.g., see “Functional transplant of megabase human immunoglobulin loci recapitulates human antibody response in mice” Mendez, M. J. et al. (1997) Nat. Genet. 15: 146-156). The humanized antibodies can be prepared by recombination of the hypervariable region of a monoclonal antibody (Methods in Enzymology (1991) 203: 99-121).

A cDNA of the present invention encodes, for example, an amino acid sequence of a protein that is predicted to have the following function. The use of the amino acid sequences of the polypeptides encoded by the cDNAs of the present invention enables predicting that the polypeptides have the following functions. It can be predict, from the results of homology search of SwissProt, GenBank, UniGene, or nr, that these polypeptides have such functions. Specifically, for instance, as shown in Examples, searching for a known gene or polypeptide that is homologous to the partial sequence of the full-length cDNA of the invention (2443 clone) and referring the function of the gene and of the polypeptide encoded by the gene make it possible to predict the function of the polypeptide encoded by the cDNA of the invention. In this way, each of 1216 clones out of the 2443 full-length cDNA clones of the invention was predicted to encode a polypeptide that was classified into the following categories.

Secretory and/or membrane protein (632 clones)

Glycoprotein-related protein (128 clones)

Signal transduction-related protein (84 clones)

Transcription-related protein (144 clones)

Disease-related protein (387 clones)

Enzyme and/or metabolism-related protein (206 clones)

Cell division- and/or cell proliferation-related protein (33 clones)

Cytoskeleton-related protein (75 clones)

Nuclear protein and/or RNA synthesis-related protein (65 clones)

Protein synthesis- and/or transport-related protein (62 clones)

Cellular defense-related protein (15 clones)

Development and/or differentiation-related protein (13 clones)

DNA- and/or RNA-binding protein (174 clones)

ATP- and/or GTP-binding protein (68 clones)

The functions of the polypeptides encoded by the cDNAs of the present invention can be predicted by assessing the presence of signal sequence, transmembrane region, nuclear translocation signal, glycosylation signal, phosphorylation site, and zinc finger motif, SH3 domain, etc. in the amino acid sequences. The programs, PSORT (Nakai K., and Kanehisa M. (1992) Genomics 14: 897-911), SOSUI (Hirokawa T. et al. (1998) Bioinformatics 14: 378-379) (Mitsui Knowledge Industry), and MEMSAT (Jones D. T., Taylor W. R., and Thornton J. M. (1994) Biochemistry 33: 3038-3049) can be used to predict the existence of the signal sequence or transmembrane region. Alternatively, a partial amino acid sequence of the polypeptide is fused with another polypeptide such as GFP, the fusion polypeptide is transfected into cultured cells, and the localization is analyzed to predict the function of the original polypeptide.

Based on the determined nucleotide sequences of the full-length cDNAs obtained in the present invention, it is possible to predict more detailed functions of the polypeptides encoded by the cDNA clones, for example, by searching the databases such as GenBank, Swiss-Prot, UniGene, and nr for homologies of the cDNAs; or by searching the amino acid sequences deduced from the full-length cDNAs for signal sequences by using software programs such as PSORT, for transmembrane regions by using software programs such as SOSUI or for motifs by using software programs such as Pfam ( and PROSITE ( As a matter of course, the functions are often predictable by using partial sequence information (preferably 300 nucleotides or more) instead of the full-length nucleotide sequences. However, the result of the prediction by using partial nucleotide sequence does not always agree with the result obtained by using full-length nucleotide sequence, and thus, it is needless to say that the prediction of function is preferably performed based on the full-length nucleotide sequences.

GenBank, Swiss-Prot, UniGene and nr databases were searched for homologies of the full-length nucleotide sequences of the 2443 clones (see Example 6). The amino acid sequences deduced from the full-length nucleotide sequences were searched for functional domains by PSORT, SOSUI and Pfam. Prediction of functions of polypeptides encoded by the clones and the categorization thereof were performed based on these results obtained. The categorization was carried out by the following method.

[1] Firstly, the cDNA clones were classified into the above-mentioned 14 functional categories based on the results of annotation-based categorization (using the keywords in the case of Swiss-Prot hit data; using Definition or Reference information in the case of GenBank, UniGene, or nr hit data), and the signal sequence search of the deduced ORFs by PSORT and the transmembrane region search by SOSUI.

[2] Secondly, clones which had been unassignable to the categories by the method of [1] were searched for functional domains and/or motifs by Pfam. Based on the results, the clones were additionally classified into the above-mentioned 14 types of categories when they had a functional domain and/or motif assignable to any one of the categories.

The following 632 clones presumably belong to secretory and/or membrane proteins.

ADIPS10000640, ADRGL10001470, ADRGL20013520, ADRGL20018540, ADRGL20035850, ASTRO20001410, ASTRO20005330, ASTRO20033160, ASTRO20055750, ASTRO20058630, ASTRO20190390, BEAST20004540, BGGI110000240, BNGH420088500, BRACE20006400, BRACE20038000, BRACE20038470, BRACE20039040, BRACE20039540, BRACE20051380, BRACE20053630, BRACE20059370, BRACE20060550, BRACE20061050, BRACE20063630, BRACE20067430, BRACE20069090, BRACE20081720, BRACE20101700, BRACE20101710, BRACE20116110, BRACE20147800, BRACE20153680, BRACE20163350, BRACE20179340, BRACE20188470, BRACE20195100, BRACE20201570, BRACE20210140, BRACE20224480, BRACE20224500, BRACE20228480, BRACE20232840, BRACE20238000, BRACE20273890, BRACE20274080, BRALZ20013500, BRALZ20054710, BRALZ20064740, BRALZ20069760, BRALZ20073760, BRALZ20077930, BRAMY20000860, BRAMY20002770, BRAMY20025840, BRAMY20039260, BRAMY20060920, BRAMY20063970, BRAMY20111960, BRAMY20112800, BRAMY20124260, BRAMY20134140, BRAMY20135900, BRAMY20136210, BRAMY20144620, BRAMY20152110, BRAMY20174550, BRAMY20181220, BRAMY20195090, BRAMY20211390, BRAMY20211420, BRAMY20215230, BRAMY20218250, BRAMY20218670, BRAMY20229800, BRAMY20231720, BRAMY20247280, BRAMY20252180, BRAMY20273960, BRAMY20277170, BRAMY20284910, BRAMY20285160, BRAWH20015350, BRAWH20015890, BRAWH20016860, BRAWH20018730, BRAWH20030250, BRAWH20064050, BRAWH20110790, BRAWH20112940, BRAWH20117950, BRAWH20118230, BRAWH20121640, BRAWH20122580, BRAWH20132190, BRCAN20064010, BRCAN20071190, BRCAN20091560, BRCAN20103740, BRCAN20224720, BRCAN20273550, BRCAN20280360, BRCAN20285450, BRCOC10000870, BRCOC20004040, BRCOC20006370, BRCOC20041750, BRCOC20077690, BRCOC20078640, BRCOC20090520, BRCOC20101230, BRCOC20107300, BRCOC20114180, BRCOC20121720, BRCOC20134480, BRCOC20136750, BRHIP10001290, BRHIP20000870, BRHIP20003120, BRHIP20103090, BRHIP20111200, BRHIP20118380, BRHIP20118910, BRHIP20121410, BRHIP20135100, BRHIP20174040, BRHIP20179200, BRHIP20183690, BRHIP20191490, BRHIP20191770, BRHIP20198190, BRHIP20207430, BRHIP20208270, BRHIP20208590, BRHIP20217620, BRHIP20233090, BRHIP20234380, BRHIP20238880, BRHIP20283030, BRHIP30004570, BRSSN20003120, BRSSN20043040, BRSSN20066110, BRSSN20120810, BRSSN20137020, BRSSN20142940, BRSSN20146100, BRSSN20151990, BRSSN20169050, BRSTN20002200, BRTHA20004740, BRTHA20046290, BRTHA20046420, COLON10001350, COLON20093370, CTONG10000100, CTONG10000940, CTONG10001650, CTONG20004690, CTONG20009770, CTONG20092570, CTONG20092580, CTONG20095340, CTONG20099380, CTONG20103480, CTONG20105080, CTONG20114740, CTONG20119200, CTONG20120770, CTONG20124730, CTONG20131490, CTONG20132220, CTONG20133480, CTONG20139340, CTONG20149950, CTONG20155400, CTONG20158660, CTONG20159530, CTONG20161850, CTONG20267700, D3OST10001090, D3OST20036070, D3OST20038560, D3OST30002580, D6OST20005070, D9OST20002780, D9OST20015470, D9OST20023970, D9OST20026730, D9OST20035940, D9OST20040180, DFNES20025880, FCBBF10000240, FCBBF10000380, FCBBF10001150, FCBBF10001210, FCBBF10001550, FCBBF10002430, FCBBF10002700, FCBBF10003220, FCBBF10003760, FCBBF10005460, FCBBF10005740, FCBBF20032970, FCBBF20042560, FCBBF20049300, FCBBF20051220, FCBBF30008470, FCBBF30024750, FCBBF30078290, FCBBF30083620, FCBBF30086440, FCBBF30090690, FCBBF30095260, FCBBF30123470, FCBBF30172550, FCBBF30175310, FCBBF30190850, FCBBF30215060, FCBBF30238870, FCBBF30251420, FCBBF30279030, FEBRA20002100, FEBRA20004620, FEBRA20009090, FEBRA20029860, FEBRA20037260, FEBRA20080810, FEBRA20086620, FEBRA20092890, FEBRA20093520, FEBRA20095880, FEBRA20111460, FEBRA20125070, FEBRA20130190, FEBRA20140100, FEBRA20145780, FEBRA20211710, FEBRA20223220, FEBRA20229630, FEBRA20235500, HCHON20000380, HCHON20008180, HCHON20015980, HCHON20016040, HCHON20016650, HCHON20040020, HCHON20064590, HCHON20067700, HCHON20068710, HCHON20086720, HCHON20100740, HEART20003060, HEART20005410, HEART20034320, HEART20049410, HEART20049800, HEART20072310, HHDPC20001040, HHDPC20014320, HHDPC20034720, HHDPC20068620, HHDPC20084140, HHDPC20091780, HHDPC20092080, HLUNG10000550, KIDNE20003940, KIDNE20007770, KIDNE20011400, KIDNE20021910, KIDNE20022620, KIDNE20100070, KIDNE20101510, KIDNE20109730, KIDNE20121880, KIDNE20125630, KIDNE20126010, KIDNE20126130, KIDNE20127450, KIDNE20130450, KIDNE20131580, KIDNE20137340, KIDNE20181660, LIVER20035110, LIVER20045650, LIVER20055200, LIVER20062510, LIVER20064690, LIVER20075680, LIVER20087060, LIVER20091180, MESAN10001260, MESAN20014500, MESAN20027090, MESAN20038510, MESAN20089360, MESAN20103120, MESAN20115970, MESAN20125860, MESAN20139360, MESAN20152770, MESAN20153910, MESAN20174170, NOVAR20000380, NT2NE20010050, NT2NE20021620, NT2NE20068130, NT2NE20118960, NT2NE20124480, NT2NE20131890, NT2NE20132170, NT2NE20155110, NT2NE20156260, NT2NE20157470, NT2NE20159740, NT2NE20177520, NT2NE20183760, NT2RI20003480, NT2RI20023910, NT2RI20025400, NT2RI20028470, NT2RI20040930, NT2RI20054050, NT2RI20056700, NT2RI20076290, NT2RI20086220, NT2RI20091940, NT2RI20244600, NT2RP70072690, NT2RP70081610, NT2RP70122910, NT2RP70125160, NT2RP70133740, NT2RP70134990, NT2RP70137290, NT2RP70179710, NT2RP70188020, NT2RP70192730, NT2RP70198350, NTONG20028070, NTONG20029700, NTONG20048060, NTONG20049910, NTONG20051530, NTONG20061870, NTONG20063010, NTONG20067830, NTONG20076930, NTONG20092330, OCBBF10001750, OCBBF20013890, OCBBF20019830, OCBBF20023570, OCBBF20026630, OCBBF20046690, OCBBF20050770, OCBBF20059560, OCBBF20063320, OCBBF20071210, OCBBF20072320, OCBBF20080050, OCBBF20086400, OCBBF20086910, OCBBF20087010, OCBBF20088140, OCBBF20091150, OCBBF20107090, OCBBF20108630, OCBBF20116850, OCBBF20120390, OCBBF20122620, OCBBF20130910, OCBBF20132850, OCBBF20145760, OCBBF20155060, OCBBF20178880, OCBBF20180120, OCBBF20180840, OCBBF20188730, PANCR10000910, PEBLM10000710, PEBLM20024320, PEBLM20040150, PEBLM20074370, PEBLM20075980, PERIC20004220, PLACE60086400, PLACE60121080, PLACE60161600, PLACE60177140, PROST20005050, PROST20050670, PROST20107820, PROST20116600, PROST20120160, PROST20127800, PROST20146010, PROST20164440, PROST20169800, PROST20170980, PROST20175290, PUAEN20003740, PUAEN20030180, SALGL10001710, SKMUS20003610, SKMUS20007800, SKMUS20011640, SKMUS20020840, SKMUS20028210, SKMUS20028400, SKMUS20077400, SKNSH20028660, SKNSH20031740, SKNSH20051940, SKNSH20063040, SMINT20009840, SMINT20011990, SMINT20022020, SMINT20029760, SMINT20040860, SMINT20050750, SMINT20053870, SMINT20073650, SMINT20095050, SMINT20100680, SMINT20105330, SMINT20106720, SMINT20121950, SMINT20127930, SMINT20144430, SMINT20144890, SMINT20153260, SMINT20154540, SMINT20157450, SMINT20173240, SMINT20178550, SMINT20191420, SMINT20192000, SPLEN20003070, SPLEN20021660, SPLEN20029310, SPLEN20079510, SPLEN20095810, SPLEN20097330, SPLEN20118300, SPLEN20141360, SPLEN20141990, SPLEN20142100, SPLEN20144520, SPLEN20152760, SPLEN20157880, SPLEN20165310, SPLEN20167200, SPLEN20169220, SPLEN20169720, SPLEN20171890, SPLEN20172120, SPLEN20179810, SPLEN20186430, SPLEN20211570, SPLEN20211940, SPLEN20213830, SPLEN20273950, SPLEN20292950, SPLEN20293800, SPLEN20304950, SPLEN20329240, STOMA20005390, STOMA20005670, STOMA20006400, STOMA20006780, STOMA20008880, STOMA20051200, STOMA20056640, STOMA20056670, STOMA20062130, STOMA20077450, STOMA20080500, STOMA20088380, STOMA20092530, SYNOV20001520, SYNOV20001730, SYNOV20002510, SYNOV20002790, SYNOV20002970, SYNOV20004260, SYNOV20007000, SYNOV20008240, SYNOV20009230, SYNOV20010880, SYNOV20011110, SYNOV20013000, SYNOV20013560, SYNOV20013900, SYNOV30001840, TBAES20003150, TESOP20004000, TESOP20005690, TESTI20001720, TESTI20036380, TESTI20037560, TESTI20094120, TESTI20110280, TESTI20123080, TESTI20123560, TESTI20128350, TESTI20136100, TESTI20136710, TESTI20143390, TESTI20148000, TESTI20164100, TESTI20193360, TESTI20209810, TESTI20209990, TESTI20211220, TESTI20214250, TESTI20216370, TESTI20230250, TESTI20231940, TESTI20242990, TESTI20244190, TESTI20254220, TESTI20254860, TESTI20265970, TESTI20271850, TESTI20272960, TESTI20284880, TESTI20291310, TESTI20291960, TESTI20303220, TESTI20303360, TESTI20303420, TESTI20307700, TESTI20309170, TESTI20314180, TESTI20316870, TESTI20333000, TESTI20335200, TESTI20347180, TESTI20347300, TESTI20352620, TESTI20357960, TESTI20370810, TESTI20373820, TESTI20383880, TESTI20390260, TESTI20390410, TESTI20391770, TESTI20393530, TESTI20396130, TESTI20397760, TESTI20401020, TESTI20401280, TESTI20415170, TESTI20421490, TESTI20422640, TESTI20441940, TESTI20442760, TESTI20444130, TESTI20444180, TESTI20449200, TESTI20463520, TESTI20463580, TESTI20465350, THYMU10005360, THYMU10005540, THYMU20027560, THYMU20032870, THYMU20039810, THYMU20066100, THYMU20081490, THYMU20100410, THYMU20106710, THYMU20111830, THYMU20141670, THYMU20147770, THYMU20159430, THYMU20161640, THYMU20162190, THYMU20173980, THYMU20194420, THYMU20208300, THYMU20216840, THYMU20222890, THYMU20229220, THYMU20241850, THYMU20277390, TKIDN20005210, TRACH20002870, TRACH20003590, TRACH20016210, TRACH20019960, TRACH20029540, TRACH20033230, TRACH20034840, TRACH20042920, TRACH20050040, TRACH20067620, TRACH20068660, TRACH20069180, TRACH20076740, TRACH20085400, TRACH20085830, TRACH20109650, TRACH20111130, TRACH20121380, TRACH20128110, TRACH20128230, TRACH20134950, TRACH20136710, TRACH20139820, TRACH20140820, TRACH20145440, TRACH20168350, TRACH20180840, TRACH20190240, UMVEN20000690, UTERU20030570, UTERU20040610, UTERU20046980, UTERU20055480, UTERU20064860, UTERU20076390, UTERU20094350, UTERU20135860, UTERU20144640, UTERU20158300, UTERU20158800, UTERU20161570, UTERU20178100, UTERU20183640, UTERU20186740

The following 128 clones presumably belong to glycoprotein-related proteins. ADIPS10000640, BRACE20059370, BRACE20163350, BRAMY20277170, BRAMY20285160, BRAWH20064050, BRAWH20112940, BRAWH20117950, BRAWH20118230, BRCAN20103740, BRCOC20004040, BRCOC20006370, BRHIP10001290, BRHIP20103090, BRHIP20283030, BRHIP30004570, BRSSN20003120, BRSSN20146100, BRTHA20046290, COLON10001350, CTONG20159530, D9OST20023970, D9OST20040180, FCBBF10001150, FCBBF20049300, FCBBF30024750, FCBBF30083620, FCBBF30190850, FCBBF30238870, FEBRA20086620, FEBRA20092890, HCHON20015980, HCHON20016040, HCHON20064590, HCHON20086720, HCHON20100740, HEART20003060, HHDPC20014320, HHDPC20068620, HHDPC20092080, KIDNE20003940, KIDNE20007770, KIDNE20101510, LIVER20064690, MESAN20125860, NT2NE20118960, NT2NE20157470, NT2NE20177520, NT2RI20003480, NT2RI20056700, NT2RP70192730, NTONG20051530, NTONG20076930, OCBBF20107090, OCBBF20108630, OCBBF20120390, OCBBF20145760, OCBBF20155060, PLACE60177140, SMINT20050750, SMINT20073650, SMINT20105330, SMINT20106720, SMINT20112730, SMINT20127930, SMINT20153260, SMINT20179740, SMINT20190170, SPLEN20021660, SPLEN20142100, SPLEN20157880, SPLEN20165310, SPLEN20179810, SPLEN20186430, STOMA20001830, STOMA20005390, STOMA20005670, STOMA20006400, STOMA20008880, STOMA20034770, STOMA20056640, STOMA20056670, STOMA20083610, STOMA20088380, STOMA20092530, SYNOV20001520, SYNOV20001730, SYNOV20002510, SYNOV20002790, SYNOV20002970, SYNOV20004260, SYNOV20007000, SYNOV20008240, SYNOV20009230, SYNOV20010880, SYNOV20011110, SYNOV20013000, SYNOV20013560, SYNOV20013900, TESOP20004000, TESTI20136100, TESTI20216370, TESTI20244190, TESTI20254860, TESTI20303220, TESTI20335200, TESTI20352620, TESTI20358980, TESTI20442760, TESTI20449200, TESTI20455090, THYMU10005360, THYMU10005540, THYMU20147770, THYMU20159430, THYMU20241850, TRACH20016210, TRACH20050040, TRACH20067620, TRACH20069180, TRACH20076740, TRACH20128230, UTERU20046980, UTERU20064860, UTERU20144640, UTERU20158800, UTERU20161570, UTERU20183640

The following 84 clones presumably belong to signal transduction-related proteins.

ASTRO20108190, BRACE20115920, BRACE20154120, BRACE20177200, BRACE20237270, BRAMY20104640, BRAMY20242470, BRAMY20271400, BRAWH20016620, BRAWH20103290, BRAWH20149340, BRCOC20021550, BRCOC20091960, BRHIP20189980, BRHIP20218580, BRHIP20238600, BRSSN20038200, CD34C30004240, CTONG20118150, CTONG20127450, CTONG20200310, FCBBF30012350, FCBBF40001730, FEBRA10001880, FEBRA20004620, FEBRA20132740, FEBRA20144170, FEHRT20003250, HCHON20007510, HLUNG20033780, IMR3220002430, KIDNE20008010, KIDNE20102710, KIDNE20107620, NT2NE20080170, NT2NE20181650, NT2RP70027380, NT2RP70036880, NT2RP70063950, NT2RP70078420, NT2RP70159960, NTONG20046140, NTONG20056570, OCBBF20028050, OCBBF20053430, OCBBF20054760, OCBBF20124360, OCBBF20127140, OCBBF20149280, OCBBF20173980, PEBLM20013120, PEBLM20085760, PROST20161950, PUAEN20015260, PUAEN20015860, PUAEN20083140, SMINT20028820, SMINT20049090, SMINT20110660, SPLEN20011410, SPLEN20121750, SPLEN20170310, SPLEN20181810, SPLEN20222270, SPLEN20250170, SPLEN20283650, TESTI20035960, TESTI20288910, TESTI20305540, TESTI20326810, TESTI20369650, TESTI20392250, TESTI20416640, TESTI20432750, TESTI20467320, THYMU20169680, THYMU20172150, THYMU20201980, THYMU20202890, TKIDN20004640, TKIDN20047480, TRACH20057690, UMVEN10001860, UTERU20146310

The following 144 clones presumably belong to transcription-related proteins.

3NB6920014590, ADIPS20004250, ASTRO20008010, ASTRO20168470, BLADE20003400, BLADE20003890, BRACE20060890, BRACE20068590, BRACE20257100, BRAMY20210400, BRAMY20260910, BRAMY20270730, BRAWH20028110, BRAWH20075700, BRAWH20096780, BRCAN20280210, BRCOC20144000, BRCOC20178270, BRHIP20005340, BRHIP20096170, BRHIP20119330, BRHIP20191860, BRHIP20195890, BRHIP20222280, BRSSN20039370, BRSSN20046790, BRSSN20176820, CTONG20050280, CTONG20075860, CTONG20085950, CTONG20091080, CTONG20092700, CTONG20121010, CTONG20124220, CTONG20133390, CTONG20133520, D9OST20033970, FCBBF10001710, FCBBF10004370, FCBBF20059090, FCBBF20068820, FCBBF30007680, FCBBF30010810, FCBBF30018550, FCBBF30025560, FCBBF30057290, FCBBF30083820, FCBBF30129630, FCBBF30240960, FCBBF30246230, FEBRA20018690, FEBRA20026110, FEBRA20034680, FEBRA20040530, FEBRA20082010, FEBRA20171380, FEBRA20195820, FEBRA20233770, HCHON20008320, HCHON20009560, HCHON20035130, HHDPC10000830, HHDPC20030490, HHDPC20031130, KIDNE20027250, KIDNE20027950, KIDNE20182690, LIVER20055440, NT2NE20010490, NT2NE20089970, NT2NE20142210, NT2NE20184900, NT2RP60000770, NT2RP70043480, NT2RP70063950, NT2RP70102350, NT2RP70157890, NTONG20070200, OCBBF10001850, OCBBF20020830, OCBBF20037440, OCBBF20046120, OCBBF20049300, OCBBF20054200, OCBBF20066390, OCBBF20071840, OCBBF20080410, OCBBF20108190, OCBBF20125530, OCBBF20148280, PEBLM20060360, PEBLM20078320, PERIC20003870, PROST10003220, PROST20047390, PROST20066880, PROST20185830, PROST20189770, PROST20191640, SKNSH20008190, SMINT20001760, SMINT20028820, SMINT20130320, SMINT20144800, SPLEN20026950, SPLEN20054290, SPLEN20079260, SPLEN20095410, SPLEN20117660, SPLEN20140800, SPLEN20147390, SPLEN20160450, SPLEN20162680, SPLEN20243830, SPLEN20250170, SPLEN20252190, SPLEN20267650, STOMA20032890, STOMA20063250, TESTI20039400, TESTI20041690, TESTI20067200, TESTI20088220, TESTI20130010, TESTI20156100, TESTI20230850, TESTI20318090, TESTI20320670, TESTI20378190, TESTI20385960, TESTI20409890, TESTI20420620, TESTI20432820, TESTI20456110, THYMU20247480, TRACH20079690, TRACH20154860, TRACH20163170, TRACH20164980, TRACH20184490, UTERU20099720, UTERU20116570, UTERU20145480, UTERU20176130

The following 387 clones presumably belong to disease-related proteins.

ADIPS20004250, ADRGL10001470, ADRGL20011190, ADRGL20018300, ADRGL20035850, ADRGL20078100, ASTRO10001650, ASTRO20008010, ASTRO20027430, ASTRO20106150, ASTRO20108190, ASTRO20168470, BLADE20003400, BLADE20003890, BRACE20038480, BRACE20039540, BRACE20059370, BRACE20108130, BRACE20108880, BRACE20115920, BRACE20116460, BRACE20232840, BRACE20248260, BRACE20253330, BRACE20284100, BRALZ20013500, BRALZ20017430, BRALZ20018340, BRAMY20000520, BRAMY20025840, BRAMY20120910, BRAMY20134140, BRAMY20135900, BRAMY20162510, BRAMY20174550, BRAMY20210400, BRAMY20211390, BRAMY20242470, BRAMY20245300, BRAMY20266850, BRAMY20285160, BRAWH20016620, BRAWH20028110, BRAWH20064050, BRAWH20096780, BRAWH20110960, BRAWH20113430, BRAWH20114000, BRAWH20118230, BRAWH20121640, BRAWH20128270, BRAWH20137480, BRCAN20103740, BRCAN20224720, BRCAN20279700, BRCAN20280210, BRCAN20283190, BRCOC20001860, BRCOC20006370, BRCOC20027510, BRCOC20055420, BRCOC20099370, BRCOC20178270, BRCOC20178560, BRHIP20003120, BRHIP20005340, BRHIP20174040, BRHIP20176420, BRHIP20191490, BRHIP20191860, BRHIP20194940, BRHIP20195890, BRHIP20222280, BRHIP20249110, BRHIP20285930, BRHIP30004880, BRSSN20013420, BRSSN20038200, BRSSN20039370, BRSSN20046790, BRSSN20066110, BRSSN20101100, BRSSN20120810, BRSSN20187310, BRTHA20046290, CD34C30004240, COLON10001350, CTONG20004690, CTONG20052650, CTONG20099550, CTONG20124220, CTONG20125640, CTONG20128430, CTONG20131560, CTONG20133390, CTONG20153300, CTONG20153580, CTONG20158040, CTONG20159530, D6OST20003580, D9OST20023970, DFNES20001530, DFNES20037420, FCBBF10001210, FCBBF10001710, FCBBF10003770, FCBBF20059090, FCBBF20064520, FCBBF20068820, FCBBF30010810, FCBBF30024750, FCBBF30025560, FCBBF30039020, FCBBF30049550, FCBBF30057290, FCBBF30083620, FCBBF30129630, FCBBF30190850, FCBBF30238870, FCBBF30240960, FCBBF30243640, FCBBF30279030, FCBBF30281880, FCBBF40001730, FEBRA10001880, FEBRA20004620, FEBRA20010120, FEBRA20018690, FEBRA20082010, FEBRA20097310, FEBRA20130190, FEBRA20132740, FEBRA20144170, FEBRA20195820, FEBRA20223220, FEBRA20233770, FEBRA20235500, FEHRT20003250, HCHON10001760, HCHON20007380, HCHON20008320, HCHON20009560, HCHON20015230, HCHON20015980, HCHON20016040, HCHON20035130, HCHON20036420, HCHON20064590, HCHON20067700, HCHON20086720, HCHON20100740, HEART20003060, HEART20017730, HEART20025980, HEART20049410, HHDPC20014320, HHDPC20030490, HHDPC20084140, HHDPC20091140, HHDPC20091780, HHDPC20092080, HLUNG20033780, IMR3220002430, KIDNE20007770, KIDNE20020150, KIDNE20021680, KIDNE20022620, KIDNE20024830, KIDNE20027950, KIDNE20101370, KIDNE20101510, KIDNE20182690, LIVER20002160, LIVER20055200, LIVER20055440, LIVER20059810, LIVER20064690, MESAN20101140, MESAN20125860, MESAN20130220, MESAN20154010, MESAN20174170, NOVAR10000910, NT2NE20010490, NT2NE20118960, NT2NE20157470, NT2RI20040990, NT2RI20041880, NT2RI20048840, NT2RI20050960, NT2RI20240080, NT2RP60000770, NT2RP70027380, NT2RP70032610, NT2RP70037240, NT2RP70192730, NT2RP70198350, NTONG20013620, NTONG20015870, NTONG20028070, NTONG20067830, NTONG20070200, NTONG20090600, NTONG20092330, OCBBF20006770, OCBBF2003744.0, OCBBF20046120, OCBBF20049300, OCBBF20053490, OCBBF20053730, OCBBF20054760, OCBBF20071840, OCBBF20072240, OCBBF20078920, OCBBF20108430, OCBBF20108580, OCBBF20127140, OCBBF20129360, OCBBF20145760, OCBBF20153350, OCBBF20173980, OCBBF20178880, PEBLM10000710, PEBLM20013120, PERIC10000250, PLACE60060420, PLACE60177140, PROST20100460, PROST20159240, PROST20169800, PROST20176170, PUAEN20018820, PUAEN20030180, PUAEN20055020, PUAEN20083140, SKMUS20018230, SKMUS20018500, SKMUS20021530, SKMUS20024750, SKMUS20029200, SKMUS20048970, SKMUS20049030, SKNSH20008190, SKNSH20089400, SMINT20001760, SMINT20026890, SMINT20028820, SMINT20050750, SMINT20073650, SMINT20105330, SMINT20112730, SMINT20121220, SMINT20127350, SMINT20127930, SMINT20136130, SMINT20138900, SMINT20153260, SMINT20155180, SMINT20179740, SMINT20190170, SMINT20191420, SPLEN20006070, SPLEN20011410, SPLEN20026950, SPLEN20027440, SPLEN20039240, SPLEN20079260, SPLEN20095410, SPLEN20146450, SPLEN20147390, SPLEN20151210, SPLEN20160450, SPLEN20170310, SPLEN20179180, SPLEN20186430, SPLEN20212730, SPLEN20243830, SPLEN20245300, SPLEN20250390, SPLEN20252190, SPLEN20267650, SPLEN20305620, STOMA20001830, STOMA20005390, STOMA20008880, STOMA20010250, STOMA20034770, STOMA20046680, STOMA20056670, STOMA20064470, STOMA20077450, STOMA20080500, STOMA20083610, STOMA20088380, SYNOV20001520, SYNOV20001730, SYNOV20002790, SYNOV20002970, SYNOV20007000, SYNOV20008240, SYNOV20009230, SYNOV20010880, SYNOV20011110, TBAES20003770, TESOP20004000, TESOP20005270, TESTI20031270, TESTI20036380, TESTI20044310, TESTI20067200, TESTI20116830, TESTI20121550, TESTI20156100, TESTI20168480, TESTI20208400, TESTI20215990, TESTI20231940, TESTI20234360, TESTI20237520, TESTI20238610, TESTI20239510, TESTI20249990, TESTI20266740, TESTI20316870, TESTI20318090, TESTI20335050, TESTI20335200, TESTI20343570, TESTI20352620, TESTI20368330, TESTI20369650, TESTI20385960, TESTI20392250, TESTI20400940, TESTI20404240, TESTI20420620, TESTI20436560, TESTI20438570, TESTI20441940, TESTI20442760, TESTI20443090, TESTI20449200, TESTI20455090, TESTI20455620, TESTI20456110, TESTI20463580, TESTI20465350, TESTI20465690, TESTI20467210, THYMU20122730, THYMU20126900, THYMU20130890, THYMU20159430, THYMU20169680, THYMU20172150, THYMU20180280, THYMU20193640, THYMU20209590, THYMU20232090, THYMU20247480, TKIDN10000010, TKIDN20004640, TKIDN20047480, TRACH20016210, TRACH20019960, TRACH20050040, TRACH20057690, TRACH20067620, TRACH20077540, TRACH20079690, TRACH20096610, TRACH20105870, TRACH20121380, TRACH20154860, TRACH20162860, TRACH20163170, TRACH20164980, TRACH20190240, TSTOM20005690, TUTER20002830, UTERU20030570, UTERU20116570, UTERU20144640, UTERU20151980, UTERU20158800, UTERU20183640, UTERU20185230

The following 206 clones presumably belong to the category of enzymes and/or metabolism-related proteins.

3NB6910001910, ADRGL10001470, ADRGL20035850, ADRGL20078100, ASTRO20105820, ASTRO20106150, ASTRO20130500, ASTRO20145760, BRACE20027620, BRACE20038000, BRACE20062640, BRACE20096200, BRACE20107530, BRACE20108130, BRACE20108880, BRACE20116460, BRACE20148240, BRACE20185680, BRACE20253160, BRALZ20017430, BRALZ20018340, BRAMY20104640, BRAMY20134140, BRAMY20153110, BRAMY20213100, BRAMY20252720, BRAWH20016620, BRAWH20105840, BRAWH20112940, BRAWH20114000, BRAWH20117950, BRAWH20125380, BRAWH20132190, BRAWH20171030, BRCAN20054490, BRCAN20224720, BRCAN20280360, BRCAN20283190, BRCAN20283380, BRCOC20001860, BRCOC20031250, BRCOC20055420, BRCOC20091960, BRCOC20144000, BRHIP10001290, BRHIP20005530, BRHIP20096850, BRHIP20103090, BRHIP20174040, BRHIP20249110, BRSSN20013420, BRSSN20015790, BRSSN20120810, BRSSN20146100, CTONG20095340, CTONG20106520, CTONG20118250, CTONG20127450, CTONG20140580, CTONG20153300, CTONG20158040, D3OST20006180, D6OST20003580, DFNES20031920, DFNES20071130, FCBBF10001820, FCBBF10003670, FCBBF30012350, FCBBF30012810, FCBBF30175310, FCBBF30243640, FEBRA10001880, FEBRA20007620, FEBRA20130190, FEBRA20144170, FEBRA20167390, FEBRA20196630, FEHRT20003250, HCHON10001760, HCHON20003220, HCHON20015350, HEART20034320, HEART20090000, HHDPC20014320; KIDNE20002520, KIDNE20008010, KIDNE20021680, KIDNE20022620, KIDNE20028390, KIDNE20028720, KIDNE20107620, LIVER20059810, MESAN20154010, NT2NE20118960, NT2NE20157470, NT2RI20005750, NT2RI20244600, NT2RI20273230, NT2RP70032610, NT2RP70045590, NT2RP70192730, NT2RP70195430, NTONG20009770, NTONG20013620, NTONG20046140, OCBBF20028650, OCBBF20030910, OCBBF20046690, OCBBF20050770, OCBBF20053430, OCBBF20053490, OCBBF20053730, OCBBF20054760, OCBBF20078920, OCBBF20124360, OCBBF20129360, OCBBF20178880, PEBLM20044520, PEBLM20052820, PEBLM20060490, PERIC10000250, PLACE50000660, PROST20083600, PROST20169800, PUAEN20015260, PUAEN20030180, SKMUS20018230, SMINT20028820, SMINT20049090, SMINT20102780, SMINT20105330, SMINT20106290, SMINT20110660, SMINT20152940, SMINT20191420, SMINT20191530, SPLEN20021660, SPLEN20026950, SPLEN20121750, SPLEN20145720, SPLEN20149240, SPLEN20150940, SPLEN20151210, SPLEN20173510, SPLEN20212730, SPLEN20250390, SPLEN20305620, STOMA20006860, STOMA20077450, TBAES20002550, TBAES20003150, TESOP20004000, TESOP20005270, TESTI20001000, TESTI20002720, TESTI20002780, TESTI20060400, TESTI20066670, TESTI20082330, TESTI20083200, TESTI20108720, TESTI20116830, TESTI20143390, TESTI20148000, TESTI20216370, TESTI20232140, TESTI20234360, TESTI20237520, TESTI20239510, TESTI20266740, TESTI20314180, TESTI20334410, TESTI20343570, TESTI20352620, TESTI20355020, TESTI20366910, TESTI20368330, TESTI20369650, TESTI20375340, TESTI20397760, TESTI20416640, TESTI20432750, TESTI20463580, TESTI20465350, TESTI20471410, TESTI20473830, THYMU20023380, THYMU20111830, THYMU20126900, THYMU20169680, THYMU20202890, TKIDN20004640, TKIDN20047480, TRACH20003590, TRACH20016210, TRACH20019960, TRACH20041830, TRACH20057690, TRACH20067620, TRACH20084720, TRACH20085830, TRACH20162860, UTERU20064860, UTERU20144640, UTERU20146310, UTERU20151980

The following 33 clones presumably belong to the category of cell division- and/or cell proliferation-related proteins.

BRALZ20077900, BRAMY20135900, BRAWH20002320, BRAWH20128270, BRCAN20071190, BRCAN20273640, BRHIP20096170, CTONG10000940, CTONG20124220, FCBBF30247930, FEBRA20113560, HCASM10000500, HCHON20097490, MESAN20025190, NT2RI20050960, OCBBF20039250, OCBBF20054760, OCBBF20072240, SMINT20051610, SPLEN20147110, SPLEN20284240, TESOP20005690, TESTI20234360, TESTI20305540, TESTI20332420, TESTI20335050, TESTI20368330, TESTI20392760, TESTI20400940, THYMU20161640, TKIDN20047480, UTERU20097760, UTERU20185230

The following 75 clones presumably belong to the category of cytoskeleton-related proteins.

ADRGL20011190, ADRGL20018300, ASTRO10001650, ASTRO20055750, BRACE20003070, BRACE20059370, BRACE20163350, BRAMY20121620, BRAMY20157820, BRAMY20242470, BRAWH20028110, BRAWH20137480, BRCAN20003460, BRCOC20008160, BRCOC20059510, BRHIP20115080, BRHIP20137230, BRHIP20167880, BRHIP20283030, BRHIP20285830, BRSSN20187310, CTONG10002770, CTONG20052900, CTONG20121580, FCBBF10001150, FCBBF30013770, FCBBF30015940, FCBBF30049550, FEBRA20024100, FEBRA20237640, HCHON20015980, HCHON20068410, HEART20017730, HEART20025980, HEART20061950, HEART20077670, HLUNG20016330, KIDNE20118580, MESAN20004570, NT2RI20040990, NT2RI20041880, NT2RP70037240, NT2RP70062230, NTONG20015870, NTONG20056570, NTONG20067830, NTONG20090600, OCBBF20107090, OCBBF20155060, PLACE60079250, PUAEN20040670, SKMUS20001980, SKMUS20016220, SKMUS20048970, SKMUS20049030, SMINT20024570, SMINT20026890, SMINT20121220, SMINT20138900, SPLEN20006070, SPLEN20027440, SPLEN20142100, TESTI20063830, TESTI20094230, TESTI20278400, TESTI20371030, TESTI20417300, TESTI20436560, TESTI20455090, THYMU20105190, THYMU20172150, THYMU20209590, TRACH20096610, UMVEN10001560, UTERU20116570

The following 65 clones presumably belong to the category of nuclear proteins and/or RNA synthesis-related proteins.

BRACE20057190, BRACE20064880, BRACE20248260, BRACE20253160, BRAMY20000520, BRAMY20120910, BRAWH20113430, BRAWH20171030, BRCAN10001490, BRCAN20283190, BRCOC20037320, BRCOC20178560, BRHIP20106100, BRHIP20176420, BRHIP20243470, BRSSN20101100, CTONG20114290, CTONG20125540, CTONG20131560, CTONG20140580, DFNES20001530, FCBBF20064520, FEBRA20007620, FEBRA20010120, FEBRA20097310, FEBRA20144170, FEBRA20174410, FEBRA20215500, IMR3220002430, MESAN20101140, NT2RI20273230, OCBBF20028650, OCBBF20030910, OCBBF20078920, PROST20104000, PUAEN20018820, SKMUS20007010, SMINT20127350, SMINT20177360, SMINT20191530, SPLEN20008740, SPLEN20146450, STOMA20046680, TESTI20082330, TESTI20094470, TESTI20121550, TESTI20208400, TESTI20234360, TESTI20237520, TESTI20249990, TESTI20334410, TESTI20355020, TESTI20368330, TESTI20392760, TESTI20408970, TESTI20436560, TESTI20438570, TESTI20443090, THYMU20193640, THYMU20202890, THYMU20241210, TRACH20096610, TUTER20002830, UTERU20151980, UTERU20176320

The following 62 clones presumably belong to the category of protein synthesis- and/or protein transport-related proteins.

3NB6910001910, ASTRO20106150, ASTRO20130500, ASTRO20141350, BRACE20038480, BRACE20052160, BRACE20057620, BRACE20106840, BRACE20172980, BRACE20192440, BRAWH20110960, BRCOC20037320, BRHIP20005530, BRSSN20120810, BRSTN20005360, CTONG20009770, CTONG20114290, CTONG20125640, CTONG20153300, D6OST20003580, DFNES20037420, FCBBF30012810, FEBRA20080810, HCHON20064590, HHDPC20014320, HHDPC20084140, HLUNG20017120, LIVER20064690, NT2NE20132170, NT2NE20157470, NT2RP70133740, NTONG20009770, NTONG20075220, NTONG20076930, OCBBF20030910, OCBBF20035930, OCBBF20153340, PLACE60060420, SMINT20152940, SPLEN20008740, SPLEN20103950, SPLEN20118300, SPLEN20212730, SPLEN20250390, STOMA20077450, TBAES20002550, TESOP20004000, TESTI20239510, TESTI20278400, TESTI20314180, TESTI20463580, THYMU20111830, THYMU20122730, THYMU20130890, THYMU20232090, TKIDN10000010, TRACH20084720, TRACH20105870, TRACH20139820, TRACH20149970, UTERU20120310, UTERU20188110

The following 15 clones presumably belong to the category of cellular defense-related proteins.

BRCOC20144000, CTONG20092680, KIDNE20020150, LIVER20002160, NT2RI20050960, NT2RP70045590, OCBBF20128120, PLACE60003480, SKNSH20089400, SMINT20106290, SPLEN20039240, TESTI20001000, TESTI20455620, TRACH20028030, UTERU20176320

The following 13 clones presumably belong to the category of development and/or differentiation-related proteins.

3NB6920014590, BRAMY20211390, CTONG20091080, CTONG20121010, FCBBF30024750, KIDNE20027250, NT2NE20142210, OCBBF20054200, PROST10003220, SKMUS20007010, SPLEN20179810, STOMA20063250, TESTI20291960

The following 174 clones presumably belong to the category of DNA- and/or RNA-binding proteins.

3NB6920014590, ADIPS20004250, ASTRO20008010, ASTRO20168470, BLADE20003400, BLADE20003890, BRACE20057620, BRACE20060890, BRACE20064880, BRACE20068590, BRACE20248260, BRACE20253160, BRAMY20000520, BRAMY20213100, BRAMY20260910, BRAMY20270730, BRAWH20028110, BRAWH20075700, BRAWH20096780, BRAWH20113430, BRCAN10001490, BRCAN20280210, BRCAN20283190, BRCOC20144000, BRCOC20178270, BRCOC20178560, BRHIP20005340, BRHIP20106100, BRHIP20119330, BRHIP20153600, BRHIP20176420, BRHIP20191860, BRHIP20195890, BRHIP20222280, BRSSN20039370, BRSSN20046790, BRSSN20176820, CTONG20050280, CTONG20075860, CTONG20085950, CTONG20091080, CTONG20092700, CTONG20121010, CTONG20124220, CTONG20125540, CTONG20133390, CTONG20133520, CTONG20140580, CTONG20156780, D9OST20033970, FCBBF10001710, FCBBF10004370, FCBBF20059090, FCBBF20064520, FCBBF20068820, FCBBF30007680, FCBBF30010810, FCBBF30018550, FCBBF30025560, FCBBF30057290, FCBBF30083820, FCBBF30129630, FCBBF30240960, FCBBF30246230, FEBRA20010120, FEBRA20018690, FEBRA20026110, FEBRA20034680, FEBRA20040530, FEBRA20082010, FEBRA20097310, FEBRA20171380, FEBRA20195820, FEBRA20196630, FEBRA20233770, HCHON20008320, HCHON20009560, HCHON20035130, HHDPC10000830, HHDPC20031130, KIDNE20017130, KIDNE20027250, KIDNE20027950, KIDNE20107390, KIDNE20182690, LIVER20055440, MESAN20101140, NT2NE20010490, NT2NE20089970, NT2NE20142210, NT2NE20184900, NT2RP60000770, NT2RP70044280, NT2RP70102350, NT2RP70157890, NTONG20070200, OCBBF10001850, OCBBF20020830, OCBBF20037440, OCBBF20046120, OCBBF20049300, OCBBF20066390, OCBBF20071840, OCBBF20078920, OCBBF20080410, OCBBF20108190, OCBBF20125530, OCBBF20148280, PEBLM20060360, PEBLM20060490, PEBLM20078320, PERIC10000250, PROST10003220, PROST20047390, PROST20066880, PROST20185830, PROST20189770, PROST20191640, PUAEN20018820, SKNSH20008190, SKNSH20089400, SMINT20001760, SMINT20127350, SMINT20144800, SMINT20177360, SMINT20191530, SPLEN20054290, SPLEN20079260, SPLEN20095410, SPLEN20140800, SPLEN20147390, SPLEN20160450, SPLEN20252190, SPLEN20267650, STOMA20010250, STOMA20032890, STOMA20046680, STOMA20063250, TESTI20039400, TESTI20067200, TESTI20088220, TESTI20094470, TESTI20121550, TESTI20130010, TESTI20156100, TESTI20204450, TESTI20230850, TESTI20237520, TESTI20266740, TESTI20318090, TESTI20320670, TESTI20334410, TESTI20355020, TESTI20378190, TESTI20385960, TESTI20432820, TESTI20443090, TESTI20456110, THYMU20193640, THYMU20241210, THYMU20247480, TRACH20079690, TRACH20105870, TRACH20139820, TRACH20154860, TRACH20163170, TRACH20164980, TRACH20184490, TUTER20002830, UTERU20099720, UTERU20116570, UTERU20145480, UTERU20176130, UTERU20185230

The following 68 clones presumably belong to the category of ATP- and/or GTP-binding proteins.

3NB6910001910, BRACE20108130, BRACE20148240, BRAMY20134140, BRAMY20157820, BRAMY20174550, BRAWH20164460, BRCAN20003460, BRCAN20054490, BRCAN20283190, BRCOC20059510, BRCOC20144000, BRHIP20103090, BRHIP20115080, BRHIP20167880, BRSTN20005360, CD34C30004240, CTONG20095340, CTONG20121580, CTONG20200310, DFNES20037420, FCBBF20067810, FCBBF30012350, FCBBF30015940, FEBRA20007620, FEBRA20024100, FEBRA20144170, KIDNE20020150, KIDNE20028720, LIVER20002160, LIVER20087060, NT2RI20005750, NT2RI20041880, NT2RI20048840, NT2RI20273230, OCBBF20028650, OCBBF20046690, OCBBF20054760, OCBBF20108430, OCBBF20108630, SMINT20121220, SMINT20183530, SMINT20191530, SPLEN20026950, SPLEN20039240, SPLEN20099700, SPLEN20145720, SPLEN20179180, STOMA20006860, TESTI20035960, TESTI20355020, TESTI20397760, TESTI20400940, TESTI20417300, TESTI20443090, TESTI20455620, THYMU20105190, THYMU20202890, THYMU20209590, TKIDN20004640, TKIDN20047480, TRACH20005400, TRACH20019960, TRACH20057690, TRACH20084720, UTERU20168220, UTERU20176320, UTERU20185230

Among the clones other than the ones shown above, BRAMY20248490, FCBBF10002800, NTONG20092290, OCBBF20127040, SMINT20163960, THYMU20279750, TRACH20167220, are clones which were predicted to highly possibly belong to the category of secretory protein and/or membrane protein based on the result of domain search by Pfam.

FCBBF10002800, NTONG20092290, OCBBF20127040, SMINT20163960, TESTI20478850, THYMU20279750

The 6 clones shown above are clones which were predicted to highly possibly belong to the category of glycoprotein-related protein based on the result of domain search by Pfam. BRACE20060720, BRACE20223330, BRALZ20058880, BRAMY20148130, BRAWH20101360, BRCAN20124080, BRHIP20253660, CTONG10000620, CTONG20014280, CTONG20124010, KIDNE20109890, MESAN20171520, OCBBF20109310, OCBBF20140640, PROST20079500, PUAEN20078980, SPLEN20077500, SPLEN20143180, TESTI20017950, TESTI20184620, TESTI20208710, TESTI20211160, TESTI20226230, TESTI20234140, TESTI20258460, TESTI20275030

The 26 clones shown above are clones which were predicted to highly possibly belong to the category of signal transduction-related protein based on the result of domain search by Pfam.

ADRGL20048330, ASTRO20064750, ASTRO20084250, BRACE20151320, BRALZ20058880, BRHIP20207990, CTONG20093950, FCBBF30195640, FEBRA10001900, FEBRA20090290, FEBRA20214970, FEBRA20222040, KIDNE20109890, LIVER20087510, MESAN20029400, MESAN20031900, MESAN20035290, MESAN20136110, NT2NE20130190, PEBLM20060310, PERIC20004780, PROST20171280, PUAEN20078980, SMINT20115880, SPLEN20095550, TESTI20023510, TESTI20083940, TESTI20152460, TESTI20185650, TESTI20189410, TESTI20200710, TESTI20308600, TESTI20343070, TESTI20369690, TESTI20381040, UTERU20050690

The 36 clones shown above are clones which were predicted to highly possibly belong to the category of transcription-related protein based on the result of domain search by Pfam. BGGI120006160, BRACE20053480, BRACE20190040, BRACE20223330, BRAWH20101360, BRAWH20185060, BRCOC20023230, BRHIP20252450, BRSSN20105870, BRSSN20117990, BRTHA20000570, CTONG20098440, CTONG20129960, CTONG20146300, CTONG20155180, FEBRA20025270, HEART20083640, KIDNE20009470, LIVER20035680, MESAN20029400, MESAN20031900, MESAN20186700, NOVAR10000150, NTONG20029480, OCBBF20079310, OCBBF20082830, PEBLM20042900, PLACE60136500, PLACE60136720, PROST20114390, SKNSH20020540, SMINT20013480, SMINT20174360, SPLEN20077500, SPLEN20119810, SPLEN20126190, SPLEN20174260, SPLEN20211220, TESTI20046750, TESTI20057750, TESTI20061110, TESTI20197940, TESTI20211160, TESTI20226230, TESTI20255820, TESTI20317600, TESTI20377230, THYMU20111180, THYMU20115850, THYMU20143270, THYMU20240710, UTERU20055330, UTERU20055930, UTERU20064000, UTERU20119060

The 55 clones shown above are clones which were predicted to highly possibly belong to the category of enzyme and/or metabolism-related protein based on the result of domain search by Pfam.

TESTI20127760, TESTI20392270

The 2 clone shown above is a clone which was predicted to highly possibly belong to the category of cell division and/or cell proliferation-related protein based on the result of domain search by Pfam.

FCBBF30262510, MESAN20031900, NT2NE20125050, SMINT20068010, SPLEN20163560, STOMA20092890, TESTI20382750

The 7 clones shown above are clones which were predicted to highly possibly belong to the category of cytoskeleton-related protein based on the result of domain search by Pfam.


The clone shown above is clone which was predicted to highly possibly belong to the category of Nuclear protein and/or RNA synthesis-related protein based on the result of domain search by Pfam.

BRACE20053480, BRACE20240740, KIDNE20009470, OCBBF20140890, SMINT20035690, UTERU20064000

The 6 clones shown above are clones which were predicted to highly possibly belong to the category of Protein synthesis-and/or transport-related protein based on the result of domain search by Pfam.

ADRGL20048330, ASTRO20064750, ASTRO20084250, BRACE20151320, BRACE20190040, BRACE20223330, BRALZ20058880, BRAMY20103570, BRCOC20023230, BRHIP20207990, BRTHA20000570, CTONG20093950, CTONG20129960, CTONG20146300, CTONG20155180, CTONG20160560, FCBBF10004120, FCBBF30195640, FEBRA10001900, FEBRA20090290, FEBRA20214970, FEBRA20222040, HCHON20008150, HEART20083640, KIDNE20109890, LIVER20035680, LIVER20087510, MESAN20029400, MESAN20031900, MESAN20035290, MESAN20136110, MESAN20186700, NT2NE20130190, NT2RI20025640, NTONG20029480, PEBLM20060310, PERIC20004780, PROST20114390, PROST20171280, PUAEN20078980, SMINT20115880, SPLEN20095550, SPLEN20119810, TESTI20023510, TESTI20057750, TESTI20083940, TESTI20152460, TESTI20185650, TESTI20189410, TESTI20200710, TESTI20308600, TESTI20343070, TESTI20369690, TESTI20381040, THYMU20115850, UTERU20050690, UTERU20055330

The 57 clones shown above are clones which were predicted to highly possibly belong to the category of DNA- and/or RNA-binding protein based on the result of domain search by Pfam.


The clone shown above is a clone which was predicted to highly possibly belong to the category of ATP- and/or GTP-binding proteins based on the result of domain search by Pfam.

The 213 clones shown below are clones which were unassignable to any of the above-mentioned categories, but have been predicted to have some functions based on homology search using their full-length nucleotide sequences and motif search in their estimated ORFs. Clone Name, Definition in the result of homology search or Motif Name in the motif search, demarcated by a double slash mark (//), are shown below.

ADRGL20028570//Rattus norvegicus MG87 mRNA, complete cds.

ADRGL20061930//transposon-derived Buster1 transposase-like protein

ASTRO20012490//Eukaryotic initiation factor 1A


ASTRO20114370//Mus musculus SMAR1 mRNA, complete cds.

ASTRO20125520//dnaj protein [Schizosaccharomyces pombe]

ASTRO20143630//KH domain// Bacterial regulatory proteins, crp family

ASTRO20155290//TPR Domain// TPR Domain// TPR Domain

ASTRO20181690//oocyte-specific protein P100

BGGI110001930//UBX domain

BRACE20011070//Mus musculus F-box protein FBX15 mRNA, partial cds.

BRACE20039440//Drosophila melanogaster CHARYBDE (charybde) mRNA, complete cds.

BRACE20050900//TPR Domain// TPR Domain// TPR Domain// TPR Domain

BRACE20053280//Mus musculus Pdz-containing protein (Pdzx) mRNA, complete cds.

BRACE20057730//toxin sensitivity protein KTI12 homolog

BRACE20058580//Homo sapiens HCMOGT-1 mRNA for sperm antigen, complete cds.

BRACE20063780//NOL1/NOP2/sun family

BRACE20269200//Heat-labile enterotoxin alpha chain

BRACE20276430//Homo sapiens retinoblastoma-associated protein RAP140 mRNA, complete cds.

BRACE20286360//Alpha adaptin carboxyl-terminal domain

BRAMY10001300//Homo sapiens MAGE-E1b mRNA, complete cds.

BRAMY20045240//Flagellar L-ring protein

BRAMY20054880//Rattus norvegicus KPL2 (Kp12) mRNA, complete cds.

BRAMY20167060//Collagen triple helix repeat (20 copies)

BRAMY20184670//Homo sapiens mRNA for ALEX1, complete cds.

BRAMY20217460//Homo sapiens cardiac voltage gated potassium channel modulatory subunit mRNA, complete cds, alternatively spliced.

BRAMY20240040//Homo sapiens suppressor of white apricot homolog 2 (SWAP2) mRNA, complete cds.

BRAMY20247110//Mus musculus semaphorin cytoplasmic domain-associated protein 3A (Semcap3) mRNA, complete cds.

BRAWH20004600//Mus musculus mRNA for NAKAP95, complete cds.

BRAWH20011710//cytoplasmic linker 2

BRAWH20012390//Trichomonas vaginalis mRNA for centrin (ce1 gene).

BRAWH20017010//Homo sapiens testes development-related NYD-SP22 mRNA, complete cds.

BRAWH20029630//Homo sapiens bet3 (BET3) mRNA, complete cds.

BRAWH20138660//Homo sapiens stonin 2 mRNA, complete cds.

BRCOC20008500//Human ras inhibitor mRNA, 3′ end.

BRCOC20026640//Gag P30 core shell protein



BRCOC20110100//Integrase core domain

BRCOC20176520//Rattus norvegicus mRNA for type II brain 4.1, complete cds.

BRHIP20001630//Protein of unknown function DUF16

BRHIP20132860//Homo sapiens rhophilin-like protein mRNA, complete cds.

BRHIP20143730//MYND finger

BRHIP20175420//Mus musculus partial mRNA for stretch responsive protein 278 (sr278 gene).

BRHIP20236950//Outer Capsid protein VP4 (Hemagglutinin)


BRSSN20018690//Homo sapiens NY-REN-25 antigen mRNA, partial cds.



BRSTN10000830//Kelch motif// Kelch motif// Kelch motif// Kelch motif

CTONG10000220//Mus musculus cerebellar postnatal development protein-1 (Cpd1) mRNA, partial cds.

CTONG10000930//Armadillo/beta-catenin-like repeats

CTONG20027090//Glypican// Leucine Rich Repeat// Leucine Rich Repeat



CTONG20100240//Mus musculus radial spokehead-L protein (Rshl1) mRNA, complete cds.

CTONG20139860//Homo sapiens nasopharyngeal carcinoma susceptibility protein LZ16 mRNA, complete cds.

CTONG20143690//MYND finger


CTONG20165050//Keratin, high sulfur B2 protein



D3OST20024360//Homo sapiens neuroendocrine differentiation factor mRNA, complete cds.

D9OST20031370//Homo sapiens mRNA for partial putative TCPTP-interacting protein (ptpip5 gene).


FCBBF10000630//Homo sapiens huntingtin interacting protein HYPB mRNA, partial cds.

FCBBF10000770//Homo sapiens REC8 mRNA, partial cds.


FCBBF10005500//Keratin, high sulfur B2 protein


FCBBF20042170//Homo sapiens NIBAN mRNA, complete cds.

FCBBF30016320//SecA protein, amino terminal region

FCBBF30033050//Sm protein

FCBBF30054440//PLAT/LH2 domain

FCBBF30225660//Ank repeat// Ank repeat// Ank repeat// K+ channel tetramerisation domain// BTB/POZ domain

FCBBF30233680//G10 protein

FCBBF30246630//H. sapiens mRNA for ZYG homologue.


FCBBF30252520//Homo sapiens bicaudal-D (BICD) mRNA, alternatively spliced, partial cds.


FCBBF30252850//Mus musculus peripherial benzodiazepine receptor associated protein (Pap7) mRNA, complete cds.

FCBBF30285280//Keratin, high sulfur B2 protein// Bacterial regulatory proteins, gntR family


FEBRA20184330//Rattus norvegicus glutamate receptor interacting protein 2 (GRIP2) mRNA, complete cds.

FEBRA20192420//Cyclin-dependent kinase inhibitor// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif FEBRA20196370//Cyclin-dependent kinase inhibitor// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif

FEBRA20225040//high-glucose-regulated protein 8


HCHON20003440//Homo sapiens cyclin-D binding Myb-like protein mRNA, complete cds.

HCHON20010990//TPR Domain

HCHON20059870//Hypothetical protein.

HHDPC20034390//Cereal trypsin/alpha-amylase inhibito

HHDPC20057420//Mus musculus proline-rich protein (Bprp) mRNA, complete cds.


HLUNG20023340//Mus musculus SLM-1 (Slm1) mRNA, complete cds.

KIDNE20007210//Xenopus laevis mRNA for RPA interacting protein alpha (ripalpha gene).

KIDNE20028830//K-box region

KIDNE20115080//Homo sapiens mRNA for hNBL4, complete cds.

KIDNE20124400//Homo sapiens mRNA for ALEX1, complete cds.

KIDNE20127100//Drosophila melanogaster Diablo (dbo) mRNA, complete cds.

KIDNE20127750//Homo sapiens partial mRNA for transport-secretion protein 2.1 (TTS-2.1 gene).

KIDNE20190740//Rattus norvegicus SNIP-b mRNA, complete cds.

LIVER10004790//EF hand

LIVER20011130//Homo sapiens F-box protein FBL9 mRNA, partial cds.

LIVER20064100//Ciona intestinalis mRNA for myoplasmin-C1, complete cds.

LIVER20080530//Drosophila melanogaster forked mRNA for large Forked protein, complete cds.

MAMGL10000830//Drosophila melanogaster L82B (L82) mRNA, complete cds.

MESAN20036460//Corticotropin-releasing factor family

MESAN20127350//myelin expression factor-3

MESAN20141920//Human ovarian cancer downregulated myosin heavy chain homolog (Doc1) mRNA, complete cds.

NT2NE20010400//Homo sapiens GL013 mRNA, complete cds.


NT2NE20158600//erythroid ankyrin-Synechocystis sp. (strain PCC 6803).

NT2RI20001330//Homo sapiens KE03 protein mRNA, partial cds.

NT2RI20009870//lunatic fringe precursor [Mus musculus]

NT2RI20046080//recA bacterial DNA recombination proteins

NT2RI20091730//Molluscan rhodopsin C-terminal tail

NT2RP60000850//Bos taurus RPGR-interacting protein-1 (RPGRIP1) mRNA, complete cds.

NT2RP70080850//SPRY domain// Adenovirus EB1 55K protein/large t-an

NT2RP70105210//Myc amino-terminal region

NT2RP70188710//Yeast PIR proteins

NT2RP70194450//Bacterial regulatory proteins, crp family NTONG20052650//Gallus gallus Xin mRNA, complete cds.


NTONG20064840//Mus musculus slp1 mRNA for synaptotagmin-like protein 1, complete cds.

NTONG20066460//Mus musculus Gd mRNA for gasdermin, complete cds.

NTONG20067090//Mus musculus mRNA for Sh3yl1, complete cds.

NTONG20070340//collagen alpha 1 (IX) chain

NTONG20083650//TPR Domain// TPR Domain// TPR Domain// PPR repeat// TPR Domain// PPR repeat// TPR Domain

NTONG20088620//Homo sapiens genethonin 3 mRNA, partial cds.

OCBBF10000540//Mus musculus rjs (rjs) mRNA, complete cds.

OCBBF20019380//seizure related gene 6

OCBBF20022900//Homo sapiens SCHIP-1 mRNA, complete cds.

OCBBF20030280//Rattus norvegicus hfb2 mRNA, complete cds.

OCBBF20046470//ARFAPTIN 1.

OCBBF20049840//Homo sapiens mRNA for neurabin II protein.

OCBBF20068490//Mus musculus RW1 protein mRNA, complete cds.

OCBBF20071960//Coturnix coturnix japonica qMEF2D gene.

OCBBF20073540//Homo sapiens p30 DBC mRNA, complete cds.


OCBBF20127550//Outer Capsid protein VP4 (Hemagglutinin)


OCBBF20178150//Plasmodium falciparum ADA2-like protein gene, partial cds.

PEBLM10000240//Domain found in Dishevelled, Eg1-10, and Ple

PROST20047270//CRAL/TRI0 domain.

PROST20112970//Sterile alpha motif (SAM)/Pointed domain// SAM domain (Sterile alpha motif)

PUAEN10000850//Uncharacterized protein family UPF0025// Sec1 family

PUAEN20011880//Mus musculus mRNA for MIWI (piwi), complete cds.

PUAEN20051100//Mus musculus otogelin mRNA, complete cds.

PUAEN20108240//Drosophila melanogaster ankyrin 2 (Ank2) mRNA, complete cds.

SKMUS20084740//Syndecan domain

SMINT20053300//Homo sapiens hepatocellular carcinoma-associated antigen 59 mRNA, complete cds.

SMINT20071400//NOL1/NOP2/sun family

SMINT20101440//Human cisplatin resistance associated alpha protein (hCRA alpha) mRNA, complete cds.

SMINT20110330//pKID domain

SMINT20122910//Mus musculus StAR-related protein 1-4E mRNA, partial cds.

SMINT20131810//ENV polyprotein (coat polyprotein)

SMINT20168570//Homo sapiens mRNA for stabilin-1 (stab1 gene).

SPLEN20008390//Human placenta (Diff48) mRNA, complete cds.


SPLEN20128000//Xenopus laevis XMAB21 (Xmab-21) mRNA, complete cds.

SPLEN20149110//Dishevelled specific domain

SPLEN20171470//Keratin, high sulfur B2 protein

SPLEN20194050//Homo sapiens HOTTL protein mRNA, complete cds.

SPLEN20214580//Mus musculus mdg1-1 mRNA, complete cds.

STOMA20057820//Uncharacterized protein family UPF0024

STOMA20063980//Collagen triple helix repeat (20 copies)

STOMA20069040//Keratin, high sulfur B2 protein

SYNOV20017080//UBX domain

TBAES20000590//Cytochrome P450// Cytochrome P450

TESTI20001170//HORMA domain

TESTI20031810//Bacterial luciferase// Domain of unknown function DUF28

TESTI20044230//Mus musculus testis-specific Y-encoded-like protein (Tspy11) mRNA, complete cds.

TESTI20098350//VAT-Nn domain

TESTI20157520//K+ channel tetramerisation domain// K+ channel tetramerisation domain

TESTI20170350//Cystine-knot domain

TESTI20192800//Homo sapiens nasopharyngeal carcinoma susceptibility protein LZ16 mRNA, complete cds.


TESTI20202650//Repeat in HS1/Cortactin

TESTI20229600//Drosophila melanogaster SP2353 mRNA, complete cds.

TESTI20231920//Gag P30 core shell protein

TESTI20242830//E2 (early) protein, C terminal// Syndecan domain

TESTI20254540//Homo sapiens hepatocellular carcinoma-associated antigen 59 mRNA, complete cds.


TESTI20327680//EF hand// EF hand

TESTI20328280//KE2 family protein// Troponin

TESTI20351830//K-box region

TESTI20370020//Bleomycin resistance protein

TESTI20391210//IQ calmodulin-binding motif

TESTI20408150//Keratin, high sulfur B2 protein

TESTI20451990//SAP domain

TESTI20467970//Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain

THYMU20108310//Mouse NCBP-29 mRNA for PW29, complete cds.


THYMU20194360//Kelch motif

THYMU20239000//collagen alpha 1(XI) chain

TOVAR20004760//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat

TRACH20005020//Ank repeat// MutT-like domain



TRACH20068700//Homo sapiens adaptor protein CIKS mRNA, complete cds.

TRACH20076760//Keratin, high sulfur B2 protein

TRACH20135520//TBC domain// Rhodanese-like domain

TRACH20141240//Mus musculus G21 protein mRNA, complete cds.

TRACH20183170//Rattus norvegicus Sprague-Dawley SM-20 mRNA, complete cds.

UTERU20000740//Human fusion protein mRNA, complete cds.

UTERU20004240//CGI-96 protein

UTERU20006960//endoplasmic reticulum resident protein 58

UTERU20022940//Human (p23) mRNA, complete cds.

UTERU20046640//Mus musculus ldlBp (LDLB) mRNA, complete cds.


UTERU20115740//Human PMS2 related (hPMSR3) gene, complete cds.

UTERU20179880//TPR Domain// TPR Domain// TPR Domain// TPR Domain

Further, the reason is that a polypeptide does not always belong solely to a single category of the above-described functional categories, and therefore, a polypeptide may belong to any of the predicted functional categories. Besides, additional functions can be found for the clones classified into these functional categories by further analyses.

Since the polypeptide encoded by clones of the invention contains full-length amino acid sequence, it is possible to analyze its biological activity, and its effect on cellular conditions such as cell proliferation and differentiation by expressing the polypeptide as a recombinant polypeptide using an appropriate expression system, injecting the recombinant into the cell, or raising a specific antibody against the polypeptide.

The biological activities of respective polypeptides can be analyzed by the methods as shown below.

Secretory Protein, Transmembrane Protein:

  • “Ion Channels” (Ed., R. H. Ashley, 1995) of “The Practical Approach Series” (IRL PRESS),
  • “Growth Factors” (Eds., I. McKay, I. Leigh, 1993),
  • “Extracellular Matrix” (Eds., M. A. Haralson, J. R. Hassell, 1995);
    Glycoprotein-Related Protein:
  • “Glycobiology” (Eds., M. Fukuda, A. Kobata, 1993) of “The Practical Approach Series” (IRL PRESS),
  • “Glycoprotein Analysis in Biomedicine” (Ed., Elizabeth F. Hounsell, 1993) of “Method in Molecular Biology” (Humana Press) series;
    Signal Transduction-Related Protein:
  • “Signal Transduction” (Ed., G. Milligan, 1992) of “The Practical Approach Series” (IRL PRESS),
  • “Protein Phosphorylation” (Ed., D. G. Hardie, 1993), or
  • “Signal Transduction Protocols” (Eds., David A. Kendall, Stephen J. Hill, 1995) of “Method in Molecular Biology” (Humana Press) series;
    Transcription-Related Protein:
  • “Gene Transcription” (Eds., B. D. Hames, S. J. Higgins, 1993) of “The Practical Approach Series” (IRL PRESS),
  • “Transcription Factors” (Ed., D. S. Latchman, 1993); Enzyme and/or metabolism-related protein:
  • “Enzyme Assays” (Eds., ROBERT EISENTHAL and MICHAEL J. DANSON, 1992) of “The Practical Approach Series” (IRL PRESS);
    Cell Division and/or Cell Proliferation-Related Protein:
  • “Cell Growth, Differentiation and Senescence” (Ed., GEORGE STUDZINSKI, 2000) of “The Practical Approach Series” (IRL PRESS);
    Cytoskeleton-Related Protein:
  • “Cytoskeleton: Signalling and Cell Regulation” (Eds., KERMIT L. CARRAWAY and CAROLIE A. CAROTHERS CARRAWAY, 2000) of “The Practical Approach Series” (IRL PRESS),
  • “Cytoskeleton Methods and Protocols” (Ed., Gavin, Ray H., 2000) of “Method in Molecular Biology” (Humana Press) series;
    Nuclear Protein and/or RNA Synthesis-Related Protein:
  • “Nuclear Receptors” (Ed., DIDIER PICARD, 1999) of “The Practical Approach Series” (IRL PRESS),
  • “RNA Processing” (Eds., STEPHEN J. HIGGINS and B. DAVID HAMES, 1994);
    Protein Synthesis and/or Transport-Related Protein:
  • “Membrane Transport” (Ed., STEPHEN A. BALDWIN, 2000) of “The Practical Approach Series” (IRL PRESS),
  • “Protein Synthesis Methods and Protocols” (Eds., Martin, Robin, 1998) of “Method in Molecular Biology” (Humana Press) series;
    Cellular Defense-Related Protein:
  • “DNA Repair Protocols” (Henderson, Daryl S., 1999) of “Method in Molecular Biology” (Humana Press) series,
  • “Chaperonin Protocols” (Eds., Schneider, Christine, 2000); Development and/or differentiation-related protein:
  • “Developmental Biology Protocols” (Eds., ROBERT EISENTHAL and MICHAEL J. DANSON, 1992) of “Method in Molecular Biology” (Humana Press) series;
    DNA- and/or RNA-Binding Protein:
  • “DNA-Protein Interactions Principles and Protocols” (Eds., Kneale, G. Geoff, 1994) of “Method in Molecular Biology” (Humana Press) series,
  • “RNA-Protein Interaction Protocols” (Eds., Haynes, Susan R., 1999);
    ATP- and/or GTP-Binding Protein:
  • “Signal Transduction Protocols” (Eds., David A. Kendall, Stephen J. Hill, 1995) of “Method in Molecular Biology” (Humana Press) series.

In the categorization, the clone predicted to belong to the category of secretory and/or membrane protein means a clone having hit data with some annotation, such as growth factor, cytokine, hormone, signal, transmembrane, membrane, extracellular matrix, receptor, G-protein coupled receptor, ionic channel, voltage-gated channel, calcium channel, cell adhesion, collagen, connective tissue, etc., suggesting that it was a secretory or membrane protein, or a clone in which the presence of nucleotide sequence encoding a signal sequence or transmembrane region was suggested by the results of PSORT and SOSUI analyses for deduced ORF.

The clone predicted to belong to the category of glycoprotein-related protein means a clone having hit data with some annotation, such as glycoprotein, suggesting that the clone encodes a glycoprotein-related protein.

The clone predicted to belong to the category of signal transduction-related protein means a clone having hit data with some annotation, such as serine/threonine-protein kinase, tyrosine-protein kinase, SH3 domain, SH2 domain, etc., suggesting that the clone encodes a signal transduction-related protein.

The clone predicted to belong to the category of transcription-related protein means a clone having hit data with some annotation, such as transcription regulation, zinc finger, homeobox, etc., suggesting that the clone encodes a transcription-related protein.

The clone predicted to belong to the category of disease-related protein means a clone having hit data with some annotation, such as disease mutation, syndrome, etc., suggesting that the clone encodes a disease-related protein, or a clone whose full-length nucleotide sequence has hit data for Swiss-Prot, GenBank, UniGene, or nr, where the hit data corresponds to genes or polypeptides which have been deposited in the Online Mendelian Inheritance in Man (OMIM) (, which is the human gene and disease database described later.

The clone predicted to belong to the category of enzyme and/or metabolism-related protein means a clone having hit data with some annotation, such as metabolism, oxidoreductase, E. C. No. (Enzyme commission number), etc., suggesting that the clone encodes an enzyme and/or metabolism-related protein.

The clone predicted to belong to the category of cell division and/or cell proliferation-related protein means a clone having hit data with some annotation, such as cell division, cell cycle, mitosis, chromosomal protein, cell growth, apoptosis, etc., suggesting that the clone encodes a cell division and/or cell proliferation-related protein.

The clone predicted to belong to the category of cytoskeleton-related protein means a clone having hit data with some annotation, such as structural protein, cytoskeleton, actin-binding, microtubles, etc., suggesting that the clone encodes a cytoskeleton-related protein.

The clone predicted to belong to the category of nuclear protein and/or RNA synthesis-related protein means a clone having hit data with some annotation, such as nuclear protein, RNA splicing, RNA processing, RNA helicase, polyadenylation, etc., suggesting that the clone encodes a nuclear protein and/or RNA synthesis-related protein.

The clone predicted to belong to the category of protein synthesis and/or transport-related protein means a clone having hit data with some annotation, such as translation regulation, protein biosynthesis, amino-acid biosynthesis, ribosomal protein, protein transport, signal recognition particle, etc., suggesting that the clone encodes a protein synthesis and/or transport-related protein.

The clone predicted to belong to the category of cellular defense-related protein means a clone having hit data with some annotation, such as heat shock, DNA repair, DNA damage, etc., suggesting that the clone encodes a cellular defense-related protein.

The clone predicted to belong to the category of development and/or differentiation-related proteins means a clone having hit data with some annotation, such as developmental protein, etc., suggesting that the clone encodes a development and/or differentiation-related protein.

The clone predicted to belong to the category of DNA-and/or RNA-binding protein means a clone having hit data with some annotation, such as DNA-binding, RNA-binding, etc.

The clone predicted to belong to the category of ATP-and/or GTP-binding protein means a clone having hit data with some annotation, such as ATP-binding, GTP-binding, etc.

As to a protein involved in a disease, it is possible to perform a functional analysis as described above, but also possible to analyze correlation between the expression or the activity of the protein and a certain disease by using a specific antibody that is obtained by using expressed protein. Alternatively, it is possible to utilize the database OMIM, which is a database of human genes and diseases, to analyze the protein. Further, new information is constantly being deposited in the OMIM database. Therefore, it is possible for one skilled in the art to find a new relationship between a particular disease and a gene of the present invention in the most up-to-date database. The proteins involved in diseases are useful for developing a diagnostic marker or medicines for regulation of their expression and activity, or as a target of gene therapy.

Also, as for a secretory protein, membrane protein, signal transduction-related protein, glycoprotein-related protein, or transcription-related protein, etc., search of the OMIM with the following keywords resulted in the finding that the proteins are involved in many diseases (the result of the OMIM search for secrete and membrane proteins is shown below). Also, association between proteins related to signal transduction or transcription and diseases is reported in “Transcription Factor Research-1999” (Fujii, Tamura, Morohashi, Kageyama, and Satake edit, (1999) Jikken-Igaku Zoukan, Vol. 17, No.3), and “Gene Medicine” (1999) Vol. 3, No.2). When cancer is used as an example, as described in “Biology of Cancer” (S. Matsubara, 1992) of Life Science series (Shokabo), many proteins are involved in cancers, which include enzyme and/or metabolism-related proteins, cytoskeleton-related proteins, cell division and/or cell proliferation-related proteins as well as secretory proteins, membrane proteins, signal transduction-related proteins, glycoprotein-related proteins, transcription-related proteins. As clearly seen by the above example, it is evident that not only disease-related proteins but also secretory proteins, membrane proteins, signal transduction-related proteins, glycoprotein-related proteins, transcription-related proteins, etc. are often involved in diseases, and thus they can be useful targets in the field of medical industry.

The result of the OMIM search for secretory and membrane proteins is shown below, in which the keywords,

(1) secretion protein,

(2) membrane protein,

(3) channel, and

(4) extracellular matrix were used.

Shown in the search result are only the accession numbers in the OMIM. Using the number, data showing the relationship between a disease and a gene or protein can be seen. The OMIM data has been renewed everyday.

1) Secretion Protein

354 entries found, searching for “secretion protein”

*604667, *104760, *176860, *151675, *139320, *107400, *604029, *118910, #200100, *176880, *603850, *147572, *604028, *179513, *125950, *139250, *246700, *600946, *600560, *602926, 185860, *605083, *603215, *602421, *157147, *179512, *600174, *109270, *604710, *138120, *179510, *600998, *179509, *170280, *179511, *600626, *603831, *601489, *154545, *179490,

*603826, *122559, *603216, *102720, *147290, *164160, *603062, *112262, *602672, *605435, *605322, *131230, *601652, *603166, *601746, *601591, *179508, #160900, *104311, *600759, *147545, *167805, #104300, *167770, #219700, *168470, *601684, *602049, *601146, *605227, *602434, *602534, *114840, *603489, *604323, *107470, *600753, *600768, *118825, *600564,

*604252, *173120, *134370, *192340, *308230, *600322, *605359, *600046, *300090, 106160, *600041, #262500, *605563, *150390, *158106, *182590, #103580, *104610, #173900, *134797, *143890, #145980, *306900, *308700, *176300, *227500, *137350, #154700, *138079, *600760, *107730, *142410, *147670, *124092, *590050, *152760, *600509, *605646, *201910, *227600,

*152790, *300200, *300300, 300800, *138160, *107741, *120150, *601199, *120180, *120160, *176730, *133170, *122560, *107300, *137241, *120140, *101000, *193400, *217000, *272800, *600937, #201710, *600377, #174800, *106100, #274600, *173350, #177170, *147620, *214500, *131244, *202110, *120120, *601007, *191160, *147470, *603372, *600733, *252800, *190160,

*138040, *158070, *162151, #125700, #130070, *113811, *603355, *171060, *136435, #184700, *603732, *190180, *164008, *186590, *120220, *604312, *152200, *138130, *605085, *605353, *600840, #166210, *188545, *207750, *173360, *601933, #194050, *153450, *138850, *253200, *307030, *157145, *600514, *600262, *264080, *147380, *600281, #204000, #227810, *232200,

*188826, *232800, *161561, #166200, *188400, *153620, *182099, *218040, #265800, *172400, #177200, *176805, #211600, #214700, #176410, *152780, *600633, *601771, *301500, *605402, *601922, *307800, *147892, *147720, *312060, #520000, *147660, *106150, *602358, *107270, *601769, *147440, *604558, *131530, *600270, *601610, *603692, *603401, *600423, *601604,

*603345, #125853, *602843, *142640, *603044, *605740, *134830, *602779, *130660, *139191, *137035, *600761, *601340, *600823, *107740, *130160, *600877, *605110, *600945, *130080, *600957, #130050, *605580, *118444, *601124, *124020, 122470, *120700, *603201, *137216, *601185, *138945, *218030, *600839, #240600, #262400, #162300, *162330, *188450, #265850,

*263200, *162641, *300159, *601038, #191390, *201810, *601398, *602384, *131240, *602423, *139392, *142703, *602663, *232700, *602682, #602722, *602730, *600734, *188540, *182452, *601538, *603061, *146880, *603140, *603160, *142704, #252650, *182280, *125255, *603252, #131750, *182139, *182100, #259420, #261100, *603493, *601745, *182098, *603795, *123812,

*600264, *147940, *180246, *180245, *118888, #604284, *168450, *118455, *604398, *604433, *601919, *118445, *600031, *604961, *605032, *605033, *171050, #171300, *131243, *109160, *605254, 274900, #171400, *600042, *151670, *184600, *605470, *605546, *176760, *602008, *102200, *605720, *600732, *605901

2) Membrane Protein

1489 entries found, searching for “membrane protein”

*130500, *605704, *305360, *153330, *173610, *109270, *170995, *170993, *104776, *602333, *309060, *605703, *120920, *605943, *602690, *159430, *600897, *133090, *601178, *602413, *602003, *604405, *605940, *603237, *109280, *600378, *602173, *107776, *602334, *602335, *125305, *601134, *309845, *605731, *154045, *603241, *603718, *600594, *603214, *185881,

*603657, *600182, *603177, *605331, *601476, *605456, *601114, *605190, *600723, *603904, *136950, *300222, *602879, *185880, *605348, *300096, *602257, *177070, *310200, *603062, *603344, *600039, *602977, *300100, *128240, *600959, *600322, *227400, *186945, *600946, *602534, *602048, *182900, *601097, *600267, *602625, *136430, *602421, *601047, *107450,

*143450, *603141, *184756, *164730, *159440, *154050, *600579, *312080, *604202, *603700, *600447, *256540, *604691, *158343, *600403, *602414, *137290, *176640, *176981, *600179, *600754, *604456, *604693, *605875, *604605, *188860, *300172, *602910, *604323, *219800, *601848, *60.3179, *600279, *602251, #222700, *603831, *605072, *605377, *601028, *604155,

*108733, *104225, *601896, *601510, *173335, *107770, *601767, *600046, *603850, *600040, *603784, *603234, 188560, *605863, *121015, *605862, *605861, *186946, *604252, *603215, *142461, *604597, *603143, *605264, *603735, *176860, *605536, *176801, *180721, *603355, *104760, *131560, *310300, *602631, *304700, #309400, *603142, *143890, *605431, *600753,

*115501, *176790, *600266, *601691, *168468, *601239, *602216, #104300, *605613, *601595, *605550, *125950, *605475, *602217, *602261, *603534, *602262, *604631, *190315, *601313, *604306, *104311, *604672, *605000, *602461, *605548, *602296, *604376, *121014, *121011, *600691, *604262, *139310, *304040, *605445, *179514, *179512, *151460, #160900, *120130,

*128239, *601158, *601403, *176943, *601014, 300800, *300294, *601757, *185470, *273800, *605034, *602887, #185000, *604871, *603593, *603583, *605454, *104775, *605872, *141180, *602713, *603531, *139150, *601531, *601832, *605452, *134651, *604156, *120620, *605883, *604142, *166945, *605324, *600816, *604699, *300112, *605182, *600164, *182180, *605071,

*300023, *605057, *308240, *300249, *176947, *176894, *605081, *605035, *602044, *182860, *107271, *305100, *153390, *113730, *602689, *180069, *603518, *300017, *191275, *177061, *601693, *601789, *604241, *600934, *138160, *604424, *603868, *600174, *600718, *600523, *604141, *601009, *605251, *600481, *600874, *155550, *605227, *601017, *162230, 601138,

*604157, *601212, *600763, *604110, *604158, *601107, *601326, 600621, *600587, 601137, *600917, *600855, *605058, *194355, *605194, *603291, *102720, *136425, *170715, *603216, *605547, *135630, *602926, *600168, *605002, *602474, *600157, *603025, *603893, *231200, *120090, *601966, *131230, *604722, *604721, *604515, *246700, *602101, *605628, *303630,

*605787, *602857, *602285, *605708, *602488, *605025, *603817, *300051, *603293, *176878, *603646, 605707, 185860, *112205, *300187, *602654, *120070, *603648, *604850, *602655, *602514, *300118, *182309, *179590, *602701, *600759, *204200, *604170, *175100, #103580, *147670, *306400, *143100, *182870, *257220, *180380, #116920, *301000, *193300, *157147,

*131550, *139200, *139130, *190195, *605406, *155760, *155960, *605734, *155970, *605385, *111700, *155975, *150370, 605709, *151430, *605438, *151510, *116952, *157655, *158105, *605777, *176877, *153619, *120131, *185430, *109190, *120190, *109170, *605093, *605250, *153432, *107777, *186590, *160993, *605699, *605698, *605813, *605697, *605616, *605300,

*162060, *605219, *163970, *135620, *165040, *605478, *604964, *103195, *604932, *604923, *605906, *605496, *605914, *166490, 138277, *604915, *114070, *605213, *605933, *180297, *101000, *191163, *191164, *605101, *603167, *600772, *603164, *600708, *604001, *191328, *313440, *602672, *604009, *604299, *192974, *604256, *603048, *600515, *604221, *602632,

*604196, *601179, 603290, *604661, *601023, *601110, *304800, *203200, *300212, *602933, *603352, *208900, *604418, *604838, *600551, #212140, *604837, *602049, *600552, *600553, *300213, *602574, *600583, *600932, *603452, *604775, *516020, *604617, *604464, *603498, *300145, *601523, *602694, *600632, *604762, *604492, *400015, *604504, *601717, *601728,

*300242, *602426, *604194, *603821, *604730, *600695, *603823, *603869, *300241, *600707, *603822, *602370, *602202, *604193, *601181, *604089, *602507, *604195, *602306, *300284, *601805, *601895, *601275, *604660, *600752, *603820, *604192, *602207, *308230, *600894, *312600, *603199, *604029, *602500, *102680, *235200, #256300, *601633, #219700, 262890,

*156225, *173470, *193400, *173910, *600354, *113705, *600065, *107741, *107400, *600024, *131195, *113811, #118220, *601638, *300011, *276903, *604144, *311770, *601758, #173900, *604592, *120120, *179605, *603130, *603372, *110750, *222900, *602509, *256100, *602469, *602281, *229300, *224100, *110900, *190180, *261600, *602997, *603616, *603189, 601791,

*601567, *312700, *171060, *308700, *604027, *162643, *516000, *176261, *604028, *314850, #145980, *601383, *600930, *305900, *601253, *136350, *605537, *138140, *604033, *605070, *139250, *300500, *603967, *300041, *603866, #130600, *120150, *601050, *604942, *605204, *605248, *272750, *600163, *604235, *600682, *107266, *306900, *191092, #262500, *600106,

*152790, *186720, *227650, *153700, *308380, *103390, *605646, *164920, *604478, #252650, *173850, *173350, *602505, *246530, *194380, *602575, *603030, #209920, *212138, #214100, *605767, *600582, *189980, #176200, *604653, *604678, *256550, *300037, *253700, #253300, #226700, *604766, #244400, *190000, *188040, *604824, *214500, #237500, *232300, *605014,

*604477, *190930, *605124, *604475, *604594, #227810, *306700, #301050, *600135, *600143, *605145, #269920, *300104, *277900, *300135, *300231, *192500, *182138, *191190, *176805, *600185, *186591, *604889, *603051, *165360, *147545, *601040, #156575, *107269, *603009, *602934, *123825, *601081, *602924, *163890, *600381, *602909, *150330, *109690, *123900,

*603434, *603491, *110700, *602581, *125647, #154700, *114760, *141900, *603690, *120220, *601199, #145500, *601309, *602382, *120325, *600877, *604205, *604090, *601497, *602377, *605464, *138720, *603728, *120950, *604026, *600580, *601610, *137167, *603960, *603931, *601880, *603126, *138190, *130130, *601997, *601975, *600395, *516040, *600418, *600650,

*605245, *605172, *600509, *164761, *310400, *600308, *605109, *600544, *600359, *600103, *605267, *312610, *176100, *308100, *158070, *605123, *173325, #312750, *600839, *158120, #604369, *604465, *173510, #161200, *151525, *605369, *604237, *516050, #600886, *604517, *165180, *605381, *605399, *307800, *604365, *155740, *147795, 601709, *604673, *147730,

*602122, *147557, *193245, *600978, *604990, *603261, *603274, *601007, *131100, *602941, *107941, *146710, *276901, *131244, *602872, *603411, *186357, *176290, *601066, *185050, *232200, *143030, *601843, #236700, *604122, *142800, *134638, *604985, *182380, *603930, *142410, *137060, *604586, *601193, *120650, *252500, *253800, *120930, *604858, *605874,

601274, *602158, *605873, *193210, *203100, *601295, *604095, #201710, *126150, *108740, #205400, *601373, *300167, *109545, *602894, *603361, #300257, *266200, *603401, *131390, *180470, *605908, *604798, #221770, *223360, *180901, *605641, *605745, *604018, *300200, *604603, *230800, *602676, #604004, *605692, *602640, *601599, *134637, *245900, *118425,

601614, *605725, *120110, *300189, *300035, *603102, *250800, *602282, *602458, *123610, *603754, *300278, *601463, *300224, *601581, *182160, *601653, *139191, *601733, *600748, *142460, *601194, *152390, *153620, *601615, *601814, *601617, *601613, *300191, #308300, *600798, 601858, *601872, *601597, #601588, *600821, *147840, *152427, *138850, *600823,

*601492, *300256, *600840, *300267, *601411, *139080, *139090, 600851, *300334, *179080, *602095, *601284, *601282, #177200, *601681, *601252, *176000, *602184, *602188, #266510, #154020, *186711, *257200, *601711, *600667, *602241, *186745, *255125, *300126, *600644, *123890, #255120, #175200, *600004, *302060, *123580, *186760, *122561, *602316, *600017,

*120940, 140300, *151690, *120700, *602354, *600019, *600857, *182175, *600536, *158380, *600516, *120290, *600493, *182310, #252010, *182530, *186830, *601839, *142790, *159465, *118990, *250790, *248600, #248250, *186845, *601153, *142600, *116930, *114860, *171834, #303600, *186880, *600444, *142871, *601852, *602602, *602607, *114207, *186910, #232220,

600880, *134635, *112203, #112100, *111680, *231680, *311030, *111250, *111200, *134390, #226670, #145600, *226200, *602714, *171760, *133550, *602727, *161555, *602744, *602746, #131705, *602835, *600423, *176267, *602859, #600918, 277175, *602874, *601020, *109770, *600170, *217070, *173515, *602893, *147280, *154360, *171050, *108780, *176257, *600979,

*600377, *108360, *204500, *170260, *146880, *154582, *601011, *600997, *602992, *201475, *603005, *190198, *147360, #270400, *600238, #164970, *306250, #126600, *193065, #181350, *106180, *602136, *600937, *603086, *603087, *307030, *182099, *103320, *601683, #192430, *103180, *102681, *192321, *600244, *191740, *191315, *603152, *102642, *191305, #266140,

*100500, *600867, *604585, *604404, *604345, *603201, *605430, *603207, *603208, *605433, *604101, *603969, *605896, *604616, *605851, *605768, *604576, *605754, *605730, *605477, *603263, *605538, *603283, *604402, *605453, *605427, *603302, *605458, 603313, *604415, *603345, *605541, *603353, *605295, *603879, *605268, *605266, *605246, *603377, *603380,

*605181, *604203, *603425, *603867, *605106, *605017, *603842, *604936, *603510, *604857, *605932, *605816, *603765, *603551, *605357, *605237, *604204, *603594, *605110, *604190, *603861, *604962, *603639, *603644, *605007, *605349, *604943, *604918, *604907, *603667, *603681, *605396, *605561, *603712, *603713, *605688, *605942, *604878, *604843, *604659,

*604671, *603798, *604682, *604056, *604705, *603749, 602586, *603647, *602515, #602475, *603717, *602359, *602372, *602380, *602518, *603652, *602573, *603626, 602587, *603598, *602871, *603613, *603750, *603875, *602608, *602666, *602345, *602935, *603564, *603548, *603927, 601876, *602343, *603943, *603787, *601730, *601611, *602679, *603788, *602243,

603790, *601535, *603796, *601488, *601485, *602314, *601478, *604047, *604048, *602297, *604057, *602715, *602192, *601459, *601416, *603833, *602190, *604102, *602106, *604111, *602724, *603499, *602736, *601123, *601002, *600923, *601987, *604149, *601929, *600910, *600900, *600864, *604165, *600782, *602836, *600769, *600742, *602783, *601905, *600535,

*604198, *601901, *600534, *602876, *603356, *600530, *604216, *604217, *602890, *602905, *600465, *600464, *600446, *602891, *603366, *601894, *604272, *603926, *603312, *600368, *602914, *600327, *603151, *603202, 602911, *602974, *603006, *601883, *603008, *600074, *603007, *603046, #603903, *604433, *600016, *603925, *516005, *516004, *516003, *601756,

*604487, *516001, *313475, *313470, #307810, *604527, *604528, *601745, *604551, *604555, *603243, *603242, *603061, *603063, *603217, *300335, *300283, *300281, *604600, *300197, *603097, *603220, *601625, *604623, *603118, *601590, *604646, *300008, *601568, *300007, *275630, *601533, #275200, *270200, #261550, *604031, *604683, #254800, *251100, #242300,

*604058, *604720, *240500, *233690, #232240, #226730, *223100, *222100, #220100, *216950, *604832, 212750, 212067, *604066, *193067, 601315, *193001, *604862, *604870, *191306, *600385, *604879, *191191, *601296, *604914, *190181, *604119, #188550, *604925, *188410, #601287, *604939, *188380, *604126, *604945, *604148, *188060, *604982, *186854, *604988,

*186360, *186355, *185250, *600916, *605008, *605009, 185020, *600734, *605024, *182331, *605032, *605033, *182305, *180903, #179800, *179610, *605060, *179410, *178990, *176802, *605080, *176266, *176263, *176260, *600732, *173490, *604199, *173445, *173391, 172290, *605147, *605149, *171890, *600528, *171833, *605185, #170500, *605193, #168000, *605196,

*167055, *605205, *605208, 166900, *605216, *162651, *162010, *600504, #161400, *604253, #160800, *159460, *154540, *605254, *605261, *153634, *600429, *153337, *600424, *605292, #604286, #152700, 152423, *152310, *151625, *600153, *604313, *151523, *150325, *150320, *150292, *603150, *150290, *150210, *605410, *605415, *605416, *605417, *605421, *603149,

*604349, *147940, *600282, *147880, *146928, *146661, *600150, *146630, *142622, *600018, *605461, *138981, *138590, *600023, *138330, *605495, *138297, *605512, *138230, #136900, #301310, *516006, *605545, *605546, *136131, *134660, *134350, *516002, *605589, *131235, #130050, *605625, *126455, *126064, #125310, *605670, *604534, *125240, *123836, *123830,

*123620, *605702, #122200, *120980, *120360, *118510, *114835, *605710, *605716, *605722, *114217, *604561, *113810, *111740, #110800, *605748, *605752, *604564, *110600, *603160, *109610, *605784, #107480, *107273, *603192, *300169, *106195, *105210, *104615, *104614, *104210, *103850, 103581, *605876, *605877, *605879, *103220, *605887, *300150, *102910,

*102670, *102576, *605916, *604629, *102575, *102573, *300132, *101800, *605947

3) Channel (Member of Membrane Protein)

361 entries found, searching for “channel”

*176266, *600724, *182390, *123825, *114208, *114206, *176267, *114205, *601784, *600937, *114204, *603415, *600053, *114207, *114209, *605427, *604527, *604528, *600760, *601011, *192500, *118425, *600228, *176261, *602235, *600761, *600359, *300008, *182389, *600877, *602232, *176263, *182391, *601328, *600054, *603939, *602208, *601534, *600504, *602323,

*603208, *601958, *603537, *601012, *601327, *600734, *602780, *602781, *604433, *603220, *182392, *605874, *605873, *601745, *603888, *603219, *602604, *603796, *302910, *602866, *601013, *602905, *602906, *603967, *600163, #170500, *152427, *180901, *176260, #601462, *603951, *601141, *604492, *600702, *602023, *600308, *602754, *107776, *176257, *602024,

*601949, *605222, *601142, *602983, *193245, *600681, *176265, *600235, *176262, *176258, *605206, *604427, *605411, *603305, *601219, *600150, *604065, *602343, *605223, *605720, *603906, *138249, *138253, *600843, *604385, *600003, *600935, *603940, *602727, *602158, 602911, *600397, *602726, *600845, *605080, *600580, *602872, *602106, *176264, *603953,

*605722, *300110, *138252, *604111, *602717, *602420, *600570, 600844, *603493, *600932, *605716, *138254, *603652, *300138, *605410, *176268, *605214, *605696, *300334, *604660, *176256, *605879, *603749, *603583, *602345, *604661, *603787, 603313, *602982, *604337, *600846, *604662, *300328, *300281, *602566, *602836, *604003, *603788, *603651, *602421,

*107777, #177200, *100725, #219700, *100690, *100710, #160800, #603830, #183086, *600509, #220400, #601144, *173910, *180902, *605692, #264350, #160900, #145600, #255700, *602076, *603061, *601313, *154275, #604233, *604532, #108500, #121201, #170400, *300225, *121014, *139311, #125800, #160120, *118503, 601439, #141500, #168300, *304040, #601887, #256450,

*186945, *154276, #300009, #216900, *600040, *601014, *601042, *602512, *601383, *605445, *602368, *603831, #117000, *601218, *108745, *605248, #177735, #173900, *601212, *182139, *601059, *600039, *601485, *180903, *186360, *603319, #600101, *118509, *600109, #121200, *600170, *604187, *176975, *137163, #310468, #263800, #262300, *603750, *600229, *124030,

*602251, #603829, *137143, #145500, *600669, *147450, *154050, *603353, *600516, *601157, *600855, *601154, *602522, *249210, *600968, #252650, *171060, *600919, *156490, #259700, #601678, *601764, #310500, *131244, *300041, *121011, *125950, *114180, *602974, *600637, *113730, *118504, *605145, *604669, *118800, *121013, *121015, *138491, *600421, *104610,

*604045, *604594, *131230, *605487, *138247, *600467, #602485, *602481, *138251, *137192, *602403, 600851, *277900, *603785, *603152, *603199, *603475, #168600, #272120, *170280, *603852, #241200, *603053, *600465, #603034, *142461, *164920, *137164, *600884, *600442, *123885, *604001, *600232, *232200, *171050, *602103, *602014, *300211, *600983, *602887,

*604415, *604418, *300242, #300071, *604471, *600837, 168350, *118511, 193007, *600300, *604654, #601820, *180297, *600046, *603853, *604678, *604693, #604772, *118508, *603855, *605204, #254210, *182099, *182307, #130600, *601109, *114080, *300103, *182860, *605438, *601129, *603964, *600019, *516060, #185000, *138079, *104210, *605818, *603418, *305990, *305450

4) Extracellular Matrix

218 entries found, searching for “extracellular matrix”

*605912, *603479, *602201, *604633, *601418, *601548, *115437, *154870, *600754, *602261, *602285, *602262, *134797, *120361, *604629, *604871, *603321, *603320, *601807, #154700, *116935, *185261, *120360, *185250, *605470, *603767, *253700, *190180, *128239, *308700, *276901, *193300, *120324, *188826, *602109, *155760, *600514, *600261, #177170, *600536,

*147557, #116920, *150240, *601313, *120140, 601614, *605158, *120150, *120180, #200610, *605127, *193400, *192240, #173900, *152200, #136900, *135821, #130070, *120320, *120220, *112260, *310200, *600900, *600262, *605670, *600985, *179590, #245150, *602574, *601463, 183850, *601211, *604241, *600758, *186745, *604710, *602369, *602090, *190182, *192975,

*602178, *230740, *600065, *601652, *158106, *190181, *156790, #158810, *193210, *155120, *192977, *193065, #226700, *187380, *231050, *182120, *188060, *186355, 163200, *164010, #156550, *151510, *150370, *253800, *156225, *150325, #194050, *150290, *216550, *147620, *600215, *222600, *147559, *165380, *182888, *600491, *146650, *146640, *600564, *600596,

*600616, *600700, *600742, *138297, *182889, *154705, *600930, *301870, *153619, *601050, *601090, *601105, *165070, *305370, *135820, *130660, *310300, *601492, *128240, *601587, #126600, *601636, *600119, *601692, *601728, *125485, 601858, *601915, *602048, *175100, *602108, *121010, *600245, *120470, *120328, *120325, *602264, *120280, *602366, *600309,

*602402, *602415, *602428, *602453, *602505, #166210, *602600, *602941, *603005, *603196, 603209, *603221, *603234, *603319, *120250, *120210, *120120, *603489, *603551, *118938, *603799, *603842, *603924, *603963, *604042, *604063, *604149, *604160, *601028, *604467, *604510, *604592, *116930, *116806, *601284, *604724, *604806, *604807, *604808, *107269,

*605007, *605008, *605009, *600214, *600076, *605174, *605175, *605292, *605343, *605351, #600204, *605497, *605546, *605587, *605623, *600211, *605702, *103320

In addition to these, the various keywords shown in the above-mentioned categorization or others can be used for the OMIM search and the result may suggest the involvement thereof in diseases.

Further, the use of nucleotide sequences of cDNAs of the present invention enables analyzing the expression frequency of genes corresponding to the cDNAs. In addition, functions of the genes can be predicted based on the information obtained by the expression frequency analysis.

There are several methods for analyzing the expression levels of genes involved in diseases. Differences in gene expression levels between diseased and normal tissues are studied by the analytical methods using, for example, Northern hybridization, RT-PCR, DNA microarray, etc. (Experimental Medicine, Vol. 17, No. 8, 980-1056 (1999); Cell Engineering (additional volume) DNA Microarray and Advanced PCR Methods, Muramatsu & Nawa (eds.), Shujunsya (2000)). By computer analysis, in addition to these analysis methods, the nucleotide sequences of expressed genes can be compared to analyze the expression frequency. For example, there is a database called “BODYMAP”; gene clones are extracted at random from cDNA libraries of various tissues and/or cells, and the clones homologous to one another are assigned to a single cluster based on the information of nucleotide sequence homology at the 3′-end; genes are classified into any clusters, and the numbers of clones in the respective clusters are compared to gain the information on expression frequency (

When explicit difference in the expression levels between diseased tissues and normal tissues is observed for a gene by these analytical methods, it can be conclude that the gene is closely involved in a disease or disorder. Instead of diseased tissues, when gene expression is explicitly different between normal cells and cells reproducing disease-associated specific features, it can be concluded that the gene is closely involved in a disease or disorder.

From the 2443 clones whose full-length nucleotide sequences had been revealed, genes involved in particular pathology or functions were selected by the use of databases shown below (see Example 7; “Expression frequency analysis in silico”). The database used in the analyses of the present invention contains nucleotide sequences of 1,402,070 clones, and the population of the database is large enough for the analysis. The sequence information in the database was obtained by selecting cDNA clones at random from cDNA libraries derived from the various tissues and cells shown in Example 1 and determining the 5′-end sequences thereof.

Then, the nucleotide sequences of respective clones in this database were categorized (clustered) based on the nucleotide sequence homology determined with a search program; the number of clones belonging to every cluster of each library was determined and normalized; thus, the ratio of a certain gene in a cDNA library was determined. This analysis provided the information of the expression frequency of a gene in a tissue or cell that is the source of the cDNA library.

Then, in order to analyze the expression of genes corresponding to the nucleotide sequences of cDNAs of the present invention in tissues and cells, the libraries from the tissues or cells, which had been used in the large-scale cDNA analyses, were taken as subjects to compare the expression levels between different tissues or cells. Namely, the expression frequency was analyzed by comparing the previously normalized values between tissues or cells from which 600 or more cDNA clones whose nucleotide sequences had been analyzed were derived. The result of this analysis showed that the cDNA clones corresponded to the genes involved in the pathology and functions, which are indicated below. Each value in Tables 3 to 51 indicated below represents a relative expression frequency; the higher the value, the higher the expression level.

Osteoporosis-Related Genes

Osteoporosis is a pathology in which bones are easily broken owing to overall decrease in components of bone. The onset correlates to the balance between the functions of osteoblast producing bone and osteoclast absorbing bone, namely bone metabolism. Thus, the genes involved in the increase of osteoclasts differentiating from precursor cells of monocyte/macrophage line (Molecular Medicine 38. 642-648. (2001)) are genes involved in osteoporosis relevant to bone metabolism.

A nucleotide sequence information-based analysis was carried out to identify the genes whose expression frequencies are higher or lower in CD34+ cell (cell expressing a glycoprotein CD34) treated with the osteoclast differentiation factor (Molecular Medicine 38. 642-648. (2001)) than in the untreated CD34+ cell, which is the precursor cell of monocyte/macrophage line. The result of comparative analysis for the frequency between the cDNA libraries prepared from the RNA of CD34+ cells (CD34C) and from the RNA of CD34+ cells treated with the osteoclast differentiation factor (D30ST, D60ST or D90ST) showed that the genes whose expression levels were different between the two were 56 clones indicated in Table 3. These clones are involved in osteoporosis.

Genes Involved in Neural Cell Differentiation

Genes involved in neural cell differentiation are useful for treating neurological diseases. Genes with varying expression levels in response to induction of cellular differentiation in neural cells are thought to be involved in neurological diseases.

A survey was performed for genes whose expression levels are varied in response to induction of differentiation (stimulation by retinoic acid (RA) or growth inhibitor treatment after RA stimulation) in cultured cells of a neural strain, NT2. The result of comparative analysis of cDNA libraries derived from undifferentiated NT2 cells (NT2RM) and the cells subjected to the differentiation treatment (NT2RP, NT2R1 or NT2NE) showed that the genes whose expression levels were different between the two were 288 clones indicated in Table 4. These genes are neurological disease-related genes.

Cancer-Related Genes

It has been assumed that, distinct from normal tissues, cancer tissues express a distinct set of genes, and thus the expression thereof can contribute to the carcinogenesis in tissues and cells. Thus, genes whose expression patterns in cancer tissues are different from those in normal tissues are cancer-related genes. Search was carried out for the genes whose expression levels in cancer tissues were different from those in normal tissues.

The result of comparative analysis of cDNA libraries derived from breast tumor (TBAES) and normal breast (BEAST) showed that the genes whose expression levels were different between the two were 35 clones indicated in Table 5.

The result of comparative analysis of cDNA libraries derived cervical tumor (TCERX) and normal cervical duct (CERVX) showed that the genes whose expression levels were different between the two were 11 clones indicated in Table 6.

The result of comparative analysis of cDNA libraries derived from colon tumor (TCOLN) and normal colon (COLON) showed that the genes whose expression levels were different between the two were 25 clones indicated in Table 7.

The result of comparative analysis of cDNA libraries derived from esophageal tumor (TESOP) and normal esophagus (NESOP) showed that the genes whose expression levels were different between the two were 41 clones indicated in Table 8.

The result of comparative analysis of cDNA libraries derived from kidney tumor (TKIDN) and normal kidney (KIDNE) showed that the genes whose expression levels were different between the two were 175 clones indicated in Table 9.

The result of comparative analysis of cDNA libraries derived from liver tumor (TLIVE) and normal liver (LIVER) showed that the genes whose expression levels were different between the two were 47 clones indicated in Table 10.

The result of comparative analysis of cDNA libraries derived from lung tumor (TLUNG) and normal lung (HLUNG) showed that the genes whose expression levels were different between the two were 62 clones indicated in Table 11.

The result of comparative analysis of cDNA libraries derived from ovary tumor (TOVER) and normal ovary (NOVER) showed the genes whose expression levels were different between the two were 23 clones indicated in Table 12.

The result of comparative analysis of cDNA libraries derived from stomach tumor (TSTOM) and normal stomach (STOMA) showed that the genes whose expression levels were different between the two were 70 clones indicated in Table 13.

The result of comparative analysis of cDNA libraries derived from uterine tumor (TUTER) and normal uterus (UTERU) showed that the genes whose expression levels were different between the two were 236 clones indicated in Table 14.

The result of comparative analysis of cDNA libraries derived from tongue cancer (CTONG) and normal tongue (NTONG) showed that the genes whose expression levels were different between the two were 232 clones indicated in Table 15.

These genes are involved in cancers.

Further, there is a method to search for genes involved in development and differentiation, which is the expression frequency analysis in which the expression levels of genes are compared between developing and/or differentiating tissues and/or cells and adult tissues and/or cells. The genes involved in tissue development and/or differentiation are genes participating in tissue construction and expression of function, and thus are useful genes, which are available for regenerative medicine aiming at convenient regeneration of injured tissues.

By using the information of gene expression frequency gained from the database of 5′-end nucleotide sequences described above, genes involved in development or differentiation of particular tissues were selected from the 2443 clones whose full-length nucleotide sequence had been revealed (see Example 7).

The result of comparative analysis of cDNA libraries derived from fetal brain (FCBBF, FEBRA or OCBBF) and adult brain (BRACE, BRALZ, BRAMY, BRAWH, BRCAN, BRCOC, BRHIP, BRSSN, BRSTN or BRTHA) showed that the genes whose expression levels were different between the two were 1195 clones indicated in Tables 16 to 48.

The result of comparative analysis of cDNA libraries derived from fetal heart (FEHRT) and adult heart (HEART) showed that the genes whose expression levels were different between the two were 45 clones indicated in Table 49.

The result of comparative analysis of cDNA libraries derived from fetal kidney (FEKID) and adult kidney (KIDNE) showed that the genes whose expression levels were different between the two were 118 clones indicated in Table 50.

The result of comparative analysis of cDNA libraries derived from fetal lung (FELNG) and adult lung (HLUNG) showed that the genes whose expression levels were different between the two were 63 clones indicated in Table 51. These genes are involved in regeneration of tissues and/or cells.

The expression frequency or the like can be analyzed by PCR based on the nucleotide sequences of cDNAs of the present invention. There are some known methods for comparing the quantities of amplification products obtained by PCR. For example, the band intensities can be determined by ethidium bromide staining. With R1-labeled or fluorescently labeled primers, the R1 signal or fluorescence intensity can be assayed for the quantity of labeled amplification products. Alternatively, the quantity of amplification products can also be determined by measuring the R1 signal or the fluorescence intensity from the R1-labeled or fluorescently labeled probe hybridizing to the products. The assay results thus obtained are compared and then the clones exhibiting differences in the expression levels can be selected.

There are some quantitative PCR methods: a PCR method using internal standards; a competitive PCR, in which the quantification is achieved by adding, to a sample, a dilution series of a known quantity of a template RNA and by comparing the quantity of an amplification product derived from the RNA of interest with the quantity of an amplification product derived from the template RNA. These methods overcome the problems of errors in the amount of amplification products among tubes and of the plateau effect. ATAC-PCR (Adaptor-tagged competitive PCR) is a method of competitive PCR which is practiced by using multiple adapters of different sizes attached to a gene whose 3′-end nucleotide sequence has previously been determined. The ratio of expression frequency of a single mRNA species from a number of tissues (cells) can be assayed in a single step (Nucleic Acids Research 1997, 25(22): 4694-4696; “DNA Micro-array and Advanced PCR Techniques”, Cell Technology, supplement, Eds., Muramatsu and Nawa (Shujunsha, 2000): 104-112).

If it is observed, by using these analytical methods, that the expression levels of genes are evidently varied during major cellular events (such as differentiation and apoptosis), the genes are involved in the cellular events and accordingly are candidates for disease- and/or disorder-related genes. Further, genes exhibiting tissue-specific expression are genes playing important parts in the tissue functions and, therefore, can be candidates for genes involved in diseases and/or disorders affecting the tissues.

For example, inflammation is an important biological response that is known to be involved in various diseases. The representative inflammation-inducing factors include TNF-a (Tumor Necrosis Factor-alpha). There exists a signaling cascade activated by TNF-α stimulations, wherein NF-κB is a transducing molecule (Cell 1995, 80:529-532). It has also been revealed that many inflammation-related genes, including IL-2, IL-6 and G-CSF, are varied in the expression levels thereof in response to the signal through the pathway (Trends Genet. 1999, 15(6): 229-235). It is assumed that genes whose expression levels are varied in response to the stimulation of TNF-α also participate in inflammation.

Further, the infection of Helicobacter pylori to the gastric epithelia is known to cause gastritis and gastroduodenal ulcer (Mebio 2000, July, 17(7): 16-33). Thus, the genes whose expression levels are altered depending on co-culturing cells with Helicobacter pylori may be involved in gastritis and gastroduodenal ulcer. A recent study has suggested that Helicobacter pylori strongly activates the NF-KB pathway(Gastroenterology 2000, 119: 97-108).

THP-1 cell, which is a human monocyte cell line, was cultured in the presence of TNF-α (Tumor Necrosis Factor-alpha) The genes whose expression levels were altered owing to the presence of TNF-α were searched for, and the result showed that the clones whose expression levels were increased owing to the presence of TNF-α were ASTRO20152140, BRACE20057620,

BRACE20060720, BRACE20090440, BRACE20152870, BRACE20229280, BRAMY20002770, BRAMY20266850, BRAMY20280720, BRAWH20106180, BRAWH20122770, BRHIP20096170, BRHIP20111200, BRHIP20186120, BRHIP20194940, BRHIP20207430, BRSSN20152380, CTONG20095270, CTONG20100240, CTONG20158150,

CTONG20265130, D3OST20006540, D9OST20031370, FCBBF20071860, FCBBF30251420, FCBBF30252520, FCBBF40001420, FEBRA20017050, FEBRA20082100, HCHON20011160, KIDNE20141190, KIDNE20163880, KIDNE20182690, LIVER10004790, LIVER20038540, LIVER20085800, MESAN20130220, MESAN20174170, NT2NE20158600, NT2RI20005750, NT2RP70110860, NT2RP70169110, NT2RP70175670, NT2RP70188710, PERIC20002140, PLACE60155130, PROST20120160, PROST20149250, PROST20161950, PUAEN20015260, SKNSH20080430, SMINT20051610, SMINT20060780, SMINT20161220, SMINT20163960, SPLEN20101190, SPLEN20157300, SPLEN20163560, SPLEN20214580, SPLEN20279950, STOMA20048520, TESTI20076850, TESTI20087620, TESTI20108720, TESTI20220100, TESTI20239510, TESTI20266740, TESTI20342430, TESTI20370020, TESTI20391210, TESTI20401020, TESTI20415640, THYMU20130890, THYMU20286290, TRACH20060150, TRACH20099340, UTERU20004240, UTERU20068990, UTERU20119060.

On the other hand, the clones whose expression levels were decreased owing to the presence of TNF-αwere ASTRO20032120,

ASTRO20084250, ASTRO20181690, BRACE20062640, BRACE20067430, BRACE20235400, BRALZ20018340, BRALZ20069760, BRALZ20075450, BRAMY20163270, BRAMY20204450, BRAMY20218670, BRAMY20229800, BRAWH10000930, BRAWH20107540, BRAWH20132190, BRAWH20158530, BRCAN20273340, BRHIP20105710, BRHIP20186120,

BRSSN20176820, CTONG20095290, DFNES20031920, FCBBF30033050, FCBBF30071520, FCBBF30083820, HCHON20008980, HCHON20022470, HHDPC20034390, KIDNE20028720, KIDNE20079440, KIDNE20127750, KIDNE20148900, LIVER20011130, MAMGL10000830, MESAN20127350, NT2NE20181650, NT2RI20023160, NT2RP70102350, NT2RP70157890, NTONG20029480, OCBBF20020830, OCBBF20041680, OCBBF20061720, OCBBF20127040, OCBBF20139260, OCBBF20178990, PEBLM20013120, PLACE60003480, PLACE60181070, PROST20151240, PUAEN20003740, PUAEN20011880, PUAEN20078980, PUAEN20085150, SKNSH20080430, SMINT20001760, SMINT20047810, SMINT20108530, SPLEN20158990, SPLEN20283650, STOMA20010250, STOMA20057820, TESTI20060400, TESTI20161970, TESTI20275620, TESTI20369690, TESTI20386230, TESTI20392250, TESTI20409440, TESTI20424730, THYMU20095960, THYMU20111180, THYMU20226600, THYMU20253250, THYMU20272490, TRACH20153810, UTERU20176130, UTERU20186740.

These clones are inflammation-related genes.

MKN45, which is a gastric cancer cell line, was co-cultured with Helicobacter pylori. The genes whose expression levels were altered owing to the presence of Helicobacter pylori were searched for, and the result showed that the clones whose expression levels were increased owing to the presence of Helicobacter pylori were ADRGL20067670, BLADE20004630,

BRACE20039040, BRACE20151320, BRACE20229280, BRACE20235400, BRALZ20058880, BRAMY20060920, BRAMY20184670, BRAMY20218670, BRAMY20229800, BRCAN20147880, BRHIP20196410, BRHIP30004880, BRSSN20187310, CD34C30004940, CTONG20265130, DFNES20031920, FCBBF30278630, FCBBF40001420,

HHDPC20095280, KIDNE20130450, LIVER20011130, LIVER20038540, NT2NE20172590, NT2RP70169110, OCBBF20085200, OCBBF20180840, PEBLM10000240, PLACE60003480, PROST20120160, PROST20151240, PUAEN20011880, SKMUS20031680, SKNSH20080430, SMINT20056210, SMINT20105000, SPLEN20019450, SPLEN20211570, STOMA20048520, TESTI20004890, TESTI20083940, TESTI20168480, TESTI20239510, TESTI20308600, TESTI20478010, UTERU20126880.

On the other hand, the clones whose expression levels were decreased owing to the presence of Helicobacter pylori were

ASTRO20032120, BRACE20090440, BRACE20114780, BRALZ20064740, BRAMY20002770, BRAMY20210400, BRAMY20215230, BRAMY20247280, BRAMY20267130, BRAWH20029630, BRAWH20100690, BRAWH20118230, BRCOC20105100, BRHIP20218580, BRSSN20046570, CTONG20138030, CTONG20146970, CTONG20158150, D3OST20037970, FCBBF30001840, FCBBF30033050, FEBRA20082100, HCHON20035130, HCHON20043590, HCHON20067220, NT2NE20174920, NT2RI20009870, NT2RI20023160, NT2RP70062230, NT2RP70130020, NTONG20070340, OCBBF20020150, OCBBF20094240, OCBBF20107920, PROST20144220, PROST20149160, PROST20153320, PUAEN20003740, PUAEN20025680, PUAEN20040670, SMINT20014580, SPLEN20101190, STOMA20076800, TESTI20087620, TESTI20098530, TESTI20123080, TESTI20161970, TESTI20234140, TESTI20288110, TESTI20357960, TESTI20391210, TESTI20424730, THYMU20158250, THYMU20226600, TRACH20005020, TRACH20134950, TRACH20184490, TSTOM20001390, UTERU20119060, UTERU20134910, UTERU20176130.

These clones are involved in gastritis or gastroduodenal ulcer.

For example, if the polypeptide encoded by the cDNA of the present invention is a regulatory factor of cellular conditions such as growth and differentiation, it can be used for developing medicines as follows. The polypeptide or antibody provided by the invention is injected into a certain kind of cells by microinjection. Then, using the cells, it is possible to screen low molecular weight compounds, etc. by measuring the change in the cellular conditions, or the activation or inhibition of a particular gene. The screening can be performed as follows.

First, the polypeptide is expressed and purified as recombinant. The purified polypeptide is microinjected into cells such as various cell lines, or primary culture cells, and the cellular change such as growth and differentiation can be examined. Alternatively, the induction of genes whose expression is known to be involved in a particular change of cellular conditions may be detected by the amount of mRNA or polypeptide. Alternatively, the amount of intracellular molecules (low molecular weight compounds, etc.) that is changed by the function of the gene product (polypeptide) which is known to be involved in a particular change of cellular conditions may be detected. The compounds to be screened (both low and high molecular compounds are acceptable) can be added to the culture media and assessed for their activity by measuring the change of the cellular conditions.

Instead of microinjection, cell lines introduced with the gene obtained in the invention can be used for the screening. If the gene product is turn out to be involved in a particular change in the cellular conditions, the change of the product can be used as a measurement for screening. Once a compound is screened out which can activate or inhibit the function of the polypeptide of the invention, it can be applied for developing medicines.

If the polypeptide encoded by the cDNA of the present invention is a secretory protein, membrane protein, or protein involved in signal transduction, glycoprotein, transcription, or diseases, it can be used in functional assays for developing medicines.

In case of a membrane protein, it is most likely to be a polypeptide that functions as a receptor or ligand on the cell surface. Therefore, it is possible to reveal a new relationship between a ligand and receptor by screening the membrane protein of the invention based on the binding activity with the known ligand or receptor. Screening can be performed according to the known methods.

For example, a ligand against the polypeptide of the invention can be screened in the following manner. Namely, a ligand that binds to a specific polypeptide can be screened by a method comprising the steps of: (a) contacting a test sample with the polypeptide of the invention or a partial peptide thereof, or cells expressing these, and (b) selecting a test sample that binds to said polypeptide, said partial peptide, or said cells.

On the other hand, for example, screening using cells expressing the polypeptide of the present invention that is a receptor protein can also be performed as follows. It is possible to screen receptors that is capable of binding to a specific polypeptide by using procedures (a) attaching the sample cells to the polypeptide of the invention or its partial peptide, and (b) selecting cells that can bind to the said polypeptide or its partial peptide.

In a following screening as an example, first the polypeptide of the invention is expressed, and the recombinant polypeptide is purified. Next, the purified polypeptide is labeled, binding assay is performed using a various cell lines or primary cultured cells, and cells that are expressing a receptor are selected (Growth and differentiation factors and their receptors, Shin-Seikagaku Jikken Kouza Vol. 7 (1991) Honjyo, Arai, Taniguchi, and Muramatsu edit, p203-236, Tokyo-Kagaku-Doujin). A polypeptide of the invention can be labeled with RI such as 125I, and enzyme (alkaline phosphatase etc.).

Alternatively, a polypeptide of the invention may be used without labeling and then detected by using a labeled antibody against the polypeptide. The cells that are selected by the above screening methods, which express a receptor of the polypeptide of the invention, can be used for the further screening of an agonists or antagonists of the said receptor.

Once the ligand binding to the polypeptide of the invention, the receptor of the polypeptide of the invention or the cells expressing the receptor are obtained by screening, it is possible to screen a compound that binds to the ligand and receptor. Also it is possible to screen a compound that can inhibit both bindings (agonists or antagonists of the receptor, for example) by utilizing the binding activities.

When the polypeptide of the invention is a receptor, the screening method comprises the steps of (a) contacting the polypeptide of the invention or cells expressing the polypeptide of the invention with the ligand, in the presence of a test sample, (b) detecting the binding activity between said polypeptide or cells expressing said polypeptide and the ligand, and (c) selecting a compound that reduces said binding activity when compared to the activity in the absence of the test sample. Furthermore, when the polypeptide of the invention is a ligand, the screening method comprises the steps of (a) contacting the polypeptide of the invention with its receptor or cells expressing the receptor in the presence of samples, (b) detecting the binding activity between the polypeptide and its receptor or the cells expressing the receptor, and (c) selecting a compound that can potentially reduce the binding activity compared to the activity in the absence of the sample.

Samples to screen include cell extracts, expressed products from a gene library, synthesized low molecular compound, synthesized peptide, and natural compounds, for example, but are not construed to be listed here. A compound that is isolated by the above screening using a binding activity of the polypeptide of the invention can also be used as a sample.

A compound isolated by the screening may be a candidate to be an agonist or an antagonist of the receptor of the polypeptide. By utilizing an assay that monitors a change in the intracellular signaling such as phosphorylation which results from reduction of the binding between the polypeptide and its receptor, it is possible to identify whether the obtained compound is an agonist or antagonist of the receptor. Also, the compound may be a candidate of a molecule that can inhibit the interaction between the polypeptide and its associated proteins (including a receptor) in vivo. Such compounds can be used for developing drugs for precaution or cures of a disease in which the polypeptide is involved.

Secretory proteins may regulate cellular conditions such as growth and differentiation. It is possible to find out a novel factor that regulates cellular conditions by adding the secretory protein of the invention to a certain kind of cell, and performing a screening by utilizing the cellular changes in growth or differentiation, or activation of a particular gene.

The screening can be performed, for example, as follows. First, the polypeptide of the invention is expressed and purified in a recombinant form. Then, the purified polypeptide is added to a various kind of cell lines or primary cultured cells, and the change in the cell growth and differentiation is monitored. The induction of a particular gene that is known to be involved in a certain cellular change is detected by the amounts of mRNA and polypeptide. Alternatively, the amount of an intracellular molecule (low-molecular-weight compounds, etc.) that is changed by the function of a gene product (polypeptide) that is known to function in a certain cellular change is used for the detection.

Once the screening reveals that the polypeptide of the invention can regulate cellular conditions or the functions, it is possible to apply the polypeptide as a pharmaceutical and diagnostic medicine for related diseases by itself or by altering a part of it into an appropriate composition.

As is above described for membrane proteins, the secretory protein provided by the invention may be used to explore a novel ligand-receptor interaction using a screening based on the binding activity to a known ligand or receptor. A similar method can be used to identify an agonist or antagonist. The resulting compounds obtained by the methods can be a candidate of a compound that can inhibit the interaction between the polypeptide of the invention and an interacting molecule (including a receptor). The compounds may be able to use as a preventive, therapeutic, and diagnostic medicine for the diseases, in which the polypeptide may play a certain role.

Proteins involved in signal transduction or transcription may be a factor that affects a certain polypeptide or gene in response to intracellular/extracellular stimuli. It is possible to find out a novel factor that can affect a polypeptide or gene by expressing the polypeptide provided by the invention in a certain types of cells, and performing a screening utilizing the activation of a certain intracellular polypeptide or gene.

The screening may be performed as follows. First, a transformed cell line expressing the polypeptide is obtained. Then, the transformed cell line and the untransformed original cell line are compared for the changes in the expression of a certain gene by detecting the amount of its mRNA or polypeptide. Alternatively, the amount of an intracellular molecule (low molecular weight compounds, etc.) that is changed by the function of a certain gene product (polypeptide) may be used for the detection. Furthermore, the change of the expression of a certain gene can be detected by introducing a fusion gene that comprises a regulatory region of the gene and a marker gene (luciferase, β-galactosidase, etc.) into a cell, expressing the polypeptide provided by the invention into the cell, and estimating the activity of a marker gene product (polypeptide).

If the polypeptide or gene of the invention is involved in diseases, it is possible to screen a gene or compound that can regulate its expression and/or activity either directly or indirectly by utilizing the polypeptide of the present invention.

For example, the polypeptide of the invention is expressed and purified as a recombinant polypeptide. Then, the polypeptide or gene that interacts with the polypeptide of the invention is purified, and screened based on the binding. Alternatively, the screening can be performed by adding with a compound of a candidate of the inhibitor added in advance and monitoring the change of binding activity. In another method, a transcription regulatory region locating in the 5′-upstream of the gene encoding the polypeptide of the invention that is capable of regulating the expression of other genes is obtained, and fused with a marker gene. The fusion is introduced into a cell, and the cell is added with compounds to explore a regulatory factor of the expression of the said gene.

The compound obtained by the screening can be used for developing pharmaceutical and diagnostic medicines for the diseases in which the polypeptide of the present invention is involved. Similarly, if the regulatory factor obtained in the screening is turn out to be a polypeptide, compounds that can newly affect the expression or activity of the polypeptide may be used as a medicine for the diseases in which the polypeptide of the invention is involved.

If the polypeptide of the invention has an enzymatic activity, regardless as to whether it is a secretory protein, membrane protein, or proteins involved in signal transduction, glycoprotein, transcription, or diseases, a screening may be performed by adding a compound to the polypeptide of the invention and monitoring the change of the compound. The enzymatic activity may also be utilized to screen a compound that can inhibit the activity of the polypeptide.

In a screening given as an example, the polypeptide of the invention is expressed and the recombinant polypeptide is purified. Then, compounds are contacted with the purified polypeptide, and the amount of the compound and the reaction products is examined. Alternatively, compounds that are candidates of an inhibitor are pretreated, then a compound (substrate) that can react with the purified polypeptide is added, and the amount of the substrate and the reaction products is examined.

The compounds obtained in the screening may be used as a medicine for diseases in which the polypeptide of the invention is involved. Also they can be applied for tests that examine whether the polypeptide of the invention functions normally in vivo.

Whether the secretory protein, membrane protein, signal transduction-related protein, glycoprotein-related protein, or transcription-related protein of the present invention is a novel protein involved in diseases or not is determined in another method than described above, by obtaining a specific antibody against the polypeptide of the invention, and examining the relationship between the expression or activity of the polypeptide and a certain disease. In an alternative way, it may be analyzed referred to the methods in “Molecular Diagnosis of Genetic Diseases” (Elles R. edit, (1996) in the series of “Method in Molecular Biology” (Humana Press).

Proteins involved in diseases are targets of screening as mentioned, and thus are very useful in developing drugs which regulate their expression and activity. Also, the proteins are useful in the medicinal industry as a diagnostic marker of the related disease or a target of gene therapy.

Compounds isolated as mentioned above can be administered patients as it is, or after formulated into a pharmaceutical composition according to the known methods. For example, a pharmaceutically acceptable carrier or vehicle, specifically sterilized water, saline, plant oil, emulsifier, or suspending agent can be mixed with the compounds appropriately. The pharmaceutical compositions can be administered to patients by a method known to those skilled in the art, such as intraarterial, intravenous, or subcutaneous injections. The dosage may vary depending on the weight or age of a patient, or the method of administration, but those skilled in the art can choose an appropriate dosage properly. If the compound is encoded by polynucleotide, the polynucleotide can be cloned into a vector for gene therapy, and used for gene therapy. The dosage of the polynucleotide and the method of its administration may vary depending on the weight or age of a patient, or the symptoms, but those skilled in the art can choose properly.

The present invention further relates to databases comprising at least a sequence of polynucleotide and/or polypeptide, or a medium recorded in such databases, selected from the sequence data of the nucleotide and/or the amino acids indicated in Table 1. The term “database” means a set of accumulated information as machine-searchable and readable information of nucleotide sequence. The databases of the present invention comprise at least one of the novel nucleotide sequences of polynucleotides provided by the present invention. The databases of the present invention can consist of only the sequence data of the novel polynucleotides provided by the present invention or can comprise other information on nucleotide sequences of known full-length cDNAs or ESTs. The databases of the present invention can be comprised of not only the information on the nucleotide sequences but also the information on the gene functions revealed by the present invention. Additional information such as names of DNA clones carrying the full-length cDNAs can be recorded or linked together with the sequence data in the databases.

The database of the present invention is useful for gaining complete gene sequence information from partial sequence information of a gene of interest. The database of the present invention comprises nucleotide sequence information of full-length cDNAs. Consequently, by comparing the information in this database with the nucleotide sequence of a partial gene fragment yielded by differential display method or subtraction method, the information on the full-length nucleotide sequence of interest can be gained from the sequence of the partial fragment as a starting clue.

The sequence information of the full-length cDNAs constituting the database of the present invention contains not only the information on the complete sequences but also extra information on expression frequency of the genes as well as homology of the genes to known genes and known polypeptides. Thus the extra information facilitates rapid functional analyses of partial gene fragments. Further, the information on human genes is accumulated in the database of the present invention, and therefore, the database is useful for isolating a human homologue of a gene originating from other species. The human homologue can be isolated based on the nucleotide sequence of the gene from the original species.

At present, information on a wide variety of gene fragments can be obtained by differential display method and subtraction method. In general, these gene fragments are utilized as tools for isolating the full-length sequences thereof. When the gene fragment corresponds to an already-known gene, the full-length sequence is easily obtained by comparing the partial sequence with the information in known databases. However, when there exists no information corresponding to the partial sequence of interest in the known databases, cDNA cloning should be carried out for the full-length cDNA. It is often difficult to obtain the full-length nucleotide sequence using the partial sequence information as an initial clue. If the full-length of the gene is not available, the amino acid sequence of the polypeptide encoded by the gene remains unidentified. Thus the database of the present invention can contribute to the identification of full-length cDNAs corresponding to gene fragments, which cannot be revealed by using databases of known genes.

The present invention has provided 2443 polynucleotides. As has not yet proceeded the isolation of full-length cDNA within the human, the invention has great significance. It is known that secretory proteins, membrane proteins, signal transduction-related proteins, glycoprotein-related proteins, transcription-related proteins, and so on are involved in many diseases. The genes and proteins involved in diseases are useful for developing a diagnostic marker or medicines for regulation of their expression and activity, or as a target of gene therapy.

In particular, cDNA assumed to encode secretory proteins, which were provided by this invention, are very important for the industry since the encoded proteins themselves are expected to be useful as pharmaceutical agents and many disease-related genes may be included in them. In addition, membrane proteins, signal transduction-related proteins, transcription-related proteins, disease-related proteins, and genes encoding them can be used as indicators for diseases, etc. These cDNA are also very important for the industry, which are expected to regulate the activity or expression of the encoded protein to treat diseases, etc.

Any patents, patent applications, and publications cited herein are incorporated by reference.

The invention is illustrated more specifically with reference to the following examples, but is not to be construed as being limited thereto.

EXAMPLE 1 Preparation of cDNA Library by Oligo-Capping

(1) Extraction and Purchase of mRNA

Total RNAs as mRNA sources were extracted from human tissues (shown below) by the method as described in the reference (J. Sambrook, E. F. Fritsch & T. Maniatis, Molecular Cloning Second edition, Cold Spring harbor Laboratory Press, 1989). Further, by the method as described in the reference (J. Sambrook, E. F. Fritsch & T. Maniatis, Molecular Cloning Second edition, Cold Spring harbor Laboratory Press, 1989), total RNAs as mRNA sources were extracted from human culture cells and human primary culture cells (shown below) which had been cultivated by the methods described in the catalogs.

The library names and the origins are indicated below in the order of “Library name: Origin”. When a library was prepared by the subtraction method, the item is followed by a description of how to prepare the subtracted library.

<Extraction of mRNA From Human Tissues>

NTONG: Normal tongue;

CTONG: Tongue cancer;

FCBBF: Fetal brain;

OCBBF: Fetal brain;

PLACE: Placenta;

SYNOV: Synovial membrane tissue (from rheumatioid arthritis);

CORDB: Cord blood.

<Extraction of mRNA from Culture Cells>

BNGH4: H4 cells (ATCC #HTB-148);

IMR32: IMR32 cells (ATCC #CCL-127);

SKNMC: SK-N-MC cells (ATCC #HTB-10);

3NB69: NB69 cells (RCB #RCB0480);

BGGI1: GI1 cells (RCB #RCB0763);

NB9N4: NB9 cells (RCB #RCB0477);

SKNSH: SK-N-SH cells (RCB #RCB0426);

AHMSC: Human mesenchymal (HMSC) cells;

CHONS: Chondrocytes;

ERLTF: TF-1 cells (erythroleukemia);

HELAC: HeLa cells;

JCMLC: Leukemia, myelogenous;

MESTC: Mesenchyme stem cells;

N1ESE: Mesenchymal stem cells;

NCRRM: Embryonal carcinoma;

NCRRP: Embryonal carcinoma treated with retinoic acid (RA) to induce the differentiation;

T1ESE: Mesenchymal stem cells treated with trichostatin and 5-azacytidine to induce the differentiation;

NT2RM: NT2 cells (STARATAGENE #204101);

NT2RP: NT2 cells treated with retinoic acid (RA) for 5 weeks to induce the differentiation;

NT2R1: NT2 cells treated with RA for 5 weeks to induce the differentiation, followed by the treatment with the growth inhibitor for 2 weeks;

NT2NE: NT2 cells were treated with RA and the growth inhibitor for the neuronal differentiation, and the resultant neurons were concentrated and harvested (NT2 Neuron);

NTISM: NT2 cells (STARATAGENE #204101) were treated with RA for 5 weeks to induce the differentiation, and then treated with the growth inhibitor for 2 weeks; mRNA was prepared from the cells and a cDNA library was constructed from the mRNA; the cDNAs of the library whose nucleotide sequences were shared by those of mRNAs from undifferentiated NT2 cells were subtracted by using a Subtract Kit (Invitrogen #K4320-01); the subtracted library (NT2R1-NT2RM) was provided by this procedure.

RCB indicates that the cell was provided by the Cell Bank, RIKEN GENE BANK, The Institute of Physical and Chemical Research; ATCC indicates that the cell was provided by American Type Culture Collection.

<Extraction of mRNA from Primary Culture Cells>

ASTRO: Normal human astrocyte NHA5732, Takara Shuzo #CC2565;

DFNES: Normal human dermal fibroblast (neonatal skin); NHDF-Neo

NHDF2564, Takara Shuzo #CC2509;

MESAN: Normal human mesangial cell NHMC56046-2, Takara Shuzo #CC2559;

NHNPC: Normal human neural progenitor cell NHNP5958, Takara Shuzo #CC2599;

PEBLM: Normal human peripheral blood mononuclear cell HPBMC5939, Takara Shuzo #CC2702;

HSYRA: Human synoviocyte HS-RA (from rheumatioid arthritis), Toyobo #T404K-05;

PUAEN: Normal human pulmonary artery endothelial cells, Toyobo #T302K-05;

UMVEN: Normal human umbilical vein endothelial cell HUVEC, Toyobo #T200K-05;

HCASM: Normal human coronary artery smooth muscle cell HCASMC, Toyobo #T305K-05;

HCHON: Normal human chondrocyte HC, Toyobo #T402K-05;

HHDPC: Normal human dermal papilla cell HDPC, Toyobo #THPCK-001;

CD34C: CD34+ cells (AllCells, LLC #CB14435M);

D3OST: CD34+ cells treated with the osteoclast differentiation factor (ODF) for 3 days to induce the differentiation;

D6OST: CD34+ cells treated with ODF for 6 days to induce the differentiation;

D9OST: CD34+ cells treated with ODF for 9 days to induce the differentiation;

ACTVT: Activated T-cells;

LYMPB: Lymphoblasts, EB virus transferred B cells;

NETRP: Neutrophils.

Then, total RNAs extracted from the following human tissues were purchased and used as mRNA sources. The library names and the origins are indicated below in the order of “Library name: Origin”. When a library was prepared by the subtraction method, the item is followed by a description of how to prepare the subtracted library.

<Purchase of Total RNA Containing mRNA Extracted From Human Tissues>

ADRGL: Adrenal gland, CLONTECH #64016-1;

BRACE: Brain (cerebellum), CLONTECH #64035-1;

BRAWH: Whole brain, CLONTECH #64020-1;

FEBRA: Fetal brain, CLONTECH #64019-1;

FELIV: Fetal liver, CLONTECH #64018-1;

HEART: Heart, CLONTECH #64025-1;

HLUNG: Lung, CLONTECH #64023-1;

KIDNE: Kidney, CLONTECH #64030-1;

LIVER: Liver, CLONTECH #64022-1;

MAMGL: Mammary Gland, CLONTECH #64037-1;

PANCR: Pancreas, CLONTECH #64031-1;

PROST: Prostate, CLONTECH #64038-1;

SALGL: Salivary Gland, CLONTECH #64026-1;

SKMUS: Skeletal Muscle, CLONTECH #64033-1;

SMINT: Small Intestine, CLONTECH #64039-1;

SPLEN: Spleen, CLONTECH #64034-1;

STOMA: Stomach, CLONTECH #64090-1;

TBAES: Breast (Tumor), CLONTECH #64015-1;

TCERX: Cervix (Tumor), CLONTECH #64010-1;

TCOLN: Colon (Tumor), CLONTECH #64014-1;

TESTI: Testis, CLONTECH #64027-1;

THYMU: Thymus, CLONTECH #64028-1;

TLUNG: Lung (Tumor), CLONTECH #64013-1;

TOVAR: Ovary (Tumor), CLONTECH #64011-1;

TRACH: Trachea, CLONTECH #64091-1;

TUTER: Uterus (Tumor), CLONTECH #64008-1;

UTERU: Uterus, CLONTECH #64029-1;

ADIPS: Adipose, Invitrogen #D6005-01;

BLADE: Bladder, Invitrogen #D6020-01;

BRALZ: Cerebral cortex from an Alzheimer patient (Brain, cortex, Alzheimer), Invitrogen #D6830-01;

CERVX: Cervix, Invitrogen #D6047-01;

COLON: Colon, Invitrogen #D6050-0;

NESOP: Esophagus, Invitrogen #D6060-01;

PERIC: Pericardium, Invitrogen #D6105-01;

RECTM: Rectum, Invitrogen #D6110-01;

TESOP: Esophageal (Tumor), Invitrogen #D6860-01;

TKIDN: Kidney (Tumor), Invitrogen #D6870-01;

TLIVE: Liver (Tumor), Invitrogen #D6880-01;

TSTOM: Stomach (Tumor), Invitrogen #D6920-01;

BEAST: Adult breast, STARATAGENE #735044;

FEHRT: Fetal heart, STARATAGENE #738012;

FEKID: Fetal kidney, STARATAGENE #738014;

FELNG: Fetal lung, STARATAGENE #738020;

NOVAR: Adult ovary, STARATAGENE #735260;

BRASW: subtracted library (BRALZ-BRAWH). A cDNA library was constructed from mRNA prepared from tissues of cerebral cortex obtained from an Alzheimer patient [BRALZ: Cerebral cortex from an Alzheimer patient (Brain, cortex, Alzheimer), Invitrogen #D6830-01]; the cDNAs of this library whose nucleotide sequences were shared by those of mRNAs from whole brain tissue [BRAWH: Whole brain, CLONTECH #64020-1] were subtracted by using a Subtract Kit (Invitrogen #K4320-01).

Further, mRNAs extracted and purified as poly A(+) RNAs from the human tissues shown below were purchased. A cDNA library was prepared from an RNA mixture in which the poly A(+) RNA from each tissue had been combined with poly A(−) RNA. The poly A(−) RNA was prepared by removing poly A(+) RNA from the total RNA of whole brain tissue (CLONTECH #64020-1) by using oligo dT cellulose. The library names and the origins are indicated below in the order of “Library name: Origin”.

<Purchase of mRNAs of Human Tissues as Poly A(+) RNAs>

BRAMY: Brain (amygdala), CLONTECH #6574-1;

BRCAN: Brain (caudate nucleus), CLONTECH #6575-1;

BRCOC: Brain (corpus callosum), CLONTECH #6577-1;

BRHIP: Brain (hippocampus), CLONTECH #6578-1;

BRSSN: Brain (substantia nigra), CLONTECH #6580-1;

BRSTN: Brain (subthalamic nucleus), CLONTECH #6581-1;

BRTHA: Brain (thalamus), CLONTECH #6582-1.

(2) Preparation of cDNA Library

cDNA library was prepared from each RNA by the improved method (WO 01/04286) of oligo capping [M. Maruyama and S. Sugano, Gene, 138: 171-174 (1994)]. A series of procedures, BAP (Bacterial Alkaline Phosphatase) treatment, TAP (Tobacco Acid Pyrophosphatase) treatment, RNA ligation, first strand cDNA synthesis and RNA removal, were carried out using the oligo-cap linker (SEQ ID NO: 5455) and oligo dT primer (SEQ ID NO: 5456), as described in WO 01/04286. Then, the single-stranded cDNA was converted to a double-stranded cDNA by PCR (polymerase chain reaction) using 5′ (SEQ ID NO: 5457) and 3′ (SEQ ID NO: 5458) PCR primers, and then digested with SfiI. Then, a fraction of cDNA fragments, typically 2-kb or longer (3-kb or longer in some cases), was unidirectionally cloned into a DraIII-digested pME18SFL3 vector (FIG. 1) (GenBank AB009864, Expression vector); the cDNA library was thus prepared.

The names of cDNA libraries, which were used in the analysis of full-length cDNA sequences, and their origins are shown in Table 2.

TABLE 2 Library Type Origin, etc. 3NB69 Culture cell NB69 cells (RCB #RCB0480) ADIPS Tissue Adipose (Invitrogen #D6005-01) ADRGL Tissue Adrenal gland (CLONTECH #64016-1) ASTRO Primary culture cell Normal Human Astrocyte NHA5732 (Takara Shuzo #CC2565) BEAST Tissue Adult Breast (STARATAGENE #735044) BGGI1 Culture cell GI1 cells (RCB #RCB0763) BLADE Tissue Bladder (Invitrogen #D6020-01) BNGH4 Culture cell H4 cells (ATCC #HTB-148) BRACE Tissue Brain, cerebellum (CLONTECH #64035-1) BRALZ Tissue Brain, cortex, Alzheimer (Invitrogen #D6830-01) BRAMY Tissue Brain, amygdala (CLONTECH #6574-1) BRAWH Tissue Brain, whole (CLONTECH #64020-1) BRCAN Tissue Brain, caudate nucleus (CLONTECH #6575-1) BRCOC Tissue Brain, corpus callosum (CLONTECH #6577-1) BRHIP Tissue Brain, hippocampus (CLONTECH #6578-1) BRSSN Tissue Brain, substantia nigra (CLONTECH #6580-1) BRSTN Tissue Brain, subthalamic nucleus (CLONTECH #6581-1) BRTHA Tissue Brain, thalamus (CLONTECH #6582-1) CD34C Primary culture cell CD34+ cells (AllCells, LLC #CB14435M) COLON Tissue Colon (Invitrogen #D6050-0) CTONG Tissue Tongue, Cancer D3OST Primary culture cell CD34+ cells (ODF induction for 3 days) D6OST Primary culture cell CD34+ cells (ODF induction for 6 days) D9OST Primary culture cell CD34+ cells (ODF induction for 9 days) DFNES Primary culture cell Normal Human Dermal Fibroblasts (Neonatal Skin); NHDF-Neo NHDF2564 (Takara Shuzo #CC2509) FCBBF Tissue Brain, Fetal FEBRA Tissue Brain, Fetal (CLONTECH #64019-1) FEHRT Tissue Heart, Fetal (STARATAGENE #738012) FELNG Tissue Lung, Fetal (STARATAGENE #738020) HCASM Primary culture cell Human coronary artery smooth muscle cells HCASMC (Toyobo #T305K-05) HCHON Primary culture cell Human Chondrocytes HC (Toyobo #T402K-05) HEART Tissue Heart (CLONTECH #64025-1) HHDPC Primary culture cell Human dermal papilla cells HDPC (Toyobo #THPCK- 001) HLUNG Tissue Lung (CLONTECH #64023-1) IMR32 Culture cell IMR32 cells (ATCC #CCL-127) KIDNE Tissue Kidney (CLONTECH #64030-1) LIVER Tissue Liver (CLONTECH #64022-1) MAMGL Tissue Mammary Gland (CLONTECH #64037-1) MESAN Primary culture cell Normal human mesangial cells NHMC56046-2 (Takara Shuzo #CC2559) NESOP Tissue Esophagus (Invitrogen #D6060-01) NOVAR Tissue Adult Ovary (STARATAGENE #735260) NT2NE Culture cell NT2 cells concentrated after differenciation (NT2 Neuron) NT2RI Culture cell NT2 cells treated by growth inhibitor for 2 weeks after RA induction for 5 weeks NT2RP Culture cell NT2 cells treated by RA for 5 weeks NTONG Tissue Tongue OCBBF Tissue Brain, Fetal PANCR Tissue Pancreas (CLONTECH #64031-1) PEBLM Primary culture cell Human peripheral blood mononuclear cells HPBMC5939 (Takara Shuzo #CC2702) PERIC Tissue Pericardium (Invitrogen #D6105-01) PLACE Tissue Placenta PROST Tissue Prostate (CLONTECH #64038-1) PUAEN Primary culture cell Human pulmonary artery endothelial cells (Toyobo #T302K-05) RECTM Tissue Rectum (Invitrogen #D6110-01) SALGL Tissue Salivary Gland (CLONTECH #64026-1) SKMUS Tissue Skeletal Muscle (CLONTECH #64033-1) SKNMC Culture cell SK-N-MC cells (ATCC #HTB-10) SKNSH Culture cell SK-N-SH cells (RCB #RCB0426) SMINT Tissue Small Intestine (CLONTECH #64039-1) SPLEN Tissue Spleen (CLONTECH #64034-1) STOMA Tissue Stomach (CLONTECH #64090-1) SYNOV Tissue Synovial membrane tissue from rheumatioid arthritis TBAES Tissue Breast, Tumor (CLONTECH #64015-1) TCOLN Tissue Colon, Tumor (CLONTECH #64014-1) TESOP Tissue Esophageal, Tumor (Invitrogen #D6860-01) TESTI Tissue Testis (CLONTECH #64027-1) THYMU Tissue Thymus (CLONTECH #64028-1) TKIDN Tissue Kidney, Tumor (Invitrogen #D6870-01) TOVAR Tissue Ovary, Tumor (CLONTECH #64011-1) TRACH Tissue Trachea (CLONTECH #64091-1) TSTOM Tissue Stomach, Tumor (Invitrogen #D6920-01) TUTER Tissue Uterus, Tumor (CLONTECH #64008-1) UMVEN Primary culture cell Human umbilical vein endothelial cells HUVEC (Toyobo #T200K-05) UTERU Tissue Uterus (CLONTECH #64029-1)

The cDNA library with the high fullness ratio (the fullness ratio of 5′-end, which was calculated for each cDNA library by using the protein coding region found in known mRNA species as an index, was 90% in average) prepared by the improved oligo-capping method was constructed by using a eukaryotic expression vector pME18SFL3. The vector contains SR α promoter and SV40 small t intron in the upstream of the cloning site, and SV40 polyA added signal sequence site in the downstream. As the cloning site of pME18SFL3 has asymmetrical DraIII sites, and the ends of cDNA fragments contain SfiI sites complementary to the DraIII sites, the cloned cDNA fragments can be inserted into the downstream of the SR α promoter unidirectionally. Therefore, clones containing full-length cDNA can be expressed transiently by introducing the obtained plasmid directly into COS cells, etc. Thus, the clones can be analyzed very easily in terms of the proteins that are the gene products of the clones, or in terms of the biological activities of the proteins.

(3) Assessment of the 5′-end Completeness of Clones Derived from the cDNA Library Prepared by Oligo-Capping

With respect to the plasmid DNAs of clones derived from the libraries, the nucleotide sequences of cDNA 5′-ends (3′-ends as well in some cases) were determined in a DNA sequencer (ABI PRISM 3700, PE Biosystems), after sequencing reaction was conducted by using a DNA sequencing reagent (BigDye Terminator Cycle Sequencing FS Ready Reaction Kit, PE Biosystems) according to the manual. A database was constructed based on the obtained data.

The 5′-end completeness of about 1110,000 clones derived from the human cDNA libraries prepared by the improved oligo-capping method was determined by the following method. The clones whose 5′-end sequences were consistent with those of known human mRNA in the public database were judged to be “full-length” if they had a longer 5′-end sequence than that of the known human mRNA; or even though the 5′-end sequence was shorter, if it contained the translation initiation codon it was judged to have the “full-length” sequence. Clones which did not contain the translation initiation codon were judged to be “not-full-length”. The fullness ratio ((the number of full-length clones)/(the number of full-length and not-full-length clones)) at the 5′-end of the cDNA clones was determined by comparing with known human mRNA. As a result, the fullness ratio of the 5′-ends was 90%. The result indicates that the fullness ratio at the 5′-end sequence was extremely high in the human cDNA clones obtained by the oligo-capping method.

EXAMPLE 2 Sequencing Analysis of cDNA Ends and Selection of Full-Length Clones

With respect to the plasmid DNAs of clones obtained from each cDNA library, the 5′-end nucleotide sequences of the cDNAs were determined in a DNA sequencer (ABI PRISM 3700, PE Biosystems), after sequencing reaction was conducted by using a DNA sequencing reagent (Dye Terminator Cycle Sequencing FS Ready Reaction Kit, dRhodamine Terminator Cycle Sequencing FS Ready Reaction Kit or BigDye Terminator Cycle Sequencing FS Ready Reaction Kit, PE Biosystems) according to the manual. A database was constructed using the data obtained.

For the analyzed 5′-end sequences of cDNA clones, the data with the annotation of “complete cds” in the GenBank and UniGene were searched by BLAST homology search. When identical to certain human mRNA sequences, such cDNA clones were excluded. Then, clustering was carried out. When the identity was 90% or higher, and the length of consensus sequence was 50 base pairs or longer, the cDNA clones were assumed to belong to an identical cluster, and thus clustered. cDNA clones longer in the 5′ direction were selected from the members belonging to a cluster; if required, the 3′-end sequences of the selected clones were determined by the same analysis method as used to determine the 5′-end sequences. The data of the end sequences obtained were analyzed, and then the clones forming a sequence contig at 5′- and 3′-ends were excluded. Further, as mentioned above, the data was analyzed again by BLAST homology search; when identical to certain human mRNA sequences (including sequences patented and applied for), the cDNA clones were excluded. Thus, the cDNAs clones to be analyzed for their nucleotide sequence were obtained.

EXAMPLE 3 Analysis of the Full-Length Nucleotide Sequences

The full-length nucleotide sequences of the selected clones were determined. The nucleotide sequence determination was mainly performed by primer walking method comprising the dideoxy terminator method using custom-made synthetic DNA primers. Namely, the nucleotide sequences of the DNAs were determined in a sequencer from PE Biosystems, after sequencing reaction was carried out with a DNA sequencing reagent from the same supplier using the custom-made synthetic DNA primers according to the manual. A part of the clones were analyzed with a DNA sequencer from Licor.

Further, the nucleotide sequences of a part of the clones were determined by the shotgun method where the plasmids containing the cDNAs were digested at random were used, instead of the use of custom-made primers, by the same method in the DNA sequencer. The full-length nucleotide sequences were finally determined by completely assembling the partial nucleotide sequences obtained by the above method.

Then, the regions translatable to proteins were deduced from the determined full-length nucleotide sequences, and thereby the amino acid sequences were determined. SEQ ID NOs corresponding to the respective sequences are shown in Table 1.

EXAMPLE 4 Functional Prediction by Homology Search

For the determined nucleotide sequences, GenBank, SwissProt, UniGene, and nr were searched by BLAST. The clones exhibiting higher homology, which were convenient to predict their functions based on the nucleotide sequences and deduced amino acid sequences, were selected based on the BLAST search hit data whose P value or E value was 10−4 or lower and for which the length of consensus sequence×homology=30 or higher in the amino acid database search. Further, from them, representative clones were selected, which are shown as Homology Search Result Data in the last part herein. Accordingly, the data shown herein are merely the representative data, and the molecule exhibiting homology to each clone is not limited thereto. Further, with respect to a part of clones, the BLAST search hit data that did not meet the criteria as described above are not shown herein.

EXAMPLE 5 Search for Signal Sequence, Transmembrane Domain and Other Functional Domains in the Deduced Amino Acid Sequences

With respect to the amino acid sequences deduced from the full-length nucleotide sequences, the prediction was made for the presence of signal sequence at the amino terminus, the presence of transmembrane domain, and the presence of functional protein domains (motifs). The signal sequence at the amino terminus was searched for by PSORT [K. Nakai & M. Kanehisa, Genomics, 14: 897-911 (1992)]; the transmembrane domain, by SOSUI [T. Hirokawa et al., Bioinformatics, 14: 378-379 (1998)] (Mitsui Knowledge Industry); the function domain, by Pfam ( The amino acid sequence in which the signal sequence at the amino terminus or transmembrane domain had been predicted to be present by PSORT or SOSUI were assumed to be a secretory or membrane protein. Further, when the amino acid sequence hit a certain functional domain by the Pfam functional domain search, the protein function can be predicted based on the hit data, for example, by referring to the function categories on the PROSITE ( In addition, the functional domain search can also be carried out on the PROSITE.

The search results obtained with the respective programs are shown below.

The clones whose deduced amino acid sequences were detected to have the signal sequences by PSORT are as follows.

ADRGL20013520, ASTRO20005330, ASTRO20055750, BNGH420088500, BRACE20038000, BRACE20081720, BRACE20101710, BRACE20224480, BRACE20257100, BRACE20273890, BRALZ20013500, BRALZ20054710, BRALZ20077930, BRAMY20063970, BRAMY20284910, BRAWH20016860, BRAWH20064050, BRCOC10000870, BRCOC20078640, BRCOC20090520, BRCOC20101230, BRCOC20114180, BRCOC20121720, BRCOC20134480, BRCOC20136750, BRHIP20179200, BRHIP20198190, BRHIP20217620, BRSSN20003120, BRSSN20137020, COLON10001350, COLON20093370, CTONG20158660, CTONG20267700, D3OST20036070, D3OST20038560, D6OST20005070, FCBBF10001210, FCBBF10002430, FCBBF10003760, FCBBF10005740, FCBBF20042560, FCBBF30086440, FCBBF30095260, FCBBF30172550, FCBBF30238870, FEBRA20009090, FEBRA20029860, FEBRA20086620, FEBRA20092890, FEBRA20111460, FEBRA20130190, FEBRA20145780, FEBRA20235500, HCHON20064590, HCHON20067700, HCHON20086720, HEART20049410, HHDPC20001040, HHDPC20014320, KIDNE20011400, KIDNE20022620, KIDNE20126130, KIDNE20127450, LIVER20064690, MESAN10001260, MESAN20038510, MESAN20115970, MESAN20152770, MESAN20153910, NT2NE20118960, NT2NE20124480, NT2NE20183760, NT2RI20003480, NT2RI20023910, NT2RI20028470, NT2RI20040930, NT2RP70134990, NTONG20029700, NTONG20063010, OCBBF20019830, OCBBF20078920, OCBBF20086400, OCBBF20087010, OCBBF20116850, OCBBF20122620, OCBBF20130910, OCBBF20188730, PEBLM20075980, PLACE60086400, PROST20175290, SKNSH20028660, SMINT20009840, SMINT20022020, SMINT20073650, SMINT20095050, SMINT20105330, SMINT20127930, SMINT20153260, SMINT20157450, SMINT20173240, SMINT20178550, SMINT20191420, SMINT20192000, SPLEN20079510, SPLEN20095810, SPLEN20118300, SPLEN20141360, SPLEN20157880, SPLEN20171890, SPLEN20213830, STOMA20005390, STOMA20056640, STOMA20080500, STOMA20088380, SYNOV20001520, SYNOV20001730, SYNOV20002790, SYNOV20002970, SYNOV20004260, SYNOV20007000, SYNOV20008240, SYNOV20009230, SYNOV20010880, SYNOV20011110, SYNOV20013000, TESOP20005690, TESTI20123560, TESTI20208400, TESTI20211220, TESTI20272960, TESTI20309170, TESTI20316870, TESTI20385960, TESTI20390260, TESTI20391770, TESTI20396130, TESTI20415170, TESTI20421490, TESTI20441940, TESTI20444180, TESTI20463580, THYMU10005360, THYMU20027560, THYMU20032870, THYMU20039810, THYMU20066100, THYMU20106710, THYMU20111830, THYMU20161640, THYMU20162190, THYMU20194420, THYMU20222890, THYMU20241850, TKIDN20005210, TRACH20029540, TRACH20034840, TRACH20050040, TRACH20069180, TRACH20085400, TRACH20136710, TRACH20145440, TRACH20180840, UTERU20158300, UTERU20158800, UTERU20161570

The clones whose deduced amino acid sequences were detected to have the transmembrane domains by SOSUI are as follows. Numerals indicate the numbers of transmembrane domains detected in the deduced amino acid sequences. Of the search result, the clone name and the number of transmembrane domains are demarcated by a double slash mark (//).

ADIPS10000640//3, ADRGL20018540//1, ADRGL20035850//2, ASTRO20001410//1, ASTRO20005330//3, ASTRO20058630//4, ASTRO20190390//1, BEAST20004540//1, BGGI110000240//2, BRACE20006400//1, BRACE20038470//1, BRACE20039040//1, BRACE20039540//1, BRACE20051380//1, BRACE20059370//1, BRACE20061050//1, BRACE20063630//2, BRACE20067430//1, BRACE20069090//2, BRACE20101700//2,

BRACE20116110//2, BRACE20147800//1, BRACE20153680//5, BRACE20163350//1, BRACE20179340//6, BRACE20188470//4, BRACE20195100//1, BRACE20201570//1, BRACE20210140//1, BRACE20224480//1, BRACE20224500//1, BRACE20228480//1, BRACE20232840//1, BRACE20238000//2, BRACE20274080//1, BRALZ20013500//2, BRALZ20064740//1, BRALZ20069760//3, BRALZ20073760//3, BRAMY20000860//2,

BRAMY20002770//2, BRAMY20025840//1, BRAMY20039260//3, BRAMY20060920//1, BRAMY20063970//3, BRAMY20111960//1, BRAMY20112800//2, BRAMY20134140//2, BRAMY20135900//1, BRAMY20136210//1, BRAMY20144620//3, BRAMY20152110//1, BRAMY20174550//4, BRAMY20181220//2, BRAMY20195090//1, BRAMY20211390//1, BRAMY20211420//10, BRAMY20215230//1, BRAMY20218250//10, BRAMY20218670//3,

BRAMY20229800//1, BRAMY20231720//1, BRAMY20247280//1, BRAMY20252180//2, BRAMY20273960//1, BRAMY20277170//5, BRAWH20015350//1, BRAWH20015890//2, BRAWH20016860//3, BRAWH20018730//10, BRAWH20030250//4, BRAWH20110790//3, BRAWH20121640//11, BRAWH20122580//2, BRAWH20132190//2, BRCAN20064010//2, BRCAN20071190//1, BRCAN20091560//1, BRCAN20103740//1, BRCAN20224720//1,

BRCAN20273550//5, BRCAN20280360//6, BRCAN20285450//2, BRCOC20004040//4, BRCOC20006370//2, BRCOC20041750//1, BRCOC20077690//2, BRCOC20090520//1, BRCOC20091960//2, BRCOC20101230//6, BRCOC20107300//1, BRCOC20114180//3, BRCOC20121720//7, BRCOC20134480//3, BRCOC20136750//2, BRHIP20000870//2, BRHIP20003120//3, BRHIP20111200//1, BRHIP20118380//1, BRHIP20118910//2,

BRHIP20121410//3, BRHIP20135100//1, BRHIP20183690//9, BRHIP20191490//2, BRHIP20191770//1, BRHIP20207430//1, BRHIP20208270//1, BRHIP20208590//2, BRHIP20217620//1, BRHIP20233090//1, BRHIP20234380//1, BRHIP20238880//1, BRHIP20283030//1, BRSSN20003120//7, BRSSN20043040//2, BRSSN20066110//2, BRSSN20137020//2, BRSSN20142940//1, BRSSN20146100//3, BRSSN20151990//2,

BRSSN20169050//2, BRSTN20002200//1, BRTHA20046290//2, BRTHA20046420//5, CTONG10000100//6, CTONG10000940//1, CTONG10001650//1, CTONG20004690//5, CTONG20092570//7, CTONG20092580//2, CTONG20095340//5, CTONG20099380//2, CTONG20103480//1, CTONG20105080//9, CTONG20114290//2, CTONG20114740//3, CTONG20119200//2, CTONG20120770//1, CTONG20124220//3, CTONG20124730//1,

CTONG20131490//1, CTONG20132220//1, CTONG20133480//2, CTONG20139340//2, CTONG20149950//1, CTONG20155400//1, CTONG20158660//9, CTONG20161850//2, CTONG20267700//1, D3OST10001090//5, D3OST20036070//1, D3OST20038560//1, D3OST30002580//2, D9OST20002780//2, D9OST20015470//2, D9OST20026730//1, D9OST20040180//7, DFNES20025880//1, FCBBF10000240//8, FCBBF10000380//1,

FCBBF10001150//1, FCBBF10001210//2, FCBBF10001550//1, FCBBF10002700//2, FCBBF10003220//1, FCBBF10005460//1, FCBBF20032970//1, FCBBF20042560//3, FCBBF20051220//2, FCBBF30008470//2, FCBBF30012350//1, FCBBF30024750//1, FCBBF30078290//1, FCBBF30086440//3, FCBBF30090690//1, FCBBF30095260//2, FCBBF30123470//3, FCBBF30172550//1, FCBBF30175310//9, FCBBF30190850//1,

FCBBF30215060//4, FCBBF30238870//1, FCBBF30251420//1, FCBBF30279030//5, FEBRA20002100//5, FEBRA20037260//1, FEBRA20080810//5, FEBRA20093520//1, FEBRA20095880//1, FEBRA20111460//1, FEBRA20125070//1, FEBRA20130190//1, FEBRA20140100//3, FEBRA20145780//2, FEBRA20211710//1, FEBRA20229630//3, FEBRA20235500//10, HCHON20000380//2, HCHON20007510//1, HCHON20008180//1,

HCHON20016650//7, HCHON20035130//1, HCHON20040020//1, HCHON20067700//1, HCHON20068710//4, HEART20003060//1, HEART20005410//1, HEART20034320//2, HEART20049800//1, HEART20072310//2, HHDPC10000830//3, HHDPC20001040//1, HHDPC20014320//1, HHDPC20034720//1, HHDPC20068620//1, HHDPC20084140//1, HHDPC20091780//2, HLUNG10000550//2, KIDNE20003940//10, KIDNE20007770//2,

KIDNE20021910//4, KIDNE20022620//1, KIDNE20100070//2, KIDNE20101510//2, KIDNE20109730//2, KIDNE20121880//5, KIDNE20125630//2, KIDNE20126010//1, KIDNE20130450//2, KIDNE20131580//7, KIDNE20137340//4, KIDNE20181660//1, LIVER20035110//1, LIVER20045650//1, LIVER20062510//1, LIVER20075680//1, LIVER20087060//1, LIVER20091180//1, MESAN20014500//6, MESAN20027090//2,

MESAN20038510//1, MESAN20089360//1, MESAN20103120//5, MESAN20115970//4, MESAN20139360//1, MESAN20153910//1, NOVAR20000380//1, NT2NE20010050//1, NT2NE20021620//1, NT2NE20118960//4, NT2NE20131890//1, NT2NE20132170//9, NT2NE20155110//1, NT2NE20156260//1, NT2NE20159740//3, NT2NE20177520//2, NT2RI20023910//2, NT2RI20025400//2, NT2RI20054050//8, NT2RI20076290//8,

NT2RI20086220//4, NT2RI20091940//3, NT2RI20244600//6, NT2RP70072690//1, NT2RP70081610//6, NT2RP70122910//2, NT2RP70125160//3, NT2RP70133740//4, NT2RP70137290//1, NT2RP70179710//1, NT2RP70188020//1, NTONG20028070//1, NTONG20048060//1, NTONG20049910//1, NTONG20051530//1, NTONG20061870//1, NTONG20067830//1, NTONG20092330//2, OCBBF10001750//2, OCBBF20013890//3,

OCBBF20023570//1, OCBBF20026630//1, OCBBF20037440//1, OCBBF20050770//1, OCBBF20059560//2, OCBBF20063320//1, OCBBF20072320//1, OCBBF20080050//2, OCBBF20086400//1, OCBBF20086910//1, OCBBF20088140//1, OCBBF20091150//1, OCBBF20107090//2, OCBBF20116850//2, OCBBF20120390//12, OCBBF20130910//2, OCBBF20132850//3, OCBBF20155060//2, OCBBF20178880//1, OCBBF20180120//10,

OCBBF20180840//1, PANCR10000910//3, PEBLM20024320//2, PEBLM20040150//2, PEBLM20074370//1, PERIC20004220//4, PLACE60121080//1, PLACE60161600//2, PLACE60177140//6, PROST20005050//1, PROST20050670//1, PROST20107820//4, PROST20116600//2, PROST20120160//1, PROST20127800//3, PROST20146010//3, PROST20164440//3, PROST20169800//1, PROST20170980//1, PROST20191640//1,

PUAEN20003740//2, PUAEN20030180//2, SALGL10001710//5, SKMUS20007800//7, SKMUS20011640//3, SKMUS20020840//3, SKMUS20028210//1, SKMUS20028400//1, SKMUS20077400//1, SKNSH20031740//1, SKNSH20051940//1, SKNSH20063040//3, SMINT20011990//1, SMINT20022020//4, SMINT20029760//1, SMINT20040860//7, SMINT20049090//1, SMINT20053870//1, SMINT20095050//2, SMINT20100680//1,

SMINT20105330//1, SMINT20144890//1, SMINT20157450//5, SMINT20173240//3, SMINT20178550//3, SMINT20192000//1, SPLEN20003070//2, SPLEN20008740//4, SPLEN20026950//1, SPLEN20029310//3, SPLEN20095810//1, SPLEN20097330//1, SPLEN20118300//9, SPLEN20141360//1, SPLEN20141990//1, SPLEN20144520//3, SPLEN20152760//2, SPLEN20157880//1, SPLEN20165310//1, SPLEN20167200//1,

SPLEN20169220//2, SPLEN20169720//1, SPLEN20171890//4, SPLEN20172120//2, SPLEN20186430//6, SPLEN20211570//2, SPLEN20211940//3, SPLEN20213830//2, SPLEN20273950//1, SPLEN20292950//7, SPLEN20293800//4, SPLEN20304950//2, SPLEN20329240//1, STOMA20006780//2, STOMA20008880//1, STOMA20051200//1, STOMA20056670//1, STOMA20062130//1, STOMA20077450//2, STOMA20080500//4,

SYNOV20013560//1, SYNOV30001840//4, TBAES20003150//2, TESOP20005690//3, TESTI20001720//3, TESTI20036380//6, TESTI20037560//1, TESTI20082330//1, TESTI20094120//8, TESTI20110280//1, TESTI20123080//1, TESTI20123560//3, TESTI20128350//1, TESTI20136100//2, TESTI20136710//2, TESTI20143390//8, TESTI20148000//1, TESTI20164100//3, TESTI20193360//1, TESTI20209810//1,

TESTI20209990//1, TESTI20214250//2, TESTI20230250//1, TESTI20231940//1, TESTI20237520//2, TESTI20242990//2, TESTI20254220//7, TESTI20254860//1, TESTI20265970//2, TESTI20271850//2, TESTI20272960//8, TESTI20284880//2, TESTI20291310//4, TESTI20291960//5, TESTI20303360//1, TESTI20303420//1, TESTI20307700//2, TESTI20316870//1, TESTI20333000//2, TESTI20347180//6,

TESTI20347300//1, TESTI20355020//1, TESTI20357960//1, TESTI20370810//9, TESTI20373820//1, TESTI20383880//1, TESTI20390410//1, TESTI20391770//3, TESTI20393530//1, TESTI20397760//2, TESTI20401280//1, TESTI20422640//2, TESTI20441940//5, TESTI20444130//1, TESTI20449200//6, TESTI20463520//1, TESTI20463580//1, THYMU20027560//4,

THYMU20032870//1, THYMU20039810//3, THYMU20100410//2, THYMU20106710//1, THYMU20111830//1, THYMU20141670//1, THYMU20147770//1, THYMU20159430//1, THYMU20161640//4, THYMU20162190//2, THYMU20173980//2, THYMU20208300//1, THYMU20216840//2, THYMU20229220//1, THYMU20241850//2, THYMU20277390//7, TRACH20002870//3, TRACH20003590//1, TRACH20016210//1, TRACH20029540//1, TRACH20033230//6, TRACH20042920//6,

TRACH20050040//2, TRACH20068660//6, TRACH20076740//4, TRACH20085400//2, TRACH20085830//1, TRACH20109650//2, TRACH20111130//1, TRACH20128110//5, TRACH20134950//1, TRACH20140820//1, TRACH20145440//1, TRACH20168350//1, UMVEN20000690//1, UTERU20030570//5, UTERU20040610//1, UTERU20055480//2, UTERU20076390//4, UTERU20094350//1, UTERU20135860//2, UTERU20158300//3,

UTERU20158800//2, UTERU20161570//6, UTERU20178100//1, UTERU20186740//1

The Names of clones whose deduced amino acid sequences were detected to have functional domains with Pfam, and the name of hit functional domains are as follows. The search result is indicated as “clone name//functional domain name”. When the clone has multiple hit functional domains, they are listed and demarcated by a double slash mark (//). When the clone has multiple hits of an identical functional domain, each is listed without abridgment.

3NB6910001910//tRNA synthetases class II (A)// tRNA synthetases class II (A)// DHHA1 domain

3NB6920014590//Homeobox domain

ADIPS20004250//Zinc finger, C2H2 type// DNA binding domain with preference for// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// TRAF-type zinc finger// Zinc finger, C2H2 type// UvrD/REP helicase// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

ADRGL10001470//Cytochrome P450//Cytochrome P450

ADRGL20011190//Calponin homology (CH) domain// Calponin homology (CH) domain// Pou domain-N-terminal to homeobox domain

ADRGL20018300//TPR Domain// TPR Domain// TPR Domain// TPR Domain// PPR repeat// TPR Domain

ADRGL20035850//Cytochrome P450

ADRGL20048330//PHD-finger// Rabphilin-3A effector domain// C2 domain// C2 domain

ASTRO20008010//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

ASTRO20012490//Eukaryotic initiation factor 1A

ASTRO20027430//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat

ASTRO20033160//Mitochondrial carrier proteins// Mitochondrial carrier proteins// Mitochondrial carrier proteins

ASTRO20055750//Collagen triple helix repeat (20 copies)// Heavy-metal-associated domain

ASTRO20058630//Vacuolar sorting protein 9 (VPS9) domain

ASTRO20064750//Zinc finger, C2H2 type// Nuclear transition protein 2

ASTRO20072210//PDZ domain (Also known as DHR or GLGF).

ASTRO20084250//KH domain// Zinc finger, C3HC4 type (RING finger)

ASTRO20105820//FAD binding domain

ASTRO20106150//Calpain family cysteine protease// Calpain large subunit, domain III


ASTRO20125520//DnaJ domain

ASTRO20130500//ThiF family// Repeat in ubiquitin-activating (UBA) pro

ASTRO20143630//KH domain// Bacterial regulatory proteins, crp family

ASTRO20155290//TPR Domain// TPR Domain// TPR Domain

ASTRO20168470//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// TRAF-type zinc finger// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type

BGGI110001930//UBX domain

BGGI120006160//Fumarylacetoacetate (FAA) hydrolase fam

BLADE20003400//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type

BLADE20003890//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Src homology domain 2//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Src homology domain 2//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

BNGH420088500//SAM domain (Sterile alpha motif)

BRACE20003070//SAM domain (Sterile alpha motif)

BRACE20011070//F-box domain.

BRACE20027620//Dienelactone hydrolase family// Dienelactone hydrolase family

BRACE20038000//ATP synthase, Delta/Epsilon chain// Dual specificity phosphatase, catalytic d

BRACE20039540//Immunoglobulin domain// Adenovirus E3 region protein CR2

BRACE20050900//TPR Domain// TPR Domain// TPR Domain// TPR Domain

BRACE20052160//SAM domain (Sterile alpha motif)

BRACE20053280//PDZ domain (Also known as DHR or GLGF).

BRACE20053480//Ribosomal protein L22p/L17e// Glycosyl hydrolases family 38

BRACE20053630//Plant thionins// Mitochondrial carrier proteins// Mitochondrial carrier proteins

BRACE20057620//Eukaryotic initiation factor 4E

BRACE20058580//L1 (late) protein

BRACE20059370//FERM domain (Band 4.1 family)

BRACE20060550//Ank repeat// Ank repeat// Ank repeat// PEP-utilizing enzymes

BRACE20060720//WD domain, G-beta repeat// WD domain, G-beta repeat

BRACE20060890//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// TRAF-type zinc finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type

BRACE20062640//Alanine racemase// RNB-like proteins

BRACE20063780//NOL1/NOP2/sun family

BRACE20064880//KH domain// KH domain// KH domain

BRACE20068590//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

BRACE20096200//Sir2 family// Sir2 family

BRACE20107530//short chain dehydrogenase

BRACE20115920//Spectrin repeat// Fes/CIP4 homology domain// Interleukin 10

BRACE20148240//Ras family

BRACE20151320//Zinc finger, C3HC4 type (RING finger)

BRACE20153680//Sir2 family// Ion transport protein

BRACE20163350//Immunoglobulin domain// Immunoglobulin domain

BRACE20177200//RanBP1 domain.

BRACE20188470//ABC transporter// Thymidylate kinase

BRACE20190040//Integrase DNA binding domain

BRACE20192440//Translation initiation factor IF-3

BRACE20223330//3′-5′ exonuclease// Adenylylsulfate kinase// Protein of unknown function DUF82.

BRACE20232840//4Fe-4S binding domain// ABC transporter// ABC transporter// ATPases associated with various cellular act

BRACE20240740//Ribosomal protein L36

BRACE20253330//PDZ domain (Also known as DHR or GLGF).

BRACE20269200//Heat-labile enterotoxin alpha chain

BRACE20273890//UBA domain

BRACE20284100//Polysaccharide lyase family 8

BRACE20286360//Alpha adaptin carboxyl-terminal domain

BRALZ20013500//Keratin, high sulfur B2 protein// u-PAR/Ly-6 domain

BRALZ20054710//Zinc finger, C3HC4 type (RING finger)// TRAF-type zinc finger

BRALZ20058880//STAT protein

BRALZ20077930//Ribosomal protein S27a

BRAMY20000520//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

BRAMY20002770//DB module

BRAMY20025840//Sec7 domain

BRAMY20045240//Flagellar L-ring protein

BRAMY20054880//Pou domain-N-terminal to homeobox domain

BRAMY20103570//DNA binding domain with preference for A/T r

BRAMY20104640//Eukaryotic protein kinase domain// Protein kinase C terminal domain

BRAMY20111960//Ribosomal protein L36

BRAMY20121620//TPR Domain// TPR Domain// TPR Domain// TPR Domain// PPR repeat

BRAMY20124260//ZU5 domain// Death domain

BRAMY20148130//WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// TBC domain

BRAMY20153110//ACT domain// Biopterin-dependent aromatic amino acid hydroxylase

BRAMY20157820//Kinesin motor domain

BRAMY20162510//MAGE family

BRAMY20167060//Collagen triple helix repeat (20 copies)

BRAMY20174550//ABC transporter transmembrane region.// Phosphoribulokinase// Adenylylsulfate kinase// FtsK/SpoIIIE family// ABC transporter

BRAMY20211390//Zinc finger, C3HC4 type (RING finger)

BRAMY20211420//Transient receptor// GGL domain

BRAMY20213100//LIM domain containing proteins// GATA zinc finger// ‘Paired box’ domain


BRAMY20217460//EF hand// EF hand// EF hand

BRAMY20218250//Ion transport protein// Sir2 family// Ion transport protein

BRAMY20240040//Nuclear transition protein 2

BRAMY20245300//Fanconi anaemia group C protein// Metallo-beta-lactamase superfamily

BRAMY20248490//Sodium:sulfate symporter transmembrane

BRAMY20260910//Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

BRAMY20270730//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C3HC4 type (RING finger)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

BRAMY20271400//Phorbol esters/diacylglycerol binding dom// PHD-finger

BRAMY20277170//K+ channel tetramerisation domain// NADH-ubiquinone/plastoquinone oxidoreduc// Ion transport protein// Transmembrane region cyclic Nucleotide G

BRAMY20285160//NTR/C345C module

BRAWH20002320//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat

BRAWH20011710//Ank repeat// Ank repeat// Ank repeat// CAP-Gly domain// CAP-Gly domain

BRAWH20012390//EF hand// EF hand// EF hand

BRAWH20016620//Eukaryotic protein kinase domain// EIAV coat protein, gp90

BRAWH20018730//Sugar (and other) transporter

BRAWH20028110//4Fe-4S binding domain// LIM domain containing proteins// LIM domain containing proteins// LIM domain containing proteins// LIM domain containing proteins// Villin headpiece domain

BRAWH20030250//jmjN domain

BRAWH20064050//Sushi domain (SCR repeat)// EGF-like domain// Trypsin Inhibitor like cysteine rich domain// EGF-like domain// Granulins// Granulins// EGF-like domain

BRAWH20075700//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

BRAWH20096780//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type


BRAWH20103290//CRAL/TR10 domain.// Spectrin repeat// Extracellular link domain// RhoGEF domain// PH domain

BRAWH20110960//PCI domain

BRAWH20112940//Similarity to lectin domain of ricin beta-chain, 3 copies.

BRAWH20114000//Glutamate/Leucine/Phenylalanine/Valine dehydrogenase


BRAWH20118230//Transforming growth factor beta like domain

BRAWH20121640//eubacterial secY protein// Transmembrane amino acid transporter protein

BRAWH20132190//Acetyltransferase (GNAT) family

BRAWH20137480//Villin headpiece domain

BRAWH20138660//Adaptor complexes medium subunit family

BRAWH20149340//IQ calmodulin-binding motif// RhoGEF domain

BRAWH20164460//Sigma-54 interaction domain// ATPases associated with various cellular activities (AAA)

BRAWH20171030//Adenylate kinase// NB-ARC domain// ATPases associated with various cellu

BRAWH20185060//Integrase core domain

BRCAN10001490//‘chromo’ (CHRromatin Organization MOdifier)


BRCAN20071190//Ubiquitin family// UBX domain

BRCAN20091560//Rieske [2Fe-2S] domain// Phosphoglucose isomerase// FAD binding domain// Pyridine nucleotide-disulphide oxidoreductase// Phytoene dehydrogenase related enzyme

BRCAN20124080//WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat

BRCAN20273550//FATC domain

BRCAN20273640//Formin Homology 2 Domain

BRCAN20280210//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

BRCAN20280360//PAP2 superfamily

BRCOC20001860//FliP family// Glycosyl hydrolase family 47

BRCOC20004040//7 transmembrane receptor (rhodopsin family)// Neurohypophysial hormones, C-terminal Domain

BRCOC20006370//Plexin repeat

BRCOC20008160//Spectrin repeat// Spectrin repeat// Tropomyosins// Spectrin repeat// Adenylate cyclase// Spectrin repeat// FF domain// Spectrin repeat// Spectrin repeat// Spectrin repeat

BRCOC20008500//Vacuolar sorting protein 9 (VPS9) domain// Ras association (RalGDS/AF-6) domain

BRCOC20023230//Reverse transcriptase (RNA-dependent DNA polymerase)

BRCOC20026640//Gag P30 core shell protein

BRCOC20027510//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat

BRCOC20031250//Triosephosphate isomerase

BRCOC20035130//14-3-3 proteins

BRCOC20037320//Apolipoprotein A1/A4/E family

BRCOC20055420//Helix-loop-helix DNA-binding domain// Myristoyl-CoA

BRCOC20074760//Herpesvirus UL25 family// Beige/BEACH domain

BRCOC20110100//Integrase core domain


BRCOC20144000//Helicases conserved C-terminal domain

BRCOC20178270//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

BRCOC20178560//LIM domain containing proteins// LIM domain containing proteins// LIM domain containing proteins// Ribosomal protein L24e// LIM domain containing proteins

BRHIP10001290//Ribosomal protein S3, C-terminal domai// Similarity to lectin domain of ricin b

BRHIP20001630//Protein of unknown function DUF16

BRHIP20003120//Dehydrins// Reticulon

BRHIP20005530//ThiF family

BRHIP20096850//ICE-like protease (caspase) p20 domain// Aminotransferases class-I

BRHIP20115080//PH domain

BRHIP20118910//Fibronectin type I domain

BRHIP20119330//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// TRAF-type zinc finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

BRHIP20132860//PDZ domain (Also known as DHR or GLGF).

BRHIP20143730//MYND finger

BRHIP20153600//RNA recognition motif. (a.k.a. RRM, RBD, or

BRHIP20174040//GAF domain// GAF domain// Transposase, Mutator family//3′5′-cyclic nucleotide phosphodiesterase

BRHIP20176420//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

BRHIP20183690//DEAD/DEAH box helicase// Integral membrane protein DUF6// Integral membrane protein DUF7

BRHIP20189980//bZIP transcription factor

BRHIP20191860//Helix-loop-helix DNA-binding domain

BRHIP20207990//Phorbol esters/diacylglycerol binding dom// Zinc finger, C3HC4 type (RING finger)// PHD-finger

BRHIP20222280//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

BRHIP20236950//Outer Capsid protein VP4 (Hemagglutinin)

BRHIP20238600//WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat

BRHIP20238880//wnt family of developmental signaling protei

BRHIP20249110//Hexokinase// Hexokinase

BRHIP20252450//Spectrin repeat// Spectrin repeat// Spectrin repeat// Phosphoenolpyruvate carboxykinase// Spectrin repeat// Spectrin repeat// Spectrin repeat// eRF1-like proteins// Spectrin repeat

BRHIP20253660//SH3 domain

BRHIP20283030//Cadherin domain// Cadherin domain// Cadherin domain// Cadherin domain// Cadherin domain// Cadherin domain// Cadherin domain// Cadherin domain

BRHIP20285830//Intermediate filament proteins

BRHIP30004570//Sushi domain (SCR repeat)// Sushi domain (SCR repeat)// Sushi domain (SCR repeat)// Sushi domain (SCR repeat)

BRHIP30004880//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Fibronectin type III domain// Fibronectin type III domain

BRSSN20003120//7 transmembrane receptor (metabotropic gluta

BRSSN20013420//Histone deacetylase family// Zn-finger in ubiquitin-hydrolases and o

BRSSN20014260//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat

BRSSN20015790//Pyridoxal-dependent decarboxylase

BRSSN20021600//BTB/POZ domain// Kelch motif// Kelch motif// Kelch motif// Kelch motif// Kelch motif// Kelch motif

BRSSN20038200//Guanine nucleotide exchange factor for Ras-like GTPases; N-terminal motif// Initiator RepB protein// RasGEF domain

BRSSN20039370//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type

BRSSN20046790//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type

BRSSN20101100//‘Cold-shock’ DNA-binding domain

BRSSN20105870//ATPases associated with various cellular activities (AAA)

BRSSN20117990//short chain dehydrogenase


BRSSN20146100//Adenylate and Guanylate cyclase catalytic domain// Adenylate and Guanylate cyclase catalytic domain// Zinc finger, C4 type (two domains)// Adenylate and Guanylate cyclase catalytic domain

BRSSN20176820//Wiskott Aldrich syndrome homology region 2


BRSSN20187310//Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat

BRSTN10000830//Kelch motif// Kelch motif// Kelch motif// Kelch motif

BRSTN20005360//TPR Domain// TPR Domain

BRTHA20000570//Reverse transcriptase (RNA-dependent DNA pol

BRTHA20004740//Phosphoglycerate kinases// lactate/malate dehydrogenase// Flavoprotein// short chain dehydrogenase// Zinc-binding dehydrogenases

BRTHA20046290//Transmembrane 4 family CD34C30004240//RhoGAP domain

COLON10001350//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

CTONG10000220//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat

CTONG10000620//Sec7 domain// PH domain// Josephin

CTONG10000930//Armadillo/beta-catenin-like repeats

CTONG10000940//Ank repeat// Ank repeat// Ank repeat

CTONG10002770//Calponin homology (CH) domain// Calponin homology (CH) domain

CTONG20009770//Proteasome/cyclosome repeat// Proteasome/cyclosome repeat// Proteasome/cyclosome repeat// Proteasome/cyclosome repeat// Proteasome/cyclosome repeat// Proteasome/cyclosome repeat//Proteasome/cyclosome repeat

CTONG20014280//WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat

CTONG20027090//Glypican// Leucine Rich Repeat// Leucine Rich Repeat

CTONG20050280//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// TRAF-type zinc finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

CTONG20075860//Ribulose bisphosphate carboxylase, smal

CTONG20076130//Hepatitis C virus non-structural protein NS2

CTONG20085950//SCAN domain// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

CTONG20092570//Integral membrane protein DUF6//Uncharacterized protein family UPF0005

CTONG20092700//BTB/POZ domain

CTONG20093950//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

CTONG20095340//E1-E2 ATPase



CTONG20099550//GGL domain

CTONG20105080//Integral membrane protein DUF6

CTONG20106520//Pyridoxal-phosphate dependent enzyme

CTONG20114290//Apolipoprotein A1/A4/E family

CTONG20118150//WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat

CTONG20118250//Eukaryotic-type carbonic anhydrase

CTONG20121010//Zinc finger, C2H2 type// CONSTANS family zinc finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

CTONG20121580//Kinesin motor domain// FHA domain// Histidine carboxylase PI chain

CTONG20124010//WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat

CTONG20125640//Ribosomal protein L10//60s Acidic ribosomal protein

CTONG20128430//Beta/Gamma crystallin// Beta/Gamma crystallin// Beta/Gamma crystallin// Beta/Gamma crystallin// Beta/Gamma crystallin// Similarity to lectin domain of ricin b

CTONG20129960//F-box domain.// UvrD/REP helicase// UvrD/REP helicase// Viral (Superfamily 1) RNA helicase

CTONG20131560//PDZ domain (Also known as DHR or GLGF).

CTONG20133390//Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C3HC4 type (RING finger)// Zinc finger, C2H2 type// Zinc finger, C2H2 type

CTONG20133520//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

CTONG20139860//Ank repeat// Ank repeat// Ank repeat

CTONG20140580//Domain of unknown function DUF25//SNF2 and others N-terminal domain// SNF2 and others N-terminal domain// Small cytokines (intecrine/chemokine), inter

CTONG20143690//MYND finger

CTONG20146300//Reverse transcriptase (RNA-dependent DNA pol

CTONG20149460//BTB/POZ domain// Kelch motif// Kelch motif// Kelch motif// Domain of unknown function// Kelch motif// Kelch motif// Kelch motif

CTONG20153300//C. elegans Srg family integral membrane prote// TBC domain

CTONG20153580//F-box domain.// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat

CTONG20155180//RNA helicase

CTONG20156780//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

CTONG20158040//UTP-glucose-1-phosphate uridylyltransferase

CTONG20158660//Latrophilin/CL-1-like GPS domain//7 transmembrane receptor (Secretin family)


CTONG20160560//DNA binding domain with preference for A/T rich regions

CTONG20161850//Immunoglobulin domain

CTONG20165050//Keratin, high sulfur B2 protein

CTONG20186320//Kelch motif// Kelch motif// Kelch motif// Kelch motif

CTONG20200310//RNB-like proteins

D3OST20006180//Dual specificity phosphatase, catalytic domain

D3OST20036070//Leucine Rich Repeat

D9OST20023970//Glycosyl hydrolases family 18//Glycosyl-hydrolases family 18

D9OST20026730//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat

D9OST20033970//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Putative zinc finger in N-recognin// Zinc finger, C2H2 type// Zinc finger, C2H2 type

D9OST20035940//Mitochondrial carrier proteins// Mitochondrial carrier proteins

D9OST20040180//7 transmembrane receptor (rhodopsin family)

DFNES20037420//Elongation factor Tu family

DFNES20071130//Phosphotriesterase family// Phosphotriesterase family// Phosphotriesterase family

FCBBF10000240//Phosphoenolpyruvate carboxylase// Bacterial Cytochrome Ubiquinol Oxidas// Glycosyl transferase

FCBBF10000630//Molluscan rhodopsin C-terminal tail// WW domain

FCBBF10001150//Cadherin domain// Cadherin domain// Cadherin domain// Cadherin domain// Cadherin domain

FCBBF10001210//Immunoglobulin domain// Immunoglobulin domain

FCBBF10001550//Glutamate/Leucine/Phenylalanine/Valine dehydrogenase

FCBBF10001710//DM DNA binding domain// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

FCBBF10002800//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

FCBBF10003670//Ubiquitin carboxyl-terminal hydrolases famil

FCBBF10003770//PDZ domain (Also known as DHR or GLGF).// PDZ domain (Also known as DHR or GLGF).// pf kB family carbohydrate kinase// PDZ domain (Also known as DHR or GLGF).// ThiC family// PDZ domain (Also known as DHR or GLGF).// PDZ domain (Also known as DHR or GLGF).// PDZ domain (Also known as DHR or GLGF).// TIR domain

FCBBF10004120//RNA recognition motif. (a.k.a. RRM, RBD, or

FCBBF10004370//KRAB box// Zinc finger, C2H2 type// Ribosomal protein L37e// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

FCBBF10005060//CRAL/TRIO domain.

FCBBF10005460//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Fibronectin type III domain// Fibronectin type III domain

FCBBF10005500//Keratin, high sulfur B2 protein

FCBBF10005740//Mitochondrial carrier proteins// Mitochondrial carrier proteins

FCBBF20014270//Acyl CoA binding protein

FCBBF20042170//Fibrillar collagen C-terminal domain

FCBBF20049300//Olfactomedin-like domain

FCBBF20059090//Zinc finger, C2H2 type

FCBBF20064520//RNA recognition motif. (a.k.a. RRM, RBD, or

FCBBF20067810//Nerve growth factor family// GTP1/OBG family// GTP1/OBG family// GTPase of unknown function// ADP-ribosylation factor family// Ras family

FCBBF20068820//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

FCBBF30010810//KRAB box// Rieske [2Fe-2S] domain// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

FCBBF30012350//Eukaryotic protein kinase domain

FCBBF30012810//Ubiquitin carboxyl-terminal hydrolases famil

FCBBF30015940//Methyl-accepting chemotaxis protein (MCP) signaling domain

FCBBF30016320//SecA protein, amino terminal region

FCBBF30018550//Oxysterol-binding protein

FCBBF30025560//Prolyl oligopeptidase family// Pou domain-N-terminal to homeobox doma// Homeobox domain

FCBBF30033050//Sm protein

FCBBF30039020//Herpesvirus UL6 like// Growth-Arrest-Specific Protein 2 Domain

FCBBF30049550//Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Glutamine amidotransferases class-II// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// ZU5 domain

FCBBF30054440//PLAT/LH2 domain

FCBBF30057290//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

FCBBF30078290//DNA binding domain with preference for A/T r

FCBBF30086440//Pilin (bacterial filament)

FCBBF30090690//Leucine rich repeat N-terminal domain// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine rich repeat C-terminal domain

FCBBF30095260//DHHC zinc finger domain

FCBBF30129630//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

FCBBF30175310//C1q domain// CDP-alcohol phosphatidyltransferase

FCBBF30190850//Sushi domain (SCR repeat)// Sushi domain (SCR repeat)// Sushi domain (SCR repeat)// Keratin, high sulfur B2 protein// Sushi domain (SCR repeat)// Phosphate transporter family

FCBBF30195640//PHD-finger// CONSTANS family zinc finger// PHD-finger// PHD-finger// Hsp20/alpha crystallin family

FCBBF30225660//Ank repeat// Ank repeat// Ank repeat// K+ channel tetramerisation domain// BTB/POZ domain

FCBBF30233680//G10 protein

FCBBF30238870//Laminin G domain// Thrombospondin N-terminal-like domains// Laminin G domain// von Willebrand factor type C domain// von Willebrand factor type C domain// EGF-like domain// EB module// EGF-like domain// EGF-like domain// Trypsin Inhibitor like cysteine rich domain// Metallothionein// EGF-like domain// EGF-like domain// EGF-like domain

FCBBF30240960//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

FCBBF30246630//Leucine Rich Repeat// Leucine Rich Repeat

FCBBF30247930//Uncharacterized protein family UPF0004

FCBBF30262510//Ank repeat// Fibronectin type III domain

FCBBF30281880//Regulator of G protein signaling domain// PX domain

FCBBF30285280//Keratin, high sulfur B2 protein// Bacterial regulatory proteins, gntR family

FCBBF40001730//WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat

FEBRA10001880//Eukaryotic protein kinase domain// Eukaryotic protein kinase domain

FEBRA10001900//Zinc finger, C2H2 type


FEBRA20007620//Bacterial type II secretion system protein// DEAD/DEAH box helicase// Helicases conserved C-terminal domain

FEBRA20018690//Zinc finger, C2H2 type

FEBRA20024100//Ank repeat// Ank repeat// Myosin head (motor domain)// Myosin head (motor domain)

FEBRA20025270//Sulfotransferase proteins

FEBRA20026110//Dictyostelium (slime mold) repeats// Zinc finger, C2H2 type// Dictyostelium (slime mold) repeats// Zinc finger, C2H2 type// Dictyostelium (slime mold) repeats// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Dictyostelium (slime mold) repeats// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Dictyostelium (slime mold) repeats// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Dictyostelium (slime mold) repeats// Zinc finger, C2H2 type

FEBRA20034680//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// DnaJ central domain (4 repeats)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type

FEBRA20040530//KRAB box// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Bacterial dnaA protein// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

FEBRA20080810//POT family

FEBRA20082010//KRAB box// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

FEBRA20086620//Olfactomedin-like domain

FEBRA20088360//Alpha adaptin carboxyl-terminal domai

FEBRA20090290//Zinc finger, C3HC4 type (RING finger)

FEBRA20092890//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Fibronectin type III domain

FEBRA20097310//SAP domain// RNA recognition motif. (a.k.a. RRM, RBD, or


FEBRA20130190//Galactosyltransferase// Fringe-like

FEBRA20132740//PH domain

FEBRA20144170//Eukaryotic protein kinase domain// Protein kinase C terminal domain// Eukaryotic protein kinase domain

FEBRA20167390//Sialyltransferase family

FEBRA20171380//KRAB box// wnt family of developmental signaling protei// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Putative zinc finger in N-recognin// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

FEBRA20184330//PDZ domain (Also known as DHR or GLGF).

FEBRA20192420//Cyclin-dependent kinase inhibitor// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif

FEBRA20195820//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// TRAF-type zinc finger// Zinc finger, C2H2 type

FEBRA20196370//Cyclin-dependent kinase inhibitor// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif

FEBRA20196630//DEAD/DEAH box helicase// Helicases conserved C-terminal domain

FEBRA20214970//Reverse transcriptase (RNA-dependent DNA pol

FEBRA20222040//bZIP transcription factor// K-box region

FEBRA20223220//EGF-like domain// EGF-like domain// Cadherin domain

FEBRA20229630//NADH-Ubiquinone/plastoquinone (complex I)

FEBRA20235500//Sodium Bile acid symporter family// ABC 3 transport family

FEBRA20237640//SAM domain (Sterile alpha motif)

FEHRT20003250//Phosphatidylinositol 3- and 4-kinases

HCASM10000500//Ribonucleotide reductases// Nucleotidyltransferase domain

HCHON10001760//Histone deacetylase family

HCHON20000380//Glucose-6-phosphate dehydrogenase

HCHON20003220//Formyl transferase// Phosphopantetheine attachment site// Protein of unknown function DUF132//Aldehyde dehydrogenase family

HCHON20007510//Phosphotyrosine interaction domain (PTB/PID)// TBC domain

HCHON20008150//RNA recognition motif. (a.k.a. RRM, RBD, or

HCHON20008320//Glutamine synthetase// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type

HCHON20009560//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

HCHON20010990//TPR Domain

HCHON20015350//FtsJ cell division protein

HCHON20015980//FG-GAP repeat// von Willebrand factor type A domain

HCHON20016040//Insulin-like growth factor binding proteins

HCHON20016650//Leucine rich repeat C-terminal domain// Immunoglobulin domain// Latrophilin/CL-1-like GPS domain//7 transmembrane receptor (Secretin family)

HCHON20035130//Zinc finger, C2H2 type// Zinc finger, C2H2 type

HCHON20036420//Death effector domain


HCHON20059870//Bromodomain// Bromodomain

HCHON20064590//Alpha-2-macroglobulin family N-terminal regi// Alpha-2-macroglobulin family N-terminal regi

HCHON20068410//IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif

HCHON20086720//Insulin-like growth factor binding pr// Thyroglobulin type-1 repeat

HCHON20100740//EGF-like domain// F5/8 type C domain// F5/8 type C domain

HEART20003060//Immunoglobulin domain// Immunoglobulin domain

HEART20005410//u-PAR/Ly-6 domain

HEART20017730//Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat

HEART20025980//Calponin homology (CH) domain

HEART20034320//Glycosyl hydrolase family 9//Glycosyl hydrolase family 9

HEART20061950//PDZ domain (Also known as DHR or GLGF).

HEART20077670//Protein phosphatase 2A regulatory B subunit

HEART20083640//NAD-dependent DNA ligase

HEART20090000//Inositol polyphosphate phosphatase family, c

HHDPC10000830//Zinc finger, C3HC4 type (RING finger)

HHDPC20014320//Reprolysin family propeptide

HHDPC20031130//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

HHDPC20034390//Cereal trypsin/alpha-amylase inhibito

HHDPC20034720//Glutathione S-transferases.

HHDPC20068620//Immunoglobulin domain// Immunoglobulin domain

HHDPC20091780//CUB domain// F5/8 type C domain

HHDPC20092080//Thyroglobulin type-1 repeat

HLUNG20016330//Methyl-accepting chemotaxis protein (MCP) s// PH domain// PH domain// Methanol dehydrogenase beta subunit

HLUNG20017120//Peptidyl-tRNA hydrolase domain

HLUNG20023340//KH domain

HLUNG20033780//Birnavirus VP3 protein// RhoGEF domain// PH domain// SH3 domain

IMR3220002430//WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat

KIDNE20002520//tRNA synthetases class I (E and Q)// tRNA synthetases class I (K)// tRNA synthetases class I (E and Q)

KIDNE20003940//Phosphotransferase system, EIIC// FecCD transport family// ABC 3 transport family

KIDNE20007770//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

KIDNE20008010//Dihydropyridine sensitive L-type calcium

KIDNE20009470//G-patch domain// Peptidase family M1

KIDNE20017130//MYND finger// DM DNA binding domain// Ribosomal protein L36

KIDNE20020150//Ribosomal protein S13/S18//Hsp70 protein

KIDNE20021680//3-hydroxyacyl-CoA dehydrogenase

KIDNE20022620//Glycosyl transferase family 8

KIDNE20024830//C2 domain// C2 domain

KIDNE20027250//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

KIDNE20027950//KRAB box

KIDNE20028390//Galactose-1-phosphate uridyl transfer// Galactose-1-phosphate uridyl transfer

KIDNE20028720//ATP synthase (C/AC39) subunit

KIDNE20028830//K-box region

KIDNE20100070//AMP-binding enzyme

KIDNE20101510//EGF-like domain// Trypsin Inhibitor like cysteine rich d// EGF-like domain// Keratin, high sulfur B2 protein// Zona pellucida-like domain

KIDNE20102710//Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat

KIDNE20107390//Histone-like transcription factor (CBF/// GHMP kinases putative ATP-binding prote

KIDNE20107620//Eukaryotic protein kinase domain// Dihydropyridine sensitive L-type calcium


KIDNE20109890//WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// Zinc finger, C4 type (two domains)// WD domain, G-beta repeat// WD domain, G-beta repeat

KIDNE20121880//PMP-22/EMP/MP20/Claudin family

KIDNE20125630//ATP1G1/PLM/MAT8 family

KIDNE20127100//Kelch motif// Kelch motif// Kelch motif

KIDNE20127750//Bacterial regulatory proteins, tetR family

KIDNE20137340//Uncharacterized membrane protein family UPFO

KIDNE20182690//BAH domain// ELM2 domain

LIVER10004790//EF hand

LIVER20002160//Hsp70 protein

LIVER20035680//UvrD/REP helicase

LIVER20055440//RhoGAP domain

LIVER20064690//Serpins (serine protease inhibitors)

LIVER20080530//Ank repeat// Ank repeat// Ank repeat// SAM domain (Sterile alpha motif)

LIVER20087060//Guanylate-binding protein


MAMGL10000830//LysM domain

MESAN10001260//von Willebrand factor type C domain// von Willebrand factor type C domain// von Willebrand factor type C domain// von Willebrand factor type C domain// TILa domain// von Willebrand factor type C domain// Keratin, high sulfur B2 protein// PEP-utilizing enzymes// von Willebrand factor type D domain// Plant PEC family metallothionein// Trypsin Inhibitor like cysteine rich

MESAN20029400//Zinc finger, C3HC4 type (RING finger)// RNA polymerases M/15 Kd subunits

MESAN20031900//Zinc finger, C3HC4 type (RING finger)// Peroxidase// Zinc finger, C3HC4 type (RING finger)// B-box zinc finger.// Fibronectin type III domain

MESAN20035290//FYVE zinc finger

MESAN20036460//Corticotropin-releasing factor family

MESAN20038510//Oxidoreductase molybdopterin binding d

MESAN20101140//LIM domain containing proteins

MESAN20103120//Sodium/calcium exchanger protein


MESAN20127350//Zinc knuckle

MESAN20130220//‘chromo’ (CHRromatin Organization MOdifier)// Enoyl-CoA hydratase/isomerase family

MESAN20136110//KH domain// KH domain// Zinc finger, C3HC4 type (RING finger)

MESAN20141920//Troponin// Tropomyosins// Borrelia ORF-A

MESAN20154010//Tryptophan synthase alpha chain// Ribulose-phosphate 3 epimerase family// Indole-3-glycerol phosphate synthases

MESAN20171520//PH domain

MESAN20174170//Regulator of G protein signaling domain

MESAN20186700//Hepatitis C virus RNA dependent RNA polymerase

NOVAR10000150//Cytosolic long-chain acyl-CoA thioester hydrolase

NT2NE20010490//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// DM DNA binding domain// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type

NT2NE20021620//Vacuolar sorting protein 9 (VPS9) domain

NT2NE20080170//CRAL/TR10 domain.

NT2NE20089970//KRAB box

NT2NE20118960//Gram-negative pili assembly chaperone

NT2NE20125050//Ezrin/radixin/moesin family

NT2NE20130190//Zinc finger, C2H2 type

NT2NE20132170//GNS1/SUR4 family// Transmembrane amino acid transporter protein

NT2NE20142210//PAS domain// PAS domain

NT2NE20157470//von Willebrand factor type A domain// Trypsin

NT2NE20158600//Ank repeat// Ank repeat

NT2NE20177520//Sushi domain (SCR repeat)// Sushi domain (SCR repeat)// Sushi domain (SCR repeat)// Sushi domain (SCR repeat)

NT2NE20181650//Src homology domain 2

NT2NE20183760//Calcitonin/CGRP/IAPP family

NT2NE20184900//FF domain

NT2RI20001330//Ank repeat// Ank repeat


NT2RI20005750//Cell division protein// Sigma-54 interaction domain// ADP-ribosylation factor family// ABC transporter// Ras family


NT2RI20025640//Reverse transcriptase (RNA-dependent DNA pol

NT2RI20040930//Mitochondrial carrier proteins// Mitochondrial carrier proteins

NT2RI20040990//Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat

NT2RI20046080//recA bacterial DNA recombination proteins

NT2RI20048840//ADP-ribosylation factor family// G-protein alpha subunit

NT2RI20054050//HSF-type DNA-binding domain

NT2RI20056700//Spectrin repeat// Apolipoprotein A1/A4/E family// Olfactomedin-like domain

NT2RI20091730//Molluscan rhodopsin C-terminal tail

NT2RI20240080//TPR Domain// TPR Domain// TPR Domain

NT2RI20244600//PAP2 superfamily

NT2RI20273230//DEAD/DEAH box helicase

NT2RP60000770//Zinc finger, C2H2 type// Zinc finger, C2H2 type// TRAF-type zinc finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

NT2RP60000850//C2 domain

NT2RP70027380//PX domain// SH3 domain// RhoGAP domain

NT2RP70032610//Peptidase family M20/M25/M40//Enol-ase

NT2RP70036880//TBC domain

NT2RP70043480//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type

NT2RP70044280//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

NT2RP70062230//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Pancreatic hormone peptides// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

NT2RP70063950//RhoGEF domain// Extracellular link domain// PH domain

NT2RP70078420//PH domain// Putative GTP-ase activating protein for Arf// Ank repeat// Ank repeat

NT2RP70080850//SPRY domain// Adenovirus EB1 55K protein/large t-an

NT2RP70102350//Viral methyltransferase// Helix-loop-helix DNA-binding domain

NT2RP70105210//Myc amino-terminal region

NT2RP70157890//KRAB box

NT2RP70159960//PH domain

NT2RP70179710//Zinc finger, C3HC4 type (RING finger)// PHD-finger

NT2RP70188710//Yeast PIR proteins

NT2RP70192730//alpha/beta hydrolase fold

NT2RP70194450//Bacterial regulatory proteins, crp family

NT2RP70195430//Zinc-binding dehydrogenases

NT2RP70198350//PWWP domain

NTONG20009770//Coronavirus S2 glycoprotein// Peptidase family M3

NTONG20013620//Sulfotransferase proteins

NTONG20015870//Transposase// Outer membrane efflux protein// Intermediate filament proteins

NTONG20028070//von Willebrand factor type C domain

NTONG20029480//NAD-dependent DNA ligase

NTONG20029700//Laminin N-terminal (Domain VI)// Laminin EGF-like (Domains III and V)// Laminin EGF-like (Domains III and V)// Laminin EGF-like (Domains III and V)

NTONG20046140//Eukaryotic protein kinase domain// Aminoglycoside phosphotransferase

NTONG20051530//Mov34/MPN/PAD-1 family// Extracellular link domain// Adhesin lipoprotein// Lectin C-type domain

NTONG20056570//WD domain, G-beta repeat// WD domain, G-beta repeat

NTONG20063010//EGF-like domain// Trypsin Inhibitor like cysteine rich domain// EGF-like domain// EGF-like domain// Keratin, high sulfur B2 protein// Chitin binding Peritrophin-A domain// Zona pellucida-like domain

NTONG20064840//C2 domain// C2 domain

NTONG20067830//Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat

NTONG20070200//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

NTONG20070340//Collagen triple helix repeat (20 copies)// Collagen triple helix repeat (20 copies)// Collagen triple helix repeat (20 copies)

NTONG20075220//RyR domain

NTONG20076930//Alpha-2-macroglobulin family

NTONG20083650//TPR Domain// TPR Domain// TPR Domain// PPR repeat// TPR Domain// PPR repeat// TPR Domain

NTONG20092290//Immunoglobulin domain// Immunoglobulin domain

NTONG20092330//Putative membrane protein

OCBBF10001850//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// DM DNA binding domain// Zinc finger, C2H2 type// Zinc finger, C2H2 type// MYND finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

OCBBF20019380//Sushi domain (SCR repeat)// CUB domain

OCBBF20019830//Fibronectin type III domain// Fibronectin type III domain// EGF-like domain// Metallothionein family 5

OCBBF20020830//Pumilio-family RNA binding domains (aka PUM-HD, Pumilio homology domain)// Pumilio-family RNA binding domains (aka PUM-HD, Pumilio homology domain)// Pumilio-family RNA binding domains (aka PUM-HD, Pumilio homology domain)// Pumilio-family RNA binding domains (aka PUM-HD, Pumilio homology domain)// Pumilio family RNA binding domains (aka PUM-HD, Pumilio homology domain)// Putative GTP-ase activating protein for Arf// Pumilio-family RNA binding domains (aka PUM-HD, Pumilio homology domain)// Pumilio-family RNA binding domains (aka PUM-HD, Pumilio homology domain)// Pumilio-family RNA binding domains (aka PUM-HD, Pumilio homology domain)

OCBBF20022900//IQ calmodulin-binding motif// Dishevelled specific domain// Kunitz/Bovine pancreatic trypsin inhibitor domain

OCBBF20028050//Phorbol esters/diacylglycerol binding domain (C1 domain)// Zinc finger, C3HC4 type (RING finger)// PHD-finger

OCBBF20028650//Ank repeat// Ank repeat// Helicases conserved C-terminal domain

OCBBF20030280//Lipoprotein amino terminal region

OCBBF20035930//NSF attachment protein

OCBBF20037440//Zinc finger, C3HC4 type (RING finger)

OCBBF20046120//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

OCBBF20049300//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Putative zinc finger in N-recognin// Zinc finger, C2H2 type// DM DNA binding domain// Zinc finger, C2H2 type

OCBBF20049840//PDZ domain (Also known as DHR or GLGF).

OCBBF20050770//Dehydrins// Carnitate acyltransferase

OCBBF20053430//Extracellular link domain// Eukaryotic protein kinase domain// Protein kinase C terminal domain

OCBBF20053730//Ank repeat// Ank repeat// Ank repeat// Patatin

OCBBF20054760//Death domain

OCBBF20059560//UvrB/uvrC motif

OCBBF20066390//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

OCBBF20071210//Spectrin repeat

OCBBF20071840//Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C3HC4 type (RING finger)// Zinc finger, C2H2 type// Zinc finger, C2H2 type

OCBBF20079310//Acetyltransferase (GNAT) family

OCBBF20080410//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

OCBBF20082830//alpha/beta hydrolase fold

OCBBF20086400//ADP-ribosylation factor family// ABC transporter// FtsK/SpoIIIE family// Ras family

OCBBF20086910//HMG (high mobility group) box

OCBBF20107090//Cadherin domain

OCBBF20108190//Zinc finger, C2H2 type// Zinc finger, C2H2 type// IBR domain// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

OCBBF20108430//ADP-ribosylation factor family// G-protein alpha subunit

OCBBF20108580//Caspase recruitment domain

OCBBF20108630//ABC transporter

OCBBF20109310//PH domain// Arrestin (or S-antigen)

OCBBF20116850//Leucine rich repeat N-terminal domain// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine rich repeat C-terminal domain// Immunoglobulin domain

OCBBF20120390//Caveolin// Hepatitis C virus core protein// Sodium:neurotransmitter symporter family

OCBBF20121390//BTB/POZ domain// Kelch motif// Kelch motif// Kelch motif// Kelch motif// Kelch motif

OCBBF20124360//CNH domain

OCBBF20125530//Vpu protein// Zinc finger, C3HC4 type (RING finger)

OCBBF20127040//Interleukin-6/G-CSF/MGF family

OCBBF20127140//WD domain, G-beta repeat// WD domain, G-beta repeat

OCBBF20127550//Outer Capsid protein VP4 (Hemagglutinin)

OCBBF20128120//DnaJ domain// DnaJ central domain (4 repeats)// DnaJ C terminal region

OCBBF20129360//PH domain// EF hand// Ribosomal RNA adenine dimethylases// EF hand// Sulfotransferase proteins// Somatotropin hormone family// Phosphatidylinositol-specific phospholi// Phosphatidylinositol-specific phospholi// C2 domain

OCBBF20132850//Leucine rich repeat N-terminal domain// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine rich repeat C-terminal domain// Immunoglobulin domain// Fibronectin type III domain

OCBBF20140640//Phosphotyrosine interaction domain (PTB/PID)

OCBBF20140890//Ribosomal protein L11


OCBBF20148280//Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

OCBBF20148730//BTB/POZ domain// Kelch motif// Kelch motif// Kelch motif// Kelch motif

OCBBF20155060//EGF-like domain// Laminin EGF-like (Domains III and V)// Laminin G domain// EGF-like domain// Laminin G domain// EGF-like domain

OCBBF20173980//Regulator of chromosome condensation// Regulator of chromosome condensation// Regulator of chromosome condensation// Regulator of chromosome condensation// Regulator of chromosome condensation// BTB/POZ domain// Thymidylate synthase


OCBBF20180120//Sodium:sulfate symporter transmembrane// Sodium:sulfate symporter transmembrane// Sodium:sulfate symporter transmembrane

PEBLM10000240//Domain found in Dishevelled, Eg1-10, and Ple

PEBLM20013120//PH domain

PEBLM20024320//Cation efflux family

PEBLM20042900//Chitin synthase

PEBLM20044520//Ubiquitin carboxyl-terminal hydrolase fam// Exonuclease

PEBLM20052820//Protein phosphatase 2C

PEBLM20060310//IBR domain// Zinc finger, C3HC4 type (RING finger)

PEBLM20060360//KRAB box

PEBLM20075980//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

PEBLM20078320//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// DnaJ central domain (4 repeats)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

PERIC10000250//Prokaryotic DNA topoisomerase

PERIC20003870//Ribosomal L32p protein family// NAC domain// TS-N domain

PERIC20004220//Domain of unknown function

PERIC20004780//bZIP transcription factor

PLACE60003480//Chorismate synthase

PLACE60060420//Ribosomal protein L44

PLACE60079250//Bacterial flagellin N-terminus// Spectrin repeat// Spectrin repeat// Spectrin repeat// Caulimovirus movement protein// Spectrin repeat// Spectrin repeat// Spectrin repeat// UvrB/uvrC motif// Spectrin repeat// Spectrin repeat// Flagellar hook-associated protein 2//Spectrin repeat// KE2 family protein


PLACE60136720//Porphobilinogen deaminase// GHMP kinases putative ATP-binding prot

PLACE60177140//7 transmembrane receptor (rhodopsin family)

PROST20047270//CRAL/TR10 domain.

PROST20047390//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

PROST20050670//Endothelin family

PROST20066880//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

PROST20079500//Hepatitis C virus non-structural protein NS4b// Ras association (RalGDS/AF-6) domain

PROST20100460//Cystine-knot domain

PROST20112970//Sterile alpha motif (SAM)/Pointed domain// SAM domain (Sterile alpha motif)

PROST20114390//Integrase DNA binding domain

PROST20161950//RasGEF domain

PROST20169800//Cytochrome P450

PROST20170980//Immunoglobulin domain// Adenovirus E3 region protein CR1

PROST20171280//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

PROST20176170//LIM domain containing proteins// LIM domain containing proteins// LIM domain containing proteins

PROST20185830//GATA zinc finger

PROST20189770//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

PROST20191640//Zinc finger, C3HC4 type (RING finger)// IBR domain// Keratin, high sulfur B2 protein// Zinc finger, C3HC4 type (RING finger)

PUAEN10000850//Uncharacterized protein family UPF0025//Sec1 family

PUAEN20011880//ZAP domain// Piwi domain

PUAEN20015860//PDZ domain (Also known as DHR or GLGF).// Regulator of G protein signaling domain

PUAEN20018820//Sterile alpha motif (SAM)/Pointed domain// Ets-domain

PUAEN20030180//Eukaryotic-type carbonic anhydrase

PUAEN20040670//FERM domain (Band 4.1 family)// FERM domain (Band 4.1 family)

PUAEN2055020//PH domain// START domain

PUAEN20078980//PH domain// FYVE zinc finger// Domain of unknown function

DUF123//PH domain

PUAEN20083140//EF hand// PH domain// Neuregulin family

PUAEN20108240//Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat

SALGL10001710//ENV polyprotein (coat polyprotein)

SKMUS20001980//Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat

SKMUS20003610//Syndecan domain// Mitochondrial carrier proteins// Mitochondrial carrier proteins// Mitochondrial carrier proteins SKMUS20007800//Matrix protein (MA), p15//Prenyltransferase and squalene oxidase re

SKMUS20016220//Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat

SKMUS20018230//Ank repeat

SKMUS20018500//Coronavirus S2 glycoprotein

SKMUS20024750//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat

SKMUS20029200//Ank repeat// Respiratory-chain NADH dehydrogenase, 4//Ank repeat// Ank repeat// Ank repeat// Ank repeat

SKMUS20048970//Actin// Actin

SKMUS20049030//Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat// Nebulin repeat

SKMUS20084740//Syndecan domain

SKNSH20008190//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// AN1-like Zinc finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

SKNSH20020540//Arginase family

SKNSH20063040//Transmembrane 4 family// Transmembrane 4 family

SMINT20001760//PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

SMINT20009840//Immunoglobulin domain// Immunoglobulin domain

SMINT20013480//Metallo-beta-lactamase superfamily

SMINT20028820//Eukaryotic protein kinase domain

SMINT20035690//Ribosomal L29 protein

SMINT20049090//Eukaryotic protein kinase domain

SMINT20050750//Kazal-type serine protease inhibitor domain

SMINT20068010//Kinesin motor domain

SMINT20071400//NOL1/NOP2/sun family

SMINT20073650//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

SMINT20102780//Quinolinate phosphoribosyl transferase

SMINT20106290//Formamidopyrimidine-DNA glycosylase

SMINT20106720//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

SMINT20110330//pKID domain

SMINT20112730//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

SMINT20115880//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

SMINT20121220//Myosin tail

SMINT20121950//2Fe-2S iron-sulfur cluster binding domains

SMINT20122910//START domain

SMINT20127930//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

SMINT20130320//NB-ARC domain// ATPases associated with various cellular act

SMINT20131810//ENV polyprotein (coat polyprotein)

SMINT20136130//Immunoglobulin domain

SMINT20138900//Hr1 repeat motif// Apolipoprotein A1/A4/E family// Intermediate filament proteins

SMINT20144430//Immunoglobulin domain

SMINT20144800//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

SMINT20152940//Sigma-54 interaction domain// ATPases associated with various cellular activities (AAA)

SMINT20154540//Glutathione S-transferases.

SMINT20163960//Immunoglobulin domain

SMINT20168570//Fasciclin domain

SMINT20174360//haloacid dehalogenase-like hydrolase

SMINT20177360//RNA recognition motif. (a.k.a. RRM, RBD, or

SMINT20179740//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

SMINT20183530//ABC transporter// ABC transporter

SMINT20190170//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

SMINT20191530//DEAD/DEAH box helicase// Helicases conserved C-terminal domain

SPLEN20006070//Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat

SPLEN20008740//Importin beta binding domain// Armadillo/beta-catenin-like repeats// Armadillo/beta-catenin-like repeats

SPLEN20011410//RhoGAP domain

SPLEN20026950//SNF2 and others N-terminal domain// Bromodomain// Helicases conserved C-terminal domain// Bromodomain

SPLEN20027440//Zinc finger present in dystrophin, CBP/p300//Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat// Ank repeat

SPLEN20039240//Ribosomal protein S13/S18//Hsp70 protein

SPLEN20054290//Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

SPLEN20077500//PH domain// Transposase

SPLEN20079260//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

SPLEN20084600//BTB/POZ domain// Kelch motif// Kelch motif// Kelch motif// Keich motif// Kelch motif

SPLEN20095410//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

SPLEN20095550//bZIP transcription factor// bZIP transcription factor// Hpt domain

SPLEN20099700//Sigma-54 interaction domain// ATPases associated with various cellular ac// Thymidine kinase from herpesvirus

SPLEN20103950//Ribosomal S17

SPLEN20118300//Transmembrane amino acid transporter protein

SPLEN20119810//Reverse transcriptase (RNA-dependent DNA polymerase)

SPLEN20126190//Lipoate-protein ligase B

SPLEN20140800//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// DnaJ central domain (4 repeats)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

SPLEN20142100//von Willebrand factor type A domain

SPLEN20143180//Src homology domain 2

SPLEN20145720//PH domain

SPLEN20147110//HECT-domain (ubiquitin-transferase).

SPLEN20147390//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

SPLEN20149110//Dishevelled specific domain

SPLEN20150940//Histone deacetylase family

SPLEN20151210//FERM domain (Band 4.1 family)// FERM domain (Band 4.1 family)// Isocitrate lyase

SPLEN20157880//Immunoglobulin domain

SPLEN20163560//Kinesin motor domain

SPLEN20165310//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

SPLEN20170310//PH domain

SPLEN20171470//Keratin, high sulfur B2 protein

SPLEN20173510//TPR Domain// TPR Domain// TPR Domain// TPR Domain// TPR Domain// NADH-ubiquinone/plastoquinone oxidoreduct

SPLEN20174260//Penicillin amidase// Bacterial regulatory proteins, lacI f// Vacuolar sorting protein 9 (VPS9) dom

SPLEN20179180//EF hand

SPLEN20179810//S-adenosylmethionine synthetase

SPLEN20181810//Phorbol esters/diacylglycerol binding domain (C1 domain)// FYVE zinc finger

SPLEN20186430//7 transmembrane receptor (rhodopsin family)//7 transmembrane receptor (rhodopsin family)

SPLEN20211220//Metalloenzyme superfamily

SPLEN20212730//Calpain large subunit, domain III// EF hand// EF hand// EF hand

SPLEN20222270//PTB domain (IRS-1 type)

SPLEN20245300//Pancreatic hormone peptides

SPLEN20250170//RhoGEF domain// PH domain// FYVE zinc finger// Domain of unknown function DUF123//PH domain

SPLEN20250390//EF hand// EF hand

SPLEN20252190//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// TRAF-type zinc finger// Zinc finger, C2H2 type

SPLEN20267650//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// TRAF-type zinc finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type

SPLEN20292950//Phosphoribulokinase// ABC transporter// Aldehyde oxidase and xanthine dehydrogenase, C terminus

SPLEN20304950//Transmembrane 4 family

SPLEN20305620//Dihydroorotate dehydrogenase

STOMA20001830//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

STOMA20005390//Sodium and potassium ATPases// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

STOMA20005670//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

STOMA20006400//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

STOMA20006780//Hepatitis C virus RNA dependent RNA polymera// Somatotropin hormone family

STOMA20008880//Olfactomedin-like domain

STOMA20032890//Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

STOMA20034770//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

STOMA20046680//bZIP transcription factor

STOMA20056640//Immunoglobulin domain

STOMA20056670//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

STOMA20057820//Uncharacterized protein family UPF0024

STOMA20062130//Immunoglobulin domain

STOMA20063980//Collagen triple helix repeat (20 copies)

STOMA20064470//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat

STOMA20069040//Keratin, high sulfur B2 protein

STOMA20077450//Repeat in ubiquitin-activating (UBA) pro// Repeat in ubiquitin-activating (UBA) pro

STOMA20080500//ABC transporter STOMA20083610//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

STOMA20088380//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

STOMA20092530//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

STOMA20092890//Myosin head (motor domain)

SYNOV20001520//Immunoglobulin domain// Immunoglobulin domain

SYNOV20001730//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

SYNOV20002510//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

SYNOV20002790//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

SYNOV20002970//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

SYNOV20004260//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

SYNOV20007000//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

SYNOV20008240//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

SYNOV20009230//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

SYNOV20010880//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

SYNOV20011110//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

SYNOV20013000//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

SYNOV20013560//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

SYNOV20013900//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

SYNOV20017080//UBX domain

SYNOV30001840//Asparagine synthase// AMP-binding enzyme

TBAES20000590//Cytochrome P450// Cytochrome P450

TBAES20002550//Peptidase family M1// Sigma-70 factor (ECF subfamily)

TBAES20003150//Cytochrome P450

TESOP20004000//Papain family cysteine protease

TESOP20005270//Sulfotransferase proteins

TESTI20001000//Formamidopyrimidine-DNA glycosylase

TESTI20001170//HORMA domain

TESTI20002780//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// PEP-utilizing enzymes

TESTI20017950//Regulator of G protein signaling domain

TESTI20023510//Transcription termination factor nusG

TESTI20031810//Bacterial luciferase// Domain of unknown function DUF28

TESTI20035960//Coproporphyrinogen III oxidase// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat

TESTI20036380//Sulfate transporter family// Sodium Bile acid symporter family// STAS domain

TESTI20041690//Zinc finger, C3HC4 type (RING finger)// PHD-finger// IBR domain// Zinc finger, C3HC4 type (RING finger)// B-box zinc finger.// lactate/malate dehydrogenase// Fibronectin type III domain

TESTI20044230//Nucleosome assembly protein (NAP)// Nucleosome assembly protein (NAP)// Nucleosome assembly protein (NAP)

TESTI20044310//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Chorismate synthase// UvrB/uvrC motif

TESTI20046750//Respiratory-chain NADH dehydrogenase, 4

TESTI20057750//RNase H// Integrase Zinc binding domain

TESTI20061110//Heavy-metal-associated domain// ATPases associated with various cellular act


TESTI20066670//Acyl-CoA dehydrogenase

TESTI20067200//K-box region// Homeobox domain

TESTI20082330//Tudor domain

TESTI20083200//Dual specificity phosphatase, catalytic doma

TESTI20083940//Progesterone receptor

TESTI20088220//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// BolA-like protein// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Snake toxin// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type


TESTI20098350//VAT-Nn domain

TESTI20108720//Protein phosphatase 2C

TESTI20121550//Putative GTP-ase activating protein for Arf

TESTI20127760//Cyclin// Calcitonin/CGRP/IAPP family

TESTI20130010//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

TESTI20136710//Glypican// PHD-finger

TESTI20143390//Integral membrane protein DUF6//Integral membrane protein DUF6

TESTI20148000//Thioredoxin// Calsequestrin// Thioredoxin

TESTI20152460//Putative zinc finger in N-recognin// PHD-finger

TESTI20156100//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

TESTI20157520//K+ channel tetramerisation domain// K+ channel tetramerisation domain

TESTI20168480//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// MAM domain.// Immunoglobulin domain

TESTI20170350//Cystine-knot domain

TESTI20184620//PH domain// Oxysterol-binding protein

TESTI20185650//AN1-like Zinc finger


TESTI20192800//HCO3-transporter family// Ank repeat// Ank repeat// Ank repeat// Alpha-2-macroglobulin family

TESTI20197940//Domain of unknown function DUF27//Aconitase family (aconitate hydratase)

TESTI20200710//PHD-finger// LIM domain containing proteins

TESTI20202650//Repeat in HS1/Cortactin

TESTI20204450//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Homeobox domain

TESTI20208400//NOL1/NOP2/sun family

TESTI20208710//WD domain, G-beta repeat// WD domain, G-beta repeat

TESTI20211160//Hydroxyethylthiazole kinase family

TESTI20214250//Mitochondrial carrier proteins// Mitochondrial carrier proteins

TESTI20215990//F-box domain.// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat


TESTI20226230//Adenylate kinase// Pou domain-N-terminal to homeobox d

TESTI20229600//EGF-like domain// Metallothionein family 5//Replication protein// Laminin G domain// EGF-like domain// Laminin G domain// Insulin-like growth factor binding prot// EGF-like domain// Laminin G domain

TESTI20230850//PAS domain

TESTI20231920//Gag P30 core shell protein

TESTI20232140//Phosphatidylinositol-specific phospholipase// Phosphatidylinositol-specific phospholipase

TESTI20234140//EF hand// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat// WD domain, G-beta repeat

TESTI20234360//WW domain// PPIC-type PPIASE domain.

TESTI20238610//MAGE family// Uncharacterized protein family UPF0057

TESTI20242830//E2 (early) protein, C terminal// Syndecan domain

TESTI20244190//Immunoglobulin domain// Immunoglobulin domain//-Immunoglobulin domain// Immunoglobulin domain

TESTI20254860//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Reeler domain// Fibronectin type III domain// Fibronectin type III domain

TESTI20255820//FERM domain (Band 4.1 family)// FERM domain (Band 4.1 family)// Isocitrate lyase

TESTI20258460//PH domain

TESTI20265970//Guanylate-binding protein

TESTI20266740//Nucleotidyltransferase domain

TESTI20272960//7 transmembrane receptor (rhodopsin family)

TESTI20275030//WD domain, G-beta repeat// WD domain, G-beta repeat

TESTI20288910//SH3 domain

TESTI20291960//Rhomboid family

TESTI20303220//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Fibronectin type III domain// Alphaherpesvirus glycoprotein E// Fibronectin type III domain// Fibronectin type III domain// Fibronectin type III domain

TESTI20303360//ENV polyprotein (coat polyprotein)

TESTI20305540//Hantavirus nucleocapsid protein// Troponin// Apolipoprotein A1/A4/E family

TESTI20308600//Homeobox domain

TESTI20309170//TPR Domain// Zinc finger, C3HC4 type (RING finger)// Aldo/keto reductase family// ATP-dependent protease La (LON) domain

TESTI20314180//Trypsin// Trypsin

TESTI20317600//Terpene synthase family

TESTI20318090//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type


TESTI20320670//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)// RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

TESTI20326810//RanBP1 domain.

TESTI20327680//EF hand// EF hand

TESTI20328280//KE2 family protein// Troponin

TESTI20333000//Immunoglobulin domain// Immunoglobulin domain

TESTI20334410//DEAD/DEAH box helicase// Helicases conserved C-terminal domain

TESTI20335050//Zinc finger, C3HC4 type (RING finger)

TESTI20335200//Immunoglobulin domain

TESTI20343070//Transcription factor E2F/dimerisation partner (TDP)

TESTI20351830//K-box region

TESTI20352620//Saposin A-type domain

TESTI20355020//Tudor domain

TESTI20358980//Homeobox domain// Collagen triple helix repeat (20 copies)

TESTI20366910//Pyridine nucleotide-disulphide oxidoreductase

TESTI20368330//Rhodanese-like domain


TESTI20370020//Bleomycin resistance protein

TESTI20370810//Ion transport protein// Polysaccharide biosynthesis protein// Sugar (and other) transporter

TESTI20371030//Kelch motif// Kelch motif// Kelch motif// Kelch motif// Kelch motif

TESTI20375340//Phosphatidylinositol-specific phospholi// UvrD/REP helicase// Phosphatidylinositol-specific phospholi// C2 domain

TESTI20377230//Thymidylate synthase

TESTI20378190//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

TESTI20381040//Putative zinc finger in N-recognin

TESTI20382750//Kinesin motor domain

TESTI20383880//DnaJ domain

TESTI20385960//Zinc finger, C3HC4 type (RING finger)// SPRY domain

TESTI20390410//Arsenical pump membrane protein

TESTI20391210//IQ calmodulin-binding motif

TESTI20391770//Domain of unknown function DUF19//Thioredoxin

TESTI20392250//PH domain// Phorbol esters/diacylglycerol binding domain (C1 domain)


TESTI20392760//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat

TESTI20393530//Mitochondrial carrier proteins

TESTI20397760//E1-E2 ATPase

TESTI20400940//K-box region

TESTI20401020//Mitochondrial carrier proteins// Mitochondrial carrier proteins

TESTI20408150//Keratin, high sulfur B2 protein

TESTI20416640//Choline/ethanolamine kinase

TESTI20432750//Cytochrome C and Quinol oxidase polypeptide

TESTI20432820//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

TESTI20436560//Spectrin repeat// Intermediate filament proteins// Intermediate filament tail domain

TESTI20442760//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

TESTI20443090//SAP domain// Zinc knuckle// Zinc finger, C3HC4 type (RING finger)

TESTI20444130//ENV polyprotein (coat polyprotein)

TESTI20449200//7 transmembrane receptor (metabotropic gluta

TESTI20451990//SAP domain

TESTI20455090//Intermediate filament proteins

TESTI20455620//Hsp70 protein

TESTI20456110//B-box zinc finger.// Spectrin repeat// SPRY domain

TESTI20463580//Ubiquitin carboxyl-terminal hydrolases famil// Immunoglobulin domain// Ubiquitin carboxyl-terminal hydrolase family

TESTI20467320//Wiskott Aldrich syndrome homology region 2

TESTI20467970//Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain

TESTI20471410//Protein phosphatase 2C

TESTI20478850//Herpesvirus Glycoprotein B

THYMU10005360//Immunoglobulin domain// Viral coat protein// Immunoglobulin domain

THYMU10005540//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

THYMU20023380//Copper/zinc superoxide dismutase (SODC)

THYMU20027560//Domain of unknown function

THYMU20039810//MAC/Perforin domain

THYMU20105190//Myosin head (motor domain)

THYMU20106710//Immunoglobulin domain

THYMU20111180//Domain of unknown function DUF27//Aconitase family (aconitate hydratase)

THYMU20115850//Reverse transcriptase (RNA-dependent DNA pol

THYMU20118520//Ubiquitin family

THYMU20122730//VHS domain

THYMU20126900//3-hydroxyacyl-CoA dehydrogenase// UDP-glucose/GDP-mannose dehydrogenase fa

THYMU20130890//Ribosomal protein S9/S16

THYMU20141670//Phorbol esters/diacylglycerol binding dom// PHD-finger// FYVE zinc finger

THYMU20142040//Wiskott Aldrich syndrome homology region 2

THYMU20143270//Cytochrome C oxidase subunit II

THYMU20147770//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

THYMU20159430//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

THYMU20161640//PMP-22/EMP/MP20/Claudin family// Integral membrane protein DUF6

THYMU20169680//Ank repeat// Ank repeat

THYMU20172150//WD domain, G-beta repeat

THYMU20194360//Kelch motif

THYMU20201980//PH domain// Phorbol esters/diacylglycerol binding domain (C1 domain)// FYVE zinc finger// PH domain

THYMU20202890//Eukaryotic protein kinase domain

THYMU20209590//PH domain// Dynamin GTPase effector domain


THYMU20229220//Closterovirus coat protein

THYMU20239000//Collagen triple helix repeat (20 copies)

THYMU20240710//tRNA synthetases class I (E and Q)

THYMU20241850//Class II histocompatibility antigen, beta// Immunoglobulin domain

THYMU20247480//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

THYMU20279750//Immunoglobulin domain

TKIDN10000010//Mitochondrial import inner membrane transloc

TKIDN20004640//GHMP kinases putative ATP-binding protei

TKIDN20047480//Eukaryotic protein kinase domain

TOVAR20004760//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat

TRACH20002870//PMP-22/EMP/MP20/Claudin family

TRACH20003590//Cytochrome P450

TRACH20005020//Ank repeat// MutT-like domain

TRACH20005400//ADP-ribosylation factor family// Ras family

TRACH20016210//Fucosyl transferase

TRACH20019960//Na+/K+ ATPase C-terminus

TRACH20028030//DnaJ domain// DnaJ central domain (4 repeats)// DnaJ C terminal region

TRACH20033230//Nucleoside transporter// Sugar (and other) transporter// Influenza RNA-dependent RNA polymerase subunit PB2

TRACH20041830//Thioredoxin// Thioredoxin

TRACH20042920//Glutamine synthetase

TRACH20048450//Phospholipase D. Active site motif// Phospholipase D. Active site motif

TRACH20050040//Plexin repeat

TRACH20067620//Core-2/1-Branching enzyme

TRACH20069180//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

TRACH20076740//Reduced folate carrier

TRACH20076760//Keratin, high sulfur B2 protein

TRACH20077540//Zinc finger, C2H2 type// G-patch domain

TRACH20079690//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type//

TRAF-type zinc finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type

TRACH20084720//tRNA synthetases class I (C)// tRNA synthetases class I (I, L, M and V)

TRACH20085400//Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

TRACH20085830//Cytochrome P450

TRACH20096610//Intermediate filament proteins// Intermediate filament tail domain

TRACH20105870//Regulatory subunit of type II PKA R-subunit// eIF4-gamma/eIF5/eIF2-epsilon

TRACH20121380//Raf-like Ras-binding domain// Leptin// Raf-like Ras-binding domain// LGN motif, putative GEF specific for G-alpha GTPase

TRACH20128230//Immunoglobulin domain// Chitin synthase// Immunoglobulin domain// Immunoglobulin domain// Immunoglobulin domain

TRACH20135520//TBC domain// Rhodanese-like domain

TRACH20136710//Immunoglobulin domain


TRACH20145440//von Willebrand factor type D domain

TRACH20154860//Squash family of serine protease inhibito// Zinc finger, C4 type (two domains)// T-box// Zinc finger, C4 type (two domains)// Ligand-binding domain of nuclear hormone

TRACH20163170//Homeobox domain

TRACH20164980//Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// PHD-finger// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

TRACH20167220//wnt family of developmental signaling protei// PLAT/LH2 domain// Fibroblast growth factor

TRACH20184490//KRAB box// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

TRACH20190240//EGF-like domain// EGF-like domain// Trypsin Inhibitor like cysteine rich domain// EGF-like domain

TSTOM20005690//BTB/POZ domain// Kelch motif// Kelch motif// Kelch motif

TUTER20002830//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

UMVEN10001860//PH domain// RhoGAP domain// bZIP transcription factor

UMVEN20000690//F5/8 type C domain

UTERU20030570//ABC 3 transport family// Voltage gated chloride channels// CBS domain// CBS domain

UTERU20046640//Rotavirus NS26

UTERU20046980//EB module// TNFR/NGFR cysteine-rich region// Furin-like cysteine rich region// Thrombospondin type 1 domain

UTERU20050690//Androgen receptor

UTERU20055330//Reverse transcriptase (RNA-dependent DNA polymerase)

UTERU20055480//AMP-binding enzyme

UTERU20055930//Helper component proteinase

UTERU20064000//Peptidase family M1

UTERU20065930//Hr1 repeat motif// PDZ domain (Also known as DHR or GLGF).

UTERU20115740//KRAB box

UTERU20116570//Villin headpiece domain

UTERU20119060//ADP-ribosyl cyclase

UTERU20144640//Choloylglycine hydrolase

UTERU20145480//KRAB box// Zinc finger, C2H2 type// Transcription factor S-II (TFIIS)// Zinc finger, C2H2 type// TRAF-type zinc finger// Zinc finger, C2H2 type// Zinc finger, C2H2 type// wnt family of developmental signaling proteins// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type// Zinc finger, C2H2 type

UTERU20146310//Diacylglycerol kinase accessory domain (pres

UTERU20161570//7 transmembrane receptor (rhodopsin family)

UTERU20168220//Cell division protein// Integrase Zinc binding domain// GTPase of unknown function

UTERU20176130//Putative GTP-ase activating protein for Arf

UTERU20176320//SMC domain N terminal domain// Tropomyosins

UTERU20178100//Aminotransferases class-III pyridoxal-pho

UTERU20179880//TPR Domain// TPR Domain// TPR Domain// TPR Domain

UTERU20183640//Immunoglobulin domain

UTERU20185230//DUP family of yeast membrane proteins

EXAMPLE 6 Functional Categorization Based on the Full-Length Nucleotide Sequences

The functional prediction and categorization of the proteins encoded by the clones were carried out based on the result of homology search of the databases of GenBank, Swiss-Prot, UniGene and nr (see the Homology Search Result Data) for the full-length nucleotide sequences and the result of domain search of the amino acid sequences deduced from the full-length nucleotide sequences (see Example 5).

The clone predicted to belong to the category of secretory protein/membrane protein means a clone having hit data with some annotation, such as growth factor, cytokine, hormone, signal, transmembrane, membrane, extracellular matrix, receptor, G-protein coupled receptor, ionic channel, voltage-gated channel, calcium channel, cell adhesion, collagen, connective tissue, etc., suggesting that it is a secretory or membrane protein, or means a clone in which the presence of nucleotide sequence encoding a signal sequence or transmembrane domain was suggested by the results of PSORT and SOSUI analyses for deduced ORF.

The clone predicted to belong to the category of glycoprotein-related protein means a clone having hit data with some annotation, such as glycoprotein, suggesting that the clone encodes a glycoprotein-related protein.

The clone predicted to belong to the category of signal transduction-related protein means a clone having hit data with some annotation, such as serine/threonine-protein kinase, tyrosine-protein kinase, SH3 domain, SH2 domain, etc., suggesting that the clone encodes a signal transduction-related protein.

The clone predicted to belong to the category of transcription-related protein means a clone having hit data with some annotation, such as transcription regulation, zinc finger, homeobox, etc., suggesting that the clone encodes a transcription-related protein.

The clone predicted to belong to the category of disease-related protein means a clone having hit data with some annotation, such as disease mutation, syndrome, etc., suggesting that the clone encodes a disease-related protein, or means a clone whose full-length nucleotide sequence has hit data for Swiss-Prot, GenBank, or UniGene, where the hit data corresponds to genes or proteins which have been deposited in the Online Mendelian Inheritance in Man (OMIM) (, which is the human gene and disease database.

The clone predicted to belong to the category of enzyme and/or metabolism-related protein means a clone having hit data with some annotation, such as metabolism, oxidoreductase, E. C. No. (Enzyme commission number), etc., suggesting that the clone encodes an enzyme and/or metabolism-related protein.

The clone predicted to belong to the category of cell division and/or cell proliferation-related protein means a clone having hit data with some annotation, such as cell division, cell cycle, mitosis, chromosomal protein, cell growth, apoptosis, etc., suggesting that the clone encodes a cell division and/or cell proliferation-related protein.

The clone predicted to belong to the category of cytoskeleton-related protein means a clone having hit data with some annotation, such as structural protein, cytoskeleton, actin-binding, microtubles, etc., suggesting that the clone encodes a cytoskeleton-related protein.

The clone which is predicted to belong to the category of nuclear protein and/or RNA synthesis-related protein means a clone having hit data with some annotation, such as nuclear protein, RNA splicing, RNA processing, RNA helicase, polyadenylation, etc., suggesting that the clone encodes a nuclear protein and/or RNA synthesis-related protein.

The clone predicted to belong to the category of protein synthesis and/or transport-related protein means a clone having hit data with some annotation, such as translation regulation, protein biosynthesis, amino-acid biosynthesis, ribosomal protein, protein transport, signal recognition particle, etc., suggesting that the clone encodes a protein synthesis and/or transport-related protein.

The clone predicted to belong to the category of cellular defense-related protein means a clone having hit data with some annotation, such as heat shock, DNA repair, DNA damage, etc., suggesting that the clone encodes a cellular defense-related protein.

The clone predicted to belong to the category of development and/or differentiation-related proteins means a clone having hit data with some annotation, such as developmental protein, etc., suggesting that the clone encodes a development and/or differentiation-related protein.

The clone predicted to belong to the category of DNA-binding and/or RNA-binding protein means a clone having hit data with some annotation, such as DNA-binding, RNA-binding, etc.

The clone predicted to belong to the category of ATP-binding and/or GTP-binding protein means a clone having hit data with some annotation, such as ATP-binding, GTP-binding, etc.

In this functional categorization, when a single clone corresponded to multiple categories of those shown above, the clone was assigned to the multiple categories. However, the function of a protein is not restricted to the functional category in this classification, and there is the possibility that other functions are newly assigned to the protein.

The clones predicted to belong to the category of secretory protein and/or membrane protein are the following 632 clones.

ADIPS10000640, ADRGL10001470, ADRGL20013520, ADRGL20018540, ADRGL20035850, ASTRO20001410, ASTRO20005330, ASTRO20033160, ASTRO20055750, ASTRO20058630, ASTRO20190390, BEAST20004540, BGGI110000240, BNGH420088500, BRACE20006400, BRACE20038000, BRACE20038470, BRACE20039040, BRACE20039540, BRACE20051380, BRACE20053630, BRACE20059370, BRACE20060550, BRACE20061050, BRACE20063630, BRACE20067430, BRACE20069090, BRACE20081720, BRACE20101700, BRACE20101710, BRACE20116110, BRACE20147800, BRACE20153680, BRACE20163350, BRACE20179340, BRACE20188470, BRACE20195100, BRACE20201570, BRACE20210140, BRACE20224480, BRACE20224500, BRACE20228480, BRACE20232840, BRACE20238000, BRACE20273890, BRACE20274080, BRALZ20013500, BRALZ20054710, BRALZ20064740, BRALZ20069760, BRALZ20073760, BRALZ20077930, BRAMY20000860, BRAMY20002770, BRAMY20025840, BRAMY20039260, BRAMY20060920, BRAMY20063970, BRAMY20111960, BRAMY20112800, BRAMY20124260, BRAMY20134140, BRAMY20135900, BRAMY20136210, BRAMY20144620, BRAMY20152110, BRAMY20174550, BRAMY20181220, BRAMY20195090, BRAMY20211390, BRAMY20211420, BRAMY20215230, BRAMY20218250, BRAMY20218670, BRAMY20229800, BRAMY20231720, BRAMY20247280, BRAMY20252180, BRAMY20273960, BRAMY20277170, BRAMY20284910, BRAMY20285160, BRAWH20015350, BRAWH20015890, BRAWH20016860, BRAWH20018730, BRAWH20030250, BRAWH20064050, BRAWH20110790, BRAWH20112940, BRAWH20117950, BRAWH20118230, BRAWH20121640, BRAWH20122580, BRAWH20132190, BRCAN20064010, BRCAN20071190, BRCAN20091560, BRCAN20103740, BRCAN20224720, BRCAN20273550, BRCAN20280360, BRCAN20285450, BRCOC10000870, BRCOC20004040, BRCOC20006370, BRCOC20041750, BRCOC20077690, BRCOC20078640, BRCOC20090520, BRCOC20101230, BRCOC20107300, BRCOC20114180, BRCOC20121720, BRCOC20134480, BRCOC20136750, BRHIP10001290, BRHIP20000870, BRHIP20003120, BRHIP20103090, BRHIP20111200, BRHIP20118380, BRHIP20118910, BRHIP20121410, BRHIP20135100, BRHIP20174040, BRHIP20179200, BRHIP20183690, BRHIP20191490, BRHIP20191770, BRHIP20198190, BRHIP20207430, BRHIP20208270, BRHIP20208590, BRHIP20217620, BRHIP20233090, BRHIP20234380, BRHIP20238880, BRHIP20283030, BRHIP30004570, BRSSN20003120, BRSSN20043040, BRSSN20066110, BRSSN20120810, BRSSN20137020, BRSSN20142940, BRSSN20146100, BRSSN20151990, BRSSN20169050, BRSTN20002200, BRTHA20004740, BRTHA20046290, BRTHA20046420, COLON10001350, COLON20093370, CTONG10000100, CTONG10000940, CTONG10001650, CTONG20004690, CTONG20009770, CTONG20092570, CTONG20092580, CTONG20095340, CTONG20099380, CTONG20103480, CTONG20105080, CTONG20114740, CTONG20119200, CTONG20120770, CTONG20124730, CTONG20131490, CTONG20132220, CTONG20133480, CTONG20139340, CTONG20149950, CTONG20155400, CTONG20158660, CTONG20159530, CTONG20161850, CTONG20267700, D3OST10001090, D3OST20036070, D3OST20038560, D3OST30002580, D6OST20005070, D9OST20002780, D9OST20015470, D9OST20023970, D9OST20026730, D9OST20035940, D9OST20040180, DFNES20025880, FCBBF10000240, FCBBF10000380, FCBBF10001150, FCBBF10001210, FCBBF10001550, FCBBF10002430, FCBBF10002700, FCBBF10003220, FCBBF10003760, FCBBF10005460, FCBBF10005740, FCBBF20032970, FCBBF20042560, FCBBF20049300, FCBBF20051220, FCBBF30008470, FCBBF30024750, FCBBF30078290, FCBBF30083620, FCBBF30086440, FCBBF30090690, FCBBF30095260, FCBBF30123470, FCBBF30172550, FCBBF30175310, FCBBF30190850, FCBBF30215060, FCBBF30238870, FCBBF30251420, FCBBF30279030, FEBRA20002100, FEBRA20004620, FEBRA20009090, FEBRA20029860, FEBRA20037260, FEBRA20080810, FEBRA20086620, FEBRA20092890, FEBRA20093520, FEBRA20095880, FEBRA20111460, FEBRA20125070, FEBRA20130190, FEBRA20140100, FEBRA20145780, FEBRA20211710, FEBRA20223220, FEBRA20229630, FEBRA20235500, HCHON20000380, HCHON20008180, HCHON20015980, HCHON20016040, HCHON20016650, HCHON20040020, HCHON20064590, HCHON20067700, HCHON20068710, HCHON20086720, HCHON20100740, HEART20003060, HEART20005410, HEART20034320, HEART20049410, HEART20049800, HEART20072310, HHDPC20001040, HHDPC20014320, HHDPC20034720, HHDPC20068620, HHDPC20084140, HHDPC20091780, HHDPC20092080, HLUNG10000550, KIDNE20003940, KIDNE20007770, KIDNE20011400, KIDNE20021910, KIDNE20022620, KIDNE20100070, KIDNE20101510, KIDNE20109730, KIDNE20121880, KIDNE20125630, KIDNE20126010, KIDNE20126130, KIDNE20127450, KIDNE20130450, KIDNE20131580, KIDNE20137340, KIDNE20181660, LIVER20035110, LIVER20045650, LIVER20055200, LIVER20062510, LIVER20064690, LIVER20075680, LIVER20087060, LIVER20091180, MESAN10001260, MESAN20014500, MESAN20027090, MESAN20038510, MESAN20089360, MESAN20103120, MESAN20115970, MESAN20125860, MESAN20139360, MESAN20152770, MESAN20153910, MESAN20174170, NOVAR20000380, NT2NE20010050, NT2NE20021620, NT2NE20068130, NT2NE20118960, NT2NE20124480, NT2NE20131890, NT2NE20132170, NT2NE20155110, NT2NE20156260, NT2NE20157470, NT2NE20159740, NT2NE20177520, NT2NE20183760, NT2RI20003480, NT2RI20023910, NT2RI20025400, NT2RI20028470, NT2RI20040930, NT2RI20054050, NT2RI20056700, NT2RI20076290, NT2RI20086220, NT2RI20091940, NT2RI20244600, NT2RP70072690, NT2RP70081610, NT2RP70122910, NT2RP70125160, NT2RP70133740, NT2RP70134990, NT2RP70137290, NT2RP70179710, NT2RP70188020, NT2RP70192730, NT2RP70198350, NTONG20028070, NTONG20029700, NTONG20048060, NTONG20049910, NTONG20051530, NTONG20061870, NTONG20063010, NTONG20067830, NTONG20076930, NTONG20092330, OCBBF10001750, OCBBF20013890, OCBBF20019830, OCBBF20023570, OCBBF20026630, OCBBF20046690, OCBBF20050770, OCBBF20059560, OCBBF20063320, OCBBF20071210, OCBBF20072320, OCBBF20080050, OCBBF20086400, OCBBF20086910, OCBBF20087010, OCBBF20088140, OCBBF20091150, OCBBF20107090, OCBBF20108630, OCBBF20116850, OCBBF20120390, OCBBF20122620, OCBBF20130910, OCBBF20132850, OCBBF20145760, OCBBF20155060, OCBBF20178880, OCBBF20180120, OCBBF20180840, OCBBF20188730, PANCR10000910, PEBLM10000710, PEBLM20024320, PEBLM20040150, PEBLM20074370, PEBLM20075980, PERIC20004220, PLACE60086400, PLACE60121080, PLACE60161600, PLACE60177140, PROST20005050, PROST20050670, PROST20107820, PROST20116600, PROST20120160, PROST20127800, PROST20146010, PROST20164440, PROST20169800, PROST20170980, PROST20175290, PUAEN20003740, PUAEN20030180, SALGL10001710, SKMUS20003610, SKMUS20007800, SKMUS20011640, SKMUS20020840, SKMUS20028210, SKMUS20028400, SKMUS20077400, SKNSH20028660, SKNSH20031740, SKNSH20051940, SKNSH20063040, SMINT20009840, SMINT20011990, SMINT20022020, SMINT20029760, SMINT20040860, SMINT20050750, SMINT20053870, SMINT20073650, SMINT20095050, SMINT20100680, SMINT20105330, SMINT20106720, SMINT20121950, SMINT20127930, SMINT20144430, SMINT201448.90, SMINT20153260, SMINT20154540, SMINT20157450, SMINT20173240, SMINT20178550, SMINT20191420, SMINT20192000, SPLEN20003070, SPLEN20021660, SPLEN20029310, SPLEN20079510, SPLEN20095810, SPLEN20097330, SPLEN20118300, SPLEN20141360, SPLEN20141990, SPLEN20142100, SPLEN20144520, SPLEN20152760, SPLEN20157880, SPLEN20165310, SPLEN20167200, SPLEN20169220, SPLEN20169720, SPLEN20171890, SPLEN20172120, SPLEN20179810, SPLEN20186430, SPLEN20211570, SPLEN20211940, SPLEN20213830, SPLEN20273950, SPLEN20292950, SPLEN20293800, SPLEN20304950, SPLEN20329240, STOMA20005390, STOMA20005670, STOMA20006400, STOMA20006780, STOMA20008880, STOMA20051200, STOMA20056640, STOMA20056670, STOMA20062130, STOMA20077450, STOMA20080500, STOMA20088380, STOMA20092530, SYNOV20001520, SYNOV20001730, SYNOV20002510, SYNOV20002790, SYNOV20002970, SYNOV20004260, SYNOV20007000, SYNOV20008240, SYNOV20009230, SYNOV20010880, SYNOV20011110, SYNOV20013000, SYNOV20013560, SYNOV20013900, SYNOV30001840, TBAES20003150, TESOP20004000, TESOP20005690, TESTI20001720, TESTI20036380, TESTI20037560, TESTI20094120, TESTI20110280, TESTI20123080, TESTI20123560, TESTI20128350, TESTI20136100, TESTI20136710, TESTI20143390, TESTI20148000, TESTI20164100, TESTI20193360, TESTI20209810, TESTI20209990, TESTI20211220, TESTI20214250, TESTI20216370, TESTI20230250, TESTI20231940, TESTI20242990, TESTI20244190, TESTI20254220, TESTI20254860, TESTI20265970, TESTI20271850, TESTI20272960, TESTI20284880, TESTI20291310, TESTI20291960, TESTI20303220, TESTI20303360, TESTI20303420, TESTI20307700, TESTI20309170, TESTI20314180, TESTI20316870, TESTI20333000, TESTI20335200, TESTI20347180, TESTI20347300, TESTI20352620, TESTI20357960, TESTI20370810, TESTI20373820, TESTI20383880, TESTI20390260, TESTI20390410, TESTI20391770, TESTI20393530, TESTI20396130, TESTI20397760, TESTI20401020, TESTI20401280, TESTI20415170, TESTI20421490, TESTI20422640, TESTI20441940, TESTI20442760, TESTI20444130, TESTI20444180, TESTI20449200, TESTI20463520, TESTI20463580, TESTI20465350, THYMU10005360, THYMU10005540, THYMU20027560, THYMU20032870, THYMU20039810, THYMU20066100, THYMU20081490, THYMU20100410, THYMU20106710, THYMU20111830, THYMU20141670, THYMU20147770, THYMU20159430, THYMU20161640, THYMU20162190, THYMU20173980, THYMU20194420, THYMU20208300, THYMU20216840, THYMU20222890, THYMU20229220, THYMU20241850, THYMU20277390, TKIDN20005210, TRACH20002870, TRACH20003590, TRACH20016210, TRACH20019960, TRACH20029540, TRACH20033230, TRACH20034840, TRACH20042920, TRACH20050040, TRACH20067620, TRACH20068660, TRACH20069180, TRACH20076740, TRACH20085400, TRACH20085830, TRACH20109650, TRACH20111130, TRACH20121380, TRACH20128110, TRACH20128230, TRACH20134950, TRACH20136710, TRACH20139820, TRACH20140820, TRACH20145440, TRACH20168350, TRACH20180840, TRACH20190240, UMVEN20000690, UTERU20030570, UTERU20040610, UTERU20046980, UTERU20055480, UTERU20064860, UTERU20076390, UTERU20094350, UTERU20135860, UTERU20144640, UTERU20158300, UTERU20158800, UTERU20161570, UTERU20178100, UTERU20183640, UTERU20186740

The clones predicted to belong to the category of glycoprotein-related protein are the following 128 clones.

ADIPS10000640, BRACE20059370, BRACE20163350, BRAMY20277170, BRAMY20285160, BRAWH20064050, BRAWH20112940, BRAWH20117950, BRAWH20118230, BRCAN20103740, BRCOC20004040, BRCOC20006370, BRHIP10001290, BRHIP20103090, BRHIP20283030, BRHIP30004570, BRSSN20003120, BRSSN20146100, BRTHA20046290, COLON10001350, CTONG20159530, D9OST20023970, D9OST20040180, FCBBF10001150, FCBBF20049300, FCBBF30024750, FCBBF30083620, FCBBF30190850, FCBBF30238870, FEBRA20086620, FEBRA20092890, HCHON20015980, HCHON20016040, HCHON20064590, HCHON20086720, HCHON20100740, HEART20003060, HHDPC20014320, HHDPC20068620, HHDPC20092080, KIDNE20003940, KIDNE20007770, KIDNE20101510, LIVER20064690, MESAN20125860, NT2NE20118960, NT2NE20157470, NT2NE20177520, NT2RI20003480, NT2RI20056700, NT2RP70192730, NTONG20051530, NTONG20076930, OCBBF20107090, OCBBF20108630, OCBBF20120390, OCBBF20145760, OCBBF20155060, PLACE60177140, SMINT20050750, SMINT20073650, SMINT20105330, SMINT20106720, SMINT20112730, SMINT20127930, SMINT20153260, SMINT20179740, SMINT20190170, SPLEN20021660, SPLEN20142100, SPLEN20157880, SPLEN20165310, SPLEN20179810, SPLEN20186430, STOMA20001830, STOMA20005390, STOMA20005670, STOMA20006400, STOMA20008880, STOMA20034770, STOMA20056640, STOMA20056670, STOMA20083610, STOMA20088380, STOMA20092530, SYNOV20001520, SYNOV20001730, SYNOV20002510, SYNOV20002790, SYNOV20002970, SYNOV20004260, SYNOV20007000, SYNOV20008240, SYNOV20009230, SYNOV20010880, SYNOV20011110, SYNOV20013000, SYNOV20013560, SYNOV20013900, TESOP20004000, TESTI20136100, TESTI20216370, TESTI20244190, TESTI20254860, TESTI20303220, TESTI20335200, TESTI20352620, TESTI20358980, TESTI20442760, TESTI20449200, TESTI20455090, THYMU10005360, THYMU10005540, THYMU20147770, THYMU20159430, THYMU20241850, TRACH20016210, TRACH20050040, TRACH20067620, TRACH20069180, TRACH20076740, TRACH20128230, UTERU20046980, UTERU20064860, UTERU20144640, UTERU20158800, UTERU20161570, UTERU20183640

The clones predicted to belong to the category of signal transduction-related protein are the following 84 clones.

ASTRO20108190, BRACE20115920, BRACE20154120, BRACE20177200, BRACE20237270, BRAMY20104640, BRAMY20242470, BRAMY20271400, BRAWH20016620, BRAWH20103290, BRAWH20149340, BRCOC20021550, BRCOC20091960, BRHIP20189980, BRHIP20218580, BRHIP20238600, BRSSN20038200, CD34C30004240, CTONG20118150, CTONG20127450, CTONG20200310, FCBBF30012350, FCBBF40001730, FEBRA10001880, FEBRA20004620, FEBRA20132740, FEBRA20144170, FEHRT20003250, HCHON20007510, HLUNG20033780, IMR3220002430, KIDNE20008010, KIDNE20102710, KIDNE20107620, NT2NE20080170, NT2NE20181650, NT2RP70027380, NT2RP70036880, NT2RP70063950, NT2RP70078420, NT2RP70159960, NTONG20046140, NTONG20056570, OCBBF20028050, OCBBF20053430, OCBBF20054760, OCBBF20124360, OCBBF20127140, OCBBF20149280, OCBBF20173980, PEBLM20013120, PEBLM20085760, PROST20161950, PUAEN20015260, PUAEN20015860, PUAEN20083140, SMINT20028820, SMINT20049090, SMINT20110660, SPLEN20011410, SPLEN20121750, SPLEN20170310, SPLEN20181810, SPLEN20222270, SPLEN20250170, SPLEN20283650, TESTI20035960, TESTI20288910, TESTI20305540, TESTI20326810, TESTI20369650, TESTI20392250, TESTI20416640, TESTI20432750, TESTI20467320, THYMU20169680, THYMU20172150, THYMU20201980, THYMU20202890, TKIDN20004640, TKIDN20047480, TRACH20057690, UMVEN10001860, UTERU20146310

The clones predicted to belong to the category of transcription-related protein are the following 144 clones.

3NB6920014590, ADIPS20004250, ASTRO20008010, ASTRO20168470, BLADE20003400, BLADE20003890, BRACE20060890, BRACE20068590, BRACE20257100, BRAMY20210400, BRAMY20260910, BRAMY20270730, BRAWH20028110, BRAWH20075700, BRAWH20096780, BRCAN20280210, BRCOC20144000, BRCOC20178270, BRHIP20005340, BRHIP20096170, BRHIP20119330, BRHIP20191860, BRHIP20195890, BRHIP20222280, BRSSN20039370, BRSSN20046790, BRSSN20176820, CTONG20050280, CTONG20075860, CTONG20085950, CTONG20091080, CTONG20092700, CTONG20121010, CTONG20124220, CTONG20133390, CTONG20133520, D9OST20033970, FCBBF10001710, FCBBF10004370, FCBBF20059090, FCBBF20068820, FCBBF30007680, FCBBF30010810, FCBBF30018550, FCBBF30025560, FCBBF30057290, FCBBF30083820, FCBBF30129630, FCBBF30240960, FCBBF30246230, FEBRA20018690, FEBRA20026110, FEBRA20034680, FEBRA20040530, FEBRA20082010, FEBRA20171380, FEBRA20195820, FEBRA20233770, HCHON20008320, HCHON20009560, HCHON20035130, HHDPC10000830, HHDPC20030490, HHDPC20031130, KIDNE20027250, KIDNE20027950, KIDNE20182690, LIVER20055440, NT2NE20010490, NT2NE20089970, NT2NE20142210, NT2NE20184900, NT2RP60000770, NT2RP70043480, NT2RP70063950, NT2RP70102350, NT2RP70157890, NTONG20070200, OCBBF10001850, OCBBF20020830, OCBBF20037440, OCBBF20046120, OCBBF20049300, OCBBF20054200, OCBBF20066390, OCBBF20071840, OCBBF20080410, OCBBF20108190, OCBBF20125530, OCBBF20148280, PEBLM20060360, PEBLM20078320, PERIC20003870, PROST10003220, PROST20047390, PROST20066880, PROST20185830, PROST20189770, PROST20191640, SKNSH20008190, SMINT20001760, SMINT20028820, SMINT20130320, SMINT20144800, SPLEN20026950, SPLEN20054290, SPLEN20079260, SPLEN20095410, SPLEN20117660, SPLEN20140800, SPLEN20147390, SPLEN20160450, SPLEN20162680, SPLEN20243830, SPLEN20250170, SPLEN20252190, SPLEN20267650, STOMA20032890, STOMA20063250, TESTI20039400, TESTI20041690, TESTI20067200, TESTI20088220, TESTI20130010, TESTI20156100, TESTI20230850, TESTI20318090, TESTI20320670, TESTI20378190, TESTI20385960, TESTI20409890, TESTI20420620, TESTI20432820, TESTI20456110, THYMU20247480, TRACH20079690, TRACH20154860, TRACH20163170, TRACH20164980, TRACH20184490, UTERU20099720, UTERU20116570, UTERU20145480, UTERU20176130

The clones predicted to belong to the category of disease-related protein are the following 387 clones.

ADIPS20004250, ADRGL10001470, ADRGL20011190, ADRGL20018300, ADRGL20035850, ADRGL20078100, ASTRO10001650, ASTRO20008010, ASTRO20027430, ASTRO20106150, ASTRO20108190, ASTRO20168470, BLADE20003400, BLADE20003890, BRACE20038480, BRACE20039540, BRACE20059370, BRACE20108130, BRACE20108880, BRACE20115920, BRACE20116460, BRACE20232840, BRACE20248260, BRACE20253330, BRACE20284100, BRALZ20013500, BRALZ20017430, BRALZ20018340, BRAMY20000520, BRAMY20025840, BRAMY20120910, BRAMY20134140, BRAMY20135900, BRAMY20162510, BRAMY20174550, BRAMY20210400, BRAMY20211390, BRAMY20242470, BRAMY20245300, BRAMY20266850, BRAMY20285160, BRAWH20016620, BRAWH20028110, BRAWH20064050, BRAWH20096780, BRAWH20110960, BRAWH20113430, BRAWH20114000, BRAWH20118230, BRAWH20121640, BRAWH20128270, BRAWH20137480, BRCAN20103740, BRCAN20224720, BRCAN20279700, BRCAN20280210, BRCAN20283190, BRCOC20001860, BRCOC20006370, BRCOC20027510, BRCOC20055420, BRCOC20099370, BRCOC20178270, BRCOC20178560, BRHIP20003120, BRHIP20005340, BRHIP20174040, BRHIP20176420, BRHIP20191490, BRHIP20191860, BRHIP20194940, BRHIP20195890, BRHIP20222280, BRHIP20249110, BRHIP20285930, BRHIP30004880, BRSSN20013420, BRSSN20038200, BRSSN20039370, BRSSN20046790, BRSSN20066110, BRSSN20101100, BRSSN20120810, BRSSN20187310, BRTHA20046290, CD34C30004240, COLON10001350, CTONG20004690, CTONG20052650, CTONG20099550, CTONG20124220, CTONG20125640, CTONG20128430, CTONG20131560, CTONG20133390, CTONG20153300, CTONG20153580, CTONG20158040, CTONG20159530, D6OST20003580, D9OST20023970, DFNES20001530, DFNES20037420, FCBBF10001210, FCBBF10001710, FCBBF10003770, FCBBF20059090, FCBBF20064520, FCBBF20068820, FCBBF30010810, FCBBF30024750, FCBBF30025560, FCBBF30039020, FCBBF30049550, FCBBF30057290, FCBBF30083620, FCBBF30129630, FCBBF30190850, FCBBF30238870, FCBBF30240960, FCBBF30243640, FCBBF30279030, FCBBF30281880, FCBBF40001730, FEBRA10001880, FEBRA20004620, FEBRA20010120, FEBRA20018690, FEBRA20082010, FEBRA20097310, FEBRA20130190, FEBRA20132740, FEBRA20144170, FEBRA20195820, FEBRA20223220, FEBRA20233770, FEBRA20235500, FEHRT20003250, HCHON10001760, HCHON20007380, HCHON20008320, HCHON20009560, HCHON20015230, HCHON20015980, HCHON20016040, HCHON20035130, HCHON20036420, HCHON20064590, HCHON20067700, HCHON20086720, HCHON20100740, HEART20003060, HEART20017730, HEART20025980, HEART20049410, HHDPC20014320, HHDPC20030490, HHDPC20084140, HHDPC20091140, HHDPC20091780, HHDPC20092080, HLUNG20033780, IMR3220002430, KIDNE20007770, KIDNE20020150, KIDNE20021680, KIDNE20022620, KIDNE20024830, KIDNE20027950, KIDNE20101370, KIDNE20101510, KIDNE20182690, LIVER20002160, LIVER20055200, LIVER20055440, LIVER20059810, LIVER20064690, MESAN20101140, MESAN20125860, MESAN20130220, MESAN20154010, MESAN20174170, NOVAR10000910, NT2NE20010490, NT2NE20118960, NT2NE20157470, NT2RI20040990, NT2RI20041880, NT2RI20048840, NT2RI20050960, NT2RI20240080, NT2RP60000770, NT2RP70027380, NT2RP70032610, NT2RP70037240, NT2RP70192730, NT2RP70198350, NTONG20013620, NTONG20015870, NTONG20028070, NTONG20067830, NTONG20070200, NTONG20090600, NTONG20092330, OCBBF20006770, OCBBF20037440, OCBBF20046120, OCBBF20049300, OCBBF20053490, OCBBF20053730, OCBBF20054760, OCBBF20071840, OCBBF20072240, OCBBF20078920, OCBBF20108430, OCBBF20108580, OCBBF20127140, OCBBF20129360, OCBBF20145760, OCBBF20153350, OCBBF20173980, OCBBF20178880, PEBLM10000710, PEBLM20013120, PERIC10000250, PLACE60060420, PLACE60177140, PROST20100460, PROST20159240, PROST20169800, PROST20176170, PUAEN20018820, PUAEN20030180, PUAEN20055020, PUAEN20083140, SKMUS20018230, SKMUS20018500, SKMUS20021530, SKMUS20024750, SKMUS20029200, SKMUS20048970, SKMUS20049030, SKNSH20008190, SKNSH20089400, SMINT20001760, SMINT20026890, SMINT20028820, SMINT20050750, SMINT20073650, SMINT20105330, SMINT20112730, SMINT20121220, SMINT20127350, SMINT20127930, SMINT20136130, SMINT20138900, SMINT20153260, SMINT20155180, SMINT20179740, SMINT20190170, SMINT20191420, SPLEN20006070, SPLEN20011410, SPLEN20026950, SPLEN20027440, SPLEN20039240, SPLEN20079260, SPLEN20095410, SPLEN20146450, SPLEN20147390, SPLEN20151210, SPLEN20160450, SPLEN20170310, SPLEN20179180, SPLEN20186430, SPLEN20212730, SPLEN20243830, SPLEN20245300, SPLEN20250390, SPLEN20252190, SPLEN20267650, SPLEN20305620, STOMA20001830, STOMA20005390, STOMA20008880, STOMA20010250, STOMA20034770, STOMA20046680, STOMA20056670, STOMA20064470, STOMA20077450, STOMA20080500, STOMA20083610, STOMA20088380, SYNOV20001520, SYNOV20001730, SYNOV2.0002790, SYNOV20002970, SYNOV20007000, SYNOV20008240, SYNOV20009230, SYNOV20010880, SYNOV20011110, TBAES20003770, TESOP20004000, TESOP20005270, TESTI20031270, TESTI20036380, TESTI20044310, TESTI20067200, TESTI20116830, TESTI20121550, TESTI20156100, TESTI20168480, TESTI20208400, TESTI20215990, TESTI20231940, TESTI20234360, TESTI20237520, TESTI20238610, TESTI20239510, TESTI20249990, TESTI20266740, TESTI20316870, TESTI20318090, TESTI20335050, TESTI20335200, TESTI20343570, TESTI20352620, TESTI20368330, TESTI20369650, TESTI20385960, TESTI20392250, TESTI20400940, TESTI20404240, TESTI20420620, TESTI20436560, TESTI20438570, TESTI20441940, TESTI20442760, TESTI20443090, TESTI20449200, TESTI20455090, TESTI20455620, TESTI20456110, TESTI20463580, TESTI20465350, TESTI20465690, TESTI20467210, THYMU20122730, THYMU20126900, THYMU20130890, THYMU20159430, THYMU20169680, THYMU20172150, THYMU20180280, THYMU20193640, THYMU20209590, THYMU20232090, THYMU20247480, TKIDN10000010, TKIDN20004640, TKIDN20047480, TRACH20016210, TRACH20019960, TRACH20050040, TRACH20057690, TRACH20067620, TRACH20077540, TRACH20079690, TRACH20096610, TRACH20105870, TRACH20121380, TRACH20154860, TRACH20162860, TRACH20163170, TRACH20164980, TRACH20190240, TSTOM20005690, TUTER20002830, UTERU20030570, UTERU20116570, UTERU20144640, UTERU20151980, UTERU20158800, UTERU20183640, UTERU20185230

In particular, hit data of the following 386 clones for Swiss-Prot, or GenBank, UniGene, or nr corresponded to genes or proteins which had been deposited in the Online Mendelian Inheritance in Man (OMIM), which is the human gene and disease database, (the OMIM Number is shown in the parenthesis after the Clone Name).

ADIPS20004250 (601505), ADRGL10001470 (202010;103900), ADRGL20011190 (182790), ADRGL20018300 (600025), ADRGL20035850 (202110), ADRGL20078100 (103270), ASTRO10001650 (126660), ASTRO20008010 (603899), ASTRO20027430 (179555), ASTRO20106150 (602537), ASTRO20108190 (191092), ASTRO20168470 (604077), BLADE20003400 (601276), BLADE20003890 (604077), BRACE20038480 (601504), BRACE20039540 (600169), BRACE20059370 (130500;266140), BRACE20108130 (605413), BRACE20108880 (603758), BRACE20115920 (300023),

BRACE20116460 (603150), BRACE20232840 (601213), BRACE20248260 (600813), BRACE20253330 (604990), BRACE20284100 (602415), BRALZ20013500 (602470), BRALZ20017430 (600658), BRALZ20018340 (600547), BRAMY20000520 (164020), BRAMY20025840 (602327), BRAMY20120910 (600188), BRAMY20134140 (603931), BRAMY20135900 (601342), BRAMY20162510 (300098), BRAMY20174550 (605464), BRAMY20210400 (603809), BRAMY20211390 (602212), BRAMY20242470 (605000), BRAMY20245300 (605367), BRAMY20266850 (605609), BRAMY20285160 (120700), BRAWH20016620 (605762), BRAWH20028110 (602330), BRAWH20064050 (135820), BRAWH20096780 (602277), BRAWH20110960 (603481), BRAWH20113430 (602649), BRAWH20114000 (138130), BRAWH20118230 (112267), BRAWH20121640 (604437), BRAWH20128270 (601997), BRAWH20137480 (602330), BRCAN20103740 (602566), BRCAN20224720 (600923;176200), BRCAN20279700 (604205), BRCAN20280210 (194538), BRCAN20283190 (602118), BRCOC20001860 (604346), BRCOC20006370 (603784), BRCOC20027510 (179555), BRCOC20055420 (603801), BRCOC20099370 (606045), BRCOC20178270 (194558), BRCOC20178560 (602567), BRHIP20003120 (604249), BRHIP20005340 (147586), BRHIP20174040 (602658), BRHIP20176420 (164020), BRHIP20191490 (600009), BRHIP20191860 (602272), BRHIP20194940 (604696), BRHIP20195890 (602211), BRHIP20222280 (603899), BRHIP20249110 (142600), BRHIP20285930 (602626), BRHIP30004880 (188840), BRSSN20013420 (300272), BRSSN20038200 (602306), BRSSN20039370 (194531), BRSSN20046790 (604077), BRSSN20066110 (605248), BRSSN20101100 (600188), BRSSN20120810 (142440), BRSSN20187310 (182900), BRTHA20046290 (602644), COLON10001350 (146900), CTONG20004690 (600019), CTONG20052650 (603871), CTONG20099550 (190370), CTONG20124220 (184756), CTONG20125640 (180510), CTONG20128430 (601797), CTONG20131560 (103390), CTONG20133390 (604077), CTONG20153300 (604334), CTONG20153580 (605652), CTONG20158040 (602862), CTONG20159530 (600395), D6OST20003580 (602443), D9OST20023970 (601525), DFNES20001530 (164500), DFNES20037420 (139259), FCBBF10001210 (602461), FCBBF10001710 (194558), FCBBF10003770 (604597), FCBBF20059090 (194542), FCBBF20064520 (164020), FCBBF20068820 (194558), FCBBF30010810 (603899), FCBBF30024750 (603706), FCBBF30025560 (600494), FCBBF30039020 (602835), FCBBF30049550 (106410), FCBBF30057290 (194556), FCBBF30083620 (300022), FCBBF30129630 (603899), FCBBF30190850 (131210), FCBBF30238870 (602320), FCBBF30240960 (604078), FCBBF30243640 (601961), FCBBF30279030 (605208), FCBBF30281880 (602517), FCBBF40001730 (176981), FEBRA10001880 (605451), FEBRA20004620 (600278), FEBRA20010120 (600368), FEBRA20018690 (194542), FEBRA20082010 (602187), FEBRA20097310 (602895), FEBRA20130190 (605863), FEBRA20132740 (602654), FEBRA20144170 (601685), FEBRA20195820 (604074), FEBRA20223220 (604633), FEBRA20233770 (603347), FEBRA20235500 (312090), FEHRT20003250 (600286), HCHON10001760 (605315), HCHON20007380 (600833), HCHON20008320 (604077), HCHON20009560 (194548), HCHON20015230 (604646), HCHON20015980 (604789), HCHON20016040 (146732), HCHON20035130 (194529), HCHON20036420 (603434), HCHON20064590 (103950), HCHON20067700 (603054), HCHON20086720 (146732), HCHON20100740 (602281), HEART20003060 (109480), HEART20017730 (106410), HEART20025980 (602127), HEART20049410 (603777), HHDPC20014320 (602714), HHDPC20030490 (603795), HHDPC20084140 (605184), HHDPC20091140 (603054), HHDPC20091780 (227400), HHDPC20092080 (146732), HLUNG20033780 (600888), IMR3220002430 (602923), KIDNE20007770 (114890), KIDNE20020150 (140550;603012), KIDNE20021680 (601609), KIDNE20022620 (603590), KIDNE20024830 (604205), KIDNE20027950 (194531), KIDNE20101370 (602580), KIDNE20101510 (191845), KIDNE20182690 (605226), LIVER20002160 (600816), LIVER20055200 (604814), LIVER20055440 (605277), LIVER20059810 (230350), LIVER20064690 (601841), MESAN20101140 (602567), MESAN20125860 (155750), MESAN20130220 (603778), MESAN20154010 (180480), MESAN20174170 (602516), NOVAR10000910 (159350), NT2NE20010490 (603899), NT2NE20118960 (180490), NT2NE20157470 (217000), NT2RI20040990 (106410), NT2RI20041880 (160775), NT2RI20048840 (139360), NT2RI20050960 (606103), NT2RI20240080 (603419), NT2RP60000770 (603044), NT2RP70027380 (118423), NT2RP70032610 (172430), NT2RP70037240 (604108), NT2RP70192730 (278000), NT2RP70198350 (300043), NTONG20013620 (604125), NTONG20015870 (123940), NTONG20028070 (602369), NTONG20067830 (182900), NTONG20070200 (194558), NTONG20090600 (313440), NTONG20092330 (153700), OCBBF20006770 (154500), OCBBF20037440 (602290), OCBBF20046120 (601262), OCBBF20049300 (602277), OCBBF20053490 (154550;602579), OCBBF20053730 (603604), OCBBF20054760 (603453), OCBBF20071840 (604077), OCBBF20072240 (604331), OCBBF20078920 (602120), OCBBF20108430 (139360), OCBBF20108580 (300103), OCBBF20127140 (139380), OCBBF20129360 (602142), OCBBF20145760 (600395), OCBBF20153350 (601935), OCBBF20173980 (603524), OCBBF20178880 (601617), PEBLM10000710 (601007), PEBLM20013120 (602288), PERIC10000250 (603582), PLACE60060420 (180469), PLACE60177140 (600022), PROST20100460 (158374), PROST20159240 (606019), PROST20169800 (604426), PROST20176170 (605903), PUAEN20018820 (164740), PUAEN20030180 (603263), PUAEN20055020 (604677), PUAEN20083140 (604762), SKMUS20018230 (603768), SKMUS20018500 (601402), SKMUS20021530 (606045), SKMUS20024750 (179555), SKMUS20029200 (605758), SKMUS20048970 (102610), SKMUS20049030 (161650), SKNSH20008190 (604075), SKNSH20089400 (603070), SMINT20001760 (194558), SMINT20026890 (602127), SMINT20028820 (604719), SMINT20050750 (182120), SMINT20073650 (146900), SMINT20105330 (230500;230600;230650;253010), SMINT20112730 (146900), SMINT20121220 (160776), SMINT20127350 (180740), SMINT20127930 (146900), SMINT20136130 (147220), SMINT20138900 (125660;601419), SMINT20153260 (602201), SMINT20155180 (603004), SMINT20179740 (147020), SMINT20190170 (146900), SMINT20191420 (102770),

SPLEN20006070 (182900), SPLEN20011410 (602732), SPLEN20026950 (600014), SPLEN20027440 (106410), SPLEN20039240 (140550;603012), SPLEN20079260 (604074), SPLEN20095410 (602277), SPLEN20146450 (602861), SPLEN20147390 (604078), SPLEN20151210 (600267), SPLEN20160450 (604375), SPLEN20170310 (605216), SPLEN20179180 (605890), SPLEN20186430 (600052), SPLEN20212730 (114230), SPLEN20243830 (601796), SPLEN20245300 (606004), SPLEN20250390 (114220), SPLEN20252190 (604077), SPLEN20267650 (602277), SPLEN20305620 (126064), STOMA20001830 (146900), STOMA20005390 (146900), STOMA20008880 (601652;137750), STOMA20010250 (605786), STOMA20034770 (146900), STOMA20046680 (164772), STOMA20056670 (146900), STOMA20064470 (173320), STOMA20077450 (314370), STOMA20080500 (605414), STOMA20083610 (146900), STOMA20088380 (146900), SYNOV20001520 (147200), SYNOV20001730 (147120), SYNOV20002790 (147120), SYNOV20002970 (147120), SYNOV20007000 (147120), SYNOV20008240 (147120), SYNOV20009230 (146900), SYNOV20010880 (147120), SYNOV20011110 (147120), TBAES20003770 (118990), TESOP20004000 (116810), TESOP20005270 (600641), TESTI20031270 (191161), TESTI20036380 (126650;214700), TESTI20044310 (179555), TESTI20067200 (176312), TESTI20116830 (603142), TESTI20121550 (600862), TESTI20156100 (602253), TESTI20168480 (188840), TESTI20208400 (164031), TESTI20215990 (605652), TESTI20231940 (604200), TESTI20234360 (601052), TESTI20237520 (604212), TESTI20238610 (300097), TESTI20239510 (604334),

TESTI20249990 (164500), TESTI20266740 (605198), TESTI20316870 (605497), TESTI20318090 (604077), TESTI20335050 (605209), TESTI20335200 (109770), TESTI20343570 (190470), TESTI20352620 (176801;249900), TESTI20368330 (157680), TESTI20369650 (602052), TESTI20385960 (605970), TESTI20392250 (605541), TESTI20400940 (117143), TESTI20404240 (602725), TESTI20420620 (602955), TESTI20436560 (150330), TESTI20438570 (603577), TESTI20441940 (604119), TESTI20442760 (603491), TESTI20443090 (602954), TESTI20449200 (604101),

TESTI20455090 (148070), TESTI20455620 (140560), TESTI20456110 (109092), TESTI20463580 (603486), TESTI20465350 (123830), TESTI20465690 (605468), TESTI20467210 (600833), THYMU20122730 (604700), THYMU20126900 (603370), THYMU20130890 (603675), THYMU20159430 (146900), THYMU20169680 (601441), THYMU20172150 (605000), THYMU20180280 (600549), THYMU20193640 (603083;164021), THYMU20209590 (602378), THYMU20232090 (601717), THYMU20247480 (604077), TKIDN10000010 (605034), TKIDN20004640 (137028), TKIDN20047480 (602399), TRACH20016210 (136836), TRACH20019960 (182310), TRACH20050040 (603784), TRACH20057690 (164731), TRACH20067620 (600429;110800), TRACH20077540 (300080), TRACH20079690 (604078), TRACH20096610 (150330), TRACH20105870 (600495), TRACH20121380 (602513), TRACH20154860 (180240), TRACH20162860 (603845), TRACH20163170 (601739), TRACH20164980 (602277), TRACH20190240 (604633), TSTOM20005690 (605775), TUTER20002830 (602719), UTERU20030570 (602023;241200), UTERU20116570 (602330),

UTERU20144640 (228000), UTERU20151980 (602038), UTERU20158800 (600738), UTERU20183640 (601281), UTERU20185230 (605333)

The clones predicted to belong to the category of enzyme and/or metabolism-related protein are the following 206 clones.

3NB6910001910, ADRGL10001470, ADRGL20035850, ADRGL20078100, ASTRO20105820, ASTRO20106150, ASTRO20130500, ASTRO20145760, BRACE20027620, BRACE20038000, BRACE20062640, BRACE20096200, BRACE20107530, BRACE20108130, BRACE20108880, BRACE20116460, BRACE20148240, BRACE20185680, BRACE20253160, BRALZ20017430, BRALZ20018340, BRAMY20104640, BRAMY20134140, BRAMY20153110, BRAMY20213100, BRAMY20252720, BRAWH20016620, BRAWH20105840, BRAWH20112940, BRAWH20114000, BRAWH20117950, BRAWH20125380, BRAWH20132190, BRAWH20171030, BRCAN20054490, BRCAN20224720, BRCAN20280360, BRCAN20283190, BRCAN20283380, BRCOC20001860, BRCOC20031250, BRCOC20055420, BRCOC20091960, BRCOC20144000, BRHIP10001290, BRHIP20005530, BRHIP20096850, BRHIP20103090, BRHIP20174040, BRHIP20249110, BRSSN20013420, BRSSN20015790, BRSSN20120810, BRSSN20146100, CTONG20095340, CTONG20106520, CTONG20118250, CTONG20127450, CTONG20140580, CTONG20153300, CTONG20158040, D3OST20006180, D6OST20003580, DFNES20031920, DFNES20071130, FCBBF10001820, FCBBF10003670, FCBBF30012350, FCBBF30012810, FCBBF30175310, FCBBF30243640, FEBRA10001880, FEBRA20007620, FEBRA20130190, FEBRA20144170, FEBRA20167390, FEBRA20196630, FEHRT20003250, HCHON10001760, HCHON20003220, HCHON20015350, HEART20034320, HEART20090000, HHDPC20014320, KIDNE20002520, KIDNE20008010, KIDNE20021680, KIDNE20022620, KIDNE20028390, KIDNE20028720, KIDNE20107620, LIVER20059810, MESAN20154010, NT2NE20118960, NT2NE20157470, NT2RI20005750, NT2RI20244600, NT2RI20273230, NT2RP70032610, NT2RP70045590, NT2RP70192730, NT2RP70195430, NTONG20009770, NTONG20013620, NTONG20046140, OCBBF20028650, OCBBF20030910, OCBBF20046690, OCBBF20050770, OCBBF20053430, OCBBF20053490, OCBBF20053730, OCBBF20054760, OCBBF20078920, OCBBF20124360, OCBBF20129360, OCBBF20178880, PEBLM20044520, PEBLM20052820, PEBLM20060490, PERIC10000250, PLACE50000660, PROST20083600, PROST20169800, PUAEN20015260, PUAEN20030180, SKMUS20018230, SMINT20028820, SMINT20049090, SMINT20102780, SMINT20105330, SMINT20106290, SMINT20110660, SMINT20152940, SMINT20191420, SMINT20191530, SPLEN20021660, SPLEN20026950, SPLEN20121750, SPLEN20145720, SPLEN20149240, SPLEN20150940, SPLEN20151210, SPLEN20173510, SPLEN20212730, SPLEN20250390, SPLEN20305620, STOMA20006860, STOMA20077450, TBAES20002550, TBAES20003150, TESOP20004000, TESOP20005270, TESTI20001000, TESTI20002720, TESTI20002780, TESTI20060400, TESTI20066670, TESTI20082330, TESTI20083200, TESTI20108720, TESTI20116830, TESTI20143390, TESTI20148000, TESTI20216370, TESTI20232140, TESTI20234360, TESTI20237520, TESTI20239510, TESTI20266740, TESTI20314180, TESTI20334410, TESTI20343570, TESTI20352620, TESTI20355020, TESTI20366910, TESTI20368330, TESTI20369650, TESTI20375340, TESTI20397760, TESTI20416640, TESTI20432750, TESTI20463580, TESTI20465350, TESTI20471410, TESTI20473830, THYMU20023380, THYMU20111830, THYMU20126900, THYMU20169680, THYMU20202890, TKIDN20004640, TKIDN20047480, TRACH20003590, TRACH20016210, TRACH20019960, TRACH20041830, TRACH20057690, TRACH20067620, TRACH20084720, TRACH20085830, TRACH20162860, UTERU20064860, UTERU20144640, UTERU20146310, UTERU20151980

The clones predicted to belong to the category of cytoskeleton-related protein are the following 75 clones.

ADRGL20011190, ADRGL20018300, ASTRO10001650, ASTRO20055750, BRACE20003070, BRACE20059370, BRACE20163350, BRAMY20121620, BRAMY20157820, BRAMY20242470, BRAWH20028110, BRAWH20137480, BRCAN20003460, BRCOC20008160, BRCOC20059510, BRHIP20115080, BRHIP20137230, BRHIP20167880, BRHIP20283030, BRHIP20285830, BRSSN20187310, CTONG10002770, CTONG20052900, CTONG20121580, FCBBF10001150, FCBBF30013770, FCBBF30015940, FCBBF30049550, FEBRA20024100, FEBRA20237640, HCHON20015980, HCHON20068410, HEART20017730, HEART20025980, HEART20061950, HEART20077670, HLUNG20016330, KIDNE20118580, MESAN20004570, NT2RI20040990, NT2RI20041880, NT2RP70037240, NT2RP70062230, NTONG20015870, NTONG20056570, NTONG20067830, NTONG20090600, OCBBF20107090, OCBBF20155060, PLACE60079250, PUAEN20040670, SKMUS20001980, SKMUS20016220, SKMUS20048970, SKMUS20049030, SMINT20024570, SMINT20026890, SMINT20121220, SMINT20138900, SPLEN20006070, SPLEN20027440, SPLEN20142100, TESTI20063830, TESTI20094230, TESTI20278400, TESTI20371030, TESTI20417300, TESTI20436560, TESTI20455090, THYMU20105190, THYMU20172150, THYMU20209590, TRACH20096610, UMVEN10001560, UTERU20116570

The clones predicted to belong to the category of nuclear protein and/or RNA synthesis-related protein are the following 65 clones.

BRACE20057190, BRACE20064880, BRACE20248260, BRACE20253160, BRAMY20000520, BRAMY20120910, BRAWH20113430, BRAWH20171030, BRCAN10001490, BRCAN20283190, BRCOC20037320, BRCOC20178560, BRHIP20106100, BRHIP20176420, BRHIP20243470, BRSSN20101100, CTONG20114290, CTONG20125540, CTONG20131560, CTONG20140580, DFNES20001530, FCBBF20064520, FEBRA20007620, FEBRA20010120, FEBRA20097310, FEBRA20144170, FEBRA20174410, FEBRA20215500, IMR3220002430, MESAN20101140, NT2RI20273230, OCBBF20028650, OCBBF20030910, OCBBF20078920, PROST20104000, PUAEN20018820, SKMUS20007010, SMINT20127350, SMINT20177360, SMINT20191530, SPLEN20008740, SPLEN20146450, STOMA20046680, TESTI20082330, TESTI20094470, TESTI20121550, TESTI20208400, TESTI20234360, TESTI20237520, TESTI20249990, TESTI20334410, TESTI20355020, TESTI20368330, TESTI20392760, TESTI20408970, TESTI20436560, TESTI20438570, TESTI20443090, THYMU20193640, THYMU20202890, THYMU20241210, TRACH20096610, TUTER20002830, UTERU20151980, UTERU20176320

The clones predicted to belong to the category of protein synthesis and/or transport-related protein are the following 62 clones.

3NB6910001910, ASTRO20106150, ASTRO20130500, ASTRO20141350, BRACE20038480, BRACE20052160, BRACE20057620, BRACE20106840, BRACE20172980, BRACE20192440, BRAWH20110960, BRCOC20037320, BRHIP20005530, BRSSN20120810, BRSTN20005360, CTONG20009770, CTONG20114290, CTONG20125640, CTONG20153300, D6OST20003580, DFNES20037420, FCBBF30012810, FEBRA20080810, HCHON20064590, HHDPC20014320, HHDPC20084140, HLUNG20017120, LIVER20064690, NT2NE20132170, NT2NE20157470, NT2RP70133740, NTONG20009770, NTONG20075220, NTONG20076930, OCBBF20030910, OCBBF20035930, OCBBF20153340, PLACE60060420, SMINT20152940, SPLEN20008740, SPLEN20103950, SPLEN20118300, SPLEN20212730, SPLEN20250390, STOMA20077450, TBAES20002550, TESOP20004000, TESTI20239510, TESTI20278400, TESTI20314180, TESTI20463580, THYMU20111830, THYMU20122730, THYMU20130890, THYMU20232090, TKIDN10000010, TRACH20084720, TRACH20105870, TRACH20139820, TRACH20149970, UTERU20120310, UTERU20188110

The clones predicted to belong to the category of cellular defense-related protein are the following 15 clones.

BRCOC20144000, CTONG20092680, KIDNE20020150, LIVER20002160, NT2RI20050960, NT2RP70045590, OCBBF20128120, PLACE60003480, SKNSH20089400, SMINT20106290, SPLEN20039240, TESTI20001000, TESTI20455620, TRACH20028030, UTERU20176320

The clones predicted to belong to the category of development and/or differentiation-related protein are the following 13 clones.

3NB6920014590, BRAMY20211390, CTONG20091080, CTONG20121010, FCBBF30024750, KIDNE20027250, NT2NE20142210, OCBBF20054200, PROST10003220, SKMUS20007010, SPLEN20179810, STOMA20063250, TESTI20291960

The clones predicted to belong to the category of DNA-binding and/or RNA-binding protein are the following 174 clones.

3NB6920014590, ADIPS20004250, ASTRO20008010, ASTRO20168470, BLADE20003400, BLADE20003890, BRACE20057620, BRACE20060890, BRACE20064880, BRACE20068590, BRACE20248260, BRACE20253160, BRAMY20000520, BRAMY20213100, BRAMY20260910, BRAMY20270730, BRAWH20028110, BRAWH20075700, BRAWH20096780, BRAWH20113430, BRCAN10001490, BRCAN20280210, BRCAN20283190, BRCOC20144000, BRCOC20178270, BRCOC20178560, BRHIP20005340, BRHIP20106100, BRHIP20119330, BRHIP20153600, BRHIP20176420, BRHIP20191860, BRHIP20195890, BRHIP20222280, BRSSN20039370, BRSSN20046790, BRSSN20176820, CTONG20050280, CTONG20075860, CTONG20085950, CTONG20091080, CTONG20092700, CTONG20121010, CTONG20124220, CTONG20125540, CTONG20133390, CTONG20133520, CTONG20140580, CTONG20156780, D9OST20033970, FCBBF10001710, FCBBF10004370, FCBBF20059090, FCBBF20064520, FCBBF20068820, FCBBF30007680, FCBBF30010810, FCBBF30018550, FCBBF30025560, FCBBF30057290, FCBBF30083820, FCBBF30129630, FCBBF30240960, FCBBF30246230, FEBRA20010120, FEBRA20018690, FEBRA20026110, FEBRA20034680, FEBRA20040530, FEBRA20082010, FEBRA20097310, FEBRA20171380, FEBRA20195820, FEBRA20196630, FEBRA20233770, HCHON20008320, HCHON20009560, HCHON20035130, HHDPC10000830, HHDPC20031130, KIDNE20017130, KIDNE20027250, KIDNE20027950, KIDNE20107390, KIDNE20182690, LIVER20055440, MESAN20101140, NT2NE20010490, NT2NE20089970, NT2NE20142210, NT2NE20184900, NT2RP60000770, NT2RP70044280, NT2RP70102350, NT2RP70157890, NTONG20070200, OCBBF10001850, OCBBF20020830, OCBBF20037440, OCBBF20046120, OCBBF20049300, OCBBF20066390, OCBBF20071840, OCBBF20078920, OCBBF20080410, OCBBF20108190, OCBBF20125530, OCBBF20148280, PEBLM20060360, PEBLM20060490, PEBLM20078320, PERIC10000250, PROST10003220, PROST20047390, PROST20066880, PROST20185830, PROST20189770, PROST20191640, PUAEN20018820, SKNSH20008190, SKNSH20089400, SMINT20001760, SMINT20127350, SMINT20144800, SMINT20177360, SMINT20191530, SPLEN20054290, SPLEN20079260, SPLEN20095410, SPLEN20140800, SPLEN20147390, SPLEN20160450, SPLEN20252190, SPLEN20267650, STOMA20010250, STOMA20032890, STOMA20046680, STOMA20063250, TESTI20039400, TESTI20067200, TESTI20088220, TESTI20094470, TESTI20121550, TESTI20130010, TESTI20156100, TESTI20204450, TESTI20230850, TESTI20237520, TESTI20266740, TESTI20318090, TESTI20320670, TESTI20334410, TESTI20355020, TESTI20378190, TESTI20385960, TESTI20432820, TESTI20443090, TESTI20456110, THYMU20193640, THYMU20241210, THYMU20247480, TRACH20079690, TRACH20105870, TRACH20139820, TRACH20154860, TRACH20163170, TRACH20164980, TRACH20184490, TUTER20002830, UTERU20099720, UTERU20116570, UTERU20145480, UTERU20176130, UTERU20185230

The clones predicted to belong to the category of ATP binding and/or GTP-binding protein are the following 68 clones.

3NB6910001910, BRACE20108130, BRACE20148240, BRAMY20134140, BRAMY20157820, BRAMY20174550, BRAWH20164460, BRCAN20003460, BRCAN20054490, BRCAN20283190, BRCOC20059510, BRCOC20144000, BRHIP20103090, BRHIP20115080, BRHIP20167880, BRSTN20005360, CD34C30004240, CTONG20095340, CTONG20121580, CTONG20200310, DFNES20037420, FCBBF20067810, FCBBF30012350, FCBBF30015940, FEBRA20007620, FEBRA20024100, FEBRA20144170, KIDNE20020150, KIDNE20028720, LIVER20002160, LIVER20087060, NT2RI20005750, NT2RI20041880, NT2RI20048840, NT2RI20273230, OCBBF20028650, OCBBF20046690, OCBBF20054760, OCBBF20108430, OCBBF20108630, SMINT20121220, SMINT20183530, SMINT20191530, SPLEN20026950, SPLEN20039240, SPLEN20099700, SPLEN20145720, SPLEN20179180, STOMA20006860, TESTI20035960, TESTI20355020, TESTI20397760, TESTI20400940, TESTI20417300, TESTI20443090, TESTI20455620, THYMU20105190, THYMU20202890, THYMU20209590, TKIDN20004640, TKIDN20047480, TRACH20005400, TRACH20019960, TRACH20057690, TRACH20084720, UTERU20168220, UTERU20176320, UTERU20185230

Among the clones other than the ones shown above, BRAMY20248490, FCBBF10002800, NTONG20092290, OCBBF20127040, SMINT20163960, THYMU20279750, TRACH20167220, are clones which were predicted to highly possibly belong to the category of secretory protein and/or membrane protein based on the result of domain search by Pfam.

FCBBF10002800, NTONG20092290, OCBBF20127040, SMINT20163960, TESTI20478850, THYMU20279750

The 6 clones shown above are clones which were predicted to highly possibly belong to the category of glycoprotein-related protein based on the result of domain search by Pfam.

BRACE20060720, BRACE20223330, BRALZ20058880, BRAMY20148130, BRAWH20101360, BRCAN20124080, BRHIP20253660, CTONG10000620, CTONG20014280, CTONG20124010, KIDNE20109890, MESAN20171520, OCBBF20109310, OCBBF20140640, PROST20079500, PUAEN20078980, SPLEN20077500, SPLEN20143180, TESTI20017950, TESTI20184620,

TESTI20208710, TESTI20211160, TESTI20226230, TESTI20234140, TESTI20258460, TESTI20275030

The 26 clones shown above are clones which were predicted to highly possibly belong to the category of signal transduction-related protein based on the result of domain search by Pfam.

ADRGL20048330, ASTRO20064750, ASTRO20084250, BRACE20151320, BRALZ20058880, BRHIP20207990, CTONG20093950, FCBBF30195640, FEBRA10001900, FEBRA20090290, FEBRA20214970, FEBRA20222040, KIDNE20109890, LIVER20087510, MESAN20029400, MESAN20031900, MESAN20035290, MESAN20136110, NT2NE20130190, PEBLM20060310, PERIC20004780, PROST20171280, PUAEN20078980, SMINT20115880, SPLEN20095550, TESTI20023510, TESTI20083940, TESTI20152460, TESTI20185650, TESTI20189410, TESTI20200710, TESTI20308600, TESTI20343070, TESTI20369690, TESTI20381040, UTERU20050690

The 36 clones shown above are clones which were predicted to highly possibly belong to the category of transcription-related protein based on the result of domain search by Pfam.

BGGI120006160, BRACE20053480, BRACE20190040, BRACE20223330, BRAWH20101360, BRAWH20185060, BRCOC20023230, BRHIP20252450, BRSSN20105870, BRSSN20117990, BRTHA20000570, CTONG20098440, CTONG20129960, CTONG20146300, CTONG20155180, FEBRA20025270, HEART20083640, KIDNE20009470, LIVER20035680, MESAN20029400, MESAN20031900, MESAN20186700, NOVAR10000150, NTONG20029480, OCBBF20079310, OCBBF20082830, PEBLM20042900, PLACE60136500, PLACE60136720, PROST20114390, SKNSH20020540, SMINT20013480, SMINT20174360, SPLEN20077500, SPLEN20119810, SPLEN20126190, SPLEN20174260, SPLEN20211220, TESTI20046750, TESTI20057750, TESTI20061110, TESTI20197940, TESTI20211160, TESTI20226230, TESTI20255820, TESTI20317600, TESTI20377230, THYMU20111180, THYMU20115850, THYMU20143270, THYMU20240710, UTERU20055330, UTERU20055930, UTERU20064000, UTERU20119060

The 55 clones shown above are clones which were predicted to highly possibly belong to the category of enzyme and/or metabolism-related protein based on the result of domain search by Pfam.

TESTI20127760, TESTI20392270

The 2 clones shown above are clones which were predicted to highly possibly belong to the category of cell division and/or cell proliferation-related protein based on the result of domain search by Pfam.

FCBBF30262510, MESAN20031900, NT2NE20125050, SMINT20068010, SPLEN20163560, STOMA20092890, TESTI20382750

The 7 clones shown above are clones which were predicted to highly possibly belong to the category of cytoskeleton-related protein based on the result of domain search by Pfam.


The clone shown above is clone which were predicted to highly possibly belong to the category of nuclear protein and/or RNA synthesis-related protein based on the result of domain search by Pfam.

BRACE20053480, BRACE20240740, KIDNE20009470, OCBBF20140890, SMINT20035690, UTERU20064000

The 6 clones shown above are clones which were predicted to highly possibly belong to the category of protein synthesis and/or transport-related protein based on the result of domain search by Pfam.

ADRGL20048330, ASTRO20064750, ASTRO20084250, BRACE20151320, BRACE20190040, BRACE20223330, BRALZ20058880, BRAMY20103570, BRCOC20023230, BRHIP20207990, BRTHA20000570, CTONG20093950, CTONG20129960, CTONG20146300, CTONG20155180, CTONG20160560, FCBBF10004120, FCBBF30195640, FEBRA10001900, FEBRA20090290, FEBRA20214970, FEBRA20222040, HCHON20008150, HEART20083640, KIDNE20109890, LIVER20035680, LIVER20087510, MESAN20029400, MESAN20031900, MESAN20035290, MESAN20136110, MESAN20186700, NT2NE20130190, NT2RI20025640, NTONG20029480, PEBLM20060310, PERIC20004780, PROST20114390, PROST20171280, PUAEN20078980, SMINT20115880, SPLEN20095550, SPLEN20119810, TESTI20023510, TESTI20057750, TESTI20083940, TESTI20152460, TESTI20185650, TESTI20189410, TESTI20200710, TESTI20308600, TESTI20343070, TESTI20369690, TESTI20381040, THYMU20115850, UTERU20050690, UTERU20055330

The 57 clones shown above are clones which were predicted to highly possibly belong to the category of DNA-binding and/or RNA-binding protein based on the result of domain search by Pfam.


The clone shown above is a clone which was predicted to highly possibly belong to the category of ATP-binding and/or GTP-binding protein based on the result of domain search by Pfam.

The 213 clones shown below are clones which were unassignable to any of the above-mentioned categories, but have been predicted to have some functions based on homology search for their full-length nucleotide sequences and motif search in their deduced ORFs. Clone Name, Definition in the result of homology search or Motif Name in the motif search, demarcated by a double slash mark (//), are shown below.

ADRGL20028570//Rattus norvegicus MG87 mRNA, complete cds.

ADRGL20061930//transposon-derived Buster1 transposase-like protein

ASTRO20012490//Eukaryotic initiation factor 1A


ASTRO20114370//Mus musculus SMAR1 mRNA, complete cds.

ASTRO20125520//dnaj protein [Schizosaccharomyces pombe]

ASTRO20143630//KH domain// Bacterial regulatory proteins, crp family

ASTRO20155290//TPR Domain// TPR Domain// TPR Domain

ASTRO20181690//oocyte-specific protein P100

BGGI110001930//UBX domain

BRACE20011070//Mus musculus F-box protein FBX15 mRNA, partial cds.

BRACE20039440//Drosophila melanogaster CHARYBDE (charybde) mRNA, complete cds.

BRACE20050900//TPR Domain// TPR Domain// TPR Domain// TPR Domain

BRACE20053280//Mus musculus Pdz-containing protein (Pdzx) mRNA, complete cds.

BRACE20057730//toxin sensitivity protein KTI12 homolog

BRACE20058580//Homo sapiens HCMOGT-1 mRNA for sperm antigen, complete cds.

BRACE20063780//NOL1/NOP2/sun family

BRACE20269200//Heat-labile enterotoxin alpha chain

BRACE20276430//Homo sapiens retinoblastoma-associated protein RAP140 mRNA, complete cds.

BRACE20286360//Alpha adaptin carboxyl-terminal domain

BRAMY10001300//Homo sapiens MAGE-E1b mRNA, complete cds.

BRAMY20045240//Flagellar L-ring protein

BRAMY20054880//Rattus norvegicus KPL2 (Kpl2) mRNA, complete cds.

BRAMY20167060//Collagen triple helix repeat (20 copies)

BRAMY20184670//Homo sapiens mRNA for ALEX1, complete cds.

BRAMY20217460//Homo sapiens cardiac voltage gated potassium channel modulatory subunit mRNA, complete cds, alternatively spliced.

BRAMY20240040//Homo sapiens suppressor of white apricot homolog 2 (SWAP2) mRNA, complete cds.

BRAMY20247110//Mus musculus semaphorin cytoplasmic domain-associated protein 3A (Semcap3) mRNA, complete cds.

BRAWH20004600//Mus musculus mRNA for NAKAP95, complete cds.

BRAWH20011710//cytoplasmic linker 2

BRAWH20012390//Trichomonas vaginalis mRNA for centrin (ce1 gene).

BRAWH20017010//Homo sapiens testes development-related NYD-SP22 mRNA, complete cds.

BRAWH20029630//Homo sapiens bet3 (BET3) mRNA, complete cds.

BRAWH20138660//Homo sapiens stonin 2 mRNA, complete cds.

BRCOC20008500//Human ras inhibitor mRNA, 3′ end.

BRCOC20026640//Gag P30 core shell protein



BRCOC20110100//Integrase core domain

BRCOC20176520//Rattus norvegicus mRNA for type II brain 4.1, complete cds.

BRHIP20001630//Protein of unknown function DUF16

BRHIP20132860//Homo sapiens rhophilin-like protein mRNA, complete cds.

BRHIP20143730//MYND finger

BRHIP20175420//Mus musculus partial mRNA for stretch responsive protein 278 (sr278 gene).

BRHIP20236950//Outer Capsid protein VP4 (Hemagglutinin)


BRSSN20018690//Homo sapiens NY-REN-25 antigen mRNA, partial cds.



BRSTN10000830//Kelch motif// Kelch motif// Kelch motif// Kelch motif

CTONG10000220//Mus musculus cerebellar postnatal development protein-1 (Cpd1) mRNA, partial cds.

CTONG10000930//Armadillo/beta-catenin-like repeats

CTONG20027090//Glypican// Leucine Rich Repeat// Leucine Rich Repeat



CTONG20100240//Mus musculus radial spokehead-L protein (Rshl1) mRNA, complete cds.

CTONG20139860//Homo sapiens nasopharyngeal carcinoma susceptibility protein LZ16 mRNA, complete cds.

CTONG20143690//MYND finger


CTONG20165050//Keratin, high sulfur B2 protein



D3OST20024360//Homo sapiens neuroendocrine differentiation factor mRNA, complete cds.

D9OST20031370//Homo sapiens mRNA for partial putative TCPTP-interacting protein (ptpip5 gene).


FCBBF10000630//Homo sapiens huntingtin interacting protein HYPB mRNA, partial cds.

FCBBF10000770//Homo sapiens REC8 mRNA, partial cds.


FCBBF10005500//Keratin, high sulfur B2 protein


FCBBF20042170//Homo sapiens NIBAN mRNA, complete cds.

FCBBF30016320//SecA protein, amino terminal region

FCBBF30033050//Sm protein

FCBBF30054440//PLAT/LH2 domain

FCBBF30225660//Ank repeat// Ank repeat// Ank repeat// K+ channel tetramerisation domain// BTB/POZ domain

FCBBF30233680//G10 protein

FCBBF30246630//H. sapiens mRNA for ZYG homologue.


FCBBF30252520//Homo sapiens bicaudal-D (BICD) mRNA, alternatively spliced, partial cds.


FCBBF30252850//Mus musculus peripherial benzodiazepine receptor associated protein (Pap7) mRNA, complete cds.

FCBBF30285280//Keratin, high sulfur B2 protein// Bacterial regulatory proteins, gntR family


FEBRA20184330//Rattus norvegicus glutamate receptor interacting protein 2 (GRIP2) mRNA, complete cds.

FEBRA20192420//Cyclin-dependent kinase inhibitor// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif

FEBRA20196370//Cyclin-dependent kinase inhibitor// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif// IQ calmodulin-binding motif

FEBRA20225040//high-glucose-regulated protein 8


HCHON20003440//Homo sapiens cyclin-D binding Myb-like protein mRNA, complete cds.

HCHON20010990//TPR Domain

HCHON20059870//Hypothetical protein.

HHDPC20034390//Cereal trypsin/alpha-amylase inhibito

HHDPC20057420//Mus musculus proline-rich protein (Bprp) mRNA, complete cds.


HLUNG20023340//Mus musculus SLM-1 (Slm1) mRNA, complete cds.

KIDNE20007210//Xenopus laevis mRNA for RPA interacting protein alpha (ripalpha gene).

KIDNE20028830//K-box region

KIDNE20115080//Homo sapiens mRNA for hNBL4, complete cds.

KIDNE20124400//Homo sapiens mRNA for ALEX1, complete cds.

KIDNE20127100//Drosophila melanogaster Diablo (dbo) mRNA, complete cds.

KIDNE20127750//Homo sapiens partial mRNA for transport-secretion protein 2.1 (TTS-2.1 gene).

KIDNE20190740//Rattus norvegicus SNIP-b mRNA, complete cds.

LIVER10004790//EF hand

LIVER20011130//Homo sapiens F-box protein FBL9 mRNA, partial cds.

LIVER20064100//Ciona intestinalis mRNA for myoplasmin-C1, complete cds.

LIVER20080530//Drosophila melanogaster forked mRNA for large Forked protein, complete cds.

MAMGL10000830//Drosophila melanogaster L82B (L82) mRNA, complete cds.

MESAN20036460//Corticotropin-releasing factor family

MESAN20127350//myelin expression factor-3

MESAN20141920//Human ovarian cancer downregulated myosin heavy chain homolog (Doc1) mRNA, complete cds.

NT2NE20010400//Homo sapiens GLO13 mRNA, complete cds.


NT2NE20158600//erythroid ankyrin—Synechocystis sp. (strain PCC 6803).

NT2RI20001330//Homo sapiens KE03 protein mRNA, partial cds.

NT2RI20009870//lunatic fringe precursor [Mus musculus]

NT2RI20046080//recA bacterial DNA recombination proteins

NT2RI20091730//Molluscan rhodopsin C-terminal tail

NT2RP60000850//Bos taurus RPGR-interacting protein-1 (RPGRIP1) mRNA, complete cds.

NT2RP70080850//SPRY domain// Adenovirus EB1 55K protein/large t-an

NT2RP70105210//Myc amino-terminal region

NT2RP70188710//Yeast PIR proteins

NT2RP70194450//Bacterial regulatory proteins, crp family

NTONG20052650//Gallus gallus Xin mRNA, complete cds.


NTONG20064840//Mus musculus slp1 mRNA for synaptotagmin-like protein 1, complete cds.

NTONG20066460//Mus musculus Gd mRNA for gasdermin, complete cds.

NTONG20067090//Mus musculus mRNA for Sh3yl1, complete cds.

NTONG20070340//collagen alpha 1(IX) chain

NTONG20083650//TPR Domain// TPR Domain// TPR Domain// PPR repeat// TPR Domain// PPR repeat// TPR Domain

NTONG20088620//Homo sapiens genethonin 3 mRNA, partial cds.

OCBBF10000540//Mus musculus ris (rjs) mRNA, complete cds.

OCBBF20019380//seizure related gene 6

OCBBF20022900//Homo sapiens SCHIP-1 mRNA, complete cds.

OCBBF20030280//Rattus norvegicus hfb2 mRNA, complete cds.

OCBBF20046470//ARFAPTIN 1.

OCBBF20049840//Homo sapiens mRNA for neurabin II protein.

OCBBF20068490//Mus musculus RW1 protein mRNA, complete cds.

OCBBF20071960//Coturnix coturnix japonica qMEF2D gene.

OCBBF20073540//Homo sapiens p30 DBC mRNA, complete cds.


OCBBF20127550//Outer Capsid protein VP4 (Hemagglutinin)


OCBBF20178150//Plasmodium falciparum ADA2-like protein gene, partial cds.

PEBLM10000240//Domain found in Dishevelled, Eg1-10, and Ple PROST20047270//CRAL/TR10 domain.

PROST20112970//Sterile alpha motif (SAM)/Pointed domain// SAM domain (Sterile alpha motif)

PUAEN10000850//Uncharacterized protein family UPF0025//Sec1 family

PUAEN20011880//Mus musculus mRNA for MIWI (piwi), complete cds.

PUAEN20051100//Mus musculus otogelin mRNA, complete cds.

PUAEN20108240//Drosophila melanogaster ankyrin 2 (Ank2) mRNA, complete cds.

SKMUS20084740//Syndecan domain

SMINT20053300//Homo sapiens hepatocellular carcinoma-associated antigen 59 mRNA, complete cds.

SMINT20071400//NOL1/NOP2/sun family

SMINT20101440//Human cisplatin resistance associated alpha protein (hCRA alpha) mRNA, complete cds.

SMINT20110330//pKID domain

SMINT20122910//Mus musculus StAR-related protein 1-4E mRNA, partial cds.

SMINT20131810//ENV polyprotein (coat polyprotein)

SMINT20168570//Homo sapiens mRNA for stabilin-1 (stab1 gene).

SPLEN20008390//Human placenta (Diff48) mRNA, complete cds.


SPLEN20128000//Xenopus laevis XMAB21 (Xmab-21) mRNA, complete cds.

SPLEN20149110//Dishevelled specific domain

SPLEN20171470//Keratin, high sulfur B2 protein

SPLEN20194050//Homo sapiens HOTTL protein mRNA, complete cds.

SPLEN20214580//Mus musculus mdg1-1 mRNA, complete cds.

STOMA20057820//Uncharacterized protein family UPF0024

STOMA20063980//Collagen triple helix repeat (20 copies)

STOMA20069040//Keratin, high sulfur B2 protein

SYNOV20017080//UBX domain

TBAES20000590//Cytochrome P450// Cytochrome P450

TESTI20001170//HORMA domain

TESTI20031810//Bacterial luciferase// Domain of unknown function DUF28

TESTI20044230//Mus musculus testis-specific Y-encoded-like protein (Tspyl1) mRNA, complete cds.

TESTI20098350//VAT-Nn domain

TESTI20157520//K+ channel tetramerisation domain// K+ channel tetramerisation domain

TESTI20170350//Cystine-knot domain

TESTI20192800//Homo sapiens nasopharyngeal carcinoma susceptibility protein LZ16 mRNA, complete cds.


TESTI20202650//Repeat in HS1/Cortactin

TESTI20229600//Drosophila melanogaster SP2353 mRNA, complete cds.

TESTI20231920//Gag P30 core shell protein

TESTI20242830//E2 (early) protein, C terminal// Syndecan domain

TESTI20254540//Homo sapiens hepatocellular carcinoma-associated antigen 59 mRNA, complete cds.


TESTI20327680//EF hand// EF hand

TESTI20328280//KE2 family protein// Troponin

TESTI20351830//K-box region

TESTI20370020//Bleomycin resistance protein

TESTI20391210//IQ calmodulin-binding motif

TESTI20408150//Keratin, high sulfur B2 protein

TESTI20451990//SAP domain

TESTI20467970//Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain// Neurohypophysial hormones, N-terminal Domain

THYMU20108310//Mouse NCBP-29 mRNA for PW29, complete cds.


THYMU20194360//Kelch motif

THYMU20239000//collagen alpha 1(XI) chain

TOVAR20004760//Leucine Rich Repeat// Leucine Rich Repeat// Leucine Rich Repeat

TRACH20005020//Ank repeat// MutT-like domain



TRACH20068700//Homo sapiens adaptor protein CIKS mRNA, complete cds.

TRACH20076760//Keratin, high sulfur B2 protein

TRACH20135520//TBC domain// Rhodanese-like domain

TRACH20141240//Mus musculus G21 protein mRNA, complete cds.

TRACH20183170//Rattus norvegicus Sprague-Dawley SM-20 mRNA, complete cds.

UTERU20000740//Human fusion protein mRNA, complete cds.

UTERU20004240//CGI-96 protein

UTERU20006960//endoplasmic reticulum resident protein 58

UTERU20022940//Human (p23) mRNA, complete cds.

UTERU20046640//Mus musculus ld1Bp (LDLB) mRNA, complete cds.


UTERU20115740//Human PMS2 related (hPMSR3) gene, complete cds.

UTERU20179880//TPR Domain// TPR Domain// TPR Domain// TPR Domain

With respect to the remaining 882 clones, there are so far no information available for estimating their functions. However, there is the possibility that the functions of these clones will be revealed in future. Their Clone Names are indicated below.

3NB6920014080, ADRGL20000640, ADRGL20012870, ADRGL20013010, ADRGL20044590, ADRGL20067670, ADRGL20068170, ADRGL20068460, ADRGL20073570, ADRGL20076360, ADRGL20083310, ASTRO20032120, ASTRO20100720, ASTRO20111490, ASTRO20114610, ASTRO20136710, ASTRO20138020, ASTRO20152140, ASTRO20166810, ASTRO20173480, BLADE20004630, BRACE20019540, BRACE20037660, BRACE20038850, BRACE20051690, BRACE20054500, BRACE20055180, BRACE20056810, BRACE20057420, BRACE20058810, BRACE20060840, BRACE20061740, BRACE20062400, BRACE20062740, BRACE20063800, BRACE20063930, BRACE20082950, BRACE20090440, BRACE20096540, BRACE20097320, BRACE20099570, BRACE20106690, BRACE20109370, BRACE20109830, BRACE20111830, BRACE20114780, BRACE20115450, BRACE20118380, BRACE20121850, BRACE20136240, BRACE20141080, BRACE20142320, BRACE20142570, BRACE20148210, BRACE20150310, BRACE20152870, BRACE20163150, BRACE20165830, BRACE20171240, BRACE20175870, BRACE20190440, BRACE20220300, BRACE20223280, BRACE20229280, BRACE20230700, BRACE20235400, BRACE20262930, BRACE20262940, BRACE20266750, BRACE20267250, BRACE20269710, BRACE20283920, BRACE20287410, BRALZ20014450, BRALZ20019660, BRALZ20059500, BRALZ20065600, BRALZ20075450, BRALZ20075760, BRALZ20080310, BRALZ20088690, BRAMY10001570, BRAMY20004110, BRAMY20011140, BRAMY20071850, BRAMY20102080, BRAMY20110640, BRAMY20116790, BRAMY20121190, BRAMY20137560, BRAMY20147540, BRAMY20160700, BRAMY20163250, BRAMY20163270, BRAMY20167710, BRAMY20168920, BRAMY20170140, BRAMY20178640, BRAMY20182730, BRAMY20183080, BRAMY20196000, BRAMY20204450, BRAMY20205740, BRAMY20229840, BRAMY20230600, BRAMY20250240, BRAMY20250320, BRAMY20261680, BRAMY20267130, BRAMY20268990, BRAMY20277140, BRAMY20280720, BRAMY20285930, BRAMY20286820, BRAWH10000930, BRAWH20012410, BRAWH20014920, BRAWH20016660, BRAWH20100690, BRAWH20103180, BRAWH20106180, BRAWH20107540, BRAWH20110660, BRAWH20111550, BRAWH20122770, BRAWH20126190, BRAWH20126980, BRAWH20139410, BRAWH20142340, BRAWH20147290, BRAWH20155950, BRAWH20158530, BRAWH20160280, BRAWH20162690, BRAWH20166790, BRAWH20173050, BRAWH20182060, BRCAN20006200, BRCAN20006390, BRCAN20060190, BRCAN20126130, BRCAN20143700, BRCAN20147880, BRCAN20216690, BRCAN2.0237240, BRCAN20263400, BRCAN20273100, BRCAN20273340, BRCAN20275130, BRCAN20280400, BRCAN20284600, BRCOC20004870, BRCOC20020850, BRCOC20031000, BRCOC20031870, BRCOC20037400, BRCOC20093800, BRCOC20105100, BRCOC20117690, BRCOC20119960, BRCOC20122290, BRCOC20128130, BRCOC20135730, BRCOC20147480, BRCOC20148330, BRCOC20155970, BRCOC20158240, BRHIP10001740, BRHIP20104440, BRHIP20105710, BRHIP20107440, BRHIP20110800, BRHIP20115760, BRHIP20123140, BRHIP20129720, BRHIP20139720, BRHIP20140630, BRHIP20142850, BRHIP20143860, BRHIP20149540, BRHIP20153560, BRHIP20169680, BRHIP20169900, BRHIP20170100, BRHIP20173150, BRHIP20180140, BRHIP20186120, BRHIP20186500, BRHIP20190070, BRHIP20196410, BRHIP20205090, BRHIP20208420, BRHIP20214950, BRHIP20227080, BRHIP20230710, BRHIP20232290, BRHIP20238690, BRHIP20240460, BRHIP20254480, BRHIP20277620, BRHIP20284800, BRHIP30001110, BRSSN10000920, BRSSN20006340, BRSSN20015030, BRSSN20028570, BRSSN20038410, BRSSN20046570, BRSSN20046860, BRSSN20097020, BRSSN20105960, BRSSN20108300, BRSSN20121030, BRSSN20152380, BRSSN20159070, BRSSN20159820, BRSTN20000580, BRTHA20046390, CD34C30001250, CD34C30003140, CD34C30004940, COLON20043180, CTONG20002180, CTONG20028410, CTONG20038890, CTONG20049410, CTONG20077790, CTONG20082690, CTONG20091320, CTONG20095270, CTONG20095290, CTONG20096430, CTONG20097660, CTONG20099630, CTONG20101480, CTONG20105660, CTONG20106230, CTONG20108210, CTONG20124470, CTONG20126070, CTONG20128470, CTONG20136300, CTONG20138030, CTONG20139070, CTONG20140320, CTONG20141650, CTONG20146970, CTONG20147050, CTONG20150910, CTONG20158150, CTONG20162170, CTONG20163550, CTONG20164990, CTONG20265130, CTONG20273610, D3OST10002670, D3OST10002700, D3OST20006540, D3OST20007340, D3OST20024170, D3OST20024520, D3OST20037970, D3OST30002910, D6OST20004450, D9OST20000310, D9OST20035800, DFNES10000030, DFNES10001850, DFNES20010910, DFNES20055270, DFNES20082800, FCBBF10003740, FCBBF20006780, FCBBF20023700, FCBBF20035280, FCBBF20054280, FCBBF20056370, FCBBF20071860, FCBBF20072650, FCBBF20075560, FCBBF20076330, FCBBF30001840, FCBBF30016570, FCBBF30019120, FCBBF30028180, FCBBF30052180, FCBBF30062880, FCBBF30070770, FCBBF30071520, FCBBF30170590, FCBBF30178730, FCBBF30189490, FCBBF30199610, FCBBF30240020, FCBBF30242250, FCBBF30262360, FCBBF30266780, FCBBF30266920, FCBBF30278630, FCBBF30284720, FCBBF40001420, FCBBF40005480, FEBRA20003210, FEBRA20017050, FEBRA20018280, FEBRA20025520, FEBRA20026280, FEBRA20027810, FEBRA20034360, FEBRA20037500, FEBRA20042190, FEBRA20052910, FEBRA20060610, FEBRA20072120, FEBRA20079310, FEBRA20082100, FEBRA20095140, FEBRA20098460, FEBRA20161120, FEBRA20166540, FEBRA20176800, FEBRA20197110, FEBRA20204000, FEBRA20204060, FEBRA20216360, FEBRA20226010, FEBRA20229560, FEBRA20232850, FELNG20002410, HCHON20002260, HCHON20008980, HCHON20009350, HCHON20011160, HCHON20014970, HCHON20022470, HCHON20036760, HCHON20043590, HCHON20067220, HCHON20074820, HCHON20076500, HEART20021840, HEART20037810, HEART20049400, HEART20063340, HEART20067870, HEART20067890, HEART20074430, HEART20089940, HEART20095990, HHDPC10000650, HHDPC20006920, HHDPC20057940, HHDPC20095280, HLUNG20016770, HLUNG20084390, KIDNE20006780, KIDNE20011170, KIDNE20013730, KIDNE20018730, KIDNE20018970, KIDNE20021980, KIDNE20029800, KIDNE20067330, KIDNE20079440, KIDNE20096280, KIDNE20096470, KIDNE20100840, KIDNE20102650, KIDNE20104300, KIDNE20106740, KIDNE20107500, KIDNE20112000, KIDNE20120090, KIDNE20122910, KIDNE20132180, KIDNE20138010, KIDNE20141190, KIDNE20144890, KIDNE20148900, KIDNE20163880, KIDNE20180710, KIDNE20186780, LIVER10001260, LIVER20011910, LIVER20028420, LIVER20038540, LIVER20084730, LIVER20085800, MESAN20106640, MESAN20121130, MESAN20132110, MESAN20138450, MESAN20157080, MESAN20161590, MESAN20164090, MESAN20182090, NESOP10001080, NOVAR10001020, NOVAR20003520, NT2NE20003740, NT2NE20010210, NT2NE20015240, NT2NE20043780, NT2NE20053580, NT2NE20072200, NT2NE20074250, NT2NE20089610, NT2NE20108540, NT2NE20110360, NT2NE20146810, NT2NE20152750, NT2NE20172590, NT2NE20174800, NT2NE20174920, NT2NE20187390, NT2RI20022600, NT2RI20023160, NT2RI20023590, NT2RI20036670, NT2RI20055790, NT2RI20069730, NT2RI20198260, NT2RI20203900, NT2RI20207030, NT2RI20216250, NT2RI20244960, NT2RI20250750, NT2RI20252550, NT2RP70010740, NT2RP70056750, NT2RP70075240, NT2RP70077660, NT2RP70085440, NT2RP70110860, NT2RP70111320, NT2RP70130020, NT2RP70137640, NT2RP70143480, NT2RP70147210, NT2RP70150800, NT2RP70169110, NT2RP70175670, NT2RP70181970, NT2RP70190640, NT2RP70203790, NTONG20050620, NTONG20050860, NTONG20065010, NTONG20077560, NTONG20090680, OCBBF20005230, OCBBF20020150, OCBBF20029800, OCBBF20032460, OCBBF20041680, OCBBF20045330, OCBBF20047570, OCBBF20048660, OCBBF20051610, OCBBF20060300, OCBBF20061720, OCBBF20062140, OCBBF20062410, OCBBF20074140, OCBBF20076220, OCBBF20079460, OCBBF20081380, OCBBF20084660, OCBBF20085200, OCBBF20088220, OCBBF20094240, OCBBF20097720, OCBBF20100400, OCBBF20103130, OCBBF20104040, OCBBF20105570, OCBBF20107920, OCBBF20111770, OCBBF20118970, OCBBF20126780, OCBBF20130110, OCBBF20139260, OCBBF20151150, OCBBF20164050, OCBBF20164670, OCBBF20170690, OCBBF20173060, OCBBF20173250, OCBBF20178990, OCBBF20186870, OCBBF20189560, PEBLM20024550, PEBLM20071880, PEBLM20072960, PERIC20002140, PERIC20003860, PLACE60004630, PLACE60119750, PLACE60138830, PLACE60153220, PLACE60155130, PLACE60169420, PLACE60181070, PLACE60187690, PLACE60188340, PROST10004800, PROST20005670, PROST20021010, PROST20024890, PROST20029270, PROST20052280, PROST20057930, PROST20059040, PROST20087700, PROST20097950, PROST20111050, PROST20120050, PROST20121900, PROST20123530, PROST20127400, PROST20130530, PROST20132600, PROST20133270, PROST20144220, PROST20149160, PROST20149250, PROST20151240, PROST20152460, PROST20153320, PROST20166680, PROST20168290, PROST20178360, PUAEN20025680, PUAEN20027580, PUAEN20044000, PUAEN20045110, PUAEN20045250, PUAEN20052470, PUAEN20081230, PUAEN20085150, RECTM10001410, RECTM20003490, RECTM20005100, SKMUS20012010, SKMUS20031680, SKMUS20046670, SKNMC20006220, SKNSH20034660, SKNSH20062340, SKNSH20080430, SKNSH20087770, SKNSH20091970, SMINT20005410, SMINT20008240, SMINT20011140, SMINT20011580, SMINT20014580, SMINT20015590, SMINT20023280, SMINT20033170, SMINT20033400, SMINT20042990, SMINT20047810, SMINT20056210, SMINT20058000, SMINT20060780, SMINT20065960, SMINT20076470, SMINT20080540, SMINT20089170, SMINT20092330, SMINT20092720, SMINT20098320, SMINT20103690, SMINT20105000, SMINT20108530, SMINT20109970, SMINT20122850, SMINT20132280, SMINT20153530, SMINT20158100, SMINT20161220, SMINT20162860, SMINT20164400, SMINT20164770, SMINT20173190, SPLEN10000830, SPLEN20000640, SPLEN20002220, SPLEN20008820, SPLEN20013540, SPLEN20016260, SPLEN20019450, SPLEN20020070, SPLEN20022230, SPLEN20023140, SPLEN20031600, SPLEN20032040, SPLEN20032190, SPLEN20033960, SPLEN20040600, SPLEN20076530, SPLEN20101190, SPLEN20106250, SPLEN20129610, SPLEN20146690, SPLEN20149190, SPLEN20152610, SPLEN20157300, SPLEN20158900, SPLEN20158990, SPLEN20160690, SPLEN20160980, SPLEN20166270, SPLEN20171210, SPLEN20176200, SPLEN20193110, SPLEN20198110, SPLEN20204170, SPLEN20212950, SPLEN20214400, SPLEN20225220, SPLEN20242320, SPLEN20242730, SPLEN20249560, SPLEN20261440, SPLEN20264110, SPLEN20279950, SPLEN20280660, SPLEN20303970, STOMA20013890, STOMA20026880, STOMA20036460, STOMA20048520, STOMA20048840, STOMA20062290, STOMA20067800, STOMA20072690, STOMA20076800, STOMA20086140, STOMA20092560, SYNOV20003970, TCOLN20001390, TESOP20000900, TESOP20003120, TESTI10000940, TESTI20004890, TESTI20011200, TESTI20018230, TESTI20029930, TESTI20030310, TESTI20030890, TESTI20038270, TESTI20066770, TESTI20076850, TESTI20086210, TESTI20087620, TESTI20094020, TESTI20098530, TESTI20102800, TESTI20105720, TESTI20112940, TESTI20114070, TESTI20116650, TESTI20122310, TESTI20129150, TESTI20129220, TESTI20130120, TESTI20135660, TESTI20136990, TESTI20137370′, TESTI20137670, TESTI20143240, TESTI20143620, TESTI20155900, TESTI20157100, TESTI20159140, TESTI20161970, TESTI20168630, TESTI20168960, TESTI20169960, TESTI20171020, TESTI20178160, TESTI20179320, TESTI20183370, TESTI20185810, TESTI20192280, TESTI20194300, TESTI20194810, TESTI20199170, TESTI20200260, TESTI20203440, TESTI20209460, TESTI20211240, TESTI20213150, TESTI20213580, TESTI20220100, TESTI20220650, TESTI20224620, TESTI20226490, TESTI20234270, TESTI20238000, TESTI20239470, TESTI20240090, TESTI20241530, TESTI20241920, TESTI20244760, TESTI20262330, TESTI20262910, TESTI20265250, TESTI20265370, TESTI20269570, TESTI20272060, TESTI20272390, TESTI20275620, TESTI20277360, TESTI20278200, TESTI20280980, TESTI20282540, TESTI20285830, TESTI20288110, TESTI20289850, TESTI20291620, TESTI20294700, TESTI20297850, TESTI20301360, TESTI20305560, TESTI20307540, TESTI20310070, TESTI20311290, TESTI20319190, TESTI20327740, TESTI20330310, TESTI20333950, TESTI20336410, TESTI20337100, TESTI20342430, TESTI20345060, TESTI20347740, TESTI20347770, TESTI20357750, TESTI20357930, TESTI20361140, TESTI20367360, TESTI20369130, TESTI20369220, TESTI20370550, TESTI20371060, TESTI20378450, TESTI20380650, TESTI20386230, TESTI20386440, TESTI20388580, TESTI20391130, TESTI20392090, TESTI20401430, TESTI20406420, TESTI20409440, TESTI20413300, TESTI20415640, TESTI20419560, TESTI20423020, TESTI20424000, TESTI20424730, TESTI20425070, TESTI20427830, TESTI20428060, TESTI20429280, TESTI20429580, TESTI20433130, TESTI20438660, TESTI20447540, TESTI20451710, TESTI20458190, TESTI20465520, TESTI20468630, TESTI20471470, TESTI20471530, TESTI20472120, TESTI20473420, TESTI20477920, TESTI20478010, TESTI20478180, TESTI20479300, THYMU20000570, THYMU20011950, THYMU20015210, THYMU20018190, THYMU20029100, THYMU20045120, THYMU20058070, THYMU20061700, THYMU20070360, THYMU20075320, THYMU20095960, THYMU20101610, THYMU20101920, THYMU20111420, THYMU20114470, THYMU20118060, THYMU20119390, THYMU20128070, THYMU20128260, THYMU20142970, THYMU20153160, THYMU20158250, THYMU20186390, THYMU20186730, THYMU20187720, THYMU20195990, THYMU20204160, THYMU20204990, THYMU20215090, THYMU20215970, THYMU20226600, THYMU20228540, THYMU20235760, THYMU20239430, THYMU20246840, THYMU20250420, THYMU20251890, THYMU20253250, THYMU20255570, THYMU20255720, THYMU20259090, THYMU20265300, THYMU20271250, THYMU20272490, THYMU20283790, THYMU20284120, THYMU20286290, THYMU20286320, TKIDN20030590, TKIDN20030620, TOVAR20005750, TRACH20027840, TRACH20032720, TRACH20037360, TRACH20056980, TRACH20060150, TRACH20082780, TRACH20091230, TRACH20092680, TRACH20099340, TRACH20107710, TRACH20115740, TRACH20118940, TRACH20147250, TRACH20153810, TRACH20169800, TRACH20187180, TSTOM10001860, TSTOM20001390, TSTOM20003150, UMVEN20003540, UTERU20006290, UTERU20020010, UTERU20054460, UTERU20056010, UTERU20059050, UTERU20061030, UTERU20067050, UTERU20068990, UTERU20070040, UTERU20070810, UTERU20081300, UTERU20084260, UTERU20095380, UTERU20095400, UTERU20101240, UTERU20114100, UTERU20118110, UTERU20118970, UTERU20119680, UTERU20124070, UTERU20126880, UTERU20134910, UTERU20143980, UTERU20146680, UTERU20150870, UTERU20164260, UTERU20188810

EXAMPLE 7 Expression Frequency Analysis in Silico

The cDNA libraries derived from various tissues and cells as indicated in Example 1 were prepared, and cDNA clones were selected from each library at random. The 5′-end sequences were determined and the database was constructed based on the data. The database was constructed based on the nucleotide sequences of 1,402,070 clones, and thus the population of the database is large enough for the analysis.

Then, clones having a homologous sequence are categorized into a single cluster (clustering) by searching the nucleotide sequences of respective clones in this database with the program of nucleotide sequence homology search; the number of clones belonging to each cluster was determined and normalized for every library; thus, the ratio of a certain gene in each cDNA library was determined. This analysis gave the information of the expression frequency of genes in tissues and cells which were sources of the cDNA libraries.

Then, in order to analyze the expression of a gene containing the nucleotide sequence of the cDNA of the present invention in tissues and cells, the library derived from a tissue or a cell used in the large-scale cDNA analysis was subjected to the comparison of the expression levels between tissues or cells. Namely, the expression frequency was analyzed by comparing the previously normalized values between tissues and/or cells for which the nucleotide sequences of 600 or more cDNA clones had been analyzed. By this analysis, some of the genes were revealed to be involved in the pathology and functions indicated below. Each value in Tables 3 to 51 shown below represents a relative expression frequency; the higher the value, the higher the expression level.

Osteoporosis-Related Genes

Osteoporosis is a pathology in which bones are easily broken owing to overall decrease in components of bone. The onset involves the balance between the functions of osteoblast producing bone and osteoclast absorbing bone, namely bone metabolism. Thus, the genes involved in the increase of osteoclasts differentiating from precursor cells of monocyte/macrophage line (Molecular Medicine 38. 642-648. (2001)) are genes involved in osteoporosis relevant to bone metabolism.

A nucleotide sequence information-based analysis was carried out to identify the genes whose expression frequencies are higher or lower in CD34+ cell (cell expressing a glycoprotein CD34) treated with the osteoclast differentiation factor (Molecular Medicine 38. 642-648. (2001)) than in the untreated CD34+ cell, which is the precursor cell of monocyte/macrophage line. The result of comparative analysis for the frequency between the two cDNA libraries prepared from the RNA of CD34+ cells (CD34C) and from the RNA of CD34+ cells treated with the osteoclast differentiation factor (D30ST, D60ST or D90ST) showed that the genes whose expression levels were different between the two were the following clones (Table 3).

ASTRO20001410, D30ST10001090, D30ST20036070, THYMU20039810, KIDNE20028720, BRAWH10000930, BRHIP20005340, CTONG20141650, D9OST20000310, D90ST20002780, D90ST20023970, D90ST20026730, D9OST20031370, D9OST20033970, D9OST20035800, D9OST20035940, D9OST20040180, FCBBF30018550, FCBBF30233680, KIDNE20102650, NT2RI20023160, PROST20107820, SKNSH20089400, SMINT20033400, CTONG20108210, D60ST20003580, D60ST20005070, ASTRO20155290, D3OST10002670, D3OST10002700, D3OST20006180, D3OST20006540, D3OST20007340, D3OST20013280, D3OST20024170, D3OST20024360, D3OST20037970, D3OST30002580, D3OST30002910, FCBBF10004120, NT2RI20001330, NTONG20009770, SPLEN20084600, SPLEN20140800, THYMU20169680, TRACH20141240, CD34C30001250, CD34C30003140, CD34C30004240, CD34C30004940, DFNES10001850, HHDPC20034390, NT2RI20091730, SKMUS20003610, SPLEN20225220, BRCOC20101230

These genes are involved in osteoporosis.

Genes involved in neural cell differentiation

Genes involved in neural cell differentiation are useful for treating neurological diseases. Genes with varying expression levels in response to induction of cellular differentiation in neural cells are thought to be involved in neurological diseases.

A survey was performed for genes whose expression levels are varied in response to induction of differentiation (stimulation by retinoic acid (RA) or growth inhibitor treatment after RA stimulation) in cultured cells of a neural strain, NT2. The result of comparative analysis of cDNA libraries derived from undifferentiated NT2 cells (NT2RM) and the cells subjected to the differentiation treatment (NT2RP, NT2R1 or NT2NE) showed that the genes whose expression levels were different between the two were the following clones (Table 4).

CTONG20027090, CTONG20160560, NT2RP70032610, OCBBF20188730, SPLEN20162680, BRCOC20101230, BRHIP20005340, BRHIP20238880, FCBBF30016320, FEBRA20080810, FEBRA20225040, HCHON20008320, HHDPC20034390, HLUNG10000550, NT2RI20028470, NT2RI20054050, NT2RI20091730, NT2RP70078420, PUAEN20003740, THYMU20271250, BRACE20003070, BRACE20039040, BRAWH20004600, BRAWH20011710, BRCOC20121720, BRHIP20005530, D3OST10002700, HCHON20007380, HEART20072310, KIDNE20121880, MESAN20121130, NT2RI20022600, NT2RI20023160, NT2RI20086220, NT2RI20216250, NT2RP60000850, NT2RP70036880, NT2RP70043480, NT2RP70062230, NT2RP70081610, NT2RP70102350, NT2RP70130020, NT2RP70190640, OCBBF10001850, OCBBF20097720, OCBBF20173980, PEBLM20044520, SPLEN20173510, TRACH20007020, UTERU20065930, HCHON20022470, NT2NE20010490, NT2NE20174800, NT2NE20177520, PROST20087700, PROST20107820, SMINT20028820, TESTI20063830, ASTRO20125520, BRHIP30001110, HCHON20002260, HCHON20008150, KIDNE20002520, NT2NE20130190, NT2NE20158600, NT2RI20001330, NT2RI20025400, NT2RI20036670, NT2RI20048840, SKMUS20020840, BRACE20057190, BRACE20060550, BRACE20267250, BRAWH20107540, BRAWH20118230, CTONG20075860, CTONG20095290, FEBRA20086620, FEBRA20144170, FEBRA20196370, HLUNG20023340, NT2NE20003740, NT2NE20010050, NT2NE20010210, NT2NE20010400, NT2NE20015240, NT2NE20021620, NT2NE20043780, NT2NE20053580, NT2NE20068130, NT2NE20072200, NT2NE20074250, NT2NE20080170, NT2NE20089610, NT2NE20089970, NT2NE20108540, NT2NE20110360, NT2NE20118960, NT2NE20122430, NT2NE20124480, NT2NE20125050, NT2NE20131890, NT2NE20132170, NT2NE20142210, NT2NE20146810, NT2NE20152750, NT2NE20155110, NT2NE20156260, NT2NE20157470, NT2NE20159740, NT2NE20172590, NT2NE20174920, NT2NE20181650, NT2NE20183760, NT2NE20184900, NT2NE20187390, OCBBF20108430, RECTM20005100, SMINT20001760, SPLEN20169720, TESTI20265250, ASTRO10001650, ASTRO20033160, BRACE20011070, BRACE20039440, BRACE20151320, BRAMY20104640, BRAMY20137560, BRAMY20167060, BRAWH20028110, BRCAN20280360, BRCOC20004870, BRHIP20207990, BRHIP20217620, BRHIP20249110, BRSTN10000830, CTONG10000940, CTONG20004690, CTONG20050280, CTONG20105660, CTONG20125640, CTONG20133520, CTONG20186320, FCBBF10000770, FCBBF10002800, FCBBF10003770, FCBBF30018550, FCBBF30123470, FCBBF30246230, FEBRA20018280, FEBRA20095140, FEBRA20192420, HCHON20064590, HHDPC10000830, HLUNG20016770, HLUNG20033780, IMR3220002430, KIDNE20104300, MESAN20004570, MESAN20089360, NOVAR10000910, NT2RI20003480, NT2RI20005750, NT2RI20009870, NT2RI20023590, NT2RI20023910, NT2RI20025640, NT2RI20040930, NT2RI20041880, NT2RI20046080, NT2RI20050960, NT2RI20055790, NT2RI20056700, NT2RI20069730, NT2RI20076290, NT2RI20091940, NT2RI20198260, NT2RI20203900, NT2RI20207030, NT2RI20240080, NT2RI20244600, NT2RI20244960, NT2RI20250750, NT2RI20252550, NT2RI20273230, NTONG20067090, OCBBF10001750, OCBBF20047570, OCBBF20054760, OCBBF20059560, OCBBF20073540, OCBBF20125530, OCBBF20126780, OCBBF20127040, OCBBF20140890, SKMUS20003610, SKNSH20008190, SKNSH20080430, SMINT20144800, SPLEN20027440, SPLEN20095550, SPLEN20140800, TESTI20094020, TESTI20369690, TESTI20391770, TESTI20442760, TRACH20084720, TRACH20107710, TRACH20118940, UTERU20022940, ASTRO20108190, BGGI120006160, BRAMY20136210, BRAWH20016620, BRAWH20164460, BRCOC20144000, BRHIP20132860, BRSSN20146100, CTONG10000100, CTONG20103480, CTONG20108210, CTONG20139070, FCBBF10000240, FCBBF10000630, FCBBF20067810, FCBBF30010810, FCBBF30012810, FCBBF30013770, FCBBF30039020, FCBBF40001420, FEBRA10001880, FEBRA20082010, HHDPC20001040, KIDNE20021910, NT2RP60000770, NT2RP70010740, NT2RP70027380, NT2RP70037240, NT2RP70044280, NT2RP70045590, NT2RP70056750, NT2RP70063950, NT2RP70072690, NT2RP70077660, NT2RP70085440, NT2RP70105210, NT2RP70110860, NT2RP70111320, NT2RP70122910, NT2RP70125160, NT2RP70133740, NT2RP70134990, NT2RP70137290, NT2RP70137640, NT2RP70143480, NT2RP70147210, NT2RP70150800, NT2RP70157890, NT2RP70159960, NT2RP70169110, NT2RP70175670, NT2RP70179710, NT2RP70181970, NT2RP70188020, NT2RP70188710, NT2RP70192730, NT2RP70194450, NT2RP70195430, NT2RP70198350, NT2RP70203790, OCBBF20039250, OCBBF20080410, OCBBF20108190, OCBBF20108580, OCBBF20122620, OCBBF20130110, OCBBF20151150, OCBBF20189560, PROST10003220, TESTI20001720, TESTI20121550, TESTI20152460, TESTI20211240, TESTI20234140, UMVEN20003540, UTERU20006960, UTERU20094350, UTERU20164260

These genes are neurological disease-related genes. Cancer-related genes

It has been assumed that, distinct from normal tissues, cancer tissues express a distinct set of genes, and thus the expression can contribute to the carcinogenesis in tissues and cells. Thus, the genes whose expression patterns in cancer tissues are different from those in normal tissues are cancer-related genes. Search was carried out for the genes whose expression levels in cancer tissues were different from those in normal tissues.

The result of comparative analysis of cDNA libraries derived from breast tumor (TBAES) and normal breast (BEAST) showed that the genes whose expression levels were different between the two were the following clones (Table 5).

BRACE20039040, BRAMY20163250, BRCOC20031250, BRHIP20005340, BRHIP20217620, BRHIP30001110, FCBBF10000770, FCBBF30010810, FEBRA20080810, FEBRA20144170, FEBRA20196630, FEBRA20197110, HCHON20002260, HCHON20040020, HHDPC20034390, HLUNG10000550, NOVAR10000910, NT2RI20023160, NT2RI20054050, NT2RI20091730, OCBBF20188730, SMINT20144800, SPLEN20128000, SPLEN20171210, SPLEN20264110, TBAES20000590, TBAES20002550, TBAES20003150, TESTI20334410, TESTI20432750, TRACH20003590, TRACH20084720, UTERU20046640, BEAST20004540, SPLEN20008740

The result of comparative analysis of cDNA libraries derived cervical tumor (TCERX) and normal cervical duct (CERVX) showed that the genes whose expression levels were different between the two were the following clones (Table 6).

BGGI120006160, BRAMY20063970, BRHIP20218580, FEBRA20002100, SPLEN20162680, TESTI20214250, CTONG20105080, HCHON20015980, PROST20175290, TESTI20254220, THYMU20279750

The result of comparative analysis of cDNA libraries derived from colon tumor (TCOLN) and normal colon (COLON) showed that the genes whose expression levels were different between the two were the following clones (Table 7).

ASTRO20001410, BRAWH20162690, CTONG20132220, HCHON20002260, NT2RI20001330, TCOLN20001390, 3NB6910001910, BRAMY20120910, BRAWH20004600, BRCOC20031250, BRCOC20031870, COLON10001350, COLON20043180, COLON20093370, FEBRA20002100, FEBRA20082010, FEBRA20197110, KIDNE20007770, KIDNE20013730, NT2RP70045590, OCBBF20078920, PROST20083600, SPLEN20011410, TRACH20084720, THYMU20271250

The result of comparative analysis of cDNA libraries derived from esophageal tumor (TESOP) and normal esophagus (NESOP) showed that the genes whose expression levels were different between the two were the following clones (Table 8).

ASTRO20033160, ASTRO20125520, BRAMY20266850, BRAWH20164460, BRHIP20005340, BRHIP20191490, CTONG20095290, CTONG20143690, CTONG20161850, DFNES20001530, DFNES20071130, FCBBF30123470, FCBBF30175310, FEBRA20095140, HCHON20016650, MESAN20025190, NT2RI20028470, NT2RI20054050, NT2RP70036880, NTONG20009770, NTONG20064840, NTONG20076930, SMINT20042990, SPLEN20008820, SPLEN20128000, SPLEN20149110, STOMA20013890, TESOP20000900, TESOP20003120, TESOP20004000, TESOP20005270, TESOP20005690, TESTI20334410, THYMU20271250, TRACH20141240, UTERU20022940, NESOP10001080, NT2RI20023160, NTONG20013620, TRACH20077540, NTONG20015870

The result of comparative analysis of cDNA libraries derived from kidney tumor (TKIDN) and normal kidney (KIDNE) showed that the genes whose expression levels were different between the two were the following clones (Table 9).

ASTRO20008010, ASTRO20181690, BRACE20111830, BRACE20152870, BRACE20237270, BRAMY20147540, BRAMY20286820, BRAWH20015350, BRAWH20096780, BRAWH20132190, BRAWH20182060, BRCAN20060190, BRCOC20004870, BRCOC20176520, BRHIP20000870, BRHIP20198190, BRHIP20233090, BRHIP30001110, BRSSN20015790, BRSTN20000580, CTONG10000940, CTONG20098440, CTONG20150910, CTONG20165050, DFNES20014040, DFNES20037420, FCBBF10000770, FCBBF30083820, FCBBF30247930, FEBRA20037500, FEBRA20072120, FEBRA20080810, FEBRA20086620, FEBRA20140100, FEBRA20144170, FEBRA20176800, HCHON20008320, HCHON20059870, HLUNG10000550, MESAN20106640, NT2RI20025400, NT2RI20076290, NT2RI20091940, OCBBF20019830, OCBBF20022900, OCBBF20039250, OCBBF20080050, OCBBF20097720, OCBBF20125530, OCBBF20130110, OCBBF20140640, OCBBF20173980, PANCR10000910, PROST20087700, PUAEN20044000, SPLEN20144520, SPLEN20160980, TKIDN10000010, TKIDN20004640, TKIDN20005210, TKIDN20030590, TKIDN20030620, TKIDN20047480, TRACH20003590, TRACH20028030, TRACH20183170, TRACH20184490, UMVEN20003540, UTERU20004240, UTERU20055930, ASTRO10001650, ASTRO20108190, BGGI120006160, BRACE20039040, BRAMY20102080, BRAWH20004600, BRAWH20125380, BRAWH20162690, BRHIP20115760, BRHIP20205090, CTONG20052650, CTONG20108210, CTONG20128470, CTONG20133480, CTONG20139070, D90ST20000310, DFNES20001530, FCBBF10001820, FEBRA20002100, HCHON20008980, HCHON20016650, HLUNG20033780, KIDNE20002520, KIDNE20003940, KIDNE20006780, KIDNE20007210, KIDNE20007770, KIDNE20008010, KIDNE20009470, KIDNE20011170, KIDNE20011400, KIDNE20013730, KIDNE20017130, KIDNE20018730, KIDNE20018970, KIDNE20020150, KIDNE20021680, KIDNE20021910, KIDNE20021980, KIDNE20022620, KIDNE20024830, KIDNE20027250, KIDNE20027950, KIDNE20028390, KIDNE20028720, KIDNE20028830, KIDNE20029800, KIDNE20067330, KIDNE20079440, KIDNE20096280, KIDNE20096470, KIDNE20100070, KIDNE20100840, KIDNE20101370, KIDNE20101510, KIDNE20102650, KIDNE20102710, KIDNE20104300, KIDNE20106740, KIDNE20107390, KIDNE20107500, KIDNE20107620, KIDNE20109730, KIDNE20109890, KIDNE20112000, KIDNE20115080, KIDNE20118580, KIDNE20120090, KIDNE20121880, KIDNE20122910, KIDNE20124400, KIDNE20125630, KIDNE20126010, KIDNE20126130, KIDNE20127100, KIDNE20127450, KIDNE20127750, KIDNE20130450, KIDNE20131580, KIDNE20132180, KIDNE20137340, KIDNE20138010, KIDNE20141190, KIDNE20144890, KIDNE20148900, KIDNE20163880, KIDNE20180710, KIDNE20181660, KIDNE20182690, KIDNE20186780, KIDNE20190740, LIVER20035110, MESAN20025190, NT2RP70043480, PROST20107820, PROST20123530, PROST20161950, PUAEN20030180, SKMUS20003610, SMINT20033400, TBAES20000590, TESTI20044310, TESTI20082330, TRACH20032720, UTERU20099720

The result of comparative analysis of cDNA libraries derived from liver tumor (TLIVE) and normal liver (LIVER) showed that the genes whose expression levels were different between the two were the following clones (Table 10).

BRAWH20166790, CTONG20103480, HEART20005410, LIVER10001260, LIVER10004790, LIVER20002160, LIVER20011130, LIVER20011910, LIVER20028420, LIVER20035110, LIVER20035680, LIVER20038540, LIVER20045650, LIVER20055200, LIVER20055440, LIVER20059810, LIVER20062510, LIVER20064100, LIVER20064690, LIVER20075680, LIVER20080530, LIVER20084730, LIVER20085800, LIVER20087510, LIVER20091180, NTONG20063010, PROST20087700, PROST20107820, TRACH20005400, ASTRO20001410, ASTRO20125520, BRACE20152870, BRAMY20167060, BRAMY20181220, BRAMY20285160, BRCOC20001860, FEBRA20144170, HLUNG10000550, OCBBF20073540, OCBBF20088220, PLACE60169420, SMINT20152940, SPLEN20242320, THYMU20000570, TRACH20077540, UTERU20055930, UTERU20065930

The result of comparative analysis of cDNA libraries derived from lung tumor (TLUNG) and normal lung (HLUNG) showed that the genes whose expression levels were different between the two were the following clones (Table 11).

BRACE20096200, BRAWH20004600, BRAWH20030250, BRCAN20006390, BRCAN20280360, BRHIP20238880, CTONG10000940, CTONG20103480, CTONG20129960, CTONG20155180, FCBBF10001210, FEBRA20144170, FEBRA20197110, HCHON20002260, HHDPC20034390, HLUNG10000550, HLUNG20016330, HLUNG20016770, HLUNG20017120, HLUNG20023340, HLUNG20033780, HLUNG20084390, IMR3220002430, LIVER20028420, NOVAR20000380, NT2RI20023910, NT2RI20054050, NT2RI20091730, NT2RP70044280, OCBBF20020830, OCBBF20125530, PLACE60004630, PROST20057930, PROST20107820, PROST20185830, PUAEN20030180, SMINT20121220, SPLEN20002220, SPLEN20008740, SPLEN20054290, SPLEN20128000, SPLEN20157300, SPLEN20176200, SPLEN20179180, SPLEN20211940, STOMA20013890, TBAES20000590, TESTI20094230, TESTI20184620, TESTI20334410, THYMU20000570, THYMU20039810, TRACH20007020, TRACH20141240, TRACH20183170, ASTRO20108190, ASTRO20155290, BRHIP20096850, FEBRA20080810, MESAN20014500, SMINT20028820, SPLEN20162680

The result of comparative analysis of cDNA libraries derived from ovary tumor (TOVER) and normal ovary (NOVER) showed the genes whose expression levels were different between the two were the following clones (Table 12).

BGGI120006160, BRHIP20005340, BRHIP20191860, HHDPC20001040, NOVAR10000150, NOVAR10000910, NOVAR10001020, NOVAR20000380, NOVAR20003520, THYMU20271250, ASTRO20141350, BRAMY20157820, BRCOC20001860, HLUNG20016770, NT2RI20054050, NTONG20090600, PROST20087700, PUAEN20015860, SPLEN20029310, TOVAR20004760, TOVAR20005750, TRACH20079690, UTERU20004240

The result of comparative analysis of cDNA libraries derived from stomach tumor (TSTOM) and normal stomach (STOMA) showed that the genes whose expression levels were different between the two were the following clones (Table 13).

BRACE20060840, FEBRA20052910, HCHON20002260, HLUNG10000550, NTONG20009770, PROST20107820, THYMU20039810, TSTOM10001860, TSTOM20001390, TSTOM20003150, TSTOM20005690, ASTRO20125520, BRACE20039040, BRAMY20124260, BRCOC20031870, BRHIP20191860, CTONG20128470, FEBRA20037500, HCHON20040020, HHDPC10000830, IMR3220002430, KIDNE20007770, NOVAR20000380, NT2RI20054050, NT2RI20091730, PROST20130530, SPLEN20149110, SPLEN20157880, STOMA20001830, STOMA20005390, STOMA20005670, STOMA20006400, STOMA20006780, STOMA20006860, STOMA20008880, STOMA20010250, STOMA20013890, STOMA20026880, STOMA20032890, STOMA20034770, STOMA20036460, STOMA20046680, STOMA20048520, STOMA20048840, STOMA20051200, STOMA20056640, STOMA20056670, STOMA20057820, STOMA20062130, STOMA20062290, STOMA20063250, STOMA20063980, STOMA20064470, STOMA20067800, STOMA20069040, STOMA20072690, STOMA20076800, STOMA20077450, STOMA20080500, STOMA20083610, STOMA20086140, STOMA20088380, STOMA20092530, STOMA20092560, STOMA20092890, TESTI20184620, TRACH20003590, TRACH20183170, PROST20083600, TRACH20068660

The result of comparative analysis of cDNA libraries derived from uterine tumor (TUTER) and normal uterus (UTERU) showed that the genes whose expression levels were different between the two were the following clones (Table 14). DFNES10001850, NT2RI20023910, SMINT20144800, SPLEN20162680, TOVAR20004760, TUTER20002830, ASTRO20008010, ASTRO20033160, ASTRO20058630, ASTRO20105820, ASTRO20108190, BRACE20039040, BRACE20057190, BRACE20060840, BRACE20111830, BRACE20223330, BRAMY20266850, BRAWH20113430, BRAWH20126980, BRCOC20031870, BRCOC20107300, BRCOC20121720, BRCOC20155970, BRHIP20105710, BRHIP20191490, BRHIP20207990, BRHIP20217620, BRHIP20222280, BRHIP20238880, BRHIP20249110, BRSSN20018690, BRTHA20000570, CTONG10000940, CTONG10002770, CTONG20095290, CTONG20099380, CTONG20103480, CTONG20108210, CTONG20118250, CTONG20129960, CTONG20131560, CTONG20139070, CTONG20139340, CTONG20143690, CTONG20160560, D30ST30002580, FCBBF10000240, FCBBF10001820, FCBBF10003670, FCBBF10004120, FCBBF10005740, FCBBF30175310, FCBBF30240020, FCBBF30246230, FCBBF40001420, FEBRA20002100, FEBRA20004620, FEBRA20018280, FEBRA20025270, FEBRA20034360, FEBRA20037500, FEBRA20080810, FEBRA20082100, FEBRA20144170, FEBRA20225040, HCHON20002260, HCHON20007380, HCHON20015980, HCHON20016650, HCHON20022470, HCHON20040020, HCHON20076500, HEART20072310, HHDPC20034390, HLUNG10000550, HLUNG20016770, KIDNE20131580, LIVER20028420, MAMGL10000830, MESAN20171520, NOVAR10000150, NOVAR10000910, NT2NE20053580, NT2NE20159740, NT2NE20174920, NT2RI20023160, NT2RI20041880, NT2RI20054050, NT2RI20076290, NT2RI20273230, NT2RP60000770, NT2RP60000850, NT2RP70036880, NT2RP70043480, NT2RP70045590, NT2RP70056750, NT2RP70062230, NT2RP70081610, OCBBF10001750, OCBBF20006770, OCBBF20032460, OCBBF20039250, OCBBF20047570, OCBBF20054760, OCBBF20059560, OCBBF20068490, OCBBF20080050, OCBBF20094240, OCBBF20097720, OCBBF20103130, OCBBF20105570, OCBBF20140640, OCBBF20173980, OCBBF20180120, OCBBF20188730, OCBBF20189560, PEBLM20044520, PLACE60060420, PROST20087700, PROST20107820, PROST20149160, PROST20159240, PROST20176170, PROST20189770, PUAEN20003740, PUAEN20015860, SKMUS20003610, SKNSH20008190, SKNSH20080430, SMINT20026890, SMINT20029760, SMINT20068010, SMINT20110330, SMINT20121220, SPLEN20008390, SPLEN20011410, SPLEN20054290, SPLEN20128000, SPLEN20140800, SPLEN20145720, SPLEN20169720, SPLEN20179180, SPLEN20193110, SPLEN20194050, SPLEN20211940, SPLEN20212730, SPLEN20225220, TBAES20000590, TESTI20061110, TESTI20116830, TESTI20184620, TESTI20208710, TESTI20211240, TESTI20213580, TESTI20214250, TESTI20334410, TESTI20369130, TESTI20369690, TESTI20391770, THYMU20039810, THYMU20216840, THYMU20240710, TRACH20003590, TRACH20032720, TRACH20033230, TRACH20141240, TRACH20149970, UMVEN10001860, UTERU20000740, UTERU20004240, UTERU20006290, UTERU20020010, UTERU20022940, UTERU20030570, UTERU20040610, UTERU20046640, UTERU20046980, UTERU20050690, UTERU20054460, UTERU20055330, UTERU20055930, UTERU20056010, UTERU20059050, UTERU20061030, UTERU20064000, UTERU20064860, UTERU20065930, UTERU20067050, UTERU20068990, UTERU20070040, UTERU20070810, UTERU20076390, UTERU20081300, UTERU20084260, UTERU20094350, UTERU20095380, UTERU20095400, UTERU20097760, UTERU20099720, UTERU20101240, UTERU20114100, UTERU20115740, UTERU20116570, UTERU20118110, UTERU20118970, UTERU20119060, UTERU20119680, UTERU20120310, UTERU20124070, UTERU20126880, UTERU20134910, UTERU20135860, UTERU20143980, UTERU20144640, UTERU20145480, UTERU20146310, UTERU20146680, UTERU20150870, UTERU20151980, UTERU20158300, UTERU20158800, UTERU20161570, UTERU20164260, UTERU20168220, UTERU20176130, UTERU20176320, UTERU20178100, UTERU20179880, UTERU20183640, UTERU20185230, UTERU20186740, UTERU20188110, UTERU20188810, BRAWH10000930, CTONG20128470, UTERU20006960

The result of comparative analysis of cDNA libraries derived from tongue cancer (CTONG) and normal tongue (NTONG) showed that the genes whose expression levels were different between the two were the following clones (Table 15).

ADRGL20018300, ASTRO20058630, ASTRO20072210, ASTRO20108190, BRACE20003070, BRACE20039040, BRACE20060720, BRACE20061050, BRACE20210140, BRACE20276430, BRAMY20152110, BRAMY20266850, BRAMY20271400, BRAWH10000930, BRAWH20004600, BRCAN20280360, BRCOC20004870, BRHIP20005340, BRHIP20005530, BRHIP20238880, BRSSN20146100, CTONG10000100, CTONG10000220, CTONG10000620, CTONG10000930, CTONG10000940, CTONG10001650, CTONG10002770, CTONG20002180, CTONG20004690, CTONG20009770, CTONG20014280, CTONG20027090, CTONG20028410, CTONG20038890, CTONG20049410, CTONG20050280, CTONG20052650, CTONG20052900, CTONG20075860, CTONG20076130, CTONG20077790, CTONG20082690, CTONG20085950, CTONG20091080, CTONG20091320, CTONG20092570, CTONG20092580, CTONG20092680, CTONG20092700, CTONG20093950, CTONG20095270, CTONG20095290, CTONG20095340, CTONG20096430, CTONG20096750, CTONG20097660, CTONG20098440, CTONG20099380, CTONG20099550, CTONG20099630, CTONG20100240, CTONG20101480, CTONG20103480, CTONG20105080, CTONG20105660, CTONG20106230, CTONG20106520, CTONG20108210, CTONG20114290, CTONG20114740, CTONG20118150, CTONG20118250, CTONG20119200, CTONG20120770, CTONG20121010, CTONG20121580, CTONG20124010, CTONG20124220, CTONG20124470, CTONG20124730, CTONG20125540, CTONG20125640, CTONG20126070, CTONG20127450, CTONG20128470, CTONG20129960, CTONG20131490, CTONG20131560, CTONG20132220, CTONG20133390, CTONG20133480, CTONG20133520, CTONG20136300, CTONG20138030, CTONG20139070, CTONG20139340, CTONG20139860, CTONG20140320, CTONG20140580, CTONG20141650, CTONG20146300, CTONG20147050, CTONG20149460, CTONG20149950, CTONG20153300, CTONG20153580, CTONG20155180, CTONG20155400, CTONG20156780, CTONG20158040, CTONG20158150, CTONG20158660, CTONG20159530, CTONG20160560, CTONG20161850, CTONG20162170, CTONG20163550, CTONG20164990, CTONG20165050, CTONG20186320, CTONG20200310, CTONG20265130, CTONG20267700, CTONG20273610, FCBBF10000240, FCBBF10005740, FCBBF30123470, FCBBF30233680, FEBRA20025270, FEBRA20037500, HCHON20002260, HCHON20007380, HCHON20007510, HCHON20015350, HCHON20040020, HHDPC20034390, HLUNG10000550, KIDNE20002520, KIDNE20009470, KIDNE20115080, KIDNE20127100, LIVER20028420, MESAN20029400, NT2RI20023160, NT2RI20023910, NT2RI20091730, NT2RP70043480, NT2RP70078420, NT2RP70081610, OCBBF20006770, OCBBF20059560, OCBBF20073540, OCBBF20094240, OCBBF20108580, PEBLM20044520, PEBLM20071880, PROST20107820, PUAEN20030180, SKNSH20008190, SMINT20023280, SMINT20089170, SPLEN20179180, TESTI20094020, TESTI20094230, TESTI20152460, TESTI20184620, TESTI20211240, TESTI20442760, THYMU20039810, TRACH20028030, TRACH20141240, TSTOM20003150, UTERU20004240, UTERU20055930, UTERU20065930, UTERU20119060, UTERU20124070, BRACE20039440, BRACE20068590, FCBBF30018550, IMR3220002430, KIDNE20028830, NT2RI20028470, NT2RI20054050, NT2RI20086220, NTONG20009770, NTONG20013620, NTONG20028070, NTONG20029480, NTONG20029700, NTONG20046140, NTONG20048060, NTONG20049910, NTONG20050620, NTONG20050860, NTONG20051530, NTONG20052650, NTONG20056570, NTONG20061870, NTONG20063010, NTONG20064400, NTONG20064840, NTONG20065010, NTONG20066460, NTONG20067090, NTONG20067830, NTONG20070200, NTONG20070340, NTONG20075220, NTONG20076930, NTONG20077560, NTONG20083650, NTONG20088620, NTONG20090600, NTONG20090680, NTONG20092290, NTONG20092330, OCBBF20068490, SKMUS20001980, SMINT20138900, SPLEN20008390, SPLEN20162680, UTERU20134910, ASTRO20155290, FEBRA20080810, NT2RP70032610, NT2RP70036880, NTONG20015870, OCBBF20188730, SMINT20122910, SPLEN20099700

These genes are involved in cancers.

Further, there is a method to search for genes involved in development and differentiation: the expression frequency analysis in which the expression levels of genes are compared between developing or differentiating tissues and/or cells and adult tissues and/or cells. The genes involved in tissue development and/or differentiation are genes participating in tissue construction and expression of function, and thus are useful genes, which are available for regenerative medicine aiming at convenient regeneration of injured tissues.

Search was carried out for the genes whose expression frequencies were different between developing and/or differentiating tissues and/or cells, and adult tissues and/or cells, by using the information of gene expression frequency based on the database of the nucleotide sequences of 1,402,070 clones shown above.

The result of comparative analysis of cDNA libraries derived from fetal brain (FCBBF, FEBRA or OCBBF) and adult brain (BRACE, BRALZ, BRAMY, BRAWH, BRCAN, BRCOC, BRHIP, BRSSN, BRSTN or BRTHA) showed that the genes whose expression levels were different between the two were the following clones (Tables 16 to 48).

3NB6910001910, ADRGL20018300, ASTRO20001410, ASTRO20033160, ASTRO20058630, ASTRO20064750, ASTRO20100720, ASTRO20141350, ASTRO20145760, ASTRO20181690, BGGI120006160, BRACE20006400, BRACE20011070, BRACE20019540, BRACE20027620, BRACE20037660, BRACE20038000, BRACE20038470, BRACE20038480, BRACE20038850, BRACE20039440, BRACE20039540, BRACE20050900, BRACE20051380, BRACE20051690, BRACE20052160, BRACE20053280, BRACE20053480, BRACE20053630, BRACE20054500, BRACE20055180, BRACE20057420, BRACE20057620, BRACE20057730, BRACE20058580, BRACE20058810, BRACE20060840, BRACE20060890, BRACE20061050, BRACE20061740, BRACE20062400, BRACE20062740, BRACE20063630, BRACE20063780, BRACE20063800, BRACE20063930, BRACE20064880, BRACE20068590, BRACE20069090, BRACE20081720, BRACE20082950, BRACE20096200, BRACE20096540, BRACE20097320, BRACE20101700, BRACE20101710, BRACE20106840, BRACE20107530, BRACE20108130, BRACE20108880, BRACE20109370, BRACE20109830, BRACE20114780, BRACE20115450, BRACE20115920, BRACE20116110, BRACE20116460, BRACE20118380, BRACE20121850, BRACE20141080, BRACE20142320, BRACE20147800, BRACE2014.8210, BRACE20148240, BRACE20150310, BRACE20151320, BRACE20152870, BRACE20153680, BRACE20154120, BRACE20163150, BRACE20163350, BRACE20165830, BRACE20171240, BRACE20172980, BRACE20175870, BRACE20177200, BRACE20179340, BRACE20185680, BRACE20188470, BRACE20190040, BRACE20190440, BRACE20192440, BRACE20195100, BRACE20201570, BRACE20220300, BRACE20223280, BRACE20223330, BRACE20224480, BRACE20224500, BRACE20228480, BRACE20229280, BRACE20230700, BRACE20232840, BRACE20235400, BRACE20237270, BRACE20238000, BRACE20240740, BRACE20248260, BRACE20253160, BRACE20253330, BRACE20257100, BRACE20262930, BRACE20262940, BRACE20266750, BRACE20267250, BRACE20269200, BRACE20269710, BRACE20273890, BRACE20274080, BRACE20283920, BRACE20284100, BRACE20286360, BRACE20287410, BRALZ20013500, BRALZ20014450, BRALZ20017430, BRALZ20018340, BRALZ20054710, BRALZ20058880, BRALZ20059500, BRALZ20064740, BRALZ20065600, BRALZ20069760, BRALZ20073760, BRALZ20075450, BRALZ20075760, BRALZ20077900, BRALZ20077930, BRALZ20080310, BRALZ20088690, BRAMY10001300, BRAMY10001570, BRAMY20000520, BRAMY20000860, BRAMY20002770, BRAMY20004110, BRAMY20011140, BRAMY20025840, BRAMY20039260, BRAMY20045240, BRAMY20054880, BRAMY20060920, BRAMY20063970, BRAMY20071850, BRAMY20102080, BRAMY20104640, BRAMY20110640, BRAMY20111960, BRAMY20116790, BRAMY20121190, BRAMY20121620, BRAMY20124260, BRAMY20134140, BRAMY20135900, BRAMY20136210, BRAMY20137560, BRAMY20144620, BRAMY20147540, BRAMY20148130, BRAMY20152110, BRAMY20153110, BRAMY20157820, BRAMY20160700, BRAMY20163250, BRAMY20163270, BRAMY20167060, BRAMY20167710, BRAMY20168920, BRAMY20170140, BRAMY20174550, BRAMY20178640, BRAMY20181220, BRAMY20182730, BRAMY20183080, BRAMY20184670, BRAMY20195090, BRAMY20204450, BRAMY20205740, BRAMY20210400, BRAMY20211390, BRAMY20211420, BRAMY20213100, BRAMY20215230, BRAMY20217460, BRAMY20218250, BRAMY20218670, BRAMY20229800, BRAMY20229840, BRAMY20230600, BRAMY20231720, BRAMY20240040, BRAMY20245300, BRAMY20247110, BRAMY20247280, BRAMY20248490, BRAMY20250240, BRAMY20250320, BRAMY20252180, BRAMY20252720, BRAMY20260910, BRAMY20261680, BRAMY20266850, BRAMY20267130, BRAMY20268990, BRAMY20270730, BRAMY20271400, BRAMY20273960, BRAMY20277140, BRAMY20277170, BRAMY20280720, BRAMY20284910, BRAMY20285160, BRAMY20285930, BRAMY20286820, BRAWH20002320, BRAWH20012390, BRAWH20014920, BRAWH20015350, BRAWH20015890, BRAWH20016660, BRAWH20016860, BRAWH20017010, BRAWH20018730, BRAWH20028110, BRAWH20029630, BRAWH20064050, BRAWH20075700, BRAWH20096780, BRAWH20100690, BRAWH20101360, BRAWH20103180, BRAWH20105840, BRAWH20106180, BRAWH20107540, BRAWH20110660, BRAWH20110790, BRAWH20110960, BRAWH20111550, BRAWH20112940, BRAWH20114000, BRAWH20117950, BRAWH20118230, BRAWH20122580, BRAWH20125380, BRAWH20126190, BRAWH20126980, BRAWH20132190, BRAWH20137480, BRAWH20138660, BRAWH20139410, BRAWH20142340, BRAWH20147290, BRAWH20149340, BRAWH20155950, BRAWH20158530, BRAWH20160280, BRAWH20162690, BRAWH20166790, BRAWH20171030, BRAWH20173050, BRAWH20182060, BRAWH20185060, BRCAN10001490, BRCAN20003460, BRCAN20006200, BRCAN20006390, BRCAN20054490, BRCAN20060190, BRCAN20064010, BRCAN20071190, BRCAN20091560, BRCAN20103740, BRCAN20124080, BRCAN20126130, BRCAN20143700, BRCAN20147880, BRCAN20216690, BRCAN20224720, BRCAN20237240, BRCAN20263400, BRCAN20273100, BRCAN20273340, BRCAN20273550, BRCAN20275130, BRCAN20279700, BRCAN20280210, BRCAN20280400, BRCAN20283190, BRCAN20283380, BRCAN2028460b, BRCAN20285450, BRCOC10000870, BRCOC20001860, BRCOC20004040, BRCOC20004870, BRCOC20006370, BRCOC20008160, BRCOC20008500, BRCOC20020850, BRCOC20021550, BRCOC20023230, BRCOC20026640, BRCOC20027510, BRCOC20031000, BRCOC20031250, BRCOC20031870, BRCOC20035130, BRCOC20037320, BRCOC20037400, BRCOC20041750, BRCOC20055420, BRCOC20059510, BRCOC20077690, BRCOC20090520, BRCOC20091960, BRCOC20093800, BRCOC20099370, BRCOC20101230, BRCOC20107300, BRCOC20110100, BRCOC20114180, BRCOC20117690, BRCOC20119960, BRCOC20121720, BRCOC20122290, BRCOC20128130, BRCOC20134480, BRCOC20135730, BRCOC20136750, BRCOC20144000, BRCOC20147480, BRCOC20148330, BRCOC20155970, BRCOC20158240, BRCOC20176520, BRCOC20178560, BRHIP10001290, BRHIP20000870, BRHIP20001630, BRHIP20096170, BRHIP20096850, BRHIP20103090, BRHIP20104440, BRHIP20105710, BRHIP20106100, BRHIP20107440, BRHIP20111200, BRHIP20115080, BRHIP20115760, BRHIP20118380, BRHIP20118910, BRHIP20119330, BRHIP20121410, BRHIP20123140, BRHIP20129720, BRHIP20132860, BRHIP20135100, BRHIP20137230, BRHIP20139720, BRHIP20140630, BRHIP20142850, BRHIP20143730, BRHIP20143860, BRHIP20149540, BRHIP20153560, BRHIP20153600, BRHIP20167880, BRHIP20169680, BRHIP20169900, BRHIP20170100, BRHIP20173150, BRHIP20174040, BRHIP20175420, BRHIP20180140, BRHIP20183690, BRHIP20186120, BRHIP20186500, BRHIP20189980, BRHIP20190070, BRHIP20191490, BRHIP20191770, BRHIP20194940, BRHIP20195890, BRHIP20196410, BRHIP20205090, BRHIP20207430, BRHIP20207990, BRHIP20208420, BRHIP20208590, BRHIP20227080, BRHIP20230710, BRHIP20232290, BRHIP20233090, BRHIP20234380, BRHIP20236950, BRHIP20238600, BRHIP20238690, BRHIP20240460, BRHIP20243470, BRHIP20249110, BRHIP20252450, BRHIP20253660, BRHIP20277620, BRHIP20283030, BRHIP20284800, BRHIP20285830, BRHIP20285930, BRHIP30004880, BRSSN10000920, BRSSN20013420, BRSSN20014260, BRSSN20015030, BRSSN20015790, BRSSN20018690, BRSSN20028570, BRSSN20038200, BRSSN20038410, BRSSN20039370, BRSSN20043040, BRSSN20046570, BRSSN20046790, BRSSN20046860, BRSSN20066110, BRSSN20097020, BRSSN20101100, BRSSN20105870, BRSSN20105960, BRSSN20108300, BRSSN20120810, BRSSN20121030, BRSSN20137020, BRSSN20142940, BRSSN20146100, BRSSN20151990, BRSSN20159070, BRSSN20159820, BRSSN20169050, BRSSN20176820, BRSSN20177570, BRSSN20187310, BRSTN20000580, BRSTN20005360, BRTHA20000570, BRTHA20004740, BRTHA20046290, BRTHA20046390, BRTHA20046420, CD34C30001250, CD34C30004240, CTONG10000100, CTONG20004690, CTONG20027090, CTONG20050280, CTONG20076130, CTONG20077790, CTONG20095290, CTONG20095340, CTONG20099380, CTONG20106520, CTONG20118250, CTONG20121010, CTONG20127450, CTONG20128470, CTONG20141650, CTONG20143690, CTONG20153300, CTONG20155180, CTONG20158150, CTONG20161850, CTONG20164990, CTONG20186320, D3OST10002700, D6OST20003580, D9OST20000310, D9OST20035800, DFNES20010910, DFNES20071130, HCHON20002260, HCHON20003220, HCHON20010990, HCHON20015350, HCHON20022470, HCHON20067220, HCHON20067700, HEART20003060, HEART20005410, HEART20061950, HEART20090000, HHDPC10000650, HHDPC20057940, HLUNG20033780, KIDNE20011170, KIDNE20027250, KIDNE20104300, KIDNE20107500, KIDNE20122910, KIDNE20127100, KIDNE20180710, LIVER10001260, LIVER20064100, LIVER20087510, MAMGL10000830, MESAN20031900, MESAN20036460, MESAN20106640, MESAN20164090, NOVAR10000150, NOVAR20000380, NT2NE20010400, NT2NE20010490, NT2NE20021620, NT2NE20122430, NT2NE20125050, NT2NE20174920, NT2RI20001330, NT2RI20023590, NT2RI20041880, NT2RI20046080, NT2RI20216250, NT2RI20252550, NT2RP60000770, NT2RP70045590, NT2RP70063950, NT2RP70195430, NT2RP70198350, NTONG20028070, NTONG20046140, NTONG20064840, NTONG20067830, NTONG20077560, PANCR10000910, PEBLM20024550, PEBLM20052820, PEBLM20074370, PERIC20004780, PLACE50000660, PLACE60079250, PLACE60136720, PLACE60138830, PROST20005670, PROST20050670, PROST20107820, PROST20111050, PROST20116600, PROST20120160, PROST20123530, PROST20161950, PROST20171280, PROST20175290, PROST20185830, PROST20191640, PUAEN20015860, PUAEN20030180, PUAEN20044000, PUAEN20078980, PUAEN20085150, PUAEN20108240, SKMUS20012010, SKNSH20062340, SMINT20013480, SMINT20042990, SMINT20053300, SMINT20076470, SMINT20092330, SMINT20101440, SMINT20121220, SMINT20121950, SMINT20122910, SMINT20130320, SMINT20131810, SMINT20144800, SMINT20163960, SPLEN20002220, SPLEN20008740, SPLEN20011410, SPLEN20016260, SPLEN20027440, SPLEN20029310, SPLEN20033960, SPLEN20054290, SPLEN20126190, SPLEN20128000, SPLEN20145720, SPLEN20146450, SPLEN20147110, SPLEN20149110, SPLEN20157880, SPLEN20158900, SPLEN20171210, SPLEN20179180, SPLEN20186430, SPLEN20204170, SPLEN20212730, SPLEN20214580, SPLEN20250390, STOMA20051200, STOMA20062290, STOMA20092890, SYNOV20003970, TESOP20005270, TESTI10000940, TESTI20001720, TESTI20002720, TESTI20004890, TESTI20011200, TESTI20035960, TESTI20037560, TESTI20044310, TESTI20061110, TESTI20063830, TESTI20086210, TESTI20152460, TESTI20168960, TESTI20170350, TESTI20208400, TESTI20213580, TESTI20214250, TESTI20254220, TESTI20258460, TESTI20330310, TESTI20334410, TESTI20366910, TESTI20391770, TESTI20432750, TESTI20455620, THYMU20000570, THYMU20058070, THYMU20066100, THYMU20075320, THYMU20081490, THYMU20100410, THYMU20101920, THYMU20108310, THYMU20119390, THYMU20126900, THYMU20128260, THYMU20169680, THYMU20193640, THYMU20209590, THYMU20235760, THYMU20239430, THYMU20240710, THYMU20253250, THYMU20286290, TKIDN10000010, TKIDN20005210, TKIDN20030590, TRACH20005020, TRACH20005400, TRACH20007020, TRACH20019960, TRACH20034840, TRACH20079690, TRACH20128110, TRACH20149970, TRACH20183170, UMVEN10001860, UMVEN20003540, UTERU20000740, UTERU20030570, UTERU20054460, UTERU20055930, UTERU20056010, UTERU20064860, UTERU20065930, UTERU20070040, UTERU20081300, UTERU20084260, UTERU20094350, UTERU20120310, UTERU20124070, UTERU20164260, UTERU20168220, UTERU20183640, ASTRO20032120, ASTRO20125520, BRACE20039040, BRACE20060720, BRACE20062640, BRACE20090440, BRACE20099570, BRACE20111830, BRACE20142570, BRAWH20128270, BRCAN20280360, BRHIP20110800, BRHIP20176420, BRSSN20003120, CTONG20105660, CTONG20124010, CTONG20133480, CTONG20139070, CTONG20160560, FCBBF10001210, FCBBF10001550, FCBBF10001710, FCBBF10001820, FCBBF10002430, FCBBF10002700, FCBBF10002800, FCBBF10003220, FCBBF10003740, FCBBF10003760, FCBBF10005060, FCBBF10005460, FCBBF10005500, FCBBF20006780, FCBBF20014270, FCBBF20023700, FCBBF20032970, FCBBF20035280, FCBBF20042170, FCBBF20042560, FCBBF20051220, FCBBF20054280, FCBBF20056370, FCBBF20064520, FCBBF20067810, FCBBF20071860, FCBBF20072650, FCBBF20076330, FCBBF30008470, FCBBF30010810, FCBBF30012350, FCBBF30012810, FCBBF30015940, FCBBF30019120, FCBBF30024750, FCBBF30028180, FCBBF30033050, FCBBF30039020, FCBBF30052180, FCBBF30054440, FCBBF30057290, FCBBF30062880, FCBBF30070770, FCBBF30071520, FCBBF30078290, FCBBF30083620, FCBBF30123470, FCBBF30170590, FCBBF30172550, FCBBF30175310, FCBBF30178730, FCBBF30190850, FCBBF30195640, FCBBF30199610, FCBBF30215060, FCBBF30225660, FCBBF30240960, FCBBF30242250, FCBBF30243640, FCBBF30247930, FCBBF30252520, FCBBF30252800, FCBBF30252850, FCBBF30262510, FCBBF30266780, FCBBF30266920, FCBBF30278630, FCBBF30279030, FCBBF30281880, FCBBF30284720, FCBBF30285280, FCBBF40001730, FCBBF40005480, HCHON20007380, HEART20072310, HHDPC20068620, HLUNG20023340, KIDNE20017130, KIDNE20028830, MESAN20014500, NT2RP70072690, NT2RP70137640, NTONG20067090, PLACE60004630, PROST20083600, PROST20189770, RECTM20003490, SKNSH20008190, SMINT20115880, SPLEN20169720, SPLEN20194050, SPLEN20284240, TESTI20083940, TESTI20213150, TESTI20254540, TESTI20265250, TRACH20118940, UTERU20145480, UTERU20146680, ASTRO20155290, BRAWH20030250, BRAWH20113430, BRAWH20122770, BRHIP20005340, BRHIP30001110, BRSTN20002200, CTONG20052900, CTONG20108210, DFNES20031920, FEBRA10001900, FEBRA20003210, FEBRA20007620, FEBRA20009090, FEBRA20010120, FEBRA20017050, FEBRA20018280, FEBRA20025270, FEBRA20025520, FEBRA20026110, FEBRA20026280, FEBRA20029860, FEBRA20034680, FEBRA20037260, FEBRA20040530, FEBRA20042190, FEBRA20052910, FEBRA20060610, FEBRA20072120, FEBRA20079310, FEBRA20082010, FEBRA20088360, FEBRA20090290, FEBRA20092890, FEBRA20093520, FEBRA20097310, FEBRA20113560, FEBRA20125070, FEBRA20132740, FEBRA20140100, FEBRA20161120, FEBRA20166540, FEBRA20167390, FEBRA20171380, FEBRA20176800, FEBRA20184330, FEBRA20192420, FEBRA20195820, FEBRA20196370, FEBRA20196630, FEBRA20197110, FEBRA20211710, FEBRA20214970, FEBRA20215500, FEBRA20216360, FEBRA20222040, FEBRA20223220, FEBRA20225040, FEBRA20226010, FEBRA20229560, FEBRA20229630, FEBRA20232850, FEBRA20235500, HCHON20040020, KIDNE20102650, NT2RP70037240, PEBLM20072960, PLACE60169420, SKMUS20003610, SMINT20026890, SMINT20033400, SPLEN20020070, SPLEN20079510, TESTI20001000, TESTI20094020, THYMU20027560, THYMU20180280, THYMU20271250, TRACH20003590, UMVEN10001560, UTERU20022940, UTERU20046640, UTERU20119060, UTERU20144640, UTERU20176130, ASTRO20008010, BRACE20276430, BRAMY20103570, BRAMY20120910, BRAMY20162510, BRAMY20196000, BRAWH20164460, BRCAN20273640, BRCOC20105100, BRHIP20198190, BRHIP20222280, BRHIP20254480, BRHIP30004570, CTONG20028410, CTONG20091080, CTONG20103480, CTONG20126070, CTONG20139340, DFNES20001530, HCHON20008150, HHDPC20001040, HLUNG20016330, HLUNG20017120, IMR3220002430, KIDNE20007210, KIDNE20021910, KIDNE20124400, MESAN10001260, MESAN20029400, MESAN20121130, MESAN20153910, NT2NE20159740, NT2NE20177520, NT2RI20086220, NT2RI20250750, NT2RP60000850, NT2RP70044280, NT2RP70056750, NT2RP70081610, NTONG20009770, OCBBF10000540, OCBBF10001750, OCBBF20006770, OCBBF20013890, OCBBF20019830, OCBBF20020150, OCBBF20020830, OCBBF20023570, OCBBF20028050, OCBBF20028650, OCBBF20029800, OCBBF20030280, OCBBF20030910, OCBBF20035930, OCBBF20037440, OCBBF20041680, OCBBF20045330, OCBBF20046120, OCBBF20046470, OCBBF20046690, OCBBF20048660, OCBBF20050770, OCBBF20051610, OCBBF20053430, OCBBF20053490, OCBBF20053730, OCBBF20054200, OCBBF20054760, OCBBF20060300, OCBBF20062140, OCBBF20062410, OCBBF20066390, OCBBF20071210, OCBBF20071840, OCBBF20072240, OCBBF20073540, OCBBF20074140, OCBBF20076220, OCBBF20079310, OCBBF20079460, OCBBF20081380, OCBBF20082830, OCBBF20085200, OCBBF20086400, OCBBF20086910, OCBBF20088140, OCBBF20088220, OCBBF20091150, OCBBF20100400, OCBBF20103130, OCBBF20104040, OCBBF20105570, OCBBF20107090, OCBBF20107920, OCBBF20108580, OCBBF20108630, OCBBF20109310, OCBBF20111770, OCBBF20116850, OCBBF20118970, OCBBF20120390, OCBBF20121390, OCBBF20122620, OCBBF20124360, OCBBF20127040, OCBBF20127140, OCBBF20127550, OCBBF20128120, OCBBF20129360, OCBBF20130910, OCBBF20132850, OCBBF20140890, OCBBF20145760, OCBBF20148280, OCBBF20151150, OCBBF20153340, OCBBF20153350, OCBBF20155060, OCBBF20164670, OCBBF20170690, OCBBF20173060, OCBBF20173250, OCBBF20178150, OCBBF20180840, OCBBF20186870, OCBBF20189560, PEBLM20044520, PEBLM20071880, PLACE60060420, PROST20047390, PUAEN20003740, SMINT20029760, SPLEN20008820, SPLEN20084600, SPLEN20095550, SPLEN20099700, SPLEN20140800, SPLEN20173510, SPLEN20211220, SPLEN20250170, STOMA20067800, TESTI20031270, TESTI20116830, TESTI20121550, TESTI20234140, TESTI20442760, THYMU20039810, THYMU20070360, TRACH20033230, TRACH20084720, BRACE20067430, BRAWH10000930, BRHIP20003120, BRSSN20152380, FEBRA20024100, FEBRA20027810, FEBRA20037500, FEBRA20082100, FEBRA20098460, FEBRA20144170, FEBRA20145780, FEBRA20233770, HHDPC10000830, MESAN20025190, MESAN20089360, NT2RI20048840, NT2RP70043480, OCBBF20032460, OCBBF20039250, OCBBF20049300, OCBBF20061720, OCBBF20078920, OCBBF20084660, OCBBF20087010, PROST20087700, PROST20153320, TRACH20135520, ADIPS20004250, ASTRO10001650, BRACE20056810, BRACE20059370, BRACE20106690, BRACE20210140, BRAWH20103290, BRAWH20121640, BRHIP20005530, BRHIP20217620, BRHIP20218580, BRHIP20238880, CTONG20075860, CTONG20129960, FCBBF10000240, FCBBF10000630, FCBBF10001150, FCBBF10004120, FCBBF10005740, FCBBF20075560, FCBBF30018550, FCBBF30025560, FCBBF30086440, FCBBF30090690, FCBBF30189490, FCBBF30233680, FCBBF30240020, HCHON20007510, HCHON20016650, HHDPC20095280, KIDNE20002520, KIDNE20009470, NT2RI20003480, NT2RI20055790, NT2RP70027380, NT2RP70032610, NT2RP70062230, OCBBF10001850, OCBBF20022900, OCBBF20026630, OCBBF20049840, OCBBF20059560, OCBBF20068490, OCBBF20071960, OCBBF20080410, OCBBF20094240, OCBBF20097720, OCBBF20108190, OCBBF20108430, OCBBF20126780, OCBBF20130110, OCBBF20139260, OCBBF20148730, OCBBF20149280, OCBBF20164050, OCBBF20173980, OCBBF20178880, OCBBF20180120, OCBBF20188730, PROST20057930, SPLEN20162680, SPLEN20211940, TESTI20184620, TESTI20211240, TESTI20369690, THYMU20141670, TRACH20028030, UTERU20099720, UTERU20135860, BRACE20057190, BRHIP20191860, BRHIP20214950, FCBBF10003670, FCBBF10004370, FCBBF30013770, FCBBF30095260, FCBBF30246230, FEBRA20002100, FEBRA20034360, FEBRA20095140, FEBRA20130190, FEBRA20204060, HCHON20008320, LIVER20028420, TRACH20111130, ASTRO20108190, BRACE20003070, BRACE20060550, BRAWH20004600, BRAWH20011710, BRAWH20016620, BRHIP10001740, BRSTN10000830, CTONG10000940, CTONG20150910, D30ST10002670, FCBBF10000380, FCBBF10000770, FCBBF10003770, FCBBF20059090, FCBBF30016320, FCBBF30016570, FCBBF30049550, FCBBF30083820, FCBBF30238870, FCBBF40001420, FEBRA10001880, FEBRA20004620, FEBRA20080810, FEBRA20086620, FEBRA20095880, HHDPC20034390, HLUNG10000550, NT2RI20023160, NT2RI20023910, NT2RI20025400, NT2RI20028470, NT2RI20054050, NT2RI20076290, NT2RI20091730, NT2RI20091940, NT2RP70036880, NT2RP70078420, OCBBF20047570, OCBBF20080050, OCBBF20125530, OCBBF20140640, TRACH20032720, TRACH20141240, UTERU20004240

The result of comparative analysis of cDNA libraries derived from fetal heart (FEHRT) and adult heart (HEART) showed that the genes whose expression levels were different between the two were the following clones (Table 49).

FEHRT20003250, OCBBF20189560, BRAWH20029630, CTONG20150910, HCHON20007510, HEART20003060, HEART20005410, HEART20021840, HEART20025980, HEART20034320, HEART20037810, HEART20049400, HEART20049410, HEART20049800, HEART20061950, HEART20063340, HEART20067870, HEART20067890, HEART20072310, HEART20074430, HEART20077670, HEART20089940, HEART20090000, HEART20095990, HLUNG10000550, HLUNG20017120, KIDNE20028390, KIDNE20028830, NTONG20029480, OCBBF10001750, PROST20127800, SKMUS20001980, SKMUS20003610, SMINT20026890, SMINT20121220, SMINT20122910, SMINT20183530, SPLEN20008740, SPLEN20027440, SPLEN20162680, STOMA20062290, TESTI20254220, THYMU20271250, TRACH20141240, UTERU20004240

The result of comparative analysis of cDNA libraries derived from fetal kidney (FEKID) and adult kidney (KIDNE) showed that the genes whose expression levels were different between the two were the following clones (Table 50).

ASTRO10001650, ASTRO20108190, BGGI120006160, BRACE20039040, BRACE20060550, BRAMY20102080, BRAWH20004600, BRAWH20125380, BRAWH20162690, BRHIP20115760, BRHIP20205090, BRHIP20238880, CTONG20052650, CTONG20108210, CTONG20128470, CTONG20133480, CTONG20139070, D90ST20000310, DFNES20001530, FCBBF10001820, FEBRA20002100, HCHON20008980, HCHON20016650, HLUNG20033780, KIDNE20002520, KIDNE20003940, KIDNE20006780, KIDNE20007210, KIDNE20007770, KIDNE20008010, KIDNE20009470, KIDNE20011170, KIDNE20011400, KIDNE20013730, KIDNE20017130, KIDNE20018730, KIDNE20018970, KIDNE20020150, KIDNE20021680, KIDNE20021910, KIDNE20021980, KIDNE20022620, KIDNE20024830, KIDNE20027250, KIDNE20027950, KIDNE20028390, KIDNE20028830, KIDNE20029800, KIDNE20067330, KIDNE20079440, KIDNE20096280, KIDNE20096470, KIDNE20100070, KIDNE20100840, KIDNE20101370, KIDNE20101510, KIDNE20102650, KIDNE20102710, KIDNE20104300, KIDNE20106740, KIDNE20107390, KIDNE20107500, KIDNE20107620, KIDNE20109730, KIDNE20109890, KIDNE20112000, KIDNE20115080, KIDNE20118580, KIDNE20120090, KIDNE20121880, KIDNE20122910, KIDNE20124400, KIDNE20125630, KIDNE20126010, KIDNE20126130, KIDNE20127100, KIDNE20127450, KIDNE20127750, KIDNE20130450, KIDNE20131580, KIDNE20132180, KIDNE20137340, KIDNE20138010, KIDNE20141190, KIDNE20144890, KIDNE20148900, KIDNE20163880, KIDNE20180710, KIDNE20181660, KIDNE20182690, KIDNE20186780, KIDNE20190740, LIVER20035110, MESAN20025190, NOVAR20000380, NT2RI20054050, NT2RP70043480, PROST20107820, PROST20123530, PROST20161950, PUAEN20030180, SKMUS20003610, SMINT20033400, TBAES20000590, TESTI20044310, TESTI20082330, TRACH20032720, UTERU20099720, BRACE20003070, BRCOC20031870, CTONG20125640, FCBBF30016320, HCHON20002260, HLUNG10000550, PROST20130530, SPLEN20169720, SPLEN20194050, KIDNE20028720

The result of comparative analysis of cDNA libraries derived from fetal lung (FELNG) and adult lung (HLUNG) showed that the genes whose expression levels were different between the two were the following clones (Table 51).

BRACE20096200, BRAWH20004600, BRAWH20030250, BRCAN20006390, BRCAN20280360, BRHIP20238880, CTONG10000940, CTONG20103480, CTONG20129960, CTONG20155180, FCBBF10001210, FEBRA20144170, FEBRA20197110, HHDPC20034390, HLUNG20016330, HLUNG20016770, HLUNG20017120, HLUNG20023340, HLUNG20033780, HLUNG20084390, IMR3220002430, LIVER20028420, NOVAR20000380, NT2RI20054050, NT2RI20091730, NT2RP70044280, OCBBF20020830, OCBBF20125530, PLACE60004630, PROST20057930, PROST20107820, PROST20185830, PUAEN20030180, SMINT20121220, SPLEN20002220, SPLEN20054290, SPLEN20128000, SPLEN20157300, SPLEN20176200, SPLEN20179180, SPLEN20211940, STOMA20013890, TBAES20000590, TESTI20094230, TESTI20184620, TESTI20334410, THYMU20000570, THYMU20039810, TRACH20007020, TRACH20141240, TRACH20183170, D90ST20033970, FELNG20002410, HCHON20016650, KIDNE20029800, OCBBF20145760, SPLEN20162680, TESTI20214250, TRACH20005400, HCHON20002260, HLUNG10000550, NT2RI20023910, SPLEN20008740

These genes are involved in regeneration of tissues and/or cells.

EXAMPLE 8 Expression Frequency Analysis by PCR

Specific PCR primers were prepared based on the full-length nucleotide sequences, and the expression frequency was analyzed by the ATAC-PCR method (Adaptor-tagged competitive PCR method: Nucleic Acids Research 1997, 25(22): 4694-4696; “DNA Micro-array and Advanced PCR Techniques”, Cell Technology, supplement, Eds., Muramatsu and Nawa (Shujunsha, 2000): 104-112). Inflammation-related genes can be identified by revealing the genes whose expression levels are altered depending on the presence of an inflammation-inducing factor. Then, by using THP-1 cell line, which is a cell line of monocyte line, and TNF-α, which is inflammation-inducing factor, suitable for this system, the genes whose expression levels are altered depending on the presence of the factors were searched for by the system.

THP-1 cell line (purchased from DAINIPPON PHARMACEUTICAL) was cultured to be confluent in RPMI1640 medium (sigma) containing 5% fetal calf serum (GIBCO BRL). Then, the medium was changed with the medium containing 10 ng/ml TNF-α (human recombinant TNF-α; Pharmacia Biotech), and the culture was continued at 37° C. under 5% CO2. After three hours, the cells were harvested, and total RNA was extracted from them by using ISOGEN reagent (Nippon Gene). The extraction was carried out according to the method in the document attached to ISOGEN reagent. In addition, total RNA was also extracted from the cells cultured without stimulation of TNF-α.

The genes involved in the onset of gastritis and gastroduodenal ulcer induced by the infection of Helicobacter pylori to the epithelia of stomach can be identified by revealing the genes whose expression levels are altered depending on co-culturing the cells with Helicobacter pylori. A recent study has suggested that various substances derived from Helicobacter pylori trigger the inflammation reaction. In particular, the members belonging to the family of genes called “cag pathogenicity island (cag PAI)” contribute to the activation of the NF-KB pathway (Gastroenterology 2000, 119: 97-108). Further, it has been found that cag PAI is involved in the onset of gastritis and the like by the study using an animal model (Journal of Experimental Medicine 2000, 192:1601-1610). Then, by using co-culture of a gastric cancer cell line with cag PAI-positive Helicobacter pylori (TN2), suitable for this system, the genes whose expression levels are altered depending on the presence of Helicobacter pylori were searched for by the system. Further, in order to study the involvement of cag PAI in the alterations of gene expression levels depending on the co-culture with Helicobacter pylori, the altered expression levels were compared between the cells co-cultured with a strain of Helicobacter pylori (TN2ΔcagE strain) having a mutation in cagE, which is one of the cag PAI genes, and the cag PAI-positive strain (TN2).

A gastric cancer cell line MKN45 (provided by the Cell Bank, RIKEN GENE BANK, The Institute of Physical and Chemical Research) was cultured to be confluent in RPMI1640 medium (sigma) containing 10% fetal calf serum (GIBCO BRL). Then, the medium was changed with the medium containing 100-fold excess (in terms of the number of cells or the number of colonies) of Helicobacter pylori (cag PAI positive strain (TN2) and cagE mutant (TN2ΔcagE): both were provided by Prof. Omata, Faculty of Medicine, The University of Tokyo), as compared with the number of the cancer cells. The culture was continued at 37° C. under 5% CO2. After three hours, the cells were harvested, and total RNA was extracted from them by using ISOGEN reagent (Nippon Gene). The extraction was carried out according to the method in the document attached to ISOGEN reagent. In addition, total RNA was also extracted from the cells cultured without Helicobacter pylori.

The analysis by the ATAC-PCR method was carried out basically according to “DNA Micro-array and Advanced PCR Techniques”, Cell Technology, supplement (Genome Science Series 1, Eds., Muramatsu and Nawa (Shujunsha, 2000): 104-112). Adapter ligation to the internal standard sample (sample to make the calibration curve for the clone of interest) and test sample was carried out in the two separate reaction systems indicated below. The combination of 6 types of adapters (AD-1, AD-2, AD-3, AD-4, AD-5 and AD-6: see the sequences indicated below) and the samples are as follows.

Reaction System A

AD1; internal standard, 10-fold

AD2; THP-1 cells, unstimulated

AD3; internal standard, 3-fold

AD4; THP-1 cells, TNF-α stimulation for one hour

AD5; THP-1 cells, TNF-α stimulation for three hours

AD6; internal standard, 1-fold

Reaction system B

AD1; internal standard, 1-fold

AD2; MKN45 cells, unstimulated

AD3; internal standard, 3-fold

AD4; MKN45 cells, co-cultured with TN2(Helicobacter pylori)

AD5; internal standard, 10-fold

AD6; MKN45 cells, co-cultured with TN2AcagE(cagE gene mutant)

Adapter Sequences:


The internal standard sample used for this assay was a mixture of total RNAs from tissues (or culture cells; all from UNITECH) of Fetal Brain, Testis, Trachea, and Spleen. RNA was prepared according to the standard method.

The sequences of primers specific to the genes and the names of clones of interest in the analysis are as follows. The gene specific primers were designed to produce the PCR products of 70 to 200 bp, which are derived from the adapter-containing cDNA. The sequence of adapter-specific primer (labeled with fluorescence (FAM)) used in the competitive PCR was GTACATATTGTCGTTAGAACGC (22 nucleotides; SEQ ID NO: 4899). PCR was basically carried out with a cycling profile of preheating at 94° C. for 3 minutes, and 35 or 40 cycles of denaturation at 94° C. for 30 seconds/annealing at 50° C. for 60 seconds/extension at 72° C. for 90 seconds.

The nucleotide sequences of clone specific primers used in the experiments

Clone name, primer sequence and SEQ ID NO are indicated below in this order. Each is demarcated by a double slash mark (//). For a clone for which a primer used in Reaction system A (THP-1 cells) was different from a primer used in Reaction system B (MKN45 cells), the sequence of each of the primers was shown.


The result of expression frequency analysis is shown in Table 52. The clones not shown in the table contain clones whose expression levels could not be measured because the levels were too low or the sizes of the PCR products were different from the expected. It was confirmed that the expression levels of IL-8 genes used as positive control genes were elevated.

The result obtained by the search for the genes whose expression levels were altered depending on the presence of TNF-α in culturing THP-1 cell, which is a human monocyte cell line, showed that the clones whose expression levels were elevated by twofold or more one or three hours after the stimulation (the clones whose expression levels were 0.1 or lower both before and after the stimulation were excluded), were ASTRO20152140,

BRACE20057620, BRACE20060720, BRACE20090440, BRACE20152870, BRACE20229280, BRAMY20002770, BRAMY20266850, BRAMY20280720, BRAWH20106180, BRAWH20122770, BRHIP20096170, BRHIP20111200, BRHIP20186120, BRHIP20194940, BRHIP20207430, BRSSN20152380, CTONG20095270, CTONG20100240, CTONG20158150,

CTONG20265130, D30ST20006540, D90ST20031370, FCBBF20071860, FCBBF30251420, FCBBF30252520, FCBBF40001420, FEBRA20017050, FEBRA20082100, HCHON20011160, KIDNE20141190, KIDNE20163880, KIDNE20182690, LIVER10004790, LIVER20038540, LIVER20085800, MESAN20130220, MESAN20174170, NT2NE20158600, NT2RI20005750, NT2RP70110860, NT2RP70169110, NT2RP70175670, NT2RP70188710, PERIC20002140, PLACE60155130, PROST20120160, PROST20149250, PROST20161950, PUAEN20015260, SKNSH20080430, SMINT20051610, SMINT20060780, SMINT20161220, SMINT20163960, SPLEN20101190, SPLEN20157300, SPLEN20163560, SPLEN20214580, SPLEN20279950, STOMA20048520, TESTI20076850, TESTI20087620, TESTI20108720, TESTI20220100, TESTI20239510, TESTI20266740, TESTI20342430, TESTI20370020, TESTI20391210, TESTI20401020, TESTI20415640, THYMU20130890, THYMU20286290, TRACH20060150, TRACH20099340, UTERU20004240, UTERU20068990, UTERU20119060.

On the other hand, in particular cases where the expression levels were relatively high in the unstimulated cells (the relative value was 1 or higher), the clones whose expression levels were decreased by twofold or more by the TNF-α stimulation (the clones whose expression levels were increased 1 or 3 hours after the stimulation were excluded) were

ASTRO20032120, ASTRO20084250, ASTRO20181690, BRACE20062640, BRACE20067430, BRACE20235400, BRALZ20018340, BRALZ20069760, BRALZ20075450, BRAMY20163270, BRAMY20204450, BRAMY20218670, BRAMY20229800, BRAWH10000930, BRAWH20107540, BRAWH20132190, BRAWH20158530, BRCAN20273340, BRHIP20105710, BRHIP20186120, BRSSN20176820, CTONG20095290, DFNES20031920, FCBBF30033050, FCBBF30071520, FCBBF30083820, HCHON20008980, HCHON20022470, HHDPC20034390, KIDNE20028720, KIDNE20079440, KIDNE20127750, KIDNE20148900, LIVER20011130, MAMGL10000830, MESAN20127350, NT2NE20181650, NT2RI20023160, NT2RP70102350, NT2RP70157890, NTONG20029480, OCBBF20020830, OCBBF20041680, OCBBF20061720, OCBBF20127040, OCBBF20139260, OCBBF20178990, PEBLM20013120, PLACE60003480, PLACE60181070, PROST20151240, PUAEN20003740, PUAEN20011880, PUAEN20078980, PUAEN20085150, SKNSH20080430, SMINT20001760, SMINT20047810, SMINT20108530, SPLEN20158990, SPLEN20283650, STOMA20010250, STOMA20057820, TESTI20060400, TESTI20161970, TESTI20275620, TESTI20369690, TESTI20386230, TESTI20392250, TESTI20409440, TESTI20424730, THYMU20095960, THYMU20111180, THYMU20226600, THYMU20253250, THYMU20272490, TRACH20153810, UTERU20176130, UTERU20186740.

These clones were thus revealed to be involved in the inflammation reaction induced by TNF-α.

The result obtained by the search for the genes whose expression levels were altered depending on co-culturing gastric cancer cell line MKN45 with cag PAI positive Helicobacter pylori (TN2), showed that the clones whose expression levels were elevated by twofold or more (the clones whose expression levels were 0.1 or lower both before and after the stimulation were excluded), were ADRGL20067670, BLADE20004630, BRACE20039040,

BRACE20151320, BRACE20229280, BRACE20235400, BRALZ20058880, BRAMY20060920, BRAMY20184670, BRAMY20218670, BRAMY20229800, BRCAN20147880, BRHIP20196410, BRHIP30004880, BRSSN20187310, CD34C30004940, CTONG20265130, DFNES20031920, FCBBF30278630, FCBBF40001420,

HHDPC20095280, KIDNE20130450, LIVER20011130, LIVER20038540, NT2NE20172590, NT2RP70169110, OCBBF20085200, OCBBF20180840, PEBLM10000240, PLACE60003480, PROST20120160, PROST20151240, PUAEN20011880, SKMUS20031680, SKNSH20080430, SMINT20056210, SMINT20105000, SPLEN20019450, SPLEN20211570, STOMA20048520, TESTI20004890, TESTI20083940, TESTI20168480, TESTI20239510, TESTI20308600, TESTI20478010, UTERU20126880.

Of these clones, the expression levels of ADRGL20067670,

BLADE20004630, BRACE20151320, BRACE20229280, BRACE20235400, BRALZ20058880, BRAMY20218670, BRAMY20229800, BRHIP20196410, BRHIP30004880, CD34C30004940, DFNES20031920, FCBBF30278630, FCBBF40001420, HHDPC20095280, KIDNE20130450, LIVER20011130, LIVER20038540, NT2NE20172590, NT2RP70169110,

PEBLM10000240, PROST20151240, PUAEN20011880, SKMUS20031680, SKNSH20080430, SMINT20056210, SMINT20105000, SPLEN20019450, SPLEN20211570, STOMA20048520, TESTI20168480, TESTI20308600, TESTI20478010, UTERU20126880 were not increased by the co-culture with the cagE mutant (TN2ΔcagE). There may be the possibility that the expression levels of the 34 clones are altered via the NF-κB pathway. Among them, the expression levels of BRACE20229280, FCBBF40001420, LIVER20038540, NT2RP70169110, SKNSH20080430, STOMA20048520 were also increased when human monocyte cell line THP-1 was stimulated with TNF-α.

On the other hand, in particular cases where the expression levels were relatively high in the unstimulated cells (the relative value was 1 or higher), the clones whose expression levels were decreased by twofold or more in the presence of Helicobacter pylori were ASTRO20032120, BRACE20090440,

BRACE20114780, BRALZ20064740, BRAMY20002770, BRAMY20210400, BRAMY20215230, BRAMY20247280, BRAMY20267130, BRAWH20029630, BRAWH20100690, BRAWH20118230, BRCOC20105100, BRHIP20218580, BRSSN20046570, CTONG20138030, CTONG20146970, CTONG20158150, D3OST20037970, FCBBF30001840,

FCBBF30033050, FEBRA20082100, HCHON20035130, HCHON20043590, HCHON20067220, NT2NE20174920, NT2RI20009870, NT2RI20023160, NT2RP70062230, NT2RP70130020, NTONG20070340, OCBBF20020150, OCBBF20094240, OCBBF20107920, PROST20144220, PROST20149160, PROST20153320, PUAEN20003740, PUAEN20025680, PUAEN20040670, SMINT20014580, SPLEN20101190, STOMA20076800, TESTI20087620, TESTI20098530, TESTI20123080, TESTI20161970, TESTI20234140, TESTI20288110, TESTI20357960, TESTI20391210, TESTI20424730, THYMU20158250, THYMU20226600, TRACH20005020, TRACH20134950, TRACH20184490, TSTOM20001390, UTERU20119060, UTERU20134910, UTERU20176130.

These clones are involved in gastritis or gastroduodenal ulcer.

TABLE 3 CloneID CD34C D3OST D6OST D9OST ASTRO20001410 0 17.731 0 20.479 D3OST10001090 0 62.515 0 24.068 D3OST20036070 0 46.404 0 53.596 THYMU20039810 0 18.291 0 21.126 KIDNE20028720 0 0 38.385 46.259 BRAWH10000930 0 0 0 6.219 BRHIP20005340 0 0 0 4.615 CTONG20141650 0 0 0 64.925 D9OST20000310 0 0 0 63.705 D9OST20002780 0 0 0 100 D9OST20023970 0 0 0 37.837 D9OST20026730 0 0 0 19.695 D9OST20031370 0 0 0 100 D9OST20033970 0 0 0 38.536 D9OST20035800 0 0 0 93.047 D9OST20035940 0 0 0 100 D9OST20040180 0 0 0 100 FCBBF30018550 0 0 0 37.763 FCBBF30233680 0 0 0 33.084 KIDNE20102650 0 0 0 63.715 NT2RI20023160 0 0 0 10.811 PROST20107820 0 0 0 3.279 SKNSH20089400 0 0 0 25.857 SMINT20033400 0 0 0 39.619 CTONG20108210 0 0 47.973 0 D6OST20003580 0 0 95.4 0 D6OST20005070 0 0 100 0 ASTRO20155290 0 21.631 0 0 D3OST10002670 0 50.415 0 0 D3OST10002700 0 30.165 0 0 D3OST20006180 0 100 0 0 D3OST20006540 0 100 0 0 D3OST20007340 0 93.334 0 0 D3OST20013280 0 100 0 0 D3OST20024170 0 100 0 0 D3OST20024360 0 100 0 0 D3OST20037970 0 100 0 0 D3OST30002580 0 72.574 0 0 D3OST30002910 0 93.334 0 0 FCBBF10004120 0 22.594 0 0 NT2RI20001330 0 29.915 0 0 NTONG20009770 0 11.477 0 0 SPLEN20084600 0 30.589 0 0 SPLEN20140800 0 55.315 0 0 THYMU20169680 0 86.295 0 0 TRACH20141240 0 12.051 0 0 CD34C30001250 97.628 0 0 0 CD34C30003140 100 0 0 0 CD34C30004240 96.167 0 0 0 CD34C30004940 100 0 0 0 DFNES10001850 55.393 0 0 0 HHDPC20034390 21.364 0 0 0 NT2RI20091730 46.845 0 0 0 SKMUS20003610 44.913 0 0 0 SPLEN20225220 59.537 0 0 0 BRCOC20101230 46.01 0 0 14.772

TABLE 4 Clone ID NT2RM NT2RP NT2RI NT2NE CTONG20027090 62.349 0 0 0 CTONG20160560 57.22 0 0 0 NT2RP70032610 39.095 3.274 0 0 OCBBF20188730 39.876 0 0 0 SPLEN20162680 12.432 0 2.355 6.263 BRCOC20101230 0 2.64 3.981 3.97 BRHIP20005340 0 0.825 1.244 1.24 BRHIP20238880 0 2.66 7.355 2.667 FCBBF30016320 0 7.441 2.805 5.595 FEBRA20080810 0 6.827 5.147 2.566 FEBRA20225040 0 3.958 2.985 5.952 HCHON20008320 0 17.053 19.287 12.822 HHDPC20034390 0 0.613 1.387 0.922 HLUNG10000550 0 2.609 0.984 1.962 NT2RI20028470 0 9.076 6.843 4.549 NT2RI20054050 0 2.03 1.02 4.069 NT2RI20091730 0 2.688 2.027 4.042 NT2RP70078420 0 4.623 3.485 13.902 PUAEN20003740 0 2.314 0.582 1.16 THYMU20271250 0 0.431 0.651 1.297 BRACE20003070 0 8.516 4.281 0 BRACE20039040 0 6.248 4.711 0 BRAWH20004600 0 1.471 5.545 0 BRAWH20011710 0 8.931 2.245 0 BRCOC20121720 0 13.559 5.112 0 BRHIP20005530 0 12.387 9.34 0 D3OST10002700 0 6.227 4.695 0 HCHON20007380 0 7.176 5.411 0 HEART20072310 0 11.675 17.605 0 KIDNE20121880 0 21.519 16.225 0 MESAN20121130 0 14.219 10.721 0 NT2RI20022600 0 57.012 42.988 0 NT2RI20023160 0 1.932 1.457 0 NT2RI20086220 0 7.606 5.735 0 NT2RI20216250 0 45.928 34.63 0 NT2RP60000850 0 11.147 16.809 0 NT2RP70036880 0 1.78 5.367 0 NT2RP70043480 0 10.893 4.107 0 NT2RP70062230 0 10.183 7.678 0 NT2RP70081610 0 15.131 22.818 0 NT2RP70102350 0 84.14 15.86 0 NT2RP70130020 0 57.012 42.988 0 NT2RP70190640 0 30.952 23.338 0 OCBBF10001850 0 20.293 7.65 0 OCBBF20097720 0 5.676 4.28 0 OCBBF20173980 0 3.1 2.338 0 PEBLM20044520 0 3.253 2.453 0 SPLEN20173510 0 7.249 10.932 0 TRACH20007020 0 9.462 7.134 0 UTERU20065930 0 10.676 8.05 0 HCHON20022470 0 6.766 0 10.174 NT2NE20010490 0 21.179 0 31.847 NT2NE20174800 0 39.941 0 60.059 NT2NE20177520 0 28.292 0 42.542 PROST20087700 0 1.88 0 14.135 PROST20107820 0 0.586 0 2.644 SMINT20028820 0 6.998 0 10.523 TESTI20063830 0 9.768 0 14.689 ASTRO20125520 0 0 2.686 5.357 BRHIP30001110 0 0 1.86 3.71 HCHON20002260 0 0 0.733 1.461 HCHON20008150 0 0 5.075 20.242 KIDNE20002520 0 0 1.553 6.195 NT2NE20130190 0 0 33.397 66.603 NT2NE20158600 0 0 33.397 66.603 NT2RI20001330 0 0 4.656 9.286 NT2RI20025400 0 0 3.141 6.265 NT2RI20036670 0 0 33.397 66.603 NT2RI20048840 0 0 1.404 5.6 SKMUS20020840 0 0 11.346 22.628 BRACE20057190 0 0 0 10.763 BRACE20060550 0 0 0 14.499 BRACE20267250 0 0 0 66.449 BRAWH20107540 0 0 0 40.54 BRAWH20118230 0 0 0 78.374 CTONG20075860 0 0 0 21.782 CTONG20095290 0 0 0 22.915 FEBRA20086620 0 0 0 11.505 FEBRA20144170 0 0 0 1.957 FEBRA20196370 0 0 0 59.247 HLUNG20023340 0 0 0 33.313 NT2NE20003740 0 0 0 100 NT2NE20010050 0 0 0 84.719 NT2NE20010210 0 0 0 100 NT2NE20010400 0 0 0 56.184 NT2NE20015240 0 0 0 100 NT2NE20021620 0 0 0 44.305 NT2NE20043780 0 0 0 100 NT2NE20053580 0 0 0 75.239 NT2NE20068130 0 0 0 100 NT2NE20072200 0 0 0 100 NT2NE20074250 0 0 0 100 NT2NE20080170 0 0 0 100 NT2NE20089610 0 0 0 100 NT2NE20089970 0 0 0 100 NT2NE20108540 0 0 0 84.719 NT2NE20110360 0 0 0 100 NT2NE20118960 0 0 0 100 NT2NE20122430 0 0 0 76.57 NT2NE20124480 0 0 0 100 NT2NE20125050 0 0 0 66.449 NT2NE20131890 0 0 0 100 NT2NE20132170 0 0 0 100 NT2NE20142210 0 0 0 100 NT2NE20146810 0 0 0 100 NT2NE20152750 0 0 0 100 NT2NE20155110 0 0 0 100 NT2NE20156260 0 0 0 100 NT2NE20157470 0 0 0 100 NT2NE20159740 0 0 0 27.684 NT2NE20172590 0 0 0 100 NT2NE20174920 0 0 0 61.159 NT2NE20181650 0 0 0 100 NT2NE20183760 0 0 0 100 NT2NE20184900 0 0 0 84.719 NT2NE20187390 0 0 0 100 OCBBF20108430 0 0 0 53.98 RECTM20005100 0 0 0 10.923 SMINT20001760 0 0 0 50.667 SPLEN20169720 0 0 0 7.349 TESTI20265250 0 0 0 15.768 ASTRO10001650 0 0 8.055 0 ASTRO20033160 0 0 10.721 0 BRACE20011070 0 0 26.748 0 BRACE20039440 0 0 0.941 0 BRACE20151320 0 0 29.94 0 BRAMY20104640 0 0 40.041 0 BRAMY20137560 0 0 68.63 0 BRAMY20167060 0 0 9.007 0 BRAWH20028110 0 0 15.672 0 BRCAN20280360 0 0 4.387 0 BRCOC20004870 0 0 0.526 0 BRHIP20207990 0 0 9.197 0 BRHIP20217620 0 0 5.063 0 BRHIP20249110 0 0 67.372 0 BRSTN10000830 0 0 3.481 0 CTONG10000940 0 0 1.415 0 CTONG20004690 0 0 5.307 0 CTONG20050280 0 0 12.439 0 CTONG20105660 0 0 24.642 0 CTONG20125640 0 0 7.18 0 CTONG20133520 0 0 49.384 0 CTONG20186320 0 0 29.069 0 FCBBF10000770 0 0 1.472 0 FCBBF10002800 0 0 10.265 0 FCBBF10003770 0 0 19.652 0 FCBBF30018550 0 0 5.089 0 FCBBF30123470 0 0 3.989 0 FCBBF30246230 0 0 5.091 0 FEBRA20018280 0 0 9.887 0 FEBRA20095140 0 0 6.019 0 FEBRA20192420 0 0 58.974 0 HCHON20064590 0 0 19.614 0 HHDPC10000830 0 0 1.779 0 HLUNG20016770 0 0 6.385 0 HLUNG20033780 0 0 16.824 0 IMR3220002430 0 0 3.118 0 KIDNE20104300 0 0 17.33 0 MESAN20004570 0 0 7.197 0 MESAN20089360 0 0 14.459 0 NOVAR10000910 0 0 3.519 0 NT2RI20003480 0 0 32.207 0 NT2RI20005750 0 0 100 0 NT2RI20009870 0 0 100 0 NT2RI20023590 0 0 29.911 0 NT2RI20023910 0 0 11.79 0 NT2RI20025640 0 0 100 0 NT2RI20040930 0 0 100 0 NT2RI20041880 0 0 10.436 0 NT2RI20046080 0 0 6.723 0 NT2RI20050960 0 0 73.545 0 NT2RI20055790 0 0 17.054 0 NT2RI20056700 0 0 100 0 NT2RI20069730 0 0 100 0 NT2RI20076290 0 0 14.653 0 NT2RI20091940 0 0 5.358 0 NT2RI20198260 0 0 100 0 NT2RI20203900 0 0 100 0 NT2RI20207030 0 0 100 0 NT2RI20240080 0 0 61.866 0 NT2RI20244600 0 0 100 0 NT2RI20244960 0 0 100 0 NT2RI20250750 0 0 30.809 0 NT2RI20252550 0 0 62.102 0 NT2RI20273230 0 0 60.375 0 NTONG20067090 0 0 16.469 0 OCBBF10001750 0 0 13.09 0 OCBBF20047570 0 0 4.504 0 OCBBF20054760 0 0 8.495 0 OCBBF20059560 0 0 10.318 0 OCBBF20073540 0 0 3.651 0 OCBBF20125530 0 0 2.131 0 OCBBF20126780 0 0 12.535 0 OCBBF20127040 0 0 37.942 0 OCBBF20140890 0 0 35.863 0 SKMUS20003610 0 0 1.943 0 SKNSH20008190 0 0 4.523 0 SKNSH20080430 0 0 18.4 0 SMINT20144800 0 0 2.887 0 SPLEN20027440 0 0 4.053 0 SPLEN20095550 0 0 15.436 0 SPLEN20140800 0 0 8.61 0 TESTI20094020 0 0 16.66 0 TESTI20369690 0 0 6.529 0 TESTI20391770 0 0 7.531 0 TESTI20442760 0 0 17.235 0 TRACH20084720 0 0 5.703 0 TRACH20107710 0 0 61.866 0 TRACH20118940 0 0 16.16 0 UTERU20022940 0 0 9.896 0 ASTRO20108190 0 1.622 0 0 BGGI120006160 0 2.155 0 0 BRAMY20136210 0 70.518 0 0 BRAWH20016620 0 22.162 0 0 BRAWH20164460 0 20.968 0 0 BRCOC20144000 0 40.488 0 0 BRHIP20132860 0 82.532 0 0 BRSSN20146100 0 17.209 0 0 CTONG10000100 0 15.625 0 0 CTONG20103480 0 4.268 0 0 CTONG20108210 0 1.722 0 0 CTONG20139070 0 10.392 0 0 FCBBF10000240 0 10.583 0 0 FCBBF10000630 0 14.415 0 0 FCBBF20067810 0 30.502 0 0 FCBBF30010810 0 6.328 0 0 FCBBF30012810 0 49.073 0 0 FCBBF30013770 0 24.817 0 0 FCBBF30039020 0 56.608 0 0 FCBBF40001420 0 8.811 0 0 FEBRA10001880 0 5.044 0 0 FEBRA20082010 0 17.339 0 0 HHDPC20001040 0 4.459 0 0 KIDNE20021910 0 34.358 0 0 NT2RP60000770 0 15.492 0 0 NT2RP70010740 0 100 0 0 NT2RP70027380 0 27.748 0 0 NT2RP70037240 0 22.256 0 0 NT2RP70044280 0 16.256 0 0 NT2RP70045590 0 20.543 0 0 NT2RP70056750 0 7.009 0 0 NT2RP70063950 0 82.532 0 0 NT2RP70072690 0 56.608 0 0 NT2RP70077660 0 74.295 0 0 NT2RP70085440 0 100 0 0 NT2RP70105210 0 100 0 0 NT2RP70110860 0 100 0 0 NT2RP70111320 0 100 0 0 NT2RP70122910 0 100 0 0 NT2RP70125160 0 100 0 0 NT2RP70133740 0 100 0 0 NT2RP70134990 0 100 0 0 NT2RP70137290 0 100 0 0 NT2RP70137640 0 54.725 0 0 NT2RP70143480 0 100 0 0 NT2RP70147210 0 100 0 0 NT2RP70150800 0 100 0 0 NT2RP70157890 0 100 0 0 NT2RP70159960 0 100 0 0 NT2RP70169110 0 100 0 0 NT2RP70175670 0 100 0 0 NT2RP70179710 0 100 0 0 NT2RP70181970 0 100 0 0 NT2RP70188020 0 100 0 0 NT2RP70188710 0 100 0 0 NT2RP70192730 0 100 0 0 NT2RP70194450 0 100 0 0 NT2RP70195430 0 50.987 0 0 NT2RP70198350 0 2.512 0 0 NT2RP70203790 0 100 0 0 OCBBF20039250 0 4.016 0 0 OCBBF20080410 0 5.038 0 0 OCBBF20108190 0 30.231 0 0 OCBBF20108580 0 16.054 0 0 OCBBF20122620 0 34.956 0 0 OCBBF20130110 0 18.197 0 0 OCBBF20151150 0 43.004 0 0 OCBBF20189560 0 4.079 0 0 PROST10003220 0 57.613 0 0 TESTI20001720 0 20.618 0 0 TESTI20121550 0 15.444 0 0 TESTI20152460 0 28.533 0 0 TESTI20211240 0 13.774 0 0 TESTI20234140 0 39.241 0 0 UMVEN20003540 0 1.985 0 0 UTERU20006960 0 6.858 0 0 UTERU20094350 0 12.888 0 0 UTERU20164260 0 30.63 0 0

TABLE 5 CloneID BEAST TBAES BRACE20039040 0 18.237 BRAMY20163250 0 26.506 BRCOC20031250 0 39.975 BRHIP20005340 0 2.408 BRHIP20217620 0 19.598 BRHIP30001110 0 7.202 FCBBF10000770 0 5.697 FCBBF30010810 0 18.471 FEBRA20080810 0 9.963 FEBRA20144170 0 3.798 FEBRA20196630 0 61.269 FEBRA20197110 0 14.875 HCHON20002260 0 11.347 HCHON20040020 0 5.523 HHDPC20034390 0 1.789 HLUNG10000550 0 3.808 NOVAR10000910 0 27.245 NT2RI20023160 0 11.28 NT2RI20054050 0 1.975 NT2RI20091730 0 7.846 OCBBF20188730 0 9.748 SMINT20144800 0 22.352 SPLEN20128000 0 2.403 SPLEN20171210 0 54.539 SPLEN20264110 0 80.173 TBAES20000590 0 84.801 TBAES20002550 0 100 TBAES20003150 0 100 TESTI20334410 0 15.439 TESTI20432750 0 62.244 TRACH20003590 0 20.978 TRACH20084720 0 11.037 UTERU20046640 0 11.937 BEAST20004540 100 0 SPLEN20008740 10.632 0

TABLE 6 CloneID CERVX TCERX BGGI120006160 0 18.869 BRAMY20063970 0 59.264 BRHIP20218580 0 70.621 FEBRA20002100 0 14.918 SPLEN20162680 0 9.118 TESTI20214250 0 36.333 CTONG20105080 84.727 0 HCHON20015980 50.212 0 PROST20175290 52.453 0 TESTI20254220 51.293 0 THYMU20279750 82.6 0

TABLE 7 CloneID COLON TCOLN ASTRO20001410 0 32.199 BRAWH20162690 0 27.951 CTONG20132220 0 79.674 HCHON20002260 0 17.098 NT2RI20001330 0 54.324 TCOLN20001390 0 100 3NB6910001910 42.978 0 BRAMY20120910 41.689 0 BRAWH20004600 4.285 0 BRCOC20031250 39.895 0 BRCOC20031870 11.042 0 COLON10001350 100 0 COLON20043180 100 0 COLON20093370 100 0 FEBRA20002100 4.963 0 FEBRA20082010 16.836 0 FEBRA20197110 29.691 0 KIDNE20007770 53.588 0 KIDNE20013730 50.02 0 NT2RP70045590 59.84 0 OCBBF20078920 29.908 0 PROST20083600 12.636 0 SPLEN20011410 6.63 0 TRACH20084720 11.015 0 THYMU20271250 1.257 15.18

TABLE 8 CloneID NESOP TESOP ASTRO20033160 0 20.183 ASTRO20125520 0 10.113 BRAMY20266850 0 16.957 BRAWH20164460 0 59.524 BRHIP20005340 0 9.367 BRHIP20191490 0 75.561 CTONG20095290 0 43.261 CTONG20143690 0 28.473 CTONG20161850 0 17.787 DFNES20001530 0 21.906 DFNES20071130 0 45.721 FCBBF30123470 0 15.017 FCBBF30175310 0 10.97 FEBRA20095140 0 45.326 HCHON20016650 0 10.558 MESAN20025190 0 31.731 NT2RI20028470 0 8.588 NT2RI20054050 0 1.921 NT2RP70036880 0 5.052 NTONG20009770 0 6.726 NTONG20064840 0 29.574 NTONG20076930 0 48.142 SMINT20042990 0 61.748 SPLEN20008820 0 12.019 SPLEN20128000 0 2.337 SPLEN20149110 0 7.218 STOMA20013890 0 39.515 TESOP20000900 0 100 TESOP20003120 0 66.097 TESOP20004000 0 100 TESOP20005270 0 70.604 TESOP20005690 0 100 TESTI20334410 0 7.508 THYMU20271250 0 2.449 TRACH20141240 0 7.062 UTERU20022940 0 12.42 NESOP10001080 100 0 NT2RI20023160 17.058 0 NTONG20013620 74.273 0 TRACH20077540 31.967 0 NTONG20015870 69.673 12.221

TABLE 9 CloneID KIDNE TKIDN ASTRO20008010 0 3.776 ASTRO20181690 0 3.496 BRACE20111830 0 23.795 BRACE20152870 0 8.501 BRACE20237270 0 73.082 BRAMY20147540 0 5.185 BRAMY20286820 0 78.604 BRAWH20015350 0 12.794 BRAWH20096780 0 78.731 BRAWH20132190 0 35.86 BRAWH20182060 0 40.908 BRCAN20060190 0 13.906 BRCOC20004870 0 1.072 BRCOC20176520 0 51.098 BRHIP20000870 0 24.363 BRHIP20198190 0 32.096 BRHIP20233090 0 43.183 BRHIP30001110 0 3.79 BRSSN20015790 0 49.863 BRSTN20000580 0 8.929 CTONG10000940 0 1.442 CTONG20098440 0 66.526 CTONG20150910 0 6.012 CTONG20165050 0 66.526 DFNES20014040 0 38.579 DFNES20037420 0 38.579 FCBBF10000770 0 2.998 FCBBF30083820 0 39.87 FCBBF30247930 0 59.143 FEBRA20037500 0 6.758 FEBRA20072120 0 14.531 FEBRA20080810 0 2.621 FEBRA20086620 0 17.626 FEBRA20140100 0 59.757 FEBRA20144170 0 1.999 FEBRA20176800 0 35.198 HCHON20008320 0 13.096 HCHON20059870 0 36.909 HLUNG10000550 0 2.004 MESAN20106640 0 32.125 NT2RI20025400 0 6.399 NT2RI20076290 0 7.462 NT2RI20091940 0 3.638 OCBBF20019830 0 26.741 OCBBF20022900 0 37.332 OCBBF20039250 0 3.084 OCBBF20080050 0 11.755 OCBBF20097720 0 8.718 OCBBF20125530 0 4.341 OCBBF20130110 0 27.949 OCBBF20140640 0 5.056 OCBBF20173980 0 9.523 PANCR10000910 0 1.114 PROST20087700 0 2.887 PUAEN20044000 0 26.668 SPLEN20144520 0 68.029 SPLEN20160980 0 68.029 TKIDN10000010 0 41.198 TKIDN20004640 0 68.029 TKIDN20005210 0 55.069 TKIDN20030590 0 78.393 TKIDN20030620 0 100 TKIDN20047480 0 35.796 TRACH20003590 0 11.039 TRACH20028030 0 7.714 TRACH20183170 0 10.844 TRACH20184490 0 56.123 UMVEN20003540 0 3.049 UTERU20004240 0 3.144 UTERU20055930 0 12.464 ASTRO10001650 7.727 0 ASTRO20108190 2.346 0 BGGI120006160 3.117 0 BRACE20039040 9.038 0 BRAMY20102080 63.37 0 BRAWH20004600 2.128 0 BRAWH20125380 35.37 0 BRAWH20162690 4.596 0 BRHIP20115760 66.835 0 BRHIP20205090 65.282 0 CTONG20052650 65.178 0 CTONG20108210 2.491 0 CTONG20128470 6.004 0 CTONG20133480 19.179 0 CTONG20139070 7.516 0 D9OST20000310 16.47 0 DFNES20001530 11.162 0 FCBBF10001820 59.128 0 FEBRA20002100 4.929 0 HCHON20008980 35.524 0 HCHON20016650 5.38 0 HLUNG20033780 32.277 0 KIDNE20002520 2.979 0 KIDNE20003940 100 0 KIDNE20006780 100 0 KIDNE20007210 73.728 0 KIDNE20007770 19.958 0 KIDNE20008010 100 0 KIDNE20009470 8.811 0 KIDNE20011170 77.71 0 KIDNE20011400 100 0 KIDNE20013730 24.839 0 KIDNE20017130 54.019 0 KIDNE20018730 100 0 KIDNE20018970 100 0 KIDNE20020150 100 0 KIDNE20021680 100 0 KIDNE20021910 24.85 0 KIDNE20021980 100 0 KIDNE20022620 100 0 KIDNE20024830 100 0 KIDNE20027250 35.87 0 KIDNE20027950 100 0 KIDNE20028390 25.593 0 KIDNE20028720 1.993 0 KIDNE20028830 7.907 0 KIDNE20029800 10.988 0 KIDNE20067330 100 0 KIDNE20079440 35.045 0 KIDNE20096280 100 0 KIDNE20096470 100 0 KIDNE20100070 100 0 KIDNE20100840 100 0 KIDNE20101370 100 0 KIDNE20101510 100 0 KIDNE20102650 8.237 0 KIDNE20102710 100 0 KIDNE20104300 33.246 0 KIDNE20106740 100 0 KIDNE20107390 100 0 KIDNE20107500 74.264 0 KIDNE20107620 100 0 KIDNE20109730 100 0 KIDNE20109890 100 0 KIDNE20112000 100 0 KIDNE20115080 65.178 0 KIDNE20118580 100 0 KIDNE20120090 33.186 0 KIDNE20121880 62.256 0 KIDNE20122910 83.085 0 KIDNE20124400 6.171 0 KIDNE20125630 100 0 KIDNE20126010 100 0 KIDNE20126130 100 0 KIDNE20127100 33.012 0 KIDNE20127450 100 0 KIDNE20127750 100 0 KIDNE20130450 100 0 KIDNE20131580 63.24 0 KIDNE20132180 100 0 KIDNE20137340 100 0 KIDNE20138010 100 0 KIDNE20141190 49.697 0 KIDNE20144890 100 0 KIDNE20148900 100 0 KIDNE20163880 100 0 KIDNE20180710 49.105 0 KIDNE20181660 100 0 KIDNE20182690 100 0 KIDNE20186780 100 0 KIDNE20190740 100 0 LIVER20035110 28.683 0 MESAN20025190 16.169 0 NT2RP70043480 7.879 0 PROST20107820 1.696 0 PROST20123530 32.771 0 PROST20161950 20.387 0 PUAEN20030180 46.744 0 SKMUS20003610 3.728 0 SMINT20033400 10.243 0 TBAES20000590 5.253 0 TESTI20044310 29.162 0 TESTI20082330 45.847 0 TRACH20032720 12.917 0 UTERU20099720 12.351 0

TABLE 10 CloneID LIVER TLIVE BRAWH20166790 83.525 0 CTONG20103480 15.35 0 HEART20005410 11.598 0 LIVER10001260 66.455 0 LIVER10004790 100 0 LIVER20002160 100 0 LIVER20011130 92.988 0 LIVER20011910 100 0 LIVER20028420 16.548 0 LIVER20035110 71.317 0 LIVER20035680 100 0 LIVER20038540 100 0 LIVER20045650 100 0 LIVER20055200 100 0 LIVER20055440 100 0 LIVER20059810 24.82 0 LIVER20062510 100 0 LIVER20064100 88.658 0 LIVER20064690 100 0 LIVER20075680 100 0 LIVER20080530 100 0 LIVER20084730 100 0 LIVER20085800 100 0 LIVER20087510 75.266 0 LIVER20091180 100 0 NTONG20063010 47.641 0 PROST20087700 6.762 0 PROST20107820 2.108 0 TRACH20005400 12.349 0 ASTRO20001410 0 10.441 ASTRO20125520 0 10.162 BRACE20152870 0 15.788 BRAMY20167060 0 34.076 BRAMY20181220 0 87.217 BRAMY20285160 0 81.346 BRCOC20001860 0 20.45 FEBRA20144170 0 3.712 HLUNG10000550 0 3.721 OCBBF20073540 0 6.907 OCBBF20088220 0 16.388 PLAGE60169420 0 26.895 SMINT20152940 0 54.735 SPLEN20242320 0 45.601 THYMU20000570 0 18.649 TRACH20077540 0 30.987 UTERU20055930 0 15.433 UTERU20065930 0 10.151

TABLE 11 CloneID HLUNG TLUNG BRACE20096200 70.38 0 BRAWH20004600 2.238 0 BRAWH20030250 11.121 0 BRCAN20006390 61.519 0 BRCAN20280360 8.855 0 BRHIP20238880 1.35 0 CTONG10000940 1.428 0 CTONG20103480 6.495 0 CTONG20129960 10.709 0 CTONG20155180 48.707 0 FCBBF10001210 36.439 0 FEBRA20144170 1.98 0 FEBRA20197110 7.756 0 HCHON20002260 2.958 0 HHDPC20034390 0.933 0 HLUNG10000550 3.971 0 HLUNG20016330 29.367 0 HLUNG20016770 12.888 0 HLUNG20017120 12.093 0 HLUNG20023340 33.714 0 HLUNG20033780 33.957 0 HLUNG20084390 100 0 IMR3220002430 3.147 0 LIVER20028420 14.004 0 NOVAR20000380 2.278 0 NT2RI20023910 8.923 0 NT2RI20054050 2.059 0 NT2RI20091730 4.091 0 NT2RP70044280 12.369 0 OCBBF20020830 40.304 0 OCBBF20125530 4.302 0 PLACE60004630 28.618 0 PROST20057930 14.383 0 PROST20107820 0.892 0 PROST20185830 33.898 0 PUAEN20030180 12.294 0 SMINT20121220 12.822 0 SPLEN20002220 44.799 0 SPLEN20008740 1.788 0 SPLEN20054290 26.875 0 SPLEN20128000 1.253 0 SPLEN20157300 51.319 0 SPLEN20176200 18.8 0 SPLEN20179180 3.344 0 SPLEN20211940 12.373 0 STOMA20013890 21.183 0 TBAES20000590 5.527 0 TESTI20094230 59.311 0 TESTI20184620 10.365 0 TESTI20334410 8.049 0 THYMU20000570 4.974 0 THYMU20039810 1.915 0 TRACH20007020 14.4 0 TRACH20141240 3.786 0 TRACH20183170 10.745 0 ASTRO20108190 0 13.924 ASTRO20155290 0 38.341 BRHIP20096850 0 73.716 FEBRA20080810 0 14.654 MESAN20014500 0 59.68 SMINT20028820 0 60.089 SPLEN20162680 0 8.941

TABLE 12 CloneID NOVAR TOVAR BGGI120006160 21.31 0 BRHIP20005340 8.158 0 BRHIP20191860 47.038 0 HHDPC20001040 44.094 0 NOVAR10000150 72.374 0 NOVAR10000910 46.155 0 NOVAR10001020 99.094 0 NOVAR20000380 14.805 0 NOVAR20003520 100 0 THYMU20271250 4.266 0 ASTRO20141350 0 75.66 BRAMY20157820 0 85.296 BRCOC20001860 0 64.79 HLUNG20016770 0 76.536 NT2RI20054050 0 12.229 NTONG20090600 0 60.694 PROST20087700 0 16.991 PUAEN20015860 0 62.197 SPLEN20029310 0 88.828 TOVAR20004760 0 49.428 TOVAR20005750 0 96.313 TRACH20079690 0 55.276 UTERU20004240 0 18.499

TABLE 13 CloneID STOMA TSTOM BRACE20060840 0 65.917 FEBRA20052910 0 77.883 HCHON20002260 0 8.66 HLUNG10000550 0 11.625 NTONG20009770 0 21.112 PROST20107820 0 5.223 THYMU20039810 0 11.216 TSTOM10001860 0 100 TSTOM20001390 0 89.823 TSTOM20003150 0 48.943 TSTOM20005690 0 100 ASTRO20125520 10.059 0 BRACE20039040 17.642 0 BRAMY20124260 42.064 0 BRCOC20031870 10.704 0 BRHIP20191860 13.43 0 CTONG20128470 11.719 0 FEBRA20037500 12.423 0 HCHON20040020 5.343 0 HHDPC10000830 6.661 0 IMR3220002430 5.838 0 KIDNE20007770 12.986 0 NOVAR20000380 4.227 0 NT2RI20054050 1.91 0 NT2RI20091730 7.59 0 PROST20130530 20.156 0 SPLEN20149110 7.179 0 SPLEN20157880 32.942 0 STOMA20001830 100 0 STOMA20005390 100 0 STOMA20005670 100 0 STOMA20006400 100 0 STOMA20006780 100 0 STOMA20006860 100 0 STOMA20008880 100 0 STOMA20010250 100 0 STOMA20013890 39.303 0 STOMA20026880 100 0 STOMA20032890 100 0 STOMA20034770 100 0 STOMA20036460 100 0 STOMA20046680 100 0 STOMA20048520 100 0 STOMA20048840 100 0 STOMA20051200 85.988 0 STOMA20056640 100 0 STOMA20056670 100 0 STOMA20057820 91.236 0 STOMA20062130 100 0 STOMA20062290 40.913 0 STOMA20063250 100 0 STOMA20063980 100 0 STOMA20064470 100 0 STOMA20067800 59.113 0 STOMA20069040 100 0 STOMA20072690 100 0 STOMA20076800 100 0 STOMA20077450 100 0 STOMA20080500 100 0 STOMA20083610 100 0 STOMA20086140 100 0 STOMA20088380 100 0 STOMA20092530 100 0 STOMA20092560 100 0 STOMA20092890 39.042 0 TESTI20184620 19.231 0 TRACH20003590 40.588 0 TRACH20183170 19.936 0 PROST20083600 12.248 38.653 TRACH20068660 6.753 21.311

TABLE 14 CloneID UTERU TUTER DFNES10001850 0 29.393 NT2RI20023910 0 18.073 SMINT20144800 0 35.406 SPLEN20162680 0 9.628 TOVAR20004760 0 50.572 TUTER20002830 0 100 ASTRO20008010 1.217 0 ASTRO20033160 10.555 0 ASTRO20058630 4.534 0 ASTRO20105820 20.644 0 ASTRO20108190 3.21 0 BRACE20039040 3.092 0 BRACE20057190 3.542 0 BRACE20060840 3.661 0 BRACE20111830 7.667 0 BRACE20223330 10.589 0 BRAMY20266850 2.956 0 BRAWH20113430 8.367 0 BRAWH20126980 22.868 0 BRCOC20031870 0.938 0 BRCOC20107300 12.892 0 BRCOC20121720 6.71 0 BRCOC20155970 25.187 0 BRHIP20105710 18.366 0 BRHIP20191490 13.172 0 BRHIP20207990 12.072 0 BRHIP20217620 6.646 0 BRHIP20222280 10.898 0 BRHIP20238880 0.439 0 BRHIP20249110 11.054 0 BRSSN20018690 3.6 0 BRTHA20000570 51.819 0 CTONG10000940 0.464 0 CTONG10002770 24.668 0 CTONG20095290 7.541 0 CTONG20099380 23.863 0 CTONG20103480 6.336 0 CTONG20108210 2.557 0 CTONG20118250 10.239 0 CTONG20129960 3.482 0 CTONG20131560 24.668 0 CTONG20139070 2.571 0 CTONG20139340 8.273 0 CTONG20143690 4.963 0 CTONG20160560 2.372 0 D3OST30002580 22.242 0 FCBBF10000240 5.237 0 FCBBF10001820 10.114 0 FCBBF10003670 1.812 0 FCBBF10004120 2.308 0 FCBBF10005740 4.952 0 FCBBF30175310 1.912 0 FCBBF30240020 6.769 0 FCBBF30246230 6.682 0 FCBBF40001420 4.36 0 FEBRA20002100 0.843 0 FEBRA20004620 6.733 0 FEBRA20018280 6.489 0 FEBRA20025270 3.416 0 FEBRA20034360 6.63 0 FEBRA20037500 19.596 0 FEBRA20080810 0.845 0 FEBRA20082100 15.999 0 FEBRA20144170 1.288 0 FEBRA20225040 1.959 0 HCHON20002260 0.962 0 HCHON20007380 3.551 0 HCHON20015980 5.796 0 HCHON20016650 1.84 0 HCHON20022470 3.348 0 HCHON20040020 0.936 0 HCHON20076500 7.263 0 HEART20072310 11.555 0 HHDPC20034390 1.517 0 HLUNG10000550 1.937 0 HLUNG20016770 4.191 0 KIDNE20131580 21.635 0 LIVER20028420 9.107 0 MAMGL10000830 0.346 0 MESAN20171520 24.337 0 NOVAR10000150 3.622 0 NOVAR10000910 2.31 0 NT2NE20053580 24.761 0 NT2NE20159740 9.111 0 NT2NE20174920 20.127 0 NT2RI20023160 0.956 0 NT2RI20041880 3.425 0 NT2RI20054050 1.004 0 NT2RI20076290 2.404 0 NT2RI20273230 39.625 0 NT2RP60000770 30.666 0 NT2RP60000850 11.032 0 NT2RP70036880 0.881 0 NT2RP70043480 2.695 0 NT2RP70045590 10.166 0 NT2RP70056750 10.406 0 NT2RP70062230 5.039 0 NT2RP70081610 7.488 0 OCBBF10001750 8.591 0 OCBBF20006770 19.428 0 OCBBF20032460 11.672 0 OCBBF20039250 0.994 0 OCBBF20047570 2.956 0 OCBBF20054760 16.727 0 OCBBF20059560 3.386 0 OCBBF20068490 2.41 0 OCBBF20080050 3.787 0 OCBBF20094240 8.655 0 OCBBF20097720 1.404 0 OCBBF20103130 16.359 0 OCBBF20105570 43.708 0 OCBBF20140640 3.258 0 OCBBF20173980 3.068 0 OCBBF20180120 10.043 0 OCBBF20188730 6.611 0 OCBBF20189560 2.019 0 PEBLM20044520 6.439 0 PLACE60060420 6.493 0 PROST20087700 0.93 0 PROST20107820 0.29 0 PROST20149160 4.345 0 PROST20159240 8.082 0 PROST20176170 25.167 0 PROST20189770 15.499 0 PUAEN20003740 1.145 0 PUAEN20015860 3.406 0 SKMUS20003610 1.275 0 SKNSH20008190 5.937 0 SKNSH20080430 12.076 0 SMINT20026890 51.875 0 SMINT20029760 6.221 0 SMINT20068010 19.209 0 SMINT20110330 25.261 0 SMINT20121220 4.169 0 SPLEN20008390 10.886 0 SPLEN20011410 2.253 0 SPLEN20054290 17.478 0 SPLEN20128000 0.407 0 SPLEN20140800 5.651 0 SPLEN20145720 7.423 0 SPLEN20169720 4.837 0 SPLEN20179180 3.262 0 SPLEN20193110 57.827 0 SPLEN20194050 3.416 0 SPLEN20211940 8.047 0 SPLEN20212730 17.589 0 SPLEN20225220 1.691 0 TBAES20000590 1.797 0 TESTI20061110 24.59 0 TESTI20116830 38.615 0 TESTI20184620 3.37 0 TESTI20208710 64.596 0 TESTI20211240 6.816 0 TESTI20213580 40.357 0 TESTI20214250 4.107 0 TESTI20334410 2.618 0 TESTI20369130 24.204 0 TESTI20369690 4.285 0 TESTI20391770 4.943 0 THYMU20039810 2.491 0 THYMU20216840 58.853 0 THYMU20240710 39.309 0 TRACH20003590 3.557 0 TRACH20032720 4.419 0 TRACH20033230 2.123 0 TRACH20141240 3.693 0 TRAGH20149970 25.316 0 UMVEN10001860 0.63 0 UTERU20000740 62.692 0 UTERU20004240 1.013 0 UTERU20006290 100 0 UTERU20020010 40.126 0 UTERU20022940 2.165 0 UTERU20030570 3.085 0 UTERU20040610 100 0 UTERU20046640 4.048 0 UTERU20046980 100 0 UTERU20050690 64.596 0 UTERU20054460 24.816 0 UTERU20055330 100 0 UTERU20055930 4.016 0 UTERU20056010 3.04 0 UTERU20059050 100 0 UTERU20061030 100 0 UTERU20064000 15.228 0 UTERU20064860 51.819 0 UTERU20065930 3.522 0 UTERU20067050 100 0 UTERU20068990 100 0 UTERU20070040 24.856 0 UTERU20070810 17.449 0 UTERU20076390 100 0 UTERU20081300 53.896 0 UTERU20084260 26.26 0 UTERU20094350 12.756 0 UTERU20095380 40.674 0 UTERU20095400 100 0 UTERU20097760 100 0 UTERU20099720 16.901 0 UTERU20101240 100 0 UTERU20114100 100 0 UTERU20115740 100 0 UTERU20116570 100 0 UTERU20118110 100 0 UTERU20118970 100 0 UTERU20119060 16.267 0 UTERU20119680 100 0 UTERU20120310 53.896 0 UTERU20124070 29.356 0 UTERU20126880 51.568 0 UTERU20134910 13.929 0 UTERU20135860 7.858 0 UTERU20143980 100 0 UTERU20144640 16.101 0 UTERU20145480 39.231 0 UTERU20146310 100 0 UTERU20146680 39.231 0 UTERU20150870 100 0 UTERU20151980 100 0 UTERU20158300 58.853 0 UTERU20158800 100 0 UTERU20161570 100 0 UTERU20164260 15.158 0 UTERU20168220 19.178 0 UTERU20176130 12.264 0 UTERU20176320 64.596 0 UTERU20178100 100 0 UTERU20179880 100 0 UTERU20183640 53.896 0 UTERU20185230 40.126 0 UTERU20186740 100 0 UTERU20188110 100 0 UTERU20188810 100 0 BRAWH10000930 2.2 10.279 CT0NG20128470 2.054 38.378 UTERU20006960 3.394 63.416

TABLE 15 CloneID NTONG CTONG ADRGL20018300 0 22.262 ASTRO20058630 0 14.161 ASTRO20072210 0 34.963 ASTRO20108190 0 5.013 BRACE20003070 0 2.194 BRACE20039040 0 4.829 BRACE20060720 0 36.712 BRACE20061050 0 39.515 BRACE20210140 0 11.034 BRACE20276430 0 26.828 BRAMY20152110 0 24.194 BRAMY20266850 0 4.616 BRAMY20271400 0 48.032 BRAWH10000930 0 3.436 BRAWH20004600 0 1.137 BRCAN20280360 0 4.497 BRCOC20004870 0 0.54 BRHIP20005340 0 5.1 BRHIP20005530 0 4.786 BRHIP20238880 0 2.741 BRSSN20146100 0 6.65 CTONG10000100 0 12.075 CTONG10000220 0 100 CTONG10000620 0 100 CTONG10000930 0 74.021 CTONG10000940 0 0.725 CTONG10001650 0 100 CTONG10002770 0 38.523 CTONG20002180 0 100 CTONG20004690 0 5.439 CTONG20009770 0 100 CTONG20014280 0 62.446 CTONG20027090 0 4.036 CTONG20028410 0 19.729 CTONG20038890 0 100 CTONG20049410 0 100 CTONG20050280 0 25.499 CTONG20052650 0 34.822 CTONG20052900 0 42.764 CTONG20075860 0 11.194 CTONG20076130 0 16.303 CTONG20077790 0 62.68 CTONG20082690 0 12.672 CTONG20085950 0 100 CTONG20091080 0 44.201 CTONG20091320 0 100 CTONG20092570 0 100 CTONG20092580 0 100 CTONG20092680 0 100 CTONG20092700 0 100 CTONG20093950 0 100 CTONG20095270 0 100 CTONG20095290 0 11.777 CTONG20095340 0 14.323 CTONG20096430 0 100 CTONG20096750 0 100 CTONG20097660 0 100 CTONG20098440 0 33.474 CTONG20099380 0 37.266 CTONG20099550 0 100 CTONG20099630 0 38.502 CTONG20100240 0 100 CTONG20101480 0 100 CTONG20103480 0 13.193 CTONG20105080 0 15.273 CTONG20105660 0 25.256 CTONG20106230 0 100 CTONG20106520 0 29.937 CTONG20108210 0 2.662 CTONG20114290 0 100 CTONG20114740 0 100 CTONG20118150 0 100 CTONG20118250 0 15.991 CTONG20119200 0 100 CTONG20120770 0 100 CTONG20121010 0 29.404 CTONG20121580 0 33.983 CTONG20124010 0 7.835 CTONG20124220 0 69.076 CTONG20124470 0 100 CTONG20124730 0 100 CTONG20125540 0 100 CTONG20125640 0 7.359 CTONG20126070 0 3.221 CTONG20127450 0 10.331 CTONG20128470 0 9.622 CTONG20129960 0 32.63 CTONG20131490 0 24.817 CTONG20131560 0 38.523 CTONG20132220 0 6.999 CTONG20133390 0 100 CTONG20133480 0 10.246 CTONG20133520 0 50.616 CTONG20136300 0 100 CTONG20138030 0 100 CTONG20139070 0 8.031 CTONG20139340 0 12.919 CTONG20139860 0 100 CTONG20140320 0 100 CTONG20140580 0 100 CTONG20141650 0 8.968 CTONG20146300 0 100 CTONG20147050 0 34.963 CTONG20149460 0 100 CTONG20149950 0 100 CTONG20153300 0 52.97 CTONG20153580 0 74.021 CTONG20155180 0 24.734 CTONG20155400 0 100 CTONG20156780 0 62.446 CTONG20158040 0 100 CTONG20158150 0 16.385 CTONG20158660 0 100 CTONG20159530 0 100 CTONG20160560 0 3.704 CTONG20161850 0 19.368 CTONG20162170 0 100 CTONG20163550 0 100 CTONG20164990 0 65.066 CTONG20165050 0 33.474 CTONG20186320 0 14.897 CTONG20200310 0 100 CTONG20265130 0 100 CTONG20267700 0 100 CTONG20273610 0 100 FCBBF10000240 0 12.268 FCBBF10005740 0 3.866 FCBBF30123470 0 4.088 FCBBF30233680 0 9.14 FEBRA20025270 0 5.334 FEBRA20037500 0 6.8 HCHON20002260 0 1.502 HCHON20007380 0 5.546 HCHON20007510 0 6.65 HCHON20015350 0 17.176 HCHON20040020 0 1.462 HHDPC20034390 0 0.474 HLUNG10000550 0 2.016 KIDNE20002520 0 3.184 KIDNE20009470 0 9.415 KIDNE20115080 0 34.822 KIDNE20127100 0 35.274 LIVER20028420 0 3.556 MESAN20029400 0 5.924 NT2RI20023160 0 1.493 NT2RI20023910 0 1.51 NT2RI20091730 0 4.155 NT2RP70043480 0 4.209 NT2RP70078420 0 3.572 NT2RP70081610 0 11.694 OCBBF20006770 0 30.34 OCBBF20059560 0 5.287 OCBBF20073540 0 1.871 OCBBF20094240 0 13.516 OCBBF20108580 0 12.407 PEBLM20044520 0 15.083 PEBLM20071880 0 16.259 PROST20107820 0 0.453 PUAEN20030180 0 6.243 SKNSH20008190 0 4.636 SMINT20023280 0 34.547 SMINT20089170 0 20.839 SPLEN20179180 0 5.094 TESTI20094020 0 17.075 TESTI20094230 0 30.119 TESTI20152460 0 22.051 TESTI20184620 0 5.263 TESTI20211240 0 10.645 TESTI20442760 0 8.832 THYMU20039810 0 0.973 TRACH20028030 0 11.644 TRACH20141240 0 1.923 TSTOM20003150 0 4.245 UTERU20004240 0 1.582 UTERU20055930 0 2.091 UTERU20065930 0 2.75 UTERU20119060 0 12.702 UTERU20124070 0 45.844 BRACE20039440 34.336 0 BRACE20068590 74.88 0 FCBBF30018550 20.639 0 IMR3220002430 6.323 0 KIDNE20028830 16.715 0 NT2RI20028470 9.251 0 NT2RI20054050 2.069 0 NT2RI20086220 23.258 0 NTONG20009770 7.245 0 NTONG20013620 25.727 0 NTONG20028070 86.921 0 NTONG20029480 32.729 0 NTONG20029700 100 0 NTONG20046140 43.643 0 NTONG20048060 51.123 0 NTONG20049910 100 0 NTONG20050620 100 0 NTONG20050860 100 0 NTONG20051530 58.314 0 NTONG20052650 100 0 NTONG20056570 100 0 NTONG20061870 100 0 NTONG20063010 40.505 0 NTONG20064400 100 0 NTONG20064840 31.857 0 NTONG20065010 100 0 NTONG20066460 100 0 NTONG20067090 66.789 0 NTONG20067830 20.865 0 NTONG20070200 100 0 NTONG20070340 52.247 0 NTONG20075220 100 0 NTONG20076930 51.858 0 NTONG20077560 49.744 0 NTONG20083650 100 0 NTONG20088620 100 0 NTONG20090600 20.536 0 NTONG20090680 100 0 NTONG20092290 100 0 NTONG20092330 100 0 OCBBF20068490 14.895 0 SKMUS20001980 23.281 0 SMINT20138900 67.622 0 SPLEN20008390 67.269 0 SPLEN20162680 3.184 0 UTERU20134910 86.071 0 ASTRO20155290 13.655 3.451 FEBRA20080810 10.438 1.319 NT2RP70032610 10.013 27.835 NT2RP70036880 5.442 16.504 NTONG20015870 17.552 0.554 OCBBF20188730 10.213 2.581 SMINT20122910 33.985 8.589 SPLEN20099700 37.585 9.499

TABLE 16 CloneID FCBBF FEBRA OCBBF BRACE BRALZ BRAMY BRAWH BRCAN BRCOC BRHIP BRSSN BRSTN BRTHA 3NB6910001910 0 0 0 0 0 0 6.122 0 0 6.426 0 0 0 ADRGL- 0 0 0 8.483 0 0 0 0 0 0 0 0 0 20018300 ASTRO20001410 0 0 0 0 0 3.06 0 0 0 0 0 0 0 ASTRO20033160 0 0 0 2.094 0 0 2.95 0 0 0 0 0 0 ASTRO20058630 0 0 0 0 0 0 7.603 0 0 0 0 0 0 ASTRO20064750 0 0 0 0 0 7.505 0 0 0 0 0 0 16.519 ASTRO20100720 0 0 0 0 0 0 0 39.838 0 0 0 0 0 ASTRO20141350 0 0 0 0 0 0 0