Induction of exon skipping in eukaryotic cells
The present invention provides a method for at least in part decreasing the production of an aberrant protein in a cell, the cell comprising pre-mRNA comprising exons coding for the protein, by inducing so-called exon skipping in the cell. Exon-skipping results in mature mRNA that does not contain the skipped exon, which leads to an altered product of the exon codes for amino acids. Exon skipping is performed by providing a cell with an agent capable of specifically inhibiting an exon inclusion signal, for instance, an exon recognition sequence, of the exon. The exon inclusion signal can be interfered with by a nucleic acid comprising complementarity to a part of the exon. The nucleic acid, which is also herewith provided, can be used for the preparation of a medicament, for instance, for the treatment of an inherited disease.
Latest Patents:
- Atomic layer deposition and etching of transition metal dichalcogenide thin films
- Sulfur-heterocycle exchange chemistry and uses thereof
- Recyclable heavy-gauge films and methods of making same
- Chemical mechanical polishing solution
- On-board device, information processing method, and computer program product
This application is a continuation of co-pending U.S. patent application Ser. No. 10/395,031, filed Mar. 21, 2003, now U.S. Pat. No. ______, which is a continuation of International Application PCT/NL01/00697, filed Sep. 21, 2001, designating the United States, published in English Mar. 28, 2002, as WO 02/024906 A1 and subsequently published with corrections Jan. 23, 2003, as WO 02/024906 C2, the contents of the entirety of each of which are hereby incorporated herein by this reference.
TECHNICAL FIELDThe invention relates to the field of gene therapy.
BACKGROUNDGiven the rapid advances of human genome research, professionals and the public expect that the near future will bring us, in addition to understanding of disease mechanisms and refined and reliable diagnostics, therapies for many devastating genetic diseases.
While it is hoped that for some (e.g., metabolic) diseases, the improved insights will bring easily administrable small-molecule therapies, it is likely that in most cases one or another form of gene therapy will ultimately be required, i.e., the correction, addition or replacement of the defective gene product.
In the past few years, research and development in this field have highlighted several technical difficulties which need to be overcome, e.g., related to the large size of many genes involved in genetic disease (limiting the choice of suitable systems to administer the therapeutic gene), the accessibility of the tissue in which the therapeutic gene should function (requiring the design of specific targeting techniques, either physically, by restricted injection, or biologically, by developing systems with tissue-specific affinities) and the safety to the patient of the administration system. These problems are to some extent interrelated, and it can be generally concluded that the smaller the therapeutic agent is, the easier it will become to develop efficient, targetable and safe administration systems.
BRIEF SUMMARY OF THE INVENTIONThe present invention addresses this problem by inducing so-called exon-skipping in cells. Exon-skipping results in mature mRNA that does not contain the skipped exon and thus, when the exon codes for amino acids, can lead to the expression of an altered product. Technology for exon-skipping is currently directed toward the use of so-called “Anti-sense Oligonucleotides” (AONs).
Much of this work is done in the mdx mouse model for Duchenne muscular dystrophy (DMD). The mdx mouse, which carries a nonsense mutation in exon 23 of the dystrophin gene, has been used as an animal model of Duchenne muscular dystrophy. Despite the mdx mutation, which should preclude the synthesis of a functional dystrophin protein, rare, naturally occurring dystrophin-positive fibers have been observed in mdx muscle tissue. These dystrophin-positive fibers are thought to have arisen from an apparently naturally occurring exon-skipping mechanism, either due to somatic mutations or through alternative splicing.
AONs directed to, respectively, the 3′ and 5′ splice sites of introns 22 and 23 in dystrophin pre-mRNA have been shown to interfere with factors normally involved in removal of intron 23 so that exon 23 was also removed from the mRNA (Wilton, 1999). In a similar study, Dunckley et al. (1998) showed that exon skipping using AONs directed to 3′ and 5′ splice sites can have unexpected results. They observed skipping of not only exon 23 but also of exons 24-29, thus resulting in an mRNA containing an exon 22-exon 30 junction.
The underlying mechanism for the appearance of the unexpected 22-30 splicing variant is not known. It could be due to the fact that splice sites contain consensus sequences leading to promiscuous hybridization of the oligos used to direct the exon skipping. Hybridization of the oligos to other splice sites than the sites of the exon to be skipped of course could easily interfere with the accuracy of the splicing process. On the other hand, the accuracy could be lacking due to the fact that two oligos (for the 5′ and the 3′ splice site) need to be used. Pre-mRNA containing one but not the other oligo could be prone to unexpected splicing variants.
To overcome these and other problems, the present invention provides a method for directing splicing of a pre-mRNA in a system capable of performing a splicing operation comprising contacting the pre-mRNA in the system with an agent capable of specifically inhibiting an exon inclusion signal of at least one exon in the pre-mRNA, the method further comprising allowing splicing of the pre-mRNA. Interfering with an exon inclusion signal (EIS) has the advantage that such elements are located within the exon. By providing an antisense oligo for the interior of the exon to be skipped, it is possible to interfere with the exon inclusion signal, thereby effectively masking the exon from the splicing apparatus. The failure of the splicing apparatus to recognize the exon to be skipped thus leads to exclusion of the exon from the final mRNA.
The present invention does not interfere directly with the enzymatic process of the splicing machinery (the joining of the exons). It is thought that this allows the method to be more robust and reliable. It is thought that an EIS is a particular structure of an exon that allows splice acceptor and donor to assume a particular spatial conformation. In this concept, it is the particular spatial conformation that enables the splicing machinery to recognize the exon. However, the invention is certainly not limited to this model.
It has been found that agents capable of binding to an exon can inhibit an EIS. Agents may specifically contact the exon at any point and still be able to specifically inhibit the EIS. The mRNA may be useful in itself. For instance, production of an undesired protein can be at least in part reduced by inhibiting inclusion of a required exon into the mRNA. A preferred method of the invention further comprises allowing translation of mRNA produced from splicing of the pre-mRNA. Preferably, the mRNA encodes a functional protein. In a preferred embodiment, the protein comprises two or more domains, wherein at least one of the domains is encoded by the mRNA as a result of skipping of at least part of an exon in the pre-mRNA.
Exon skipping will typically, though not necessarily, be of relevance for proteins in the wild-type configuration, having at least two functional domains that each performs a function, wherein the domains are generated from distinct parts of the primary amino acid sequence. Examples are, for instance, transcription factors. Typically, these factors comprise a DNA binding domain and a domain that interacts with other proteins in the cell. Skipping of an exon that encodes a part of the primary amino acid sequence that lies between these two domains can lead to a shorter protein that comprises the same function, at least in part. Thus, detrimental mutations in this intermediary region (for instance, frame-shift or stop mutations) can be at least in part repaired by inducing exon skipping to allow synthesis of the shorter (partly) functional protein.
Using a method of the invention, it is also possible to induce partial skipping of the exon. In this embodiment, the contacting results in activation of a cryptic splice site in a contacted exon. This embodiment broadens the potential for manipulation of the pre-mRNA leading to a functional protein. Preferably, the system comprises a cell. Preferably, the cell is cultured in vitro or in the organism in vivo. Typically, though not necessarily, the organism comprises a human or a mouse.
In a preferred embodiment, the invention provides a method for at least in part decreasing the production of an aberrant protein in a cell, the cell comprising pre-mRNA comprising exons coding for the protein, the method comprising providing the cell with an agent capable of specifically inhibiting an exon inclusion signal of at least one of the exons, the method further comprising allowing translation of mRNA produced from splicing of the pre-mRNA.
Any agent capable of specifically inhibiting an exon exclusion signal can be used for the present invention. Preferably, the agent comprises a nucleic acid or a functional equivalent thereof. Preferably, but not necessarily, the nucleic acid is in single-stranded form. Peptide nucleic acid and other molecules comprising the same nucleic acid binding characteristics in kind, but not necessarily in amount, are suitable equivalents. Nucleic acid or an equivalent may comprise modifications to provide additional functionality. For instance, 2′-O-methyl oligoribonucleotides can be used. These ribonucleotides are more resistant to RNAse action than conventional oligonucleotides.
In a preferred embodiment of the invention, the exon inclusion signal is interfered with by an antisense nucleic acid directed to an exon recognition sequence (ERS). These sequences are relatively purine-rich and can be distinguished by scrutinizing the sequence information of the exon to be skipped (Tanaka et al., 1994, Mol. Cell. Biol. 14, p. 1347-1354). Exon recognition sequences are thought to aid inclusion into mRNA of so-called weak exons (Achsel et al., 1996, J. Biochem. 120, p. 53-60). These weak exons comprise, for instance, 5′ and or 3′ splice sites that are less efficiently recognized by the splicing machinery. In the present invention, it has been found that exon skipping can also be induced in so-called strong exons, i.e., exons which are normally efficiently recognized by the splicing machinery of the cell. From any given sequence, it is (almost) always possible to predict whether the sequence comprises putative exons and to determine whether these exons are strong or weak. Several algorithms for determining the strength of an exon exist. A useful algorithm can be found on the NetGene2 splice site prediction server (Brunak, et al., 1991, J. Mol. Biol. 220, p. 49-65). Exon skipping by a means of the invention can be induced in (almost) every exon, independent of whether the exon is a weak exon or a strong exon and also independent of whether the exon comprises an ERS. In a preferred embodiment, an exon that is targeted for skipping is a strong exon. In another preferred embodiment, an exon targeted for skipping does not comprise an ERS.
Methods of the invention can be used in many ways. In one embodiment, a method of the invention is used to at least in part decrease the production of an aberrant protein. Such proteins can, for instance, be onco-proteins or viral proteins. In many tumors, not only the presence of an onco-protein but also its relative level of expression has been associated with the phenotype of the tumor cell. Similarly, not only the presence of viral proteins but also the amount of viral protein in a cell determines the virulence of a particular virus. Moreover, for efficient multiplication and spread of a virus, the timing of expression in the life cycle and the balance in the amount of certain viral proteins in a cell determines whether viruses are efficiently or inefficiently produced. Using a method of the invention, it is possible to lower the amount of aberrant protein in a cell such that, for instance, a tumor cell becomes less tumorigenic (metastatic) and/or a virus-infected cell produces less virus.
In a preferred embodiment, a method of the invention is used to modify the aberrant protein into a functional protein. In one embodiment, the functional protein is capable of performing a function of a protein normally present in a cell but absent in the cells to be treated. Very often, even partial restoration of function results in significantly improved performance of the cell thus treated. Due to the better performance, such cells can also have a selective advantage over unmodified cells, thus aiding the efficacy of the treatment.
This aspect of the invention is particularly suited for the restoration of expression of defective genes. This is achieved by causing the specific skipping of targeted exons, thus bypassing or correcting deleterious mutations (typically stop-mutations or frame-shifting point mutations, single- or multi-exon deletions or insertions leading to translation termination).
Compared to gene-introduction strategies, this novel form of splice-modulation gene therapy requires the administration of much smaller therapeutic reagents, typically, but not limited to, 14-40 nucleotides. In a preferred embodiment, molecules of 14-25 nucleotides are used since these molecules are easier to produce and enter the cell more effectively. The methods of the invention allow much more flexibility in the subsequent design of effective and safe administration systems. An important additional advantage of this aspect of the invention is that it restores (at least some of) the activity of the endogenous gene, which still possesses most or all of its gene-regulatory circuitry, thus ensuring proper expression levels and the synthesis of tissue-specific isoforms.
This aspect of the invention can in principle be applied to any genetic disease or genetic predisposition to disease in which targeted skipping of specific exons would restore the translational reading frame when this has been disrupted by the original mutation, provided that translation of an internally slightly shorter protein is still fully or partly functional. Preferred embodiments for which this application can be of therapeutic value are: predisposition to second hit mutations in tumor suppressor genes, e.g., those involved in breast cancer, colon cancer, tuberous sclerosis, neurofibromatosis etc., where (partial) restoration of activity would preclude the manifestation of nullosomy by second hit mutations and thus would protect against tumorigenesis. Another preferred embodiment involves the (partial) restoration of defective gene products which have a direct disease causing effect, e.g., hemophilia A (clotting factor VIII deficiency), some forms of congenital hypothyroidism (due to thyroglobulin synthesis deficiency) and Duchenne muscular dystrophy (DMD), in which frame-shifting deletions, duplications and stop mutations in the X-linked dystrophin gene cause severe, progressive muscle degradation. DMD is typically lethal in late adolescence or early adulthood, while non-frame-shifting deletions or duplications in the same gene cause the much milder Becker muscular dystrophy (BMD), compatible with a life expectancy between 35-40 years to normal. In the embodiment as applied to DMD, the present invention enables exon skipping to extend an existing deletion (or alter the mRNA product of an existing duplication) by as many adjacent exons as required to restore the reading frame and generate an internally slightly shortened, but still functional, protein. Based on the much milder clinical symptoms of BMD patients with the equivalent of this induced deletion, the disease in the DMD patients would have a much milder course after AON-therapy.
Many different mutations in the dystrophin gene can lead to a dysfunctional protein. (For a comprehensive inventory see www.dmd.nl, the internationally accepted database for DMD and related disorders.) The precise exon to be skipped to generate a functional dystrophin protein varies from mutation to mutation. Table 1 comprises a non-limiting list of exons that can be skipped and lists for the mentioned exons some of the more frequently occurring dystrophin gene mutations that have been observed in humans and that can be treated with a method of the invention. Skipping of the mentioned exon leads to a mutant dystrophin protein comprising at least the functionality of a Becker mutant. Thus, in one embodiment, the invention provides a method of the invention wherein the exon inclusion signal is present in exon numbers 2, 8, 19, 29, 43, 44, 45, 46, 50, 51, 52 or 53 of the human dystrophin gene. The occurrence of certain deletion/insertion variations is more frequent than others. In the present invention, it was found that by inducing skipping of exon 46 with a means or a method of the invention, approximately 7% of DMD-deletion containing patients can be treated, resulting in the patients to comprise dystrophin-positive muscle fibers. By inducing skipping of exon 51, approximately 15% of DMD-deletion containing patients can be treated with a means or method of the invention. Such treatment will result in the patient having at least some dystrophin-positive fibers. Thus, with either skipping of exon 46 or 51 using a method of the invention, approximately 22% of the patients containing a deletion in the dystrophin gene can be treated. Thus, in a preferred embodiment of the invention, the exon exclusion signal is present in exon 46 or exon 51. In a particularly preferred embodiment, the agent comprises a nucleic acid sequence according to hAON#4, hAON#6, hAON#8, hAON#9, hAON#11 and/or one or more of hAON#21-30 or a functional part, derivative and/or analogue of the hAON. A functional part, derivative and/or analogue of the hAON comprises the same exon skipping activity in kind, but not necessarily in amount, in a method of the invention.
It can be advantageous to induce exon skipping of more than one exon in the pre-mRNA. For instance, considering the wide variety of mutations and the fixed nature of exon lengths and amino acid sequence flanking such mutations, the situation can occur that for restoration of function more than one exon needs to be skipped. A preferred but non-limiting example of such a case in the DMD deletion database is a 46-50 deletion. Patients comprising a 46-50 deletion do not produce functional dystrophin. However, an at least partially functional dystrophin can be generated by inducing skipping of both exon 45 and exon 51. Another preferred but non-limiting example is patients comprising a duplication of exon 2. By providing one agent capable of inhibiting an EIS of exon 2, it is possible to partly skip either one or both exons 2, thereby regenerating the wild-type protein next to the truncated or double exon 2 skipped protein. Another preferred but non-limiting example is the skipping of exons 45 through 50. This generates an in-frame Becker-like variant. This Becker-like variant can be generated to cure any mutation localized in exons 45, 46, 47, 48, 49, and/or 50 or combinations thereof. In one aspect, the invention therefore provides a method of the invention further comprising providing the cell with another agent capable of inhibiting an exon inclusion signal in another exon of the pre-mRNA. Of course, it is completely within the scope of the invention to use two or more agents for the induction of exon skipping in pre-mRNA of two or more different genes.
In another aspect, the invention provides a method for selecting the suitable agents for splice-therapy and their validation as specific exon-skipping agents in pilot experiments. A method is provided for determining whether an agent is capable of specifically inhibiting an exon inclusion signal of an exon, comprising providing a cell having a pre-mRNA containing the exon with the agent, culturing the cell to allow the formation of an mRNA from the pre-mRNA and determining whether the exon is absent the mRNA. In a preferred embodiment, the agent comprises a nucleic acid or a functional equivalent thereof, the nucleic acid comprising complementarity to a part of the exon. Agents capable of inducing specific exon skipping can be identified with a method of the invention. It is possible to include a prescreen for agents by first identifying whether the agent is capable of binding with a relatively high affinity to an exon containing nucleic acid, preferably RNA. To this end, a method for determining whether an agent is capable of specifically inhibiting an exon inclusion signal of an exon is provided, further comprising first determining in vitro the relative binding affinity of the nucleic acid or functional equivalent thereof to an RNA molecule comprising the exon.
In yet another aspect, an agent is provided that is obtainable by a method of the invention. In a preferred embodiment, the agent comprises a nucleic acid or a functional equivalent thereof. Preferably the agent, when used to induce exon skipping in a cell, is capable of at least in part reducing the amount of aberrant protein in the cell. More preferably, the exon skipping results in an mRNA encoding a protein that is capable of performing a function in the cell. In a particularly preferred embodiment, the pre-mRNA is derived from a dystrophin gene. Preferably, the functional protein comprises a mutant or normal dystrophin protein. Preferably, the mutant dystrophin protein comprises at least the functionality of a dystrophin protein in a Becker patient. In a particularly preferred embodiment, the agent comprises the nucleic acid sequence of hAON#4, hAON#6, hAON#8, hAON#9, hAON#11 and/or one or more of hAON#21-30 or a functional part, derivative and/or analogue of the hAON. A functional part, derivative and/or analogue of the hAON comprises the same exon skipping activity in kind, but not necessarily in amount, in a method of the invention.
The art describes many ways to deliver agents to cells. Particularly, nucleic acid delivery methods have been widely developed. The artisan is well capable of determining whether a method of delivery is suitable for performing the present invention. In a non-limiting example, the method includes the packaging of an agent of the invention into liposomes, the liposomes being provided to cells comprising a target pre-mRNA. Liposomes are particularly suited for delivery of nucleic acid to cells. Antisense molecules capable of inducing exon skipping can be produced in a cell upon delivery of nucleic acid containing a transcription unit to produce antisense RNA. Non-limiting examples of suitable transcription units are small nuclear RNA (SNRP) or tRNA transcription units. The invention, therefore, further provides a nucleic acid delivery vehicle comprising a nucleic acid or functional equivalent thereof of the invention capable of inhibiting an exon inclusion signal. In one embodiment, the delivery vehicle is capable of expressing the nucleic acid of the invention. Of course, in case, for instance, single-stranded viruses are used as a vehicle, it is entirely within the scope of the invention when such a virus comprises only the antisense sequence of an agent of the invention. In another embodiment of single strand viruses, AONs of the invention are encoded by small nuclear RNA or tRNA transcription units on viral nucleic encapsulated by the virus as vehicle. A preferred single-stranded virus is adeno-associated virus.
In yet another embodiment, the invention provides the use of a nucleic acid or a nucleic acid delivery vehicle of the invention for the preparation of a medicament. In a preferred embodiment, the medicament is used for the treatment of an inherited disease. More preferably, the medicament is used for the treatment of Duchenne Muscular Dystrophy.
Since exon 45 is one of the most frequently deleted exons in DMD, we initially aimed at inducing the specific skipping of exon 46 (
Design of mAONs and hAONs
A series of mouse- and human-specific AONs (mAONs and hAONs) was designed, directed at an internal part of exon 46 that contains a stretch of purine-rich sequences and is hypothesized to have a putative regulatory role in the splicing process of exon 46 (
The listing below refers to the deoxy-form used for testing, in the finally used 2-O-methyl ribonucleotides all T's should be read as U's.
The efficacy of the AONs is determined by their binding affinity for the target sequence. Notwithstanding recent improvements in computer simulation programs for the prediction of RNA-folding, it is difficult to speculate which of the designed AONs would be capable of binding the target sequence with a relatively high affinity. Therefore, we performed gel mobility shift assays (according to protocols described by Bruice et al., 1997). The exon 46 target RNA fragment was generated by in vitro T7-transcription from a PCR fragment (amplified from either murine or human muscle mRNA using a sense primer that contains the T7 promoter sequence) in the presence of 32P-CTP. The binding affinity of the individual AONs (0.5 pmol) for the target transcript fragments was determined by hybridization at 37° C. for 30 minutes and subsequent polyacrylamide (8%) gel electrophoresis. We performed these assays for the screening of both the mouse and human-specific AONs (
Transfection into Muscle Cell Cultures
The exon 46-specific AONs which showed the highest target binding affinity in gel mobility shift assays were selected for analysis of their efficacy in inducing the skipping in muscle cells in vitro. In all transfection experiments, we included a non-specific AON as a negative control for the specific skipping of exon 46. As mentioned, the system was first set up in mouse muscle cells. We used both proliferating myoblasts and post-mitotic myotube cultures (expressing higher levels of dystrophin) derived from the mouse muscle cell line C2C12. For the subsequent experiments in human-derived muscle cell cultures, we used primary muscle cell cultures isolated from muscle biopsies from one unaffected individual and two unrelated DMD patients carrying a deletion of exon 45. These heterogeneous cultures contained approximately 20-40% myogenic cells. The different AONs (at a concentration of 1 μM) were transfected into the cells using the cationic polymer PEI (MBI Fermentas) at a ratio-equivalent of 3. The AONs transfected in these experiments contained a 5′ fluorescein group which allowed us to determine the transfection efficiencies by counting the number of fluorescent nuclei. Typically, more than 60% of cells showed specific nuclear uptake of the AONs. To facilitate RT-PCR analysis, RNA was isolated 24 hours post-transfection using RNAzol B (CamPro Scientific, The Netherlands).
RT-PCR and Sequence AnalysisRNA was reverse transcribed using C. therm. polymerase (Roche) and an exon 48-specific reverse primer. To facilitate the detection of skipping of dystrophin exon 46, the cDNA was amplified by two rounds of PCR, including a nested amplification using primers in exons 44 and 47 (for the human system), or exons 45 and 47 (for the mouse system). In the mouse myoblast and myotube cell cultures, we detected a truncated product of which the size corresponded to exon 45 directly spliced to exon 47 (
We intended to induce the skipping of exon 46 in muscle cells from patients carrying an exon 45 deletion in order to restore the translation and synthesis of a dystrophin protein. To detect a dystrophin product upon transfection with hAON#8, the two patient-derived muscle cell cultures were subject to immunocytochemistry using two different dystrophin monoclonal antibodies (Mandys-1 and Dys-2) raised against domains of the dystrophin protein located proximal and distal of the targeted region respectively. Fluorescent analysis revealed restoration of dystrophin synthesis in both patient-derived cell cultures (
Our results show, for the first time, the restoration of dystrophin synthesis from the endogenous DMD gene in muscle cells from DMD patients. This is a proof of principle of the feasibility of targeted modulation of dystrophin pre-mRNA splicing for therapeutic purposes.
Targeted Skipping of Exon 51 Simultaneous Skipping of Dystrophin ExonsThe targeted skipping of exon 51. We demonstrated the feasibility of AON-mediated modulation of dystrophin exon 46 splicing, in mouse and human muscle cells in vitro. These findings warranted further studies to evaluate AONs as therapeutic agents for DMD. Since most DMD-causing deletions are clustered in two mutation hot spots, the targeted skipping of one particular exon can restore the reading frame in series of patients with different mutations (see Table 1). Exon 51 is an interesting target exon. The skipping of this exon is therapeutically applicable in patients carrying deletions spanning exon 50, exons 45-50, exons 48-50, exons 49-50, exon 52, and exons 52-63, which includes a total of 15% of patients from our Leiden database.
We designed a series of ten human-specific AONs (hAON#21-30, see below) directed at different purine-rich regions within dystrophin exon 51. These purine-rich stretches suggested the presence of a putative exon splicing regulatory element that we aimed to block in order to induce the elimination of that exon during the splicing process. All experiments were performed according to protocols as described for the skipping of exon 46 (see above). Gel mobility shift assays were performed to identify those hAONs with high binding affinity for the target RNA. We selected the five hAONs that showed the highest affinity. These hAONs were transfected into human control muscle cell cultures in order to test the feasibility of skipping exon 51 in vitro. RNA was isolated 24 hours post-transfection, and cDNA was generated using an exon 53- or 65-specific reverse primer. PCR-amplification of the targeted region was performed using different primer combinations flanking exon 51. The RT-PCR and sequence analysis revealed that we were able to induce the specific skipping of exon 51 from the human dystrophin transcript. We subsequently transfected two hAONs (#23 and #29) shown to be capable of inducing skipping of the exon into six different muscle cell cultures derived from DMD-patients carrying one of the mutations mentioned above. The skipping of exon 51 in these cultures was confirmed by RT-PCR and sequence analysis (
Exon 51-specific hAONs:
The skipping of one additional exon, such as exon 46 or exon 51, restores the reading frame for a considerable number of different DMD mutations. The range of mutations for which this strategy is applicable can be enlarged by the simultaneous skipping of more than one exon. For instance, in DMD patients with a deletion of exon 46 to exon 50, only the skipping of both the deletion-flanking exons 45 and 51 enables the reestablishment of the translational reading frame.
ERS-Independent Exon SkippingA mutation in exon 29 leads to the skipping of this exon in two Becker muscular dystrophy patients (Ginjaar at al., 2000, EJHG, vol. 8, p. 793-796). We studied the feasibility of directing the skipping of exon 29 through targeting the site of mutation by AONs. The mutation is located in a purine-rich stretch that could be associated with ERS activity. We designed a series of AONs (see below) directed to sequences both within (h29AON#1 to h29AON#6) and outside (h29AON#7 to h29AON#11) the hypothesized ERS. Gel mobility shift assays were performed (as described) to identify those AONs with highest affinity for the target RNA (
Following the promising results in cultured muscle cells, we tested the different mouse dystrophin exon 46-specific AONs in vivo by injecting them, linked to polyethylenimine (PEI), into the gastrocnemius muscles of control mice. With mAON#4, #6, and #11, previously shown to be effective in mouse muscle cells in vitro, we were able to induce the skipping of exon 46 in muscle tissue in vivo as determined by both RT-PCR and sequence analysis (
- Achsel et al., 1996, J. Biochem. 120, pp. 53-60.
- Bruice T. W. and Lima, W. F., 1997, Biochemistry 36(16): pp. 5004-5019.
- Brunak at al., 1991, J. Mol. Biol. 220, pp. 49-65.
- Dunckley, M. G. et al., 1998, Human molecular genetics 7, pp. 1083-1090.
- Ginjaar et al., 2000, EJHG, vol. 8, pp. 793-796.
- Mann et al., 2001, PNAS vol. 98, pp. 42-47.
- Tanaka et al., 1994 Mol. Cell. Biol. 14, pp. 1347-1354.
- Wilton, S. D., et al., 1999, Neuromuscular disorders 9, pp. 330-338.
Details and background on Duchenne Muscular Dystrophy and related diseases can be found on website http://www.dmd.nl
Claims
1-24. (canceled)
25. A method for directing splicing of a dystrophin pre-mRNA in a cell having dystrophin pre-mRNA, the method comprising:
- contacting the dystrophin pre-mRNA in the cell with an antisense-oligonucleotide having between 14-40 nucleotides, capable of specifically inhibiting an exon inclusion signal of exon number 2, 8, 29, 43, 44, 45; 46, 50, 51, 52, or 53 in the pre-mRNA, and
- allowing splicing of the pre-mRNA.
26. The method according to claim 25, wherein the cell is a cell from an individual suffering from Duchenne Muscular Dystrophy (DMD).
27. The method according to claim 26, wherein the dystrophin pre-mRNA comprises a DMD deletion of one or more exons selected from the groups consisting of exons 3-7, 4-7, 5-7, 6-7, 18-44, 35-43, 44, 44-47, 45, 45-54, 45-52, 50, 50-52, 45-50, 46-47, 46-48, 46 49, 46-51, 46-53, 48-52, 48-50, 49-50, 49-52, 52, 52-63, 51, 51-55, 53, and 53-55.
28. The method according to claim 25, wherein the antisense-oligonucleotide exhibiting the specific inhibition of an exon inclusion signal is obtainable by a method comprising:
- providing a second cell with the antisense-oligonucleotide, the cell having pre-mRNA containing the exon,
- culturing the second cell to form mRNA in the second cell from the pre-mRNA in the second cell, and
- determining whether the exon is absent from the thus formed mRNA in the second cell.
29. The method according to claim 25, further comprising allowing translation of an mRNA produced from splicing of the dystrophin pre-mRNA.
30. The method according to claim 29, wherein the mRNA encodes a functional dystrophin protein.
31. The method according to claim 30, wherein the functional dystrophin protein comprises at least two domains, wherein at least one of the domains is encoded by the mRNA as a result of skipping of at least part of an exon in the dystrophin pre-mRNA.
32. The method according to claim 25, wherein contacting results in activation of a cryptic splice site in a contacted exon.
33. The method according to claim 25, wherein the exon inclusion signal is present in an exon comprising a strong splice donor/acceptor pair.
34. The method according to claim 29, wherein the translation results in a mutant dystrophin protein or a normal dystrophin protein.
35. The method according to claim 34, wherein the mutant dystrophin protein is equivalent to a dystrophin protein of a Becker patient.
36. The method according to claim 25, wherein the antisense-oligonucleotide is capable of specifically inhibiting an exon inclusion signal of exon number 51.
37. The method according to claim 25, wherein the antisense-oligonucleotide comprises a nucleic acid.
38. The method according to claim 37, wherein the nucleic acid comprises a 2′-O-methyl-oligoribonucleotide or a 2′-O-methyl-phosphorothioate.
39. The method according to claim 25, wherein the antisense-oligonucleotide contains between 15-25 nucleotides.
40. The method according to claim 25, further comprising:
- providing the cell with another antisense-oligonucleotide capable of inhibiting an exon inclusion signal present in another exon of the dystrophin pre-mRNA.
41. A method for at least in part decreasing the production of an aberrant dystrophin protein in a cell, the cell comprising dystrophin pre-mRNA comprising exons coding for the aberrant dystrophin protein, the method comprising:
- providing the cell with an antisense-oligonucleotide having between 14-40 nucleotides, capable of specifically inhibiting an exon inclusion signal of exon number 2, 8, 29, 43, 44, 45, 46, 50, 51, 52, or 53, and
- allowing translation of mRNA produced from splicing of the dystrophin pre-mRNA.
42. The method according to claim 41, wherein the antisense-oligonucleotide exhibiting the specific inhibition of an exon inclusion signal is obtainable by a method comprising:
- providing a second cell with the antisense-oligonucleotide, the cell having pre-mRNA containing the exon,
- culturing the second cell to form mRNA in the second cell from the pre-mRNA in the second cell, and
- determining whether the exon is absent from the thus formed mRNA in the second cell.
43. The method according to claim 41, wherein the antisense-oligonucleotide is capable of specifically inhibiting an exon inclusion signal of exon number 51.
44. The method according to claim 41, wherein the dystrophin pre-mRNA comprises a Duchenne Muscular Dystrophy (DMD) deletion of one or more exons selected from the groups consisting of exons 3-7, 4-7, 5-7, 6-7, 18-44, 35-43, 44, 44-47, 45, 45-54, 45-52, 50, 50-52, 45-50, 46-47, 46-48, 46-49, 46-51, 46-53, 48-52, 48-50, 49-50, 49-52, 52, 52-63, 51, 51 55, 53, and 53-55.
45. The method according to claim 41, wherein the antisense-oligonucleotide comprises a nucleic acid.
46. The method according to claim 21, wherein the nucleic acid comprises a 2′-O-methyl-oligoribonucleotide or a 2′-O-methyl-phosphorothioate oligoribonucleotide.
47. The method according to claim 45, wherein the antisense-oligonucleotide contains between 15-25 nucleotides.
48. The method according to claim 41, further comprising:
- providing the cell with another antisense-oligonucleotide capable of inhibiting an exon inclusion signal present in another exon of the dystrophin pre-mRNA.
49. A method for determining whether a compound is able specifically inhibit an exon inclusion signal of an exon of a dystrophin pre-mRNA, the exon being selected from the group consisting of exon number 2, 8, 29, 43, 44, 45, 46, 50, 51, 52, or 53 and combinations thereof of the dystrophin pre-mRNA, wherein the compound has complementarity to a part of the selected exon, the method comprising:
- providing a cell having a dystrophin pre-mRNA containing the exon with the compound,
- culturing the cell to allow the formation of an mRNA from the dystrophin pre-mRNA, and
- determining whether the exon is absent from the mRNA.
50. The method according to claim 49 further comprising determining in vitro the relative binding affinity of the compound to an RNA molecule comprising the exon.
51. A compound identified by the method according to claim 49.
52. A nucleic acid delivery vehicle comprising the compound of claim 51, or the complement thereof.
53. A nucleic acid delivery vehicle comprising the compound of claim 51.
54. A method for directing splicing of a dystrophin pre-mRNA in a subject, the method comprising:
- administering to the subject the compound of claim 51.
55. A method for directing splicing of a dystrophin pre-mRNA in a subject, the method comprising administering to the subject the nucleic acid delivery vehicle of claim 52.
56. A method for directing splicing of a dystrophin pre-mRNA in a subject, the method comprising:
- administering to the subject an antisense-oligonucleotide, having between 14-40 nucleotides, and having complementarity to an element located within an exon in the pre-mRNA, the exon being selected from the group consisting of exon number 2, 8, 29, 43, 44, 45, 46, 50, 51, 52, or 53 and combinations thereof of a dystrophin gene encoding an aberrant protein,
- wherein the antisense-oligonucleotide specifically inhibits and interferes with an exon inclusion signal of the exon in the pre-mRNA, thus forming a final mRNA excluding the exon, but encoding a mutant dystrophin protein having Becker mutant's functionality.
57. The method according to claim 56, wherein the antisense-oligonucleotide that specifically inhibits and interferes with an exon inclusion signal of the exon in the pre-mRNA is obtainable by a method comprising:
- providing a cell with the antisense-oligonucleotide, the cell having a pre-mRNA containing the exon, culturing the cell to form mRNA in the cell from the pre-mRNA in the cell, and determining whether the exon is absent from the thus formed mRNA in the cell.
58. The method according to claim 56, wherein the antisense-oligonucleotide contains between 15-25 nucleotides.
59. A non-human animal provided with the compound of claim 51.
60. The non-human animal of claim 59, further comprising a nucleic acid encoding a human protein.
61. The non-human animal of claim 60, further comprising a silencing mutation in a gene encoding an animal homologue of the human protein.
62. A composition comprising:
- a nucleic acid or a functional equivalent thereof capable of inhibiting an exon inclusion signal in exon 2, 8, 29, 43, 44, 45, 46, 50, 51 or 53 of a dystrophin pre-mRNA, and having between 14-40 nucleotides.
63. The composition of claim 62, further comprising:
- a further nucleic acid or a functional equivalent thereof capable of inhibiting an exon inclusion signal present in another exon of the dystrophin pre-mRNA.
64. The composition of claim 62, wherein the nucleic acid is an antisense-oligonucleotide containing between 15-25 nucleotides.
65. A nucleic acid delivery vehicle comprising:
- an antisense-oligonucleotide capable of inhibiting an exon-inclusion signal in at least one of exons 2, 8, 29, 43, 44, 45, 50, 51, 52 or 53 of a dystrophin pre-mRNA, wherein the antisense-oligonucleotide contains between 14-40 nucleotides, or
- the complement of said antisense-oligonucleotide.
66. The nucleic acid delivery vehicle of claim 65, wherein the antisense-oligonucleotide contains between 15-25 nucleotides.
67. An antisense-oligonucleotide comprising one a nucleic acid sequence selected from the group consisting of hAON#4: 5′ CTGCTTCCTCCAACC, (SEQ ID NO: _) hAON#6: 5′ GTTATCTGCTTCCTCCAACC, (SEQ ID NO: _) hAON#8: 5′ GCTTTTCTTTTAGTTGCTGC, (SEQ ID NO: _) hAON#9: 5′ TTAGTTGCTGCTCTT, (SEQ ID NO: _) hAON#11: 5′ TTGCTGCTCTTTTCC, (SEQ ID NO: _) hAON#21: 5′ CCACAGGTTGTGTCACCAG, (SEQ ID NO: _) hAON#22: 5′ TTTCCTTAGTAACCACAGGTT, (SEQ ID NO: _) hAON#23: 5′ TGGCATTTCTAGTTTGG, (SEQ ID NO: _) hAON#24: 5′ CCAGAGCAGGTACCTCCAACATC, (SEQ ID NO: _) hAON#25: 5′ GGTAAGTTCTGTCCAAGCCC, (SEQ ID NO: _) hAON#26: 5′ TCACCCTCTGTGATTTTAT, (SEQ ID NO: _) hAON#27: 5′ CCCTCTGTGATTTT, (SEQ ID NO: _) hAON#28: 5′ TCACCCACCATCACCCT, (SEQ ID NO: _) hAON#29: 5′ TGATATCCTCAAGGTCACCC, (SEQ ID NO: _) hAON#30: 5′ CTGCTTGATGATCATCTCGTT, (SEQ ID NO: _) a functional part of any thereof, derivative of any thereof, and analogue of any thereof having the same exon skipping activity in kind, but not necessarily in amount.
68. The antisense-oligonucleotide of claim 67, containing between 14-40 nucleotides.
69. A nucleic acid delivery vehicle capable of expressing the antisense-oligonucleotide of claim 67.
70. The nucleic acid delivery vehicle of claim 69, wherein the nucleic acid delivery vehicle is a single stranded virus.
71. The nucleic acid delivery vehicle of claim 70, wherein said single stranded virus comprises an adeno-associated virus.
72. A method for directing splicing of a dystrophin pre-mRNA in a subject, the method comprising administering to the subject the nucleic acid delivery vehicle of claim 53.
Type: Application
Filed: Mar 30, 2009
Publication Date: Sep 10, 2009
Applicant:
Inventors: Garrit-Jan Boudewijn van Ommen (Amsterdam), Judith Christina, T. van Deutekom (Dordrecht), Johannes Theodorus den Dunnen (Rotterdam)
Application Number: 12/383,897
International Classification: A01K 67/027 (20060101); C12N 15/87 (20060101); C12Q 1/68 (20060101); C12N 15/63 (20060101); A61K 31/7088 (20060101); C07H 21/02 (20060101);