SOCS3 EXPRESSION PROMOTER, DRUG AND FOOD CONTAINING THE SAME AND METHOD OF PROMOTING THE EXPRESSION OF SOCS3

- Q.P. CORPORATION

A SOCS3 expression promoter includes hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof as an active ingredient.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a U.S. National Stage Application of International application No. PCT/JP2009/054491, filed Mar. 10, 2009 and published in the Japanese language on Sep. 17, 2009 as WO/2009/113512. This application claims the benefit of Japanese Application No. 2008-060930, filed Mar. 11, 2008, Japanese Application No. 2008-062032, filed Mar. 12, 2008 and Japanese Application No. 2008-263610, filed Oct. 10, 2008. The disclosures of the above applications are incorporated herein by reference.

TECHNICAL FIELD

The present invention relates to a SOCS3 expression promoter, a drug and a food containing the same, and a method of promoting expression of SOCS3.

The invention also relates to a pleiotrophin expression inhibitor, a drug and a food containing the same, and a method of inhibiting expression of pleiotrophin.

BACKGROUND ART

In recent years, the number of patients who suffer inflammatory diseases has increased due to a rapid change in eating habits and life style. Examples of inflammatory diseases include autoimmune diseases. The term “autoimmune disease” is a generic name for diseases accompanying a symptom in which the immune system that recognizes and eliminates foreign matter such as bacteria, viruses, and tumors makes an overactive response to and attacks normal cells and tissues. Autoimmune diseases are considered to be caused by abnormalities in immunocompetent cells such as T-cells, B-cells, and macrophages.

The symptoms of most of the autoimmune diseases are chronic and refractory. In Japan, many autoimmune diseases are included in specific diseases for which medical expenses are paid by the government. The treatment method differs depending on the disease. Since immunopathy is the cause of autoimmune diseases, steroids and an immunosuppressive drug are used as first-line drugs for many diseases. However, since these drugs cause side effects, an immunopathy-improving drug that causes little side effects has been desired.

WO2002-074318 discloses that high-molecular-weight hyaluronic acid suppresses expression of interleukin 12 that promotes inflammation. Interleukin 12 is a cytokine that promotes inflammation in autoimmune diseases. However, since autoimmune diseases develop various symptoms in various areas, it is difficult to achieve an overall improvement of autoimmune diseases by controlling a single cytokine.

Further examples of inflammatory diseases include arthritis. Autoimmune arthritis is one of the autoimmune diseases. It has been reported that suppressor of cytokine signaling 3 (SOCS3) that adjusts signaling through a cytokine significantly reduced destruction of bones that is observed in autoimmune arthritis for this autoimmune arthritis (Takanori Shouda, Takafumi Yoshida, Toshikatsu Hanada, Toru Wakioka, Masanobu Oishi, Kanta Miyoshi, Setsuro Komiya, Ken-ichiro Kasai, Yasushi Hanakawa, Koji Hashimoto, Kensei Nagata, and Akihiko Yoshimura, “Induction of the cytokine signal regulator SOCS3/CIS3 as a therapeutic strategy for treating inflammatory arthritis”, J. Clin. Invest., Vol. 108, No. 12, pp. 1781-1788, December 2001). The above document suggests that cytokine signaling is inhibited due to promotion of expression of SOCS3 so that autoimmune arthritis may be improved. It is considered that SOCS3 is strongly expressed in chronic inflammatory diseases such as human colitis or arthritis (Hiromi Takagi, Takahito Sanada, Yasumasa Minoda, and Akihiko Yoshimura, “Control of cytokines and Toll-like receptor signals by SOCS”, Nippon Rinsho, Vol. 62, No. 12 (2004-12), pp. 2189-2196).

It has also been reported that SOCS3 indirectly controls Toll-like receptors in innate immune cells (Andrea Baetz, Markus Frey, Klaus Heeg, and Alexander H. Dalpke, “Suppressor of Cytokine Signaling (SOCS) Proteins Indirectly Regulate Toll-like Receptor Signaling in Innate Immune Cells”, J. Biol. Chem., Vol. 279, Issue 52, pp. 54708-54715, Dec. 24, 2004).

Therefore, it is considered that inflammatory diseases can be treated or prevented by promoting expression of SOCS3. However, regulation of expression of SOCS3 in inflammatory diseases has not been extensively studied.

DISCLOSURE OF THE INVENTION

Accordingly, an object of the invention is to provide a SOCS3 expression promoter that achieves an overall improvement in inflammatory diseases, a drug and a food containing the same, and a method of promoting expression of SOCS3.

Another object of the invention is to provide a pleiotrophin expression inhibitor that achieves an overall improvement in inflammatory diseases, a drug and a food containing the same, and a method of inhibiting expression of pleiotrophin.

The inventors of the invention conducted extensive studies on expression of SOCS3, and found that expression of SOCS3 is promoted via intake of hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof. This finding has led to the completion of the invention.

According to one aspect of the invention, there is provided a SOCS3 expression promoter comprising hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof as an active ingredient.

According to another aspect of the invention, there is provided a drug comprising the above SOCS3 expression promoter as an active ingredient. In this case, the hyaluronic acid and/or a salt thereof may have an average particle diameter of 50 to 500 micrometers. The above drug may be orally administered (taken). The above drug may be used to treat a knee joint or relieve knee pain.

According to another aspect of the invention, there is provided a food comprising the above SOCS3 expression promoter.

According to another aspect of the invention, there is provided a method of promoting expression of SOCS3 in a human or an animal other than a human, the method comprising orally administering hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof to a human or an animal other than a human.

According to another aspect of the invention, there is provided a pleiotrophin expression inhibitor comprising hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof as an active ingredient.

According to another aspect of the invention, there is provided a drug comprising the above pleiotrophin expression inhibitor as an active ingredient. In this case, the hyaluronic acid and/or a salt thereof may have an average particle diameter of 50 to 500 micrometers. The above drug may be orally administered (taken). The above drug may be used to treat a knee joint or relieve knee pain.

According to another aspect of the invention, there is provided a food comprising the above pleiotrophin expression inhibitor.

According to another aspect of the invention, there is provided a method of inhibiting expression of pleiotrophin in a human or an animal other than a human, the method comprising orally administering hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof to a human or an animal other than a human.

According to another aspect of the invention, there is provided a method of treating the knee joint of a human or an animal other than a human, the method comprising orally administering hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof to a human or an animal other than a human.

According to a further aspect of the invention, there is provided a method of relieving knee pain of a human or an animal other than a human, the method comprising orally administering hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof to a human or an animal other than a human.

According to the above SOCS3 expression promoter and method of promoting expression of SOCS3, expression of SOCS3 can be promoted via oral intake of hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof to achieve an overall improvement in inflammatory diseases. According to the above pleiotrophin expression inhibitor and method of inhibiting expression of pleiotrophin, expression of pleiotrophin can be inhibited via oral intake of hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof to achieve an overall improvement in inflammatory diseases.

Therefore, a drug and a food for improving inflammatory diseases that cause no or only a slight side effect can be provided, and hyaluronic acid and/or a salt thereof is expected to be utilized in various fields.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows an electrophoresis photograph showing expression of SOCS3 genes using RT-PCR (Example 1). The photograph shows the results for the distilled water intake group, the sample A intake group, and the sample B intake group (from left to right).

FIG. 2 shows a photograph of the surface of the epithelium of the small intestine of the mouse that orally took hyaluronic acid or a salt thereof (Example 1).

FIG. 3 shows a photograph of the surface of the epithelium of the large intestine of the mouse that orally took hyaluronic acid or a salt thereof (Example 1).

FIG. 4 shows a photograph of the surface of the epithelium of the large intestine of the mouse that orally took hyaluronic acid or a salt thereof (after double staining) (Example 1).

FIG. 5 shows a photograph of the cervical lymph node of the mouse that orally took distilled water or the hyaluronic acid sample (Example 1).

FIG. 6 shows an electrophoresis photograph showing expression of SOCS3 genes using RT-PCR (Example 2). The photograph shows the results for no addition, the sample A, and the sample B (from left to right).

FIG. 7 shows the results (soft X-ray photography score) that indicate that narrowing of the fissure of the knee joint of the STR mouse that was orally administered the hyaluronic acid of Test Example 4 or 5 was significantly suppressed as compared with the control (distilled water) (Example 10). No significant difference was observed between Comparative Test Example 2 (chondroitin sulfate) and the control.

FIG. 8 shows a soft X-ray photograph (Example 10). A white arrow indicates the joint fissure. In FIG. 8, while narrowing of the joint fissure occurred in the control group (A), narrowing of the joint fissure of Test Example 4 (B) and Test Example 5 (C) (hyaluronic acid was orally administered) was suppressed. No significant difference was observed between Comparative Test Example 2 (D) and the control.

FIG. 9 is illustrative of the method of evaluating the cartilage of the knee joint using the India ink method (Example 10). The method shown in FIG. 9 evaluates roughening of the surface of the cartilage.

FIG. 10 shows evaluation of the cartilage of the knee joint using the India ink method (Example 10). FIG. 10 shows the cartilage roughening index that indicates that roughening of the cartilage was significantly suppressed in Test Example 4 or 5 (hyaluronic acid was orally administered) as compared with the control. No significant difference was observed between Comparative Test Example 2 and the control.

FIG. 11 shows a photograph of the surface of the cartilage of the knee joint stained by the India ink method (Example 10). In FIG. 11, while the surface of the cartilage was stained with the India ink in the control group (A), the staining area of Test Example 4 (B) and Test Example 5 (C) (hyaluronic acid was orally administered) was small (i.e., roughening of the cartilage was suppressed). The surface of the cartilage was stained in Comparative Test Example 2 (D) in the same manner as in the control. A white arrow indicates the ligament, which was not counted.

FIG. 12 shows the results (knee joint synovial membrane evaluation score) that indicate that activation of the synovial membrane and cell growth were suppressed in Test Example 4 or 5 (hyaluronic acid was orally administered) as compared with the control. No significant difference in synovial membrane evaluation score was observed between Comparative Test Example 2 and the control.

 BEST MODE FOR CARRYING OUT THE INVENTION

A SOCS3 expression promoter, a drug and a food containing the SOCS3 expression promoter, a method of promoting expression of SOCS3, a pleiotrophin expression inhibitor, a drug and a food containing the pleiotrophin expression inhibitor, and a method of inhibiting expression of pleiotrophin according to embodiments of the invention are described below.

Note that the unit “%” used herein refers to “mass %”.

1. SOCS3 Expression Promoter, Drug and Food Containing the Same, and Method of Promoting Expression of SOCS3 1.1. SOCS3 Expression Promoter

A SOCS3 expression promoter according to one embodiment of the invention includes hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof as an active ingredient.

The term “hyaluronic acid” used herein refers to a polysaccharide that includes at least one repeating unit formed of glucuronic acid and N-acetylglucosamine. The hyaluronic acid salt is not particularly limited. The hyaluronic acid salt is preferably an edible salt or a pharmaceutically acceptable salt. Examples of the hyaluronic acid salt include a sodium salt, a potassium salt, a calcium salt, a zinc salt, a magnesium salt, an ammonium salt, and the like of hyaluronic acid.

The hyaluronic acid and/or a salt thereof used for the SOCS3 expression promoter according to one embodiment of the invention has an average molecular weight of 500,000 or more, preferably 600,000 or more, more preferably 500,000 to 1,600,000, and still more preferably 600,000 to 1,600,000. If the average molecular weight of the hyaluronic acid and/or a salt thereof is less than 500,000, the symptom of an inflammatory disease may not be improved, or the functions of the immune system may decrease. If the average molecular weight of the hyaluronic acid and/or a salt thereof is more than 1,600,000, the hyaluronic acid and/or a salt thereof may not exhibit a sufficient effect, or it may be difficult to mix the hyaluronic acid and/or a salt thereof with a food or the like due to low solubility.

The average molecular weight used herein is measured as follows.

Specifically, about 0.05 g of purified hyaluronic acid is weighed, and dissolved in a 0.2 mol/l sodium chloride solution to prepare a 100 mL of the resulting solution. A 0.2 mol/l sodium chloride solution is added to 8 mL, 12 mL, or 16 mL of the resulting solution to prepare each of the total amount of 20 mL solutions. The each 20 mL solution and the resulting solution are used as sample solutions. The specific viscosity of each of the sample solutions and a 0.2 mol/l sodium chloride solution is measured at 30.0±0.1° C. by the viscosity measurement method (first method (capillary viscosity measurement method)) of the general tests of Japanese Pharmacopoeia (14th edition) (see expression (1)), and the reduced viscosity at each concentration is calculated (see expression (2)). The reduced viscosity (vertical axis) and the dry matter concentration (g/100 mL) (horizontal axis) are plotted on a graph, and the limiting viscosity is calculated from the intersection point of a straight line that connects each point and the vertical axis. The limiting viscosity thus calculated is substituted into the Laurent's formula ((3)) to calculate the average molecular weight (T. C. Laurent, M. Ryan, and A. Pietruszkiewicz, B. B. A., 42, 476-485 (1960)).


Specific viscosity=[(falling time of sample solution)/(falling time of 0.2 mol/l sodium chloride solution)]−1  (1)


Reduced viscosity=specific viscosity/(dry matter concentration (g/100 mL))  (2)


Limiting viscosity=3.6×10−4M0.78  (3)

M: average molecular weight

The hyaluronic acid included in the SOCS3 expression promoter according to one embodiment of the invention is basically a di- or higher saccharide that includes at least one disaccharide unit in which the 1-position of beta-D-glucuronic acid is bonded to the 3-position of beta-D-N-acetylglucosamine, and is basically formed by beta-D-glucuronic acid and beta-D-N-acetylglucosamine. The hyaluronic acid may be a saccharide in which a plurality of disaccharide units are bonded, derivative thereof that includes a hydrolyzable protecting group (e.g., acyl group), or the like. The saccharide may be an unsaturated saccharide. Examples of the unsaturated saccharide include non-reducing end saccharides, a saccharide in which an unsaturated bond is formed between the 4-position carbon atom and the 5-position carbon atom of glucuronic acid, and the like.

The hyaluronic acid and/or a salt thereof may be extracted from a natural product (e.g., living tissues such as cockscomb, umbilical cord, skin, or joint fluid), may be obtained by culturing microorganisms or animal cells (e.g., fermentation using Streptococcus microorganisms), or may be chemically or enzymatically synthesized, for example.

The hyaluronic acid used for the SOCS3 expression promoter according to one embodiment of the invention may be a commercially available product, or may be produced by the following production method 1 or 2.

1.1.1. Production Method 1 (Extraction from Cockscomb)

First, a cockscomb is subjected to a heat treatment. This heat treatment is performed to thermally denature proteins or inactivate enzymes contained in the cockscomb. The heat treatment may be performed by an arbitrary method. The heat treatment may be efficiently performed by immersing the cockscomb in hot water. The heating temperature and the heating time are not particularly limited insofar as proteins contained in the cockscomb are denatured, or enzymes contained in the cockscomb are inactivated. When using a hot water heating method, the raw material may be immersed in hot water at 60 to 100° C. for 20 to 90 minutes.

When using a frozen cockscomb, the frozen cockscomb may be directly subject to the heat treatment. Note that it is preferable to slowly defrost the frozen cockscomb with running water or the like, and then subject the cockscomb to the heat treatment. This makes it possible to easily obtain a material of constant quality.

A paste is prepared using the cockscomb subjected to the heat treatment. This improves the yield of hyaluronic acid. A paste is easily prepared by thinly cutting the cockscomb subjected to the heat treatment using a cutting machine, or cutting the cockscomb subjected to the heat treatment using a chopper, for example. A paste may be prepared by adding freshwater to the cockscomb in an amount about 1 to 5 times the amount of the cockscomb, and homogenizing the mixture for 10 to 60 minutes using a homogenizer to finely crush/grind the cockscomb, for example. Note that a high-speed stirrer or a mill may be used instead of a homogenizer.

The cockscomb paste is then subjected to an acid treatment or an alkali treatment by adding acid (e.g., hydrochloric acid or sulfuric acid) or alkali (sodium hydroxide or potassium hydroxide) to reduce the molecular weight of the hyaluronic acid so that the resulting hyaluronic acid has an average molecular weight of 500,000 or more. The molecular weight of the hyaluronic acid may be adjusted by appropriately adjusting the concentration of acid or alkali, the amount of acid or alkali, the treatment time, and the like. It is preferable to use the alkali treatment that allows the molecular weight of the hyaluronic acid to be easy controlled. When using the alkali treatment, an alkaline solution having a concentration of 10 to 30% is added to the cockscomb paste in an amount of about 1 to 5% based on the amount of cockscomb. The cockscomb is treated at 25 to 70° C. for about 15 to 90 minutes, and neutralized with hydrochloric acid or the like to adjust the molecular weight of the hyaluronic acid, for example.

The raw material of which the molecular weight has been adjusted is then subjected to a protease treatment. An arbitrary commercially available protease may be used for the protease treatment. Examples of the protease include pepsin, trypsin, papain, bromelain, and the like. The protease is preferably added in an amount of 0.01 to 1% based on the amount of cockscomb. The protease treatment temperature is 35 to 65° C., and the protease treatment time is 1 to 10 hours.

Crude hyaluronic acid is preparatively isolated from the resulting product, and purified to obtain hyaluronic acid having a purity of 90% or more and an average molecular weight of 500,000 or more.

The hyaluronic acid may be isolated and purified by a normal method. For example, a solid is removed by filtering the raw material subjected to the protease treatment to obtain a filtrate containing crude hyaluronic acid. Note that the raw material subjected to the protease treatment may be treated with activated carbon before filtering the raw material in order to achieve deodorization or decolorization or remove hydrolyzed proteins. After dissolving salt in the filtrate, ethanol is added to the solution to precipitate hyaluronic acid, and the precipitate is preparatively isolated. After the addition of aqueous ethanol having an ethanol concentration of about 80 to 95 vol %, the precipitate is washed with aqueous ethanol using a homogenizer, and the precipitate is preparatively isolated. After repeating the washing operation about 2 to 10 times, the precipitate is again preparatively isolated and dried to obtain a hyaluronic acid of Production Example 1.

1.1.2. Production Method 2 (Microorganism Fermentation)

Activated carbon is added to a culture solution of hyaluronic acid-producing Streptococcus Zoopidemicus to effect deodorization and decolorization, followed by filtration. After dissolving salt in the filtrate, ethanol is added to the solution to precipitate hyaluronic acid, and the precipitate is preparatively isolated. After the addition of aqueous ethanol having an ethanol concentration of about 80 to 95 vol %, the precipitate is washed with aqueous ethanol using a homogenizer, and the precipitate is preparatively isolated. After repeating the washing operation about 2 to 10 times, the precipitate is again preparatively isolated and dried to obtain hyaluronic acid (average molecular weight: 500,000 or more) of Production Example 2.

It suffices that the hyaluronic acid used in the invention have a purity that allows the hyaluronic acid to be used for a drug or food. The purity of the hyaluronic acid is preferably 90% or more, and more preferably 95% or more. The purity of the hyaluronic acid used herein refers to a value calculated by subtracting the content of impurities other than the hyaluronic acid from 100%. Examples of impurities include hydrolyzed proteins, fats (crude fats), chondroitin sulfate, and the like. The purity of hyaluronic acid obtained from a cockscomb (raw material) is calculated by the following expression (4).


Purity (%) of hyaluronic acid=100−hydrolyzed protein content (%)−crude fat content (%)−chondroitin sulfate content (%)  (4)

In the expression (4), the hydrolyzed protein content (%) is a value determined by the Lowry method, the crude fat content (%) is a value determined in accordance with New Food Analysis Methods (Korin Publishing Co., Ltd.), “Chapter 1—General and related ingredients, 1-4 Lipids, 1-4-2 Ether extraction method”, and the chondroitin sulfate content (%) is a value determined by the following method.

Specifically, the hyaluronic acid is dried. 50 mg of the hyaluronic acid is accurately weighed. Purified water is added to the hyaluronic acid so that the total amount of the solution is 100 mL to obtain a test solution. 4 mL of the test solution is put into a test tube. After the addition of 1 mL of a 0.5 mol/l sulfuric acid, the components are mixed. The mixture is heated for 10 minutes in a water bath, and then cooled. After the addition of 0.2 mL of 0.04 mol/l cetyltrimethylammonium bromide to the resulting solution, the components are mixed, and allowed to stand at room temperature for one hour. The absorbance at a wavelength of 660 nm (path length: 10 mm) is then measured.

The resulting absorbance data is applied to a calibration curve of chondroitin sulfate to determine the chondroitin sulfate content (o) in the purified hyaluronic acid. The calibration curve is prepared as follows. A chondroitin sulfate A sodium salt derived from whale cartilage (special grade (SG) manufactured by Seikagaku Corporation) is dried (under reduced pressure, phosphorus pentaoxide, 60° C., 5 hours), and accurately weighed. Purified water is added to the chondroitin sulfate A sodium salt to prepare a solution that contains the chondroitin sulfate A sodium salt in an amount of 10, 20, 30, or 40 micrograms/mL. After the addition of 1 mL of a 0.5 mol/l sulfuric acid, the components are mixed. After the addition of 1 mL of 0.04 mol/l cetyltrimethylammonium bromide, the components are mixed, and allowed to stand at room temperature for one hour. The absorbance is then measured in the same manner as described above. The absorbance (vertical axis) and the corresponding concentration (micrograms/mL) of the chondroitin sulfate A sodium salt solution (horizontal axis) are plotted on a graph to obtain a calibration curve.

A promotion effect on expression of SOCS3 in the cells or tissues of a human or an animal other than a human may be confirmed by known biochemical analysis such as detection or quantitative determination of SOCS3 genes using northern blotting, a DNA array, a DNA chip, or the like, or detection or quantitative determination of SOCS3 using western blotting, ELISA, affinity chromatography, or the like.

The SOCS3 expression promoter according to one embodiment of the invention normally includes the hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof in an amount of 0.1 mass % or more, and preferably 0.5 to 100 mass %.

The hyaluronic acid and/or a salt thereof preferably has an average particle diameter of 50 to 500 micrometers, more preferably 80 to 500 micrometers, and still more preferably 200 to 500 micrometers.

If the hyaluronic acid having an average molecular weight of 500,000 or more (preferably 600,000 or more, and more preferably 600,000 to 1,600,000) and/or a salt thereof (hereinafter may be referred to as “hyaluronic acid”) has an average particle diameter of 50 to 500 micrometers, the powdery hyaluronic acid and/or a salt thereof that has been orally administered is dissolved in gastric juices at an appropriate rate. This suppresses hydrolysis of the hyaluronic acid in gastric juices so that the hyaluronic acid is absorbed through the intestine while maintaining a given molecular weight, and reaches the affected area. If the average particle diameter of the hyaluronic acid is less than 50 micrometers, the hyaluronic acid may be promptly dissolved and hydrolyzed in gastric juices so that the molecular weight of the hyaluronic acid may decrease. Hyaluronic acid having a reduced molecular weight (e.g., 500,000 or less) may not improve the symptom of an inflammatory disease, or decrease the functions of the immune system. If the average particle diameter of the hyaluronic acid is more than 500 micrometers, the hyaluronic acid may not be completely dissolved in the body, so that the amount of absorption may decrease as compared with the intake. As a result, a sufficient effect for improving the symptom of an inflammatory disease may not be obtained.

The average particle diameter of the hyaluronic acid and/or a salt thereof used herein refers to a value measured by a laser diffraction-scattering method. The average particle diameter of the hyaluronic acid and/or a salt thereof may be adjusted by grinding, sieving, or the like.

1.2. Drug

A drug according to one embodiment of the invention includes the SOCS3 expression promoter according to one embodiment of the invention as an active ingredient. Specifically, the drug according to one embodiment of the invention may include the SOCS3 expression promoter according to one embodiment of the invention in an amount of 5 to 100 mass %.

The drug according to one embodiment of the invention promotes expression of SOCS3 in a human or an animal other than a human by oral administration of the hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof to a human or an animal other than a human. This improves the symptom of a patient (human or animals other than human) with an inflammatory disease (e.g., a pathological condition selected from the group consisting of rheumatoid arthritis (RA); asthma; an allergic disorder (e.g., rhinitis); a vascular disease; thrombosis or adverse platelet aggregation; reocclusion after thrombolysis; reperfusion injury; an inflammatory skin disease (e.g., psoriasis, eczema, contact dermatitis, or atopic dermatitis); diabetes (e.g., insulin-dependent diabetes mellitus or autoimmune diabetes); multiple sclerosis; systemic lupus erythematosus (SLE); an inflammatory intestinal disease (e.g., ulcerative colitis, Crohn's disease (local enteritis), or pouchitis (e.g., intestinal disease after proctocolectomy and eoanal anastomosis); an intestinal disease related to a coeliac disease, non-tropical sprue, or serologic reaction-negative arthropathy, or a disease in which leukocyte infiltration to the gastrointestinal tract is involved (e.g., lymphocytic or collagenous colitis or eosinophilic gastroenteritis); a disease related to leukocyte infiltration to epithelial tissues (e.g., skin, urinary tract, airway, or joint synovial membrane); pancreatitis; mastitis (mammary gland); hepatitis; cholecystitis; cholangitis or pericholangitis (tissues around the bile duct and the liver); bronchitis; sinusitis; inflammatory lung disease that causes interstitial fibrosis such as hypersensitivity pneumonia; a collagen disease; sarcoidosis; osteoporosis; osteoarthrosis; atherosclerosis; a neoplastic disease including neoplasm metastasis or cancerous growth; injury (injury recovery enhancement); retinodialysis or allergic conjunctivitis; an eye disease (e.g., autoimmune or uveitis); Sjogren syndrome; (chronic or acute) rejection after organ transplant; a host-versus-graft or graft-versus-host disease; intimal hyperplasia; arteriosclerosis (including graft arteriosclerosis); post-operative reinfarction or restenosis (e.g., after percutaneous transluminal angioplasty (PTCA) or percutaneous transluminal coronary recanalization); nephritis; tumor angiogenesis; malignant tumor; multiple myeloma; myeloma-induced bone resorption; septicemia; central nervous system injury (e.g., stroke, traumatic brain injury, or spinal cord injury); and Meniere's disease). In particular, an autoimmune disease such as rheumatoid arthritis (RA) or a collagen disease, and arthritis such as knee osteoarthritis can be significantly improved, and knee pain can be relieved by the drug according to one embodiment of the invention. Examples of an animal other than a human include mammals other than a human.

An inflammatory disease can be improved by orally administering the hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof to a human or an animal other than a human, while preventing pain, tumescence, oedema, rubor, heat sensation, heaviness, or numbness that may occur when employing local administration, for example.

1.3. Food

A food according to one embodiment of the invention includes the SOCS3 expression promoter according to one embodiment of the invention. Specifically, the food according to one embodiment of the invention may include the SOCS3 expression promoter according to one embodiment of the invention in an amount of 0.1 to 100 mass %.

Since a patient with the above inflammatory disease can comfortably take the food (food or drink) according to one embodiment of the invention over a long time, the symptom of the inflammatory disease can be relieved or improved as the treatment or an adjunct in the treatment of the inflammatory disease.

A mechanism by which expression of SOCS3 is promoted by oral administration of the hyaluronic acid and/or a salt thereof is not necessarily clarified. Since hyaluronic acid was observed on the surface of the epithelium of the intestine of the mouse that was orally administered the hyaluronic acid or a salt thereof (refer to FIGS. 2 and 3), and the localization of TLR-4 (i.e., a receptor on the surface of the intestinal epithelium coincided with the localization of the hyaluronic acid (refer to FIG. 4), it is estimated that the hyaluronic acid and/or a salt thereof promotes expression of SOCS3 through the receptor on the surface of the intestinal epithelium.

The drug according to one embodiment of the invention may include raw materials other than the hyaluronic acid and/or a salt thereof (i.e., SOCS3 expression promoter) insofar as the effects of the invention are not impaired. Examples of the raw materials other than the hyaluronic acid and/or a salt thereof include water, a diluting agent, an antioxidant, a preservative, a humectant, a viscous agent, a buffer, an adsorbent, a solvent, an emulsifying agent, a stabilizer, a surfactant, a lubricant, a water-soluble polymer, a sweetener, a flavoring substance, an acidifier, an alcohol, and the like.

The dosage form of the drug according to one embodiment of the invention is not particularly limited. When orally administering the drug, the drug may be in the form of an oral drug such as a solid preparation (e.g., tablet, powder, subtle granules, granules, capsule, or pill) or a liquid preparation such as a mixture, a suspension, a syrup, or an emulsion.

The food according to one embodiment of the invention includes the hyaluronic acid and/or a salt thereof (i.e., SOCS3 expression promoter) as an active ingredient. The form of the food is not particularly limited. Examples of the form of the food include general foods such as gum, candy, gummy candy, troches, jelly beverages, rice products, bread, retort (canned) foods, frozen foods, daily dishes, dry foods, seasonings such as mayonnaise, beverages, cakes, desserts, and supplements, and general foods for specified health use for which use of health claims is allowed. Among these, supplements are preferable from the viewpoint of convenience.

Examples of the form of the supplements include a solid (e.g., tablet, powder, subtle granules, granules, or capsule (hard capsule or soft capsule), a liquid, a suspension, a jelly, syrup, and the like.

Expression of SOCS3 is promoted, and the symptom of an inflammatory disease is relieved by oral intake of the above food. The above food may be added to or mixed in a meal of a patient with an inflammatory disease.

The food according to one embodiment of the invention may be added to an arbitrary food or drink. In order to alleviate the symptom of an inflammatory disease, it is desirable to continuously take the SOCS3 expression promoter according to one embodiment of the invention. Therefore, it is desirable to add the SOCS3 expression promoter according to one embodiment of the invention to a daily food or drink.

Since the hyaluronic acid and/or a salt thereof is a biological substance, it is considered that intake of a large amount of hyaluronic acid and/or a salt thereof does not cause side effects or causes side effects to only a small extent. The hyaluronic acid and/or a salt thereof may be administered as a drug in an amount of 10 to 1000 mg/day, and preferably 100 to 500 mg/day. The hyaluronic acid and/or a salt thereof may be administered one or more times per day depending on the condition. The hyaluronic acid and/or a salt thereof may be taken as a food in an amount of 1 to 1000 mg/day, and preferably 15 to 300 mg/day. When producing a drink that contains the hyaluronic acid and/or a salt thereof according to the present invention, the drink may contain the SOCS3 expression promoter in an amount of 0.001 to 1 wt %, and preferably 0.01 to 0.5 wt %.

2. Pleiotrophin Expression Inhibitor, Drug and Food Containing the Same, and Method of Inhibiting Expression of Pleiotrophin

A pleiotrophin expression inhibitor according to one embodiment of the invention includes the above hyaluronic acid and/or a salt thereof as an active ingredient. Specifically, the hyaluronic acid and/or a salt thereof included in the pleiotrophin expression inhibitor according to one embodiment of the invention has an average molecular weight of 500,000 or more, and may be the same as the hyaluronic acid and/or a salt thereof illustrated in the section entitled “SOCS3 expression promoter”.

It has been reported that expression of pleiotrophin is promoted by the onset of autoimmune encephalomyelitis (Liu X, Mashour G A, Webster H F, Kurtz A, “Basic FGF and FGF receptor1 are expressed in microglia during experimental autoimmune encephalomyelitis: temporally distinct expression of midkine and pleiotrophin”, Glia., 24, pp. 390-397, 1998). It has also been reported that expression of pleiotrophin is promoted by the onset of an inflammatory disease such as rheumatism (Pufe T, Bartscher M, Petersen W, Tillmann B, Mentlein R, “Expression of pleiotrophin, an embryonic growth and differentiation factor, in rheumatoid arthritis”, Arthritis Rheum., 48, pp. 660-667, 2003).

Since the pleiotrophin expression inhibitor according to one embodiment of the invention includes the hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof as an active ingredient, expression of pleiotrophin can be inhibited by oral administration of the pleiotrophin expression inhibitor, for example.

Inhibition of expression of pleiotrophin may be evaluated by the degree of expression of pleiotrophin genes determined using a DNA array (refer to the examples described later), for example.

Examples of a drug and a food including the pleiotrophin expression inhibitor according to one embodiment of the invention and the amount of the pleiotrophin expression inhibitor include those described above in connection with the drug and the food including the SOCS3 expression promoter.

A method of inhibiting expression of pleiotrophin according to one embodiment of the invention includes orally administering the hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt to a human or an animal other than a human.

3. Knee Pain-Relieving Agent

The drug or the food according to one embodiment of the invention may be used to relieve knee pain. The hyaluronic acid and/or a salt thereof may be the same as those described above.

3.1. Background

The number of persons who suffer knee pain due to aging or obesity has increased. Knee pain occurs due to various causes. In particular, knee osteoarthritis (i.e., inflammation occurs in the knee due to wear of the cartilage that functions as a knee joint cushion, and the joint may be deformed with the progress of the disease) is a serious problem.

A person who suffers knee osteoarthritis initially feels a pain when moving the knee (e.g., standing up), and also feels a pain when walking on level ground or sleeping. This imposes significant restrictions on life and daily activities.

Knee osteoarthritis is treated by utilizing an antiphlogistic analgesic that suppresses pain due to inflammation, or injecting sodium hyaluronate into the joint. Muscle-strengthening therapy or physiotherapy (e.g., hyperthermia therapy) may also be used. However, when relief of the symptom cannot be expected by such conservative medical management, a surgical procedure such as osteotomy or joint replacement surgery is employed. The patients are mentally and physically burdened by these measures.

Therefore, it is desired to relieve or reduce the pain due to knee osteoarthritis by oral intake of a drug or a food. U.S. Pat. No. 6,607,745 discloses a method of relieving joint pain, etc. due to knee osteoarthritis by orally administering hyaluronic acid, a salt thereof, or a digest thereof in an amount of 0.1 to 400 micrograms/kg. However, U.S. Pat. No. 6,607,745 does not discloses the molecular weight of effective hyaluronic acid or a salt thereof, and an outcome when administering the hyaluronic acid or a salt thereof.

3.2. Method of Relieving Knee Pain

The inventors of the invention orally administered a given amount of hyaluronic acid having a given molecular weight or a salt thereof to subjects suffering knee pain. The inventors observed a change in subjective symptom based on a medical index, and found that pain and stiffness significantly decreased within four weeks. The inventors further found that the daily life, daily activities, and health conditions are also improved. These findings have led to the completion of the invention.

A knee pain-relieving agent according to one embodiment of the invention includes hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof as an active ingredient. The term “knee pain” includes pain due to knee osteoarthritis. A method of relieving knee pain according to one embodiment of the invention includes orally administering hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof (e.g., in an amount of 60 to 300 mg/day).

Knee pain can be relieved while improving the daily life and activities by orally administering a given amount of the knee pain-relieving agent according to one embodiment of the invention that includes the hyaluronic acid having a given molecular weight and/or a salt thereof as an active ingredient and is contained in a drug or a food.

The knee pain-relieving agent according to one embodiment of the invention may be used in an arbitrary manner. For example, the knee pain-relieving agent may be used in the form of a powder, granules, a high-concentration liquid, a low-concentration liquid, or the like. It is preferable that the knee pain-relieving agent be a dry product rather than a liquid product from the viewpoint of the stability of the molecular weight of the hyaluronic acid or a salt thereof. The content of the hyaluronic acid or a salt thereof in the knee pain-relieving agent according to one embodiment of the invention may be appropriately determined depending on the form of the knee pain-relieving agent and the amount of the knee pain-relieving agent added to a drug or a food.

The knee pain-relieving agent according to one embodiment of the invention may optionally include an extender, a binder, a lubricant, a preservative, an antioxidant, an essence, a sweetener, an acidifier, a diluting agent, and the like. The knee pain-relieving agent may also include vitamins such as vitamin C, vitamin B2, vitamin B12, and vitamin E, nutritional ingredients such as nucleic acid, chondroitin sulfate, and collagen, and minerals such as iron and zinc.

A drug or a food that includes the knee pain-relieving agent according to one embodiment of the invention may have the same composition as that of the drug or the food that includes the above SOCS3 expression promoter.

4. Knee Joint Treatment

The drug or the food according to one embodiment of the invention may be used to treat a knee joint. The above hyaluronic acid and/or a salt thereof may be used for the drug or the food.

4.1. Background

WO00/53194, JP-A-2002-348243, JP-A-2004-181121, WO2005/040224, JP-A-11-60609, JP-A-2003-160464, and JP-A-10-43286 disclose use of hyaluronic acid or a salt thereof as a knee joint therapeutic agent. However, the technologies disclosed in these documents relate to a knee joint treatment injection (i.e., a joint preparation that contains hyaluronic acid or a salt thereof as an active ingredient is injected into the knee joint), or an engineered cartilage.

Therefore, it is desired to relieve or reduce the pain due to knee osteoarthritis by oral intake of a drug or a food. U.S. Pat. No. 6,607,745, JP-A-2004-166616, JP-T-2003-530072, and JP-A-2007-314531 disclose using hyaluronic acid as a food material as a component that is considered to be effective for knee pain as a health food or a supplement.

However, U.S. Pat. No. 6,607,745 merely discloses a functional effect that knee pain is reduced by intake. JP-A-2004-166616 discloses the blood chondroitin sulfate concentration and NTx (type 1 collagen crosslinked N-telopeptide) before and after administration. Specifically, JP-A-2004-166616 merely discloses a biochemical change in parameter that does not suggest efficacy on knee osteoarthritis. JP-T-2003-530072 discloses that hyaluronic acid is considered to be effective for treating knee pain, but does not disclose clinical efficacy achieved by hyaluronic acid. JP-A-2007-314531 merely discloses the effect of hyaluronic acid on chondrocytes determined by an in vitro cellular-level test.

4.2. Knee Joint Treatment

The inventors orally administered the hyaluronic acid or a salt thereof to an STR/OrtCrlj mouse (“STR mouse”) (i.e., a mouse that spontaneously develops knee osteoarthritis), and anatomicopathologically observed the knee joint of the hind limb. A decrease in joint fissure, roughening of the cartilage, and degeneration of the knee joint synovial membrane were suppressed in a soft X-ray photograph. Specifically, it was found that the knee joint disease (particularly cartilage involvement due to knee osteoarthritis) was suppressed. This finding has led to the completion of the invention.

An oral therapeutic agent for a knee joint according to one embodiment of the invention includes the hyaluronic acid and/or a salt thereof as an active ingredient. An oral therapeutic agent for knee osteoarthritis according to one embodiment of the invention includes the hyaluronic acid and/or a salt thereof as an active ingredient. An oral therapeutic agent for knee joint cartilage according to one embodiment of the invention includes the hyaluronic acid and/or a salt thereof as an active ingredient. An oral therapeutic agent for a knee joint synovial membrane according to one embodiment of the invention includes the hyaluronic acid and/or a salt thereof as an active ingredient. A method of relieving knee pain according to one embodiment of the invention includes orally administering hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof (e.g., in an amount of 60 to 300 mg/day).

A knee joint disease can be treated by orally administering a given amount of the therapeutic agent for a knee joint according to one embodiment of the invention that includes the hyaluronic acid and/or a salt thereof as an active ingredient and is contained in a drug or a food. Daily life and activities can be improved by thus relieving pain, and facilitating walking and movement.

A drug or a food that includes the therapeutic agent for a knee joint according to one embodiment of the invention may have the same composition as that of the drug or the food that includes the above SOCS3 expression promoter.

5. Examples

The invention is further described below by way of examples. Note that the invention is not limited to the following examples.

In the following examples, the average particle diameter of a powder refers to a value measured by dispersing the powder in ethanol, and measuring the average particle diameter using an instrument “SALD-2000A” (manufactured by Shimadzu Corporation).

5.1. Example 1

In Example 1, the hyaluronic acid according to the invention was administered to an MRL mouse via drinking water, and the effects of the SOCS3 expression promoter including the hyaluronic acid and/or a salt thereof according to the invention on expression of SOCS3 genes were investigated. The MRL mouse is a mouse model that spontaneously develops an autoimmune disease (e.g., rheumatism). Various symptoms occur due to the autoimmune disease.

Twelve MRL lpr/lpr (SPF) female mice (14 weeks old, weight: about 27 to 37 g, Charles River Laboratories Japan, Inc.) were used for experiments. The mice were kept in a room set at a temperature of 22±3° C. and a relative humidity of 50±20%, and fed a rat-mouse solid feed “CE-2” (Clea Japan, Inc.). A test material was prepared by diluting hyaluronic acid (hereinafter may be referred to as “hyaluronic acid sample”) produced by the above production method with distilled water (see Table 1), and given to the mice (voluntary intake). The details of the test material are given below.

First group: distilled water (“Otsuka Distilled Water” manufactured by Otsuka Pharmaceutical Factory, Inc.)
Second group: low-molecular-weight (hyaluronic acid having an average molecular weight of 2000 that was produced by Production Method 1 (average molecular weight range: 400 to 20,000, average particle diameter: 67 micrometers), sample A)
Third group: high-molecular-weight (hyaluronic acid having an average molecular weight of 900,000 that was produced by Production Method 2 (average molecular weight range: 600,000 to 1,600,000, average particle diameter: 75 micrometers), sample B)

The test material was aseptically prepared at room temperature using a clean bench. The concentration of the test material was adjusted to a given value using distilled water for injection. The test material was kept cold before use.

TABLE 1 Intake of Dosage of Concen- drinking hyaluronic Test tration water acid Number of Group material (mg/ml) (ml/mouse/day) (mg/kg) mice 1 Distilled — 6 — 6 water 2 Sample A 1.1 6 200 6 3 Sample B 1.1 6 200 6

The dosage of the hyaluronic acid sample was set to 200 mg/kg/day at which the hyaluronic acid sample was expected to exhibit an effect by drinking water administration. The water intake of each mouse was preliminarily determined to be 6 mL/day. Since the weight of the MRL mouse was about 33 g, the concentration of the sample A and the sample B was set to 1.1 mg/mL.

The MRL mouse is known to spontaneously develop adenopathy or the like. In this example, the sample was administered from the initial stage (14 weeks old) of the pathological condition. The administration period was set to 28 days that was considered to be appropriate for evaluating the efficacy by drinking water administration.

The mice were euthanized after conducting the intake test for 28 days, and the small intestine, the large intestine, and the cervical lymph node were removed. The samples were subjected to (1) confirmation of expression of SOCS3 genes using a DNA array, (2) confirmation of expression of SOCS3 genes using RT-PCR, (3) localization of the hyaluronic acid in the intestine, and (4) measurement of the weight of the cervical lymph node.

(1) Confirmation of Expression of SOCS3 Genes Using DNA Array

A sample (about 1 cm) including the Peyer's patch was collected from the removed large intestine, and subjected to a DNA array using a GeneChip Mouse Genome 430 2.0 Array (manufactured by AFFYMETRIX) to evaluate expression of SOCS3 genes.

Preparation of the target subjected to the DNA array, hybridization, and analysis of the DNA array were performed in accordance with the GeneChip Eukaryotic Target Preparation & Hybridization Manual (AFFYMETRIX). Specifically, a cDNA of the RNA in the sample was synthesized. The double-stranded cDNA was purified using a GeneChip Sample Cleanup Module Kit (manufactured by AFFYMETRIX). The double-stranded cDNA was labeled with biotin using a GeneChip Expression 3′-Amplification Reagents for IVT Labeling Kit (manufactured by AFFYMETRIX). The biotin-labeled cRNA was purified and fragmented using a GeneChip Expression Sample Cleanup Module Kit (manufactured by AFFYMETRIX). A hybridization control was added to the sample using a GeneChip Eukaryotic Hybridization Control Kit (manufactured by AFFYMETRIX). A hybridization operation was performed at 45° C. and 60 rpm for 16 hours using a GeneChip Hybridization Oven 640 (manufactured by AFFYMETRIX). The sample was washed and stained with streptavidin-phycoerythrin (molecular probe) using a GeneChip Fluidic Station 450 (manufactured by AFFYMETRIX). The resulting DNA array was scanned using a laser scanner (GeneChip Scanner 3000 7G (manufactured by AFFYMETRIX)). The resulting image was analyzed using dedicated software (GeneChip Operating Software ver. 1.4 (manufactured by AFFYMETRIX)). Enhancement of expression of SOCS3 genes was observed in the sample B intake group.

The gene sequences of the probes fixed on the DNA array are given below (sequence ID No. 1 to No. 11). The probe information is available at the following website.

https://www.affymetrix.com/site/login/login.affx

(sequence ID No. 1) (5′) TCACTTTTATAAAAATCCACCTCCA (3′) (sequence ID No. 2) (5′) GAGGCTGTCTGAAGATGCTTGAAAA (3′) (sequence ID No. 3) (5′) GAAGATGCTTGAAAAACTCAACCAA (3′) (sequence ID No. 4) (5′) GATGCTTGAAAAACTCAACCAAATC (3′) (sequence ID No. 5) (5′) TTGAAAAACTCAACCAAATCCCAGT (3′) (sequence ID No. 6) (5′) TCAACCAAATCCCAGTTCAACTCAG (3′) (sequence ID No. 7) (5′) CAACCAAATCCCAGTTCAACTCAGA (3′) (sequence ID No. 8) (5′) ACCAAATCCCAGTTCAACTCAGACT (3′) (sequence ID No. 9) (5′) CAAATCCCAGTTCAACTCAGACTTT (3′) (sequence ID No. 10) (5′) TCAACTCAGACTTTGCACATATATT (3′) (sequence ID No. 11) (5′) ACTCAGACTTTGCACATATATTTAT (3′)

The results for expression of SOCS3 genes are summarized in Table 2. In Table 2, the expression relative ratio of each group refers to the fluorescence intensity of each group with respect to the fluorescence intensity of the distilled water intake group. The DNA array fluorescence intensity (average value) refers to the average value of the fluorescence intensities of the probes having sequence ID No. 1 to No. 11.

TABLE 2 DNA array fluorescence intensity (average Expression relative value) ratio Distilled water 701.5 1 intake group Sample A intake group 325.6 0.5 Sample B intake group 1323.2 1.9

As shown in Table 2, expression of SOCS3 genes of the group that was administered the sample B (hyaluronic acid having an average molecular weight of 900,000) was approximately doubled as compared with that of the distilled water intake group. On the other hand, expression of SOCS3 genes was inhibited in the group that was administered the sample A (hyaluronic acid having an average molecular weight of 2000). This suggests that expression of SOCS3 is promoted by oral intake of the hyaluronic acid sample having an average molecular weight of 500,000 or more.

(2) Confirmation of Expression of SOCS3 Genes Using RT-PCR

A sample including the Peyer's patch was collected from the removed large intestine, and the mRNA was extracted. The mRNA was subjected to RT-PCR using a OneStep RT-PCR Kit (manufactured by QIAGEN) to evaluate expression of SOCS3 genes. A cDNA of the mRNA in the sample was synthesized by reverse transcription, and amplified by a PCR reaction. Specifically, the mRNA was subjected to reverse transcription at 50° C. for 30 minutes, and subjected to PCR initial activation at 95° C. for 15 minutes. The DNA was then denatured at 92° C. for 30 seconds, annealed at 60° C. for 30 seconds, and extended at 72° C. for 30 seconds. The above operation was performed in 30 cycles (the final extension was performed at 72° C. for 10 minutes) to effect DNA amplification. The sample was subjected to electrophoresis using a 1.5% agarose/TAE buffer, and stained with ethidium bromide. Oligonucleotides having a gene sequence shown by the following sequence ID No. 12 or No. 13 were used as primers.

(5′) TAGACTTCACGGCTGCCAAC (3′) (sequence ID No. 12) (5′) TCGCTTTTGGAGCTGAAGGT (3′) (sequence ID No. 13)

The results for expression of SOCS3 genes are summarized in Table 3. The electrophoresis results are shown in FIG. 1. In Table 3, the relative optical intensity refers to the average value of the relative optical intensities of the probes having sequence ID No. 12 and No. 13.

TABLE 3 Relative optical Expression relative intensity ratio Distilled water 181256 1 intake group Sample A intake group 189489 1.0 Sample B intake group 235407 1.3

As shown in Table 3 and FIG. 1, expression of SOCS3 genes of the group that was administered the sample B (hyaluronic acid having an average molecular weight of 900,000) was approximately 1.3 times that of the distilled water intake group. On the other hand, expression of SOCS3 genes of the group that was administered the sample A (hyaluronic acid having an average molecular weight of 2000) was almost equal to that of the distilled water intake group. This suggests that expression of SOCS3 is promoted by oral intake of the hyaluronic acid sample having an average molecular weight of 500,000 or more.

(3) Localization of Hyaluronic Acid in Intestine

Localization of the hyaluronic acid was determined using the large intestine and the small intestine removed from the mice.

(3-1) Staining of Hyaluronic Acid in Large Intestine/Small Intestine Epithelium

A large intestine specimen of the MRL mouse was cut to a thickness of 6 micrometers, and air-dried for 30 minutes. The sample was immersed in 10% neutral buffered formalin solution for 30 minutes, removed, and washed with PBS for 5 minutes. After repeating the washing step three times, the sample was immersed in a 100 mM acetate buffer (pH: 6.0) at 37° C. for 15 minutes (pretreatment). The pretreated sample was immersed in a 100 mM acetate buffer (pH: 6.0) containing a hyaluronidase (200 TRU/mL) (derived from actinomyces, manufactured by Amano Enzyme Inc.) for 60° C. for 120 minutes to fragment the hyaluronic acid. The sample was then washed with PBS for 5 minutes. The washing step was performed three times. The sample was then treated with a Streptavidin-biotin Blocking Kit (manufactured by VECTOR) to block endogenous biotin. Specifically, the sample was immersed in a streptavidin solution at room temperature for 15 minutes, and washed with PBS for 5 minutes. The washing step was performed three times. The sample was immersed in a biotin solution for 15 minutes, and washed with PBS for 5 minutes. The washing step was performed three times. After blocking endogenous biotin, the sample was immersed in 1% BSA/PBS for 60 minutes. The sample was then immersed in a 1 microgram/mL solution (1% BSA/PBS) of HABP-Biotin (manufactured by Seikagaku Corporation) at 4° C. overnight, and washed with PBS for 5 minutes. The washing step was performed three times.

The sample was allowed to come in contact with Streptavidin HRP at room temperature for 60 minutes, and washed with PBS for 5 minutes. The washing step was performed three times. The sample was then allowed to come in contact with DAB. The sample was then washed with distilled water, and color development was checked.

(3-2) Double Staining of Hyaluronic Acid and Receptor (TLR-4) in Large Intestine Epithelium (Staining of Hyaluronic Acid)

The large intestine epithelium sample was subjected to the process described in (3-1) up to the HABP-Biotin treatment. The sample was immersed in a 1600-fold diluted solution (1% BSA/PBS) of AlexaFluor488 (manufactured by Molecular Probe) at room temperature for 60 minutes while shading.

(Staining of TLR-4)

The following procedure was performed while shading. Specifically, the sample after staining the hyaluronic acid was washed with PBS for 5 minutes. The washing step was performed three times. The sample was then immersed in 10% donkey serum/PBS for minutes (blocking). The sample was then immersed in an anti-TLR-4 antibody (4 micrograms/mL) (10% donkey serum/PBS) at 4° C. overnight, and washed with PBS for 5 minutes. The washing step was performed three times. The sample was then immersed in a 400-fold diluted solution (10% donkey serum/PBS) of AlexaFluor594 (manufactured by Molecular Probe) at room temperature for 60 minutes. The sample was then washed with PBS for 5 minutes. The washing step was performed three times.

(Photographing Method)

The sample was photographed using a Leica DMI4000B at 488 nm (HA) and 594 nm (TLR-4) to determine localization of HA and TLR-4.

As shown in FIGS. 2 and 3, the hyaluronic acid was present on the surface of the epithelium of the small intestine and the large intestine of the group that was administered the sample B (hyaluronic acid having an average molecular weight of 900,000) (arrows shown in FIGS. 2 and 3 indicate the hyaluronic acid). As a result of double staining of the hyaluronic acid and TLR-4 on the surface of the epithelium of the bowel, it was found that localization of the hyaluronic acid was similar to localization of TLR-4 (refer to FIG. 4). Therefore, it is estimated that the hyaluronic acid is bonded to the hyaluronan receptor present on the surface of the epithelium of the bowel by oral intake of the hyaluronic acid sample having an average molecular weight of 500,000 or more, so that expression of SOCS3 is promoted, and expression of pleiotrophin is inhibited.

(4) Measurement of Weight of Cervical Lymph Node

The removed cervical lymph node was subjected to weight measurement, and photographed. Table 4 shows the measurement results for the weight of the cervical lymph node, FIG. 5 shows a photograph of the cervical lymph node, FIG. 2 shows a photograph of the surface of the epithelium of the small intestine, and FIG. 3 shows a photograph of the surface of the epithelium of the large intestine.

TABLE 4 Weight of cervical lymph node (mg) Weight relative (average value) ratio Distilled water 1262.6 1 intake group Sample A intake group 1096.4 0.9 Sample B intake group 812.8 0.6

As shown in Table 4, the weight of the cervical lymph node of the group that was administered the sample B (hyaluronic acid having an average molecular weight of 900,000) was 60% of that of the distilled water intake group (i.e., a significant decrease was observed (p=0.05, Fisher's multiple comparison test)). On the other hand, the weight of the cervical lymph node of the group that was administered the sample A (hyaluronic acid having an average molecular weight of 2000) did not significantly decrease as compared with the distilled water intake group. As is clear from FIG. 5, enlargement of the cervical lymph node was suppressed in the group that was administered the sample B (hyaluronic acid having an average molecular weight of 900,000). Therefore, it is estimated that expression of SOCS3 was promoted by oral intake of the hyaluronic acid sample having an average molecular weight of 500,000 or more, so that the symptom of the inflammatory disease (autoimmune disease) was relieved.

5.2. Example 2

In Example 2, the effects of the SOCS3 expression promoter including the hyaluronic acid and/or a salt thereof according to the invention on expression of SOCS3 genes were investigated using HT29 cells (i.e., human large intestine epithelial cell strain).

The HT29 cells were cultured under the following conditions.

The sample A or the sample B used in Example 1 was added to the medium so that the hyaluronate concentration in the medium was 100 ng/mL. After culturing the HT29 cells for 24 hours, the sample was subjected to RT-PCR in the same manner as in Example 1. Oligonucleotides having a gene sequence shown by the following sequence ID No. 14 or No. 15 were used as primers. The number of amplification cycles was 38.

(5′) GCCACCTACTGAACCCTCCT (3′) (sequence ID No. 14) (5′) ACGGTCTTCCGACAGAGATG (3′) (sequence ID No. 15)

The results are shown in FIG. 6.

As is clear from the results shown in FIG. 6, expression of SOCS3 was promoted by culturing the HT29 cells in the presence of the hyaluronic acid having an average molecular weight of 900,000. On the other hand, expression of SOCS3 was not promoted as compared with the control in the presence of the hyaluronic acid having an average molecular weight of 2000. The above results suggest that expression of SOCS3 in the large intestine epithelial cells is promoted in the presence of the hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof.

5.3. Example 3

A soft capsule was produced according to the following formulation using the sample B of Example 1 (hyaluronic acid having an average molecular weight of 900,000) as a SOCS3 expression promoter.

<Formulation>

SOCS3 expression promoter (sample B of Example 1): 20%

Olive oil: 50% Beeswax: 10%

Medium-chain triglyceride: 10%
Emulsifying agent: 10%

(Total: 100%) 5.4. Example 4

A powdered drug (granules) was produced according to the following formulation using the sample B of Example 1 (hyaluronic acid having an average molecular weight of 900,000) as a SOCS3 expression promoter.

<Formulation>

SOCS3 expression promoter (sample B of Example 1): 10%

Lactose: 60%

Corn starch: 25%
Hydroxypropylmethyl cellulose: 5%

(Total: 100%) 5.5. Example 5

A tablet was produced according to the following formulation using the sample B of Example 1 (hyaluronic acid having an average molecular weight of 900,000) as a SOCS3 expression promoter.

<Formulation>

SOCS3 expression promoter (sample B of Example 1): 25%

Lactose: 24%

Crystalline cellulose: 20%
Corn starch: 15%

Dextrin: 10%

Emulsifying agent: 5%
Silicon dioxide: 1%

(Total: 100%) 5.6. Example 6

Expression of pleiotrophin genes was evaluated using the sample evaluated in Example 1 in the same manner as in Example 1 (evaluation of expression of SOCS3 genes using a DNA array).

The gene sequences of the probes fixed on the DNA array are given below (sequence ID No. 16 to No. 26). The probe information is available at the following website.

https://www.affymetrix.com/site/login/login.affx

(sequence ID No. 16) (5′) AATGTATACCATAGTACCAGTAGGG (3′) (sequence ID No. 17) (5′) AGGAAGTTGAACTCTGTAGTACATA (3′) (sequence ID No. 18) (5′) GATTGAGGTAAGTTTTTTGGTGTTG (3′) (sequence ID No. 19) (5′) GTGATATTTCACATTTAAATCTTTT (3′) (sequence ID No. 20) (5′) ATGTTTTCTCTTGTGCATCAATTTA (3′) (sequence ID No. 21) (5′) GTGCATCAATTTAAATGTTACAACC (3′) (sequence ID No. 22) (5′) AACCATGTAAACTACTTCTCTTGTT (3′) (sequence ID No. 23) (5′) AAACTACTTCTCTTGTTAGATAGAT (3′) (sequence ID No. 24) (5′) GATAGATTTTCACCTAGACTTTTTT (3′) (sequence ID No. 25) (5′) AGAGGCAGAGCAACGATGTAGTGAA (3′) (sequence ID No. 26) (5′) AACATGAAATCCTTTCACTTTGGCA (3′)

TABLE 5 DNA array fluorescence intensity (average Expression relative value) ratio Distilled water 395 1 intake group Sample A intake group 247 0.6 Sample B intake group 199.5 0.5

In Table 5, the fluorescence intensity (average value) determined by the DNA array refers to the average value of the fluorescence intensities of the probes having sequence ID No. 16 to No. 25.

As shown in Table 5, expression of pleiotrophin was suppressed by intake of the sample B.

5.7. Example 7

It is expected that cytokine signaling is inhibited due to promotion of expression of SOCS3 so that expression of inflammatory cytokines is inhibited. Therefore, expression of inflammatory cytokines shown in Table 6 was investigated by a cytokine array using the large intestine of the mouse that was administered the hyaluronic acid according to the invention (sample Bused in Example 1).

A RayBio Mouse Cytokine Antibody Array 3 (manufactured by RayBiotech) was used. Expression of the inflammatory cytokines shown in Table 6 was investigated using 10 microliters of a blood serum collected from the mouse in Example 1. Specifically, the blood serum was caused to come in contact with a carrier on a glass slide that was bonded to antibody to various cytokines of mouse. An antigen-antibody reaction thus occurred between the cytokine in the blood serum and the antibody. After allowing a mouse anti-cytokine antibody (secondary antibody) labeled with biotin to come in contact with the carrier, a streptavidin-fluorescent dye was added and bonded to the secondary antibody. The fluorescence intensity was then measured to evaluate expression of each cytokine. The fluorescence intensity was calculated as an expression ratio with respect to a positive control. The results are shown in Table 6.

TABLE 6 Distilled water Sample B intake Normal mouse intake group group IL-10 5.46 3.81 6.89 MCP-5 n.d. 6.87 4.53 MIP-2 19.02 27.75 14.05 P-Selectin 150.22 129.35 64.76 RANTES 15.03 44.92 28.79 SCF n.d. 2.41 n.d. VEGF n.d. 3.31 2.15 IL-10: Anti-inflammatory cytokine P-Selectin: Promotes infiltration of lymphocytes and leukocytes SCF: Relates to arthritis synovial membrane VEGF: Initial arthritis maeker

According to Examples 1 and 2, it was found that expression of SOCS3 is promoted by intake of the sample B so that an inflammatory disease can be relieved. According to this example, expression of IL-10 (anti-inflammatory cytokine) was promoted by intake of the hyaluronic acid (sample B) according to the invention. These results suggest that expression of SOCS3 is promoted or expression of pleiotrophin is inhibited by intake of the sample B so that expression of the anti-inflammatory cytokine (IL-10) is promoted (i.e., an inflammatory disease is relieved).

As shown in Table 6, expression of the inflammatory cytokines (MCP-5, MIP-2, P-Selectin, RANTES, SCF, and VEGF) decreased by intake of the hyaluronic acid (sample B) according to the invention. These results suggest that inflammation was suppressed (expression of the inflammatory cytokines was inhibited) by intake of the hyaluronic acid (sample B) according to the invention.

5.8. Example 8

When hyaluronic acid is dissolved in low-pH gastric juices, the molecular weight of the hyaluronic acid may decrease due to hydrolysis as compared with the molecular weight of the hyaluronic acid before oral intake, so that the effect of improving an inflammatory disease (e.g., gonarthritis) may decrease. Therefore, it is estimated that the effect of treating gonarthritis increases as the water solubility of hyaluronic acid decreases.

In this example, the difference in solubility of hyaluronic acid due to the difference in average particle diameter was evaluated.

5.8.1. Evaluation Method

The dissolution rate of hyaluronic acid having an average molecular weight of 800,000, but having a different average particle diameter in an artificial gastric juice was evaluated. Specifically, hyaluronic acid having an average molecular weight of 800,000 was sieved to obtain hyaluronic acid particles having an average particle diameter shown in Table 7.

Hyaluronic acid having an average molecular weight of 800,000 was sieved using a sieve 1 (65 meshes (pore diameter: 208 micrometers)), a sieve 2 (150 meshes (pore diameter: 104 micrometers)), and a sieve 3 (250 meshes (pore diameter: 61 micrometers)).

Particles that passed through the sieve 1 but did not pass through the sieve 2 were used in Test Example 1, particles that passed through the sieve 2 but did not pass through the sieve 3 were used in Test Example 2, particles that did not pass through the sieve 1 were used in Test Example 3, and particles that passed through the sieve 3 were used in Comparative Test Example 1.

Hyaluronic acid having an average molecular weight of 8000 was sieved in the same manner as described above to obtain hyaluronic acid particles having an average particle diameter shown in Table 8 (the particles of Reference Examples 1 to 4 were obtained in the same manner as the particles of Test Examples 1 to 3 and Comparative Test Example 1, respectively).

0.3 g of the hyaluronic acid was added to 100 mL of an artificial gastric juice (0.2% NaCl aqueous solution, pH: 1.2). The mixture was stirred to measure the time (dissolution time) until the hyaluronic acid particles were completely dissolved (naked eye observation). Tables 7 and 8 show the dissolution time of the hyaluronic acid particles of Test Examples 1 to 3, Comparative Test Example 1, and Reference Examples 1 to 4.

TABLE 7 Comparative Test Test Test Test Example 1 Example 2 Example 3 Example 1 Average 148 75 353 48 particle diameter (micrometers) Dissolution 177 175 380 65 time (min)

TABLE 8 Reference Reference Reference Reference Example 1 Example 2 Example 3 Example 4 Average 154 71 368 41 particle diameter (micrometers) Dissolution 5 6 21 4 time (min)

5.8.2. Evaluation Results

As is clear from the above results, the solubility of the hyaluronic acid particles of Test Examples 1 to 3 (average particle diameter: 50 to 500 micrometers) in gastric juices was lower than that of the hyaluronic acid particles of Comparative Test Example (average particle diameter: less than 50 micrometers). The solubility of the hyaluronic acid particles of Test Examples 1 and 3 (average particle diameter: 80 to 500 micrometers) was lower than that of the hyaluronic acid particles of Test Example 2, and the solubility of the hyaluronic acid particles of Test Example 3 (average particle diameter: 200 to 500 micrometers) was lower than that of the hyaluronic acid particles of Test Example 1. Specifically, the hyaluronic acid particles of Test Examples 1 to 3 having an average particle diameter of 50 to 500 micrometers) were hydrolyzed (reduced in molecular weight) in gastric juices to only a small extent as compared with the hyaluronic acid particles of Comparative Test Example 1 having an average particle diameter of less than 50 micrometers.

In Reference Examples 1 to 4 in which the average molecular weight of the hyaluronic acid was 8000, a sufficient correlation was not observed between the average particle diameter and the dissolution rate. Specifically, the solubility of the hyaluronic acid having an average molecular weight of 500,000 or more in gastric juices varies depending on the average particle diameter, while the solubility of the hyaluronic acid having an average molecular weight of less than 500,000 in gastric juices does not vary depending on the average particle diameter. Note that the hyaluronic acid having an average molecular weight of less than 500,000 has a small effect of treating inflammatory diseases as compared with the hyaluronic acid having an average molecular weight of 500,000 or more (refer to Example 1).

As described above, it is estimated that hyaluronic acid having an average molecular weight of 500,000 or more and an average particle diameter of 200 to 500 micrometers is hydrolyzed (reduced in molecular weight) in gastric juices to only a small extent, and is absorbed through the bowel and reaches the affected area while maintaining the molecular weight, so that an excellent effect of treating inflammatory diseases is achieved.

5.9. Example 9

In Example 9, hyaluronic acid having an average molecular weight of 1,000,000 (i.e., within the range of 600,000 to 1,200,000) and an average particle diameter of 205 micrometers was orally administered to fifteen men and women with a subjective symptom of knee pain in an amount of 240 mg/day in the form of a soft capsule. The condition of each subject was evaluated before intake, after four weeks of intake, and after eight weeks of intake using the Japanese Knee Osteoarthritis Measure (JKOM) questionnaire and the Japanese Orthopaedic Association (JOA) score.

5.9.1. Test Product and Amount of Intake

Hyaluronic acid having an average molecular weight of 1,000,000 was obtained by Production Method 2. After adjusting the average particle diameter of the hyaluronic acid to 205 micrometers, soft capsules containing 48 mg of the hyaluronic acid were produced. The subjects took five soft capsules (hyaluronic acid: 240 mg) every day.

5.9.2. Subjects and Number of Subjects

The subjects consisted of fifteen Japanese men and women (age: 50 to 70) with a subjective symptom of knee pain during resting and exercise. Note that the subjects were persons who had a low

JOA score, and had a grade of 1 to 3 for one of the legs according to the Kellgren-Lawrence knee osteoarthritis classification (X-ray knee osteoarthritis evaluation method; classified into grades 0 to 4 depending on the progress of the symptom of the joint).

5.9.3. Evaluation Method and Evaluation Results

The condition of each subject was evaluated by the following method before intake, after four weeks of intake, and after eight weeks of intake.

5.9.3.1. JKOM Questionnaire

The condition of each subject was evaluated based on the score for criterion 1 (degree of knee pain) (visual analog scale (VAS)) and the sum of the points for criteria 2 to 5 in the JKOM questionnaire.

<Criterion 1: Degree of Knee Pain>

The degree of knee pain was indicated by the 40-stage score (“No pain”=1, “Most acute pain ever experienced”=40).

<Sum of Points for Criteria 2 to 5>

The total points (0 to 100 points) of four items (25 questions in total) were calculated in Table 9.

TABLE 9 JKOM questionnaire criteria (II to V) Item Question Criteria II. 1. Do you feel knee “No stiffness”: 0, “Slightly Knee stiffness these few days stiff”: 1, “Moderately pain or when getting up in the stiff”: 2, “Stiff”: 3, “Very stiffness morning? stiff”: 4 (32 2. Do you feel knee pain “No pain”: 0, “Slightly points) these few days when getting pain”: 1, “Moderately pain”: up in the morning? 2, “Feels pain”: 3, “Feels acute pain”: 4 3. Do you wake up feeling “No”: 0, “Occasionally”: 1, knee pain these few days? “Sometimes”: 2, “Frequently”: 3, “Every night”: 4 4. Do you feel knee pain “No pain”: 0, “Slightly these few days when walking pain”: 1, “Moderately pain”: on level ground? 2, “Feels pain”: 3, “Feels acute pain”: 4 5. Do you feel knee pain “No pain”: 0, “Slightly these few days when going pain”: 1, “Moderately pain”: up the stairs? 2, “Feels pain”: 3, “Feels acute pain”: 4 6. Do you feel knee pain “No pain”: 0, “Slightly these few days when going pain”: 1, “Moderately pain”: down the stairs? 2, “Feels pain”: 3, “Feels acute pain”: 4 7. Do you feel knee pain “No pain”: 0, “Slightly these few days when pain”: 1, “Moderately pain”: squatting down or standing 2, “Feels pain”: 3, “Feels up? acute pain”: 4 8. Do you feel knee pain “No pain”: 0, “Slightly these few days when pain”: 1, “Moderately pain”: standing? 2, “Feels pain”: 3, “Feels acute pain”: 4 III. 9. Do you have difficulty “No difficulty”: 0, Condition in going up or down the “Somewhat difficult”: 1, in daily stairs these few days? “Moderately difficult”: 2, life “Difficult”: 3, “Very (40 difficult”: 4 points) 10. Do you have difficulty “No difficulty”: 0, in squatting down or “Somewhat difficult”: 1, standing up these few days? “Moderately difficult”: 2, “Difficult”: 3, “Very difficult”: 4 11. Do you have difficulty “No difficulty”: 0, in standing up these few “Somewhat difficult”: 1, days when using a “Moderately difficult”: 2, Western-style toilet? “Difficult”: 3, “Very difficult”: 4 12. Do you have difficulty “No difficulty”: 0, in changing your clothes “Somewhat difficult”: 1, these few days? “Moderately difficult”: 2, “Difficult”: 3, “Very difficult”: 4 13. Do you have difficulty “No difficulty”: 0, in pulling on or off your “Somewhat difficult”: 1, socks these few days? “Moderately difficult”: 2, “Difficult”: 3, “Very difficult”: 4 14. How long can you walk on “30 minutes or more”: 0, “15 level ground these few days minutes or more”: 1, “Around without taking a rest? home”: 2, “Inside home”: 3, “Difficult”: 4 15. Do you use a stick these “No”: 0, “Occasionally”: 1, few days? “Sometimes”: 2, “Frequently”: 3, “Always”: 4 16. Do you have difficulty “No difficulty”: 0, in shopping these few days? “Somewhat difficult”: 1, “Moderately difficult”: 2, “Difficult”: 3, “Very difficult”: 4 17. Do you have difficulty “No difficulty”: 0, in doing easy housework “Somewhat difficult”: 1, (e.g., clearing the table “Moderately difficult”: 2, or sorting out room) these “Difficult”: 3, “Very few days? difficult”: 4 18. Do you have difficulty “No difficulty”: 0, in doing hard housework “Somewhat difficult”: 1, (e.g., using a cleaner or “Moderately difficult”: 2, moving bedding) these few “Difficult”: 3, “Very days? difficult”: 4 IV. 19. Did you go to “A few time a week”: 0, “Once Dairy entertainments or a a week”: 2, “Once a month”: 3, acvtivites department store within “No”: 4 etc. this month? (20 20. Did you have difficulty “No difficulty”: 0, points) in daily activities (e.g., “Somewhat difficult”: 1, lesson, association with “Moderately difficult”: 2, friends) within this month “Difficult”: 3, “Very due to knee pain? difficult”: 4 21. Did you limit daily “No”: 0, “Occasionally activities (e.g., lesson, limited”: 1, “Sometimes association with friends) limited”: 2, “Frequently within this month due to limited”: 3, “Limited”: 4 knee pain? 22. Did you give up going “No”: 0, “Occasionally”: 1, out to the neighborhood “Sometimes”: 2, within this month due to “Frequently”: 3, “Almost knee pain? always”: 4 23. Did you give up “No”: 0, “Occasionally”: 1, visiting a faraway place “Sometimes”: 2, within this month due to “Frequently”: 3, “Almost knee pain? always”: 4 V. 24. Do you think you are “Absolutely yes”: 0, “Yes”: Health healthy this month? 1, “Yes and no”: 2, “No”: 3, condition “Absolutely no”: 4 (8 25. Do you think that your “No”: 0, “Affected to some points) knee condition adversely extent”: 1, “Affected to affects your health within medium extent”: 2, this month? “Affected”: 3, “Affected to large extent”: 4 Total — — of I to V (100 points)

5.9.3.2. JKOM Questionnaire Results

As shown in Table 10, the score for criterion 1 (degree of knee pain) and the sum of the points for criteria 2 to 5 significantly decreased after eight weeks of intake with a risk rate of less than 1%.

TABLE 10 JKOM questionnaire results Before After four After eight Item intake weeks weeks 1. Degree of knee pain 15.6 ± 9.2  10.8 ± 8.5  8.1 ± 5.8** 2. Knee pain or 8.4 ± 4.9  5.5 ± 3.1* 4.3 ± 2.9** stiffness 3. Condition in daily 4.9 ± 5.2 2.6 ± 3.5 2.2 ± 3.3*  life 4. Daily activities 4.7 ± 3.2  2.3 ± 1.4** 2.4 ± 1.5** etc. 5. Health condition 2.7 ± 1.8 2.2 ± 1.4 2.1 ± 1.5*  Total (2 to 5) 20.8 ± 13.2  12.7 ± 7.8** 11.0 ± 7.6**  Average value ± standard deviation n = 15 *p < 0.05 **p < 0.01

5.9.3.3. JOA Questionnaire

The condition of each subject was evaluated by the total JOA score (four items) shown in Table 11.

TABLE 11 JOA score criteria Pain Can walk 1 km or more. No or occasional pain. 30 (walking Can walk 2 km or more, but feel pain. 25 ability) Can walk 200 m or more and less than 500 m, 20 but feel pain. Can walk 200 m or more and less than 500 m, 15 but feel pain. Can walk inside room or walk less than 100 m, 10 but feel pain. Cannot walk. 5 Cannot stand up. 0 Pain Can go up and down the stairs. Feels no pain 25 (ability of without using a handrail. stepping Can go up and down the stairs, but feels pain 20 stairs) without using a handrail. Feels pain even when using a handrail, but feel 15 no pain when slowly going up and down the stairs. Feels pain even when slowly going up and down 10 the stairs without using a handrail, but feels no pain slowly going up and down the stairs using a handrail. Feels pain even when slowly going up and down 5 the stairs using a handrail. Cannot go up and down the stairs. 0 Bend angle, Can sit straight. 35 high Cannot sit straight, but can sit sidewise or 30 stiffness, cross-legged. and high 110° or more 25 contracture 75° or more 20 35° or more 10 Less than 35° or stiffness/contracture 0 Tumescence None 10 Occasionally requires aspiration. 5 Frequently requires aspiration. 0 Total — Total score

5.9.3.4. JOA Questionnaire Results

As shown in Table 12, the total JOA score significantly decreased after eight weeks of intake with a risk rate of less than 1%.

TABLE 12 JOA questionnaire results Before After four After eight Item intake weeks weeks Pain (walking ability) 23.7 ± 5.8 27.7 ± 3.7*  28.0 ± 4.6*  Pain (ability of 15.4 ± 6.8 18.3 ± 6.7*  19.7 ± 6.9** stepping stairs) Bend angle, high 32.3 ± 3.2 33.3 ± 2.4  33.7 ± 2.3*  stiffness, and high contracture Tumescence  6.7 ± 2.4 8.3 ± 2.4* 8.7 ± 2.3* Total  77.7 ± 10.7 87.7 ± 8.2** 90.0 ± 9.4** Average value ± standard deviation n = 15 *p < 0.05 **p < 0.01

As described above, the JKOM score (points) and the JOA score significantly decreased with a risk rate of less than 1% by orally administering the hyaluronic acid having an average molecular weight of 1,000,000 and an average particle diameter of 205 micrometers to fifteen men and women with a subjective symptom of knee pain in an amount of 240 mg/day in the form of a soft capsule.

It was thus confirmed that knee pain can be relieved via oral intake of a supplement that includes hyaluronic acid having an average molecular weight of 500,000 or more and an average particle diameter of 50 to 500 micrometers as an active ingredient.

Hyaluronic acid having an average molecular weight of 1,200,000 (i.e., within the range of 800,000 to 1,600,000) and an average particle diameter of 80 micrometers was orally administered to fifteen men and women with a subjective symptom of knee pain in an amount of 120 mg/day in the form of a soft capsule. As a result, the JKOM score significantly decreased after eight weeks of intake with a risk rate of less than 1%.

The JOA questionnaire was omitted in this test. It was thus confirmed that knee pain can be relieved by hyaluronic acid (knee pain-relieving agent) having an average molecular weight of 1,200,000 and an average particle diameter of 80 micrometers.

As described above, knee pain could by relieved by orally administering the knee pain-relieving agent of Example 8 including hyaluronic acid having an average molecular weight of 500,000 or more (i.e., 600,000 to 1,600,000) and an average particle diameter of 50 to 500 micrometers or a salt thereof as the main component to patients who mainly suffered knee pain for eight weeks in an amount of 120 to 240 mg/day. The JKOM score and the JOA score significantly decreased with a risk rate of less than 1%. Therefore, the knee pain-relieving agent and a drug or a food that contains the knee pain-relieving agent are effective for relieving knee pain.

5.10. Example 10

In Example 10, each hyaluronic acid was dissolved in drinking water, and administered to STR mice via drinking water. Drinking water to which the hyaluronic acid was not added was used as a control, and drinking water in which chondroitin sulfate was dissolved was used as a positive control. The mice were euthanized after 17 weeks of administration, and both hind limbs were used as autopsy samples. As autopsy items, (1) narrowing of fissures in a soft X-ray photograph of the knee joint, (2) roughening of the surface of the knee joint cartilage, and (3) alteration of the synovial membrane of the knee joint were evaluated.

5.10.1. Test Product and Amount of Intake

As Test Example 4, hyaluronic acid having an average molecular weight of 900,000 (average molecular weight: 600,000 to 1,600,000, average particle diameter: 159 micrometers) was obtained by extraction from a cockscomb according to Production Method 1.

As Test Example 5, hyaluronic acid having an average molecular weight of 700,000 (average molecular weight: 500,000 to 1,200,000, average particle diameter: 211 micrometers) was obtained by microbial fermentation according to Production Method 2.

The resulting hyaluronic acid was added to drinking water in an amount of 1.1 mg/mL. Each mouse took drinking water in an amount of 7.5 mL/day (i.e., the amount of intake of the hyaluronic acid was 200 mg/kg/day.

Chondroitin sulfate (average molecular weight: about 30,000) was used as Comparative Test Example 2. Chondroitin sulfate was added to drinking water in an amount of 12.5 mg/mL. Each mouse took drinking water in an amount of 7.5 mL/day (i.e., the amount of intake of chondroitin sulfate was 1000 mg/kg/day.

Otsuka Distilled Water was used as drinking water. The test product was aseptically prepared on a clean bench, and kept cold after the preparation. The above distilled water was used for a control group.

5.10.2. Test Animals and Test Conditions

STR/OrtCrlj mice (male, 22 weeks old, Charles River Laboratories Japan, Inc.) were preliminarily kept for 15 days, and healthy mice with no abnormalities were subjected to the test.

The mice were kept at a room temperature of 19 to 25° C. and a relative humidity of 30 to 70% in a individual ventilation cage (IVC) (seven mice/cage).

The mice were fed a rat-mouse solid feed “Quick Fat” (manufactured by Clea Japan, Inc.) (voluntary intake). The mice took drinking water containing the test product.

5.10.3. Intake Period

The intake experiments were performed for 17 weeks when the mice were at the age of 22 to 39 weeks old.

5.10.4. Evaluation Method and Evaluation Results

The following items were evaluated by autopsy after 17 weeks of intake. The mice were anesthetized with ether, and subjected to laparotomy. After collecting the blood, the mice were exsanguinated to death. Both hind limbs were then removed. The limbs were collected together with the head of the femur so that fissures did not occur in the bones, and fixed with 10% neutral buffered formalin to prepare a soft X-ray photography evaluation sample and a histopathological sample.

5.10.4.1. Evaluation of Narrowing of Fissures in Soft X-Ray Photography of Knee Joint

A soft X-ray photograph was taken at a distance from the bulb of 50 cm, a voltage of 26 to 28 kvp, a current of 3 to 4 mA, and an irradiation time of 45 seconds. The soft X-ray photograph of the knee joint was evaluated.

Specifically, whether or not some or all of the joint fissures disappeared (i.e., whether or not narrowing of the joint fissures occurred) was evaluated. A case where a change did not occur as compared with the photograph of the joint of a healthy mouse was evaluated as “0”, a case where a change occurred to only a small extent as compared with the photograph of the joint of a healthy mouse was evaluated as “0.5”, a case where a change occurred to some extent as compared with the photograph of the joint of a healthy mouse was evaluated as “1”, a case where a change occurred to a medium extent as compared with the photograph of the joint of a healthy mouse was evaluated as “2”, and a case where a change occurred to a large extent as compared with the photograph of the joint of a healthy mouse was evaluated as “3”.

A blind evaluation was employed. The evaluation results are shown in FIG. 7.

The soft X-ray photography score of Test Examples 4 and 5 was significantly lower than that of the control group. On the other hand, no significant difference was observed between Comparative Test Example 2 and the control group. The presence or absence of a significant difference was determined by the Kolmogorov-Smirnov (KS) test with a risk rate of less than 1%.

FIG. 8 shows the soft X-ray photography of the 39-weeks-old STR mouse of each group.

As shown in FIG. 8, the joint fissure of Test Example 4 (B) and Test Example 5 (C) was wider than that of the control group (A) (i.e., narrowing of the joint fissure was suppressed). On the other hand, no difference was observed for Comparative Test Example 2 (D).

5.10.4.2. Evaluation of Roughening of Surface of Knee Joint Cartilage

Roughening of the surface of the knee joint cartilage was evaluated by the India ink method.

Specifically, an India ink was applied to the surface of the thighbone cartilage of the hind limb sample fixed with formalin. After washing the thighbone cartilage in a physiological saline solution, the thighbone cartilage was photographed. The India ink remains in an area in which the cartilage is roughened. The cartilage area (number of pixels) was measured using an NIH image (see FIG. 9). The number of lattice intersection points (excluding the ligament) in an area in which the India ink remained was counted by a Weigel's point counting method.

A value obtained by dividing the number of lattice intersection points by the cartilage area was used as a cartilage roughening index.

The evaluation results are shown in FIG. 10.

The cartilage roughening index of Test Examples 4 and 5 was significantly smaller than that of the control group. On the other hand, the cartilage roughening index of Comparative Test Example 2 was smaller to only a small extent than that of the control group (i.e., no significant difference was observed). The average value and the standard error were calculated from the resulting data. The presence or absence of a significant difference was determined with a risk rate of less than 1% by performing the non-parametric or parametric Tukey multiple comparison test.

FIG. 11 shows the photograph of the surface of the thighbone cartilage of the 39-weeks-old STR mouse of each group to which the India ink was applied.

As shown in FIG. 11, the staining area of Test Example 4 (B) and Test Example 5 (C) was smaller than that of the control group (A) (i.e., roughening of the surface of the knee joint cartilage was suppressed). On the other hand, only a small difference in staining area was observed between Comparative Test Example 2 (D) and the control group (A).

5.10.4.3. Evaluation of Alteration of Synovial Membrane of Knee Joint

The hind limb fixed with 10% neutral buffered formalin was delimed using 10% EDTA, embedded in paraffin, and sliced. A hematoxylin-eosine-stained sample was then prepared, and the synovial membrane on each side of the patella was histopathologically examined. “Normal” was evaluated as “0”, “Synoviocytes activation” was evaluated as “1”, “Synoviocytes activation and slight growth” was evaluated as “2”, and “Synoviocytes activation and serious growth” was evaluated as “3”. The synovial membrane evaluation score was then calculated.

The evaluation results are shown in FIG. 12.

The synovial membrane evaluation index of Test Examples 4 and 5 was significantly lower than that of the control group. On the other hand, no difference was observed between Comparative Test Example 2 and the control group. The average value and the standard error were calculated from the resulting data. The presence or absence of a significant difference was determined with a risk rate of less than 5% by performing the non-parametric or parametric Tukey multiple comparison test. No significant difference was observed between each group.

According to the histopathological examination of the synovial membrane, slight growth of the synoviocytes was significantly observed in the control group and Comparative Test Example 2. On the other hand, the growth of the synoviocytes was clearly suppressed in Test Examples 4 and 5 although activation of the synoviocytes was observed.

As is clear from the results of the soft X-ray photography of the knee joint and the histopathological of both hind limbs, narrowing of fissures in the knee joint, roughening of the surface of the knee joint cartilage, and alteration of the synovial membrane of the knee joint were suppressed by orally administering hyaluronic acid extracted from a cockscomb (average molecular weight: 600,000 to 1,600,000) and having an average particle diameter of 50 to 500 micrometers or hyaluronic acid obtained by microbial fermentation (average molecular weight: 500,000 to 1,200,000) and having an average particle diameter of 50 to 500 micrometers to the STR mice (i.e., a mouse model that spontaneously develops knee osteoarthritis) for 17 weeks.

According to Test Examples 4 and 5, the knee joint therapeutic agent according to one embodiment of the invention including the hyaluronic acid or a salt thereof as an active ingredient significantly improved the knee joint soft X-ray photography score and the knee joint cartilage roughening index of the knee osteoarthritis model animals with a risk rate of less than 1%. The patella synovial membrane score was improved although a significant difference was not observed. Therefore, the knee joint therapeutic agent according to one embodiment of the invention is effective for treating knee osteoarthritis, the cartilage of the knee joint, and the synovial membrane of the knee joint. A drug or a food that includes the knee joint therapeutic agent is effective for histopathologically improving the knee joint, and is effective for treating, preventing, or relieving diseases in the field of orthopedics.

Claims

1. A SOCS3 expression promoter comprising hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof as an active ingredient.

2. The SOCS3 expression promoter according to claim 1, wherein the hyaluronic acid and/or a salt thereof has an average particle diameter of 50 to 500 micrometers.

3. A drug comprising the SOCS3 expression promoter according to claim 1 as an active ingredient.

4. The drug according to claim 3, the drug being orally administered.

5. A food comprising the SOCS3 expression promoter according to claim 1.

6. A method of promoting expression of SOCS3 in a human or an animal other than a human, the method comprising orally administering hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof to a human or an animal other than a human.

7. A pleiotrophin expression inhibitor comprising hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof as an active ingredient.

8. The pleiotrophin expression inhibitor according to claim 7, wherein the hyaluronic acid and/or a salt thereof has an average particle diameter of 50 to 500 micrometers.

9. A drug comprising the pleiotrophin expression inhibitor according to claim 7 as an active ingredient.

10. The drug according to claim 9, the drug being orally administered.

11. A food comprising the pleiotrophin expression inhibitor according to claim 7.

12. A method of inhibiting expression of pleiotrophin in a human or an animal other than a human, the method comprising orally administering hyaluronic acid having an average molecular weight of 500,000 or more and/or a salt thereof to a human or an animal other than a human.

13. The drug according to claim 3, the drug being used to treat a knee joint or relieve knee pain.

14. The food according to claim 5, the food being used to treat a knee joint or relieve knee pain.

15. (canceled)

16. (canceled)

17. The drug according to claim 9, the drug being used to treat a knee joint or relieve knee pain.

18. The food according to claim 11, the food being used to treat a knee joint or relieve knee pain.

Patent History
Publication number: 20110053887
Type: Application
Filed: Aug 20, 2009
Publication Date: Mar 3, 2011
Applicant: Q.P. CORPORATION (Shibuya-ku, Tokyo)
Inventors: Tomoyuki Kanemitsu (Fuchu-shi), Toshihide Sato (Fuchu-shi), Akira Asari (Musashino-shi)
Application Number: 12/921,729
Classifications
Current U.S. Class: Polysaccharide (514/54); Polysaccharides (536/55.1); Particulate Matter (e.g., Sphere, Flake, Etc.) (428/402)
International Classification: A61K 31/728 (20060101); C08B 37/08 (20060101); A61P 19/02 (20060101);