Therapies for cancer using RLIP76
The present invention is a composition identified as a region of ralA binding protein 1, wherein the region neighbors a membrane-associated portion of the ralA binding protein 1, reduces transport activity and membrane association of the ralA binding protein 1 and kills cells undergoing uncontrolled cell growth in a subject that has cells undergoing uncontrolled cell growth. The region is used to generate medicines that kill malignant cells and tumorigenic cells. Medicines may be in the form of antibodies, si-RNA and small molecules that recognize the region.
Latest Board of Regents, The University of Texas System Patents:
- T-cell receptor (TCR)-binding antibodies and uses thereof
- Submersible warming device
- Block polymers for sub-10 nm patterning
- Anhydride copolymer top coats for orientation control of thin film block copolymers
- Generating terahertz frequency combs from quantum cascade lasers using nonlinear frequency mixing
This application is a continuation-in-part of prior U.S. application Ser. No. 10/714,506, filed Nov. 13, 2003, herein incorporated by reference, which claims the benefit of U.S. Provisional Patent Application No. 60/425,917, filed Nov. 13, 2002. This application is a continuation-in-part of prior U.S. application Ser. No. 10/713,578, filed Nov. 13, 2003, herein incorporated by reference, which claims the benefit of U.S. Provisional Patent Application No. 60/425,814, filed Nov. 13, 2002.
STATEMENT REGARDING FEDERALLY SPONSORED APPLICATIONSThe U.S. Government has a paid-up license in this invention and the right in limited circumstances to require the patent owner to license others on reasonable terms as provided for by the terms of Grant No. NIH 2-R01-CA77495, Grant No. NIH CA 104661.
REFERENCE TO A SEQUENCE LISTINGThis application incorporates by reference sequence listing material included on computer readable form and identified as 124263-1040 RLIP.ST25.txt saved on Nov. 2, 2005, in ASCII readable form.
BACKGROUND OF THE INVENTIONThe present invention relates to improved anti-cancer therapies, particularly one targeted towards cells expressing high levels of a ral interacting protein, RLIP76.
Current therapies for human cancers are generally unsatisfactory because of a high rate of failure and excessive side-effects. Side effects are generally significant and result, in part, because few current therapies are targeted to cancerous cells alone. There remains a need to identify targeted therapies that eliminate only cancerous cells and not healthy cells.
SUMMARY OF THE INVENTIONThe present invention solves problems associated with current therapies for cancerous cells or those that undergo uncontrolled cell growth (e.g., cancerous, tumorigenic and malignant cells). In particular, the present invention provides compositions for inhibiting and/or depleting RLIP76
As provided herein, RLIP76 is a membrane associated protein and a critical as well as predominant regulator of transport in cancerous cells or those undergoing uncontrolled cells growth. Targeting therapies against RLIP76 directly effects RLIP76 transport activity and reduce the number and/or potency of such cells undergoing uncontrolled cell growth in subjects having such uncontrolled and growing cells.
The present invention provides for compositions that target RLIP76 and reduce the number and/or potency of cells undergoing uncontrolled cell growth. Compositions comprise a region homologous to a portion of a ralA binding protein 1, wherein the region neighbors a membrane-associated portion of the ralA binding protein 1, reduces transport activity and membrane association of ralA binding protein 1 and kills cells undergoing uncontrolled cell growth in a subject that has cells undergoing uncontrolled cell growth.
Compositions of the present invention include an internal peptide region of RLIP76 to be used as bait in screens of chemical libraries for synthetic and naturally occurring organic chemicals and compounds with an ability to reduce the number and/or potency of cells undergoing uncontrolled cell growth. The identified chemicals and compounds are those acting as specific inhibitors of RLIP76 activity (e.g., found to reduce the number and/or potency of cells undergoing uncontrolled cell growth). As such, the present invention provides for compositions that are improved therapies for cancers, malignancies, and tumorigenic or uncontrolled growth cells that express RLIP76.
In one form, there present invention provides for a region recognizing a ralA binding protein 1, wherein the region further comprises SEQ ID NO.:28 and modified variants thereof.
In other forms, the present invention provides for compositions and methods of using such compositions SEQ ID NO.: 3 to SEQ ID NO.:19 and SEQ ID NO.:21. Such compositions, in various forms to be used to identify compounds as medicines for cancers, malignancies and tumors and for reducing the number and/or potency of cells undergoing uncontrolled cell growth.
Those skilled in the art will further appreciate the above-noted features and advantages of the invention together with other important aspects thereof upon reading the detailed description that follows in conjunction with the drawings.
BRIEF DESCRIPTION OF THE DRAWINGSFor more complete understanding of the features and advantages of the present invention, reference is now made to the detailed description of the invention along with the accompanying figures, wherein:
Although making and using various embodiments of the present invention are discussed in detail below, it should be appreciated that the present invention provides many inventive concepts that may be embodied in a wide variety of contexts. The specific aspects and embodiments discussed herein are merely illustrative of ways to make and use the invention, and do not limit the scope of the invention.
In the description which follows like parts are marked throughout the specification and drawing with the same reference numerals, respectively. The drawing figures are not necessarily to scale and certain features may be shown exaggerated in scale or in a somewhat generalized or schematic form in the interest of clarity and conciseness.
The following are abbreviations that may be used in describing the present invention: RLIP, ral interacting protein; MDR, multi-drug resistance; GS-E, glutathione-electrophile conjugates; phenyloin, PHE; carbamazepine, CBZ.
Current antineoplastic therapies for human malignancies are limited by the occurrence of significant normal tissue toxicities due to inherent relatively non-specific genotoxic or signaling effects. Attempts to improve antineoplastic therapies have focused on identifying targets which are preferentially expressed in cancer cells, which when inhibited cause apoptosis in malignant cells while sparing cells of normal tissues. Delineation of differentially expressed signaling proteins that are responsible for un-regulated growth and suppression of normal apoptotic pathways has led to the identification of numerous potential targets. While new agents have emerged, such as antibodies including rituximab (anti-CD20 antibody for lympho-proliferative disorders), trastuzumab (anti-Her-2/neu antibody for breast cancer) and small molecules including imatinib mseylate (Bcr-Abl kinase inhibitor for chronic myelogenous leukemia) and erlotinib (tyrosine kinase inhibitor for a variety of solid tumors), their overall efficacy remains limited, because of their limited effectiveness in only a small fraction of patients with such malignancies or because of clonal selection of cancer cells inherently refractory to such therapies. Thus, development of new targeting molecules and discovery of new targets remains critical.
RLIP76 (also referred to herein as RALBP1) represents a novel target for cancer therapy not only because of its involvement in the rate-controlling step in glutathione (GSH)-mediated metabolism of electrophilic or oxidant chemicals often used as anti-neoplastic agents, but also because of its apparent linkage to key signaling pathways known to be crucial for the survival, proliferation, and motility of malignant cells. The present inventors have recently demonstrated that lack of RLIP76 in knockout mice leads to loss of nearly 4/5 of total GSH-conjugate (GS-E) as well as anthracycline-transport activity, and widespread changes in GSH-linked antioxidant enzymes (as disclosed, e.g., in Awasthi S, et al. Cancer Res 2005;65:6022-8). RLIP76−/− mice develop a characteristic sensitivity to stress, particularly to ionizing radiation. These and other studies by the inventors in cell culture systems implicate RLIP76 as a part of stress-defenses (as disclosed, e.g., in Yang, et al., J Biol Chem 2003;278:41380-88). In particular, the inventors have determined that inhibition of RLIP76 transport function using antibodies to a cell-surface epitope or depletion of RLIP76 using si-RNA uniformly causes apoptosis in a variety of histological types of cancers (as disclosed, e.g., in Awasthi, et al., Int J Oncol 2003;22:713-20; Awasthi, et al., Int J Oncol 2003;22:721-32; Yadav, et al., Biochemistry 2004;43:16243-53; Struckler, et al., Cancer Res 2005;65:991-8).
The present invention provides clinical applicability of RLIP76 as a target for anti-cancer therapy. The present invention confirms that there is a greater dependence on RLIP76 in cancer cells, due to greater expression of the protein in such cells. The present invention shows that this dependence translates to a greater susceptibility of cancer cells to agents that deplete RLIP76; hence, RLIP76 is a powerful target a broad-spectrum anti-cancer therapy.
Anti-RLIP agents, those that reduce and inhibit protein function or deplete expression of the protein are provided herein. Such agents include anti-RLIP76 IgG, si-RNA and anti-sense DNA oligonucleotides. With the present invention, it is demonstrated that because RLIP76 is expressed to a greater degree in malignant cells and RLIP76 inhibition or depletion causes preferential toxicity towards malignant cells, anti RLIP agents exert significant antineoplastic effects in the malignant cells.
The inventors, Sanjay Awasthi and Sharad S. Singhal, of the present invention have recently described a novel non-ABC transporter that appears to be multispecific as a Ral interacting protein (see U.S. application Ser. No. 10/714,506; U.S. application Ser. No. 10/713,578; each incorporated herein by reference). As used herein, this transporter is referred to RLIP76 or RalBP1. The official human genome name for the protein is RALBP1 (SEQ ID NO.:1; and SEQ ID NO.:22 for the coding sequence). RLIP76 is a modular multifunctional and modular protein found ubiquitously in many species from Drosophila to humans. It is encoded in humans on chromosome 18p11.3 by a gene with 11 exons and 9 introns. The protein product, also known as ralA binding protein 1, is typically a 76 kDa (SEQ ID NO.:2; and SEQ ID NO.:23 for the coding sequence) protein; however, splice-variants including a 67 kDa peptide and a longer 80 kDa or 102 kDa peptide, cytocentrin, have also been identified.
Malignant cells contain a greater quantity of antigenically detectable RLIP76 as shown in the Table and in
Transport activity of RLIP76 is greater in malignant cells as determined by membrane vesicles prepared from plasma membrane fractions from each cell line, enriched for inside-out vesicles (IOVs) by wheat-germ agglutinin affinity chromatography as previously described by the inventors (see, e.g., Awasthi, et al., Int J Cancer 2004; 112:934-42). Results of measurements of ATP-dependent transport of 14C-doxorubicin (DOX) as well as 3H-dinitrophenyl S-glutathione (DNP-SG) using a standardized 96 well-plate transport assay revealed greater transport of both substrates in cells containing greater amount of RLIP76 protein. The Table shows the general correlation between RLIP76 protein level and transport activity. The greatest transport activity was found in melanoma cells with transport activity greater than in malignant than non-malignant cells. Low expression of RLIP76 in MCF-7 and HepG2 correlated with lower transport rate in the crude-membrane vesicles. Total DOX or DNP-SG transport rate correlated with either RLIP76 protein amounts (Table) or RLIP76 ATPase activity (data not shown). ATPase activity was measured using aliquots of protein fraction containing 1 to 10 μg protein added to a 0.5 mL reaction mixture (50 mM Tris-HCl pH 7.4, 10 mM MgCl2, 2 mM EGTA, 0.8 mM sodium phosphate, 2.8 mM β-mercaptoethanol, and 1 mM ouabain) that incubated for 5 minutes at 37° C. Each reaction was initiated with 1.6 mM γ-32P-ATP with or without 0.12 mM DNP-SG or 0.01 mM DOX. After 60 minutesm each reaction was terminated by addition of a 2.5 ml cold mixture of 1 M perchloric acid and 5% ammonium molybdate in water (4:1) followed by extraction with a 2.5 mL mixture of isobutanol-benzene (1:1). Radioactivity was quantified in the organic phase to determine cleaved terminal phosphate. RLIP76 activity was calculated by subtracting background counts obtained in the absence of protein from those obtained in the presence of protein. RLIP76 activity was calculated by subtracting the activity seen in the absence of DOX or DNP-SG from that seen in its presence. Each assay was performed in triplicate.
Crude membrane vesicles (inside-out vesicles or IOVs) were prepared from non-malignant cells (HAVSMC, HLBEC, HLMVEC and HUVEC) and cancer cells (SCLC, NSCLC, DG-1 human melanoma, mouse B16 melanoma, MCF7, HepG2, PC-3 and OVCAR-3) identified in the Table using procedures known in the art (see, e.g., Awasthi, et al., Clin Invest 1994;93:958-65; Awasthi, et al., Biochemistry 2000;39:9327-34). Transport studies in IOVs were performed by method known in the art (see, e.g., Awasthi, et al., Int J Cancer 2004; 112:934-42) in which heat-inactivated IOVs were used as negative controls.
RLIP76 inhibition or depletion caused preferential cytotoxicity in malignant cells. RLIP76 was inhibition by anti-RLIP76 IgG or via depletion using si-RNA (si-RNA508-528) targeted to a specific identified region of RLIP76. Varying concentrations of either inhibitor were used in an MTT assay. Maximum inhibition was observed near 40 μg/mL by MTT assay (data not shown). Anti-RLIP76 demonstrated greater cell kill in malignant cell lines (p<0.01); pre-immune IgG caused no significant cell kill. Maximal susceptibility was observed with the melanoma cell lines and the SCLC cell line (
si-RNA508-528 was targeted to region of RLIP76 and corresponds closely with a region spanning amino acids 171-185 (nucleotide 510-555 starting from 1 AUG codon in the open reading frame) in the N-terminal region of RLIP76. si-RNA508-528 is particularly novel in that it lacks homology with other proteins or nucleotide sequences. More details regarding its preparation and described later.
With RLIP76 si-RNA508-528 (at a concentration of 20 μg/ml), there was a complete depletion of RLIP76 protein after 24 to 48 hours. Non-malignant cells were less sensitive to RLIP76 depletion as compared with malignant cells. For example, 10 μg/ml si-RNA affected B16 melanoma cells significantly more than HLMVEC (
TUNEL assays were measured on adherent cells and floating cells. For adherent cells, approximately 1×106 cells were placed into 12-well plates containing coverslips and allowed to incubate with either pre-immune serum or anti-RLIP76 IgG (37 μg/ml final concentration) for about 24 hours. For floating cells, approximately 1×106 cells were grown for 24 hours in 12-well plates then incubated with either pre-immune serum or anti-RLIP76 IgG (37 μg/ml final concentration) before transferring to histological slides. Apoptosis was then determined by labeling DNA fragmentations using a terminal deoxynucleotidyl-transferase dUTP end labeling method as know in the art. Free 3′-OH DNA ends (characteristic of DNA fragmentation) were labeled using a reaction catalyzed by terminal deoxynucleotidyl-transferase (TdT). Samples were analyzed by laser scanning fluorescence microscope. Apoptotic cells showed green fluorescence and characteristic cell shrinkage
Anti-RLIP76, si-RNA or antisense DNA caused complete regression of B16 melanoma in mice. C57B mice were injected on their flanks with 1×106 B16-F1 melanoma cells and tumors were measured by calipers daily. When the surface area of the tumor (product of bi-dimensional measurements) exceeded 40 mm2 (day 11), animals were injected intraperitoneally with 100 μl diluent alone (phosphate buffered saline, PBS) or the same volume of diluent containing 200 μg anti-RLIP76 IgG, RLIP76 si-RNA508-528, or RLIP76 phosphorothioate antisense508-528. Additional control animals were injected with pre-immune IgG, scrambled si-RNA or antisense si-RNA. Tumors regressed completely in all animals treated with any inhibitor of RLIP76, whereas uncontrolled growth was observed in the control groups.
The region spanning amino acid residues 171-185 (nucleotide 510-555 starting from 1 AUG codon in the open reading frame) in the N-terminal region of RLIP76 was chosen as the target region for synthesis of phosphorothioate DNA. The oxygen in the backbone of the DNA molecules was replaced by sulfur in each phosphate group, which makes the DNA backbone resistant to nucleases. However, the macromolecule remains electrically charged, impeding its passage across cell membrane. Selected DNA sequence was subjected to blast-search (NCBI database) against EST libraries, to ensure that only the selected gene was targeted. Chemically synthesized phosphorothioate DNA in desalted form was purchased from Biosynthesis Inc. A 21-nucleotide long scrambled phosphorothioate DNA was used as a control. The scrambled DNA sequence was not homologous with RLIP76 cDNA in a blast-search against RLIP76. The targeted cDNA sequence (SEQ ID NO.: 19 or AAGAAAAAGCCAATTCAGGAGCC) corresponded to nucleotides 508-528. A corresponding phosphorothioated DNA sequence was GGCTCCTGAATTGGCTTTTTC (SEQ ID NO.: 20). The sequence of the scrambled DNA was CATCGAAATCGTTGCAGTTAC (SEQ ID NO.: 21). Transfection of phosphorothioate DNA was performed using a transfection kit known in the art; cells were assayed for silencing 24 hours after transfection.
C57 BL/6 mice were obtained and colonies bred in accordance with standard institutional protocols. In brief, twenty-one 16-week-old mice were divided into seven groups of 3 animals (PBS control; pre-immune IgG control; scrambled si-RNA control; scrambled phosphorothioate oligonucleotide control; anti-RLIP76 IgG, RLIP76508-528 si-RNA, and RLIP76508-528 phosphorothioate antisense oligonucleotide). Each 21 animals was injected with 2×106 B16 mouse melanoma cell suspensions in 100 μL of PBS, subcutaneously. Animals were examined daily for signs of tumor growth. Treatment was administered when the tumor surface area exceeded 45 mm2 (at day 11). Treatment consisted of 200 μg in 100 μL PBS of either anti-RLIP76 IgG, RLIP76508-528 si-RNA, or RLIP76508-528 phosphorothioate antisense oligonucleotide. Control groups were 200 μg/100 μl of either pre-immune IgG, scrambled si-RNA, or scrambled phosphorothioate antisense, or diluent (PBS) alone. Tumors were measured in two dimensions using calipers on days 1, 3, 5, 7, 9, 11, 13, 15, 17 and 20.
The present invention demonstrates the over-expression of RLIP76 in most malignant cells that undergo uncontrolled cells growth as compared with non-malignant cells that do not undergo uncontrolled cell growth. With greater RLIP76 expression, there was increased transport activity of RLIP76 (as demonstrated using transport agents such as DOX or DNP-SG). With greater protein expression there was also an increased dependence on RLIP76 protein as a transport molecule. The present invention also provides for an in vivo effect of targeted anti-RLIP agents in cells undergoing uncontrolled cell growth. Regression of an established melanoma nodule upon administration of a single dose of an anti-RLIP76 agent only 11 days after tumor implantation was observed in mice. Such results are unlike any observed with other anti-cancer therapies. In culture, si-RNA administration was superior to that observed with anti-RLIP76 IgG; in vivo, treatments appeared to provide similar efficacy when equivalent doses were administered. RLIP76 antibody effects may relate to contributions of antibody-dependent cellular cytotoxicity effects.
Accordingly, the present invention indicates that increased RLIP76 expression is associated with clinical cancerous growth (uncontrolled cells growth). As such, inhibition of RLIP76 offers a targeted solution to eradicate tumorigenic or malignant cells. RLIP76 appears to be a significant transporter in such cells and the activity of RLIP76 appears to be directly involved in uncontrolled cells growth, malignancy and tumorigenicity.
To specifically target unwanted tumorigenic or malignant cells, the present invention provides for compositions that antagonize, inhibit or deplete RLIP76 (e.g., inhibit RLIP76 transport activity); such compositions being new and important antineoplastic agents to be used alone or in combination with existing therapies. The antagonists include compounds that interact with a cell-surface domain of RLIP76 that directly affects RLIP76 transport activity. Suitable compositions include those molecules that inhibit, reduce or deplete transport activity of RLIP76 and may be identified as described below.
The inventors have recently reported several surface epitope regions of RLIP76 when membrane bound to cells. The surface epitope region was found necessary for optimal transport activity of RLIP76 as desctibed by Yadav et al., Biochemistry 2004;43:16243-53, herein incorporated by reference. One surface epitope region comprises on or about amino acids (aa) 154 to 219 (SEQ ID NO.:3 and conservatively modified variants, thereof, including deletions of 1 to 5 residues at the C-terminus and or N-terminus). Another surface epitope region comprises on or about amino acids 171 to 185, corresponding to an aa sequence KPIQEPEVPQIDVPN (SEQ ID NO:4 and conservatively modified variants, thereof, including deletions of 1 to 5 residues at the C-terminus and or N-terminus). Such surface epitope regions are not only necessary for optimal transport activity, they are also useful portions of the protein for the identification of inhibitors of RLIP76 transport activity. For example, a deletion mutant protein lacking amino acids 171 to 185 resulted in loss of hydrophobicity of the protein, decreased association of the protein with artificial liposomes, and decreased transport activity. In addition, cells transfected with 171-185 si-RNA (SEQ ID NO.:5) resulted in loss of cell surface expression (e.g., decreased membrane association).
Accordingly, the present invention identifies regions of the protein acting as surface epitopes and capable of providing antagonists (e.g., inhibitors) for RLIP76. Antagonists, as identified herein, include antibodies directed against one or more surface epitope region (e.g., humanized monoclonal antibody), si-RNA sequences directed against one or more surface epitope regions, as well as small molecules found using chemical library screenings against peptides containing one or more surface epitope regions.
In one form, surface epitope regions and their variants, as identified herein, are synthesized and immobilized on an inert support material and used to screen chemical libraries for compounds that bind this peptide. Suitable methods for chemical library screening are known to one of ordinary skill in the art. The compounds identified by the screening process are tested in a secondary screen that included a liposomal transport assay to determine efficiency of inhibition of RLIP76. RLIP76 inhibitors are also tested in animals alone and in combination with existing anti-seizure medicines in order to evaluate safety and efficacy of each identified inhibitor.
SEQ ID NO:3 and SEQ ID NO:4 were identified from a series of deletion mutant proteins to RLIP76 (data not shown; see Yadav et al., 2004). In brief, a series of deletion mutants were prepared by PCR-based site-directed mutagenesis using a clone of the full length RLIP76 in an expression vector [pET30a(+)] as template and upstream primer 5′ GGCGGATCCATGACTGAGTGCTTCCT (SEQ ID NO.:5: BamH1 restriction site is underlined) and downstream primer 5′CCGCTCGAGTAGATGGACGTCTCCTTCCTATCCC (SEQ ID NO.:6; XhoI restriction site underlined). Mutants included those having deletions of amino acids 203 to 219 (del 203-219), 154 to 171 (del 154-171), 171 to 185 (del 171-185), 154 to 219 (del 154-219), 415 to 448 (del 415-448) and 65 to 80 (del 65-80). The mutagenic primers for del 203-219: 5′ GTAGAGAGGACCATGGTAGAGAAGTATGGC 3′ (SEQ ID NO.: 7) with its reverse complement); for del 154-171: 5′ GAAGAAGTCAAAAGACAAGCCAATTCAGGAG (SEQ ID NO.: 8; with its reverse complement); for del 171-185: 5′ GAAGAAAAAGAAACTCAAACCCATTTTT 3′ (SEQ ID NO.: 9; with its reverse complement); for del 154-219: 5′ GAAGAAGTCAAAAGACGTAGAGAAGTATGGC 3′ (SEQ ID NO.: 10; with its reverse complement; for del 415-448: 5′ GAATTGTTTACATCGACAGGAGTGTGAAACC (SEQ ID NO.: 11; with its reverse complement); and for del 65-80: 5′ GTGTCTGATGATAGGACTGAAGGCTATG 3′ (SEQ ID NO.: 12 and its reverse complement).
The template and each deletion mutant was expressed in E. coli and after bacterial lysis (with e.g., 1% (w/v) C12E9 in lysis buffer), the protein was extracted by methods known to one of ordinary skill in the art. For the full length protein and the deletion mutants, one method of protein purification to nearly homogeneity from bacterial extracts used DNP-SG affinity resins (for full description see in Awasthi, et al. Biochemistry 2000:39:9327-9334, herein incorporated by reference). Introduction of deletions specified above in wild type RLIP76 did not affect the affinity of protein with DNP-SG; all deletion mutants could be purified by DNP-SG affinity chromatography. Protein purity was ascertained by SDS-PAGE, Western blot and amino acid composition analysis using methods know in the art and as described in Awasthi et al. 2000. The authenticity of the mutation and the absence of other fortuitous mutations were confirmed by DNA sequencing for each of the deletion mutants.
Full-length RLIP76 (wt-RLIP76) and deletion mutants (del 203-219, del 154-171, del 171-185, del 154-219, del 65-80, del 415-448 and del 65-80) were expressed as recombinant (rec) proteins in E. coli (using pET30a(+) plasmid under the control of the lac UV5 promoter. Single bacterial colonies were used to induce protein expression. To facilitate extraction of the rec-RLIP76 and its various deletion mutants, bacterial lysates were collected, sonicated, and incubated. After incubation, each reaction mixture was centrifuged and the supernatant fraction was obtained as a cytosol fraction and the pellet was the membrane fraction. The membrane fraction was resuspended in 1% polidocanol (a non-ionic detergent) sonicated again, incubated and collected in the supernatant after centrifugation.
When extracted in detergent-containing buffer, the ratio of RLIP76 in the detergent/aqueous extracts was found to be 2.5 for the wild-type protein, but decreased to 0.7 in the mutant in which aa 154-219 (SEQ ID NO.:4) were deleted (data not shown; see Yadav et al., 2004). Deletion of only one segment of this region (del 171-185 or SEQ ID NO.:3) alone resulted in a significant decrease in this ratio to 1.0. For the mutants with deletions within the region from aa 154-219, loss of hydrophobicity correlated with decreased incorporation of mutants into artificial liposomes, and decreased transport activity. The data indicates that the 154-219 region of RLIP76 significantly affects protein partitioning between cytosol and membranes; Residues 171-185 contribute significantly to this effect.
Functional reconstitution of purified RLIP76 from E. coli for transport studies was performed using methods known to one of ordinary skill in the art, an example of which is described in Awasthi, et al. 2000. The degree of incorporation of wild-type as well as mutant RLIP76 into artificial liposomes was assessed by measuring RLIP76 after centrifugation (pellet and supernatant of prepared liposomes) by ELISA assay using anti-RLIP76 antibodies. Measurement of the transport of a cationic agent, doxorubicin (DOX), in the reconstituted liposomes was performed using methods known to one of ordinary skill in the art, an example of which is described in Awasthi, et al. 2000. The ATP-dependent uptake of [14C]-DOX (specific activity 8.4×104 cpm/nmol) was determined by subtracting the radioactivity (cpm) of the control without ATP from that of the experimental containing ATP. Transport of DOX was calculated in terms of pmol/min/mg protein. The transport of [3H]-DNP-SG (specific activity 3.2×103 cpm/nmol) was measured using methods known to one of ordinary skill in the art, an example of which is described in Awasthi, et al. 2000.
The majority (87%) of total wild-type RLIP76 was found in the pellet fraction, incorporated into the proteoliposomes. Deletion of aa 203-219 or 154-171 decreased incorporation slightly (to 83 and 80%, respectively). Deletion of aa 171-185 significantly effected incorporation of the protein into proteoliposomes (64%) as did deletion of residues 154-219, with only 33% of total protein found incorporated into proteoliposomes. Deletions affecting the ATP-binding sites (aa 65-80 and aa 415-448) had no significant effect on the amount of protein incorporated into proteoliposomes. Thus region 154-219 is an important determinant of membrane insertion.
For ATP-dependent transport of molecules across the proteoliposomes, transport was significantly decreased (21%) in the mutant lacking aa 154-171 (27.6 versus 21.7 nmol/min/mg for transport of DOX by the full length RLIP76 versus the deletion mutant, p<0.05). Deletion of aa 171-185 resulted in approximately 40% loss of transport activity for DOX and a similar loss (35%) in transport activity for dinitrophenyl S-glutathione (DNP-SG). Deletion of the entire 154-219 region resulted in further significant loss (50%) of transport activity for both DOX and DNP-SG. Because deletion of ATP-binding site regions did not affect partitioning of the mutants between cytosol and membrane, the observed decrease in transport activity of deletion mutant aa 154-219 is believed due to loss of protein association with the membrane because of its decreased partitioning in the membrane.
The effect in eukaryotes of losing surface epitope regions spanning residues 171-185 (SEQ ID NO.:4) or 154-219 (SEQ ID NO.:3) was similar to that described above (data not shown; see Yadav et al., 2004). When H358 cells were transfected with an empty vector (pcDNA3.1) or a vector containing either full length RLIP76 or its deletion mutants lacking aa 171-185 or aa 154-219, membrane association of RLIP76 was significantly reduced in cells transfected with the deletion mutants, as analyzed by Western blots. Hence, the aa 154-219 region is a determinant of the membrane association of RLIP76 and it is independent of whether the protein is expressed in eukaryotes or prokaryotes. Immuno-histochemistry studies using anti-RLIP76 antibodies raised against full-length RLIP76 were performed with live, unfixed H358 wild-type cells and examined by confocal laser microscopy and showed a staining pattern consistent with cell-surface localization. RLIP76 co-localized with another protein, her2/neu, known to have a cell-surface domain. Anti-RLIP76 antibody was detected using a rhodamine red-x-conjugated secondary antibody, and anti-her2/neu antibody using an FITC tagged secondary antibody. Cell-surface epitopes were recognized by both anti-RLIP76 and her2/neu antibodies which co-localized in unfixed cells indicating that RLIP76 had cell-surface epitopes just like her2/neu.
H358 cells constitutively express a wild-type RLIP76. The wild-type was removed by treating H358 cells with si-RNA directed at the region encoding aa 171-185, to silence the expression of wild-type RLIP76, while leaving the expression of 171-185 mutant unaffected. For this, a 23-nucleotide sequence motif comprising AA(N19)TT or NA(N21) (N, any nucleotide) with approximately 50% GC content was searched for. The sequence of sense si-RNA corresponds to N21. The 3′ end of the sense si-RNA was converted to TT to generate a symmetric duplex with respect to the sequence composition of sense and antisense 3′ overhangs. The selected si-RNA sequence was subjected to blast-search (NCBI database) against EST libraries, to ensure that only one gene was targeted. Chemically synthesized si-RNA duplex in the 2′ de-protected and desalted forms, was purchased from Dharmacon. A 23-nucleotide long scrambled si-RNA duplex was used as a control. The scrambled si-RNA sequence was not homologous with RLIP76 mRNA in a blast-search against RLIP76. The targeted cDNA sequence was AAGAAAAAGCCAATTCAGGAGCC (SEQ ID NO.:13) corresponding to nucleotides 508 to 528. The corresponding sense si-RNA sequence was GAAAAAGCCAAUUCAGGAGCCdTdT (SEQ ID NO.: 14) and the antisense si-RNA sequence was GGCUCCUGAAUUGGCUUUUUCdTdT (SEQ ID NO.: 15). The sequences of the scrambled si-RNA in the sense and antisense directions were GUAACUGCAACGAUUUCGAUGdTdT (SEQ ID NO.: 16) and CAUCGAAAUCGUUGCAGUUACdTdT (SEQ ID NO.: 17), respectively.
Transfection of si-RNA duplexes was performed using a kit (Transmessenger Transfection Reagent Kit from Qiagen) and assayed for expression about 24 hours later. Cells (approximately 3×106) were placed into six-well plates and after about 24 hours were incubated for about 3 hours with RLIP76 si-RNA or scrambled si-RNA in an appropriate transfection reagent. Excess si-RNA was washed off with PBS and medium was added. Cell samples were pelleted, solubilized in a lysis buffer (10 mM Tris-HCl, pH 7.4, containing 1.4 mM β-mercaptoethanol, 100 μM EDTA, 50 μM BHT, 100 μM PMSF and 1% polidocanol), sonicated and then incubated for about 4 h in the cold (4° C.). Afterwards, each sample was centrifuged and supernatants (containing both cytosolic proteins and solubilized membrane proteins) collected and analyzed by Western blot analyses according to a method provided by Towbin et al. (Towbin, et al. PNAS 1979;76:4350-4353) using anti-RLIP76 IgG as well as IgG against the peptide 171-185. Gel bands were quantified by scanning densitometry. Polyclonal antibodies against various deleted epitope regions of RLIP76 were custom made. The peptide antibodies as well as pre-immune serum were purified by DE-52 anion exchange chromatography, followed by protein-A-Sepharose affinity chromatography to obtain pure IgG fractions. Immuno-reactivity and specificity of these peptides using their respective purified IgG were checked by dot blot analyses.
The si-RNA 171-185 effectively silenced wild-type RLIP76 expression in the untransfected, empty-vector-transfected, as well as wild-type RLIP76 transfected cells (data not shown; see Yadav et al., 2004). Antibodies against the 171-185 peptide failed to detect RLIP76 antigen, while antibodies against full-length RLIP76 recognized the persistent presence of the residual deletion mutant RLIP76. Western blotting against the anti-del 171-185 antibody showed no signal in the RLIP76 deletion mutant transfected cells confirming that expression of wild-type RLIP76 was effectively blocked in these cells. Cell surface expression of RLIP76 in del 171-185 transfected cells with or without pre-treatment with si-RNA directed at aa 171-185 using immunohistochemical analaysis and an anti-del 171-185 antibody showed that cells with control si-RNA had significant cell surface signal which was absent in cells in which RLIP had ben silenced by the si-RNA. RLIP76 is, thus, an integral membrane protein with at least one cell surface domain spanning amino acids 154 to 219.
Accordingly, the present invention provides several surface epitope regions of RLIP that, when altered, blocked or deleted, prevent RLIP from performing its transport function. Compositions of the present invention include the several surface epitope regions as well as use of these surface epitope regions to obtain specific inhibitors of RLIP that are capable of altering, inhibiting or the transport function of RLIP. The inhibitors include si-RNAs, each having a sequence directed against the one or more surface epitope regions as well as phosphorothioate antisense oligonucleotides directed against such surface epitope regions (e.g., GGCTCCTGAATTGGCTTTTTC; SEQ ID NO.:18) and a corresponding silencing RNA sequence to the phosphorothioate antisense oligonucleotides (e.g., AAGAAAAGCCAATTCAGGAGCC; SEQ ID NO.: 19), where, SEQ ID NO.: 19 corresponds with the targeted cDNA sequence for nucleotides 508 to 528 used to generate the antisense si-RNA or SEQ ID NO.: 13. In addition, inhibitors include antibodies (monoclonal and/or polyclonal) directed against the one or more surface epitope regions, such regions including SEQ ID NO.: 3 and SEQ ID NO.:4. Moreover, the inhibitors identified herein provide compounds for anti-seizure medicines. Importantly, the inhibitors are additional targets for identifying important compounds and small molecule from chemical library screenings, wherein the identified compounds and/or small molecules are effective as anti-cancer medicines.
While particular embodiments of the invention and method steps of the invention have been described herein, additional alternatives not specifically disclosed but known in the art are intended to fall within the scope of the invention. Thus, it is understood that other embodiments and applications of the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the appended claims and drawings.
Claims
1. A composition comprising:
- a region of ralA binding protein 1, wherein the region neighbors a membrane-associated portion of the ralA binding protein 1, reduces transport activity and membrane association of ralA binding protein 1 and kills cells undergoing uncontrolled cell growth in a subject that has cells undergoing uncontrolled cell growth.
2. The composition of claim 1, wherein antibodies are generated against the region to directly affect transport activity and membrane association of the ralA binding protein 1.
3. The composition of claim 1, wherein the region is used to screen chemical libraries for compounds that bind the region.
4. The composition of claim 3, wherein the compounds reduce transport activity and membrane association of ralA binding protein 1.
5. The composition of claim 3, wherein the compounds are anti-cancer medicines.
6. The composition of claim 5, wherein medicines include antibodies, si-RNA and small molecules that recognize the region.
7. The composition of claim 1, wherein si-RNA sequences are generated against the region to silence expression of wild-type ralA binding protein 1.
8. The composition of claim 1, wherein si-RNA sequences are anti-cancer medicines.
9. The composition of claim 2, wherein antibodies are anti-cancer medicines.
10. A composition comprising:
- a region of ralA binding protein 1, wherein the region neighbors a membrane-associated portion of the ralA binding protein 1, reduces transport activity and membrane association of ralA binding protein 1 and reduces tumor growth in a subject that has a tumor.
12. The composition of claim 9, wherein the region is used to identify chemical compounds that recognize the region.
13. The composition of claim 10, wherein the chemical compounds include antibodies, si-RNA and small molecules.
Type: Application
Filed: Nov 2, 2005
Publication Date: Aug 17, 2006
Applicant: Board of Regents, The University of Texas System (Austin, TX)
Inventors: Sanjay Awasthi (Arlington, TX), Sharad Singhal (Arlington, TX), Sushma Yadav (Arlington, TX)
Application Number: 11/264,910
International Classification: A61K 48/00 (20060101); A61K 39/395 (20060101);