RBM3 in Testicular Cancer Diagnostics and Prognostics

-

The present disclosure provides a method for determining whether a mammalian subject belongs to a first or a second group, wherein subjects of the first group have a higher risk of having a testicular disorder than subjects of the second group, comprising the steps of: evaluating an amount of RBM3 protein or RBM3 mRNA in at least part of an earlier obtained sample comprising biological material from a testicle of said subject and determining a sample value corresponding to the evaluated amount; comparing said sample value with a predetermined reference value; and if said sample value is higher than said reference value, concluding that the subject belongs to the first group; and if said sample value is lower than or equal to said reference value, concluding that the subject belongs to the second group. Further, a prognostic method for testicular cancer is provided, as well as means and uses with prognostic and diagnostic applications.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description

This application is a Continuation-In-Part of PCT/EP2010/051935, filed Feb. 16, 2010 which claims priority to PCT/SE2009/000091, filed Feb. 16, 2009, U.S. Provisional Application No. 61/169,963, filed Apr. 16, 2009, EP09158084.5, filed Apr. 16, 2009, U.S. Provisional Application No. 61/233,769, filed Aug. 13, 2009, EP09167847.4, filed Aug. 13, 2009, and PCT/EP2009/067419, filed Dec. 17, 2009. The present application also claims priority to U.S. Provisional Application No. 61/487,341, filed May 18, 2011 and EP11166558.4, filed May 18, 2011.

FIELD OF THE PRESENT DISCLOSURE

The present disclosure relates to the field of testicular cancer. Further, it relates to detection of testicular disorders, including pre-malignant stages of testicular cancer, as well as the establishment of a prognosis for testicular cancer patients.

BACKGROUND Cancer

Cancer is one of the most common diseases, and a major cause of death, in the western world. In general, incidence rates increase with age for most forms of cancer. As human populations continue to live longer, due to an increase of the general health status, cancer may affect an increasing number of individuals. The cause of most common cancer types is still largely unknown, although there is an increasing body of knowledge providing a link between environmental factors (dietary, tobacco smoke, UV radiation etc) as well as genetic factors (germ line mutations in “cancer genes” such as p53, APC, BRCA1, XP etc) and the risk for development of cancer.

No definition of cancer is entirely satisfactory from a cell biological point of view, despite the fact that cancer is essentially a cellular disease and defined as a transformed cell population with net cell growth and anti-social behavior. Malignant transformation represents the transition to a malignant phenotype based on irreversible genetic alterations. Although this has not been formally proven, malignant transformation is believed to take place in one cell, from which a subsequently developed tumor originates (the “clonality of cancer” dogma). Carcinogenesis is the process by which cancer is generated and is generally accepted to include multiple events that ultimately lead to growth of a malignant tumor. This multi-step process includes several rate-limiting steps, such as addition of mutations and possibly also epigenetic events, leading to formation of cancer following stages of precancerous proliferation. The stepwise changes involve accumulation of errors (mutations) in vital regulatory pathways that determine cell division, asocial behavior and cell death. Each of these changes may provide a selective Darwinian growth advantage compared to surrounding cells, resulting in a net growth of the tumor cell population. A malignant tumor does not only necessarily consist of the transformed tumor cells themselves but also surrounding normal cells which act as a supportive stroma. This recruited cancer stroma consists of connective tissue, blood vessels and various other normal cells, e.g., inflammatory cells, which act in concert to supply the transformed tumor cells with signals necessary for continued tumor growth.

The most common forms of cancer arise in somatic cells and are predominantly of epithelial origin, e.g., prostate, breast, colon, urothelium and skin, followed by cancers originating from the hematopoietic lineage, e.g., leukemia and lymphoma, neuroectoderm, e.g., malignant gliomas, and soft tissue tumors, e.g., sarcomas.

Cancer Diagnostics and Prognostics

Microscopic evaluation of biopsy material from suspected tumors remains the golden standard for cancer diagnostics. To obtain a firm diagnosis, the tumor tissue is fixated in formalin, histo-processed and paraffin embedded. From the resulting paraffin block, tissue sections can be produced and stained using both histochemical, i.e., hematoxylin-eosin staining, and immunohistochemical (IHC) methods. The surgical specimen is then evaluated with pathology techniques, including gross and microscopic analysis. This analysis often forms the basis for assigning a specific diagnosis, i.e., classifying the tumor type and grading the degree of malignancy, of a tumor.

Malignant tumors can be categorized into several stages according to classification schemes specific for each cancer type. The most common classification system for solid tumors is the tumor-node-metastasis (TNM) staging system. The T stage describes the local extent of the primary tumor, i.e., how far the tumor has invaded and imposed growth into surrounding tissues, whereas the N stage and M stage describe how the tumor has developed metastases, with the N stage describing spread of tumor to lymph nodes and the M stage describing growth of tumor in other distant organs. Early stages include: T0-1, N0, M0, representing localized tumors with negative lymph nodes. More advanced stages include: T2-4, N0, M0, localized tumors with more widespread growth and T1-4, N1-3, M0, tumors that have metastasized to lymph nodes and T1-4, N1-3, M1, tumors with a metastasis detected in a distant organ. Staging of tumors is often based on several forms of examination, including surgical, radiological and histopathological analyses. In addition to staging, for most tumor types there is also a classification system to grade the level of malignancy. The grading systems rely on morphological assessment of a tumor tissue sample and are based on the microscopic features found in a given tumor. These grading systems may be based on the degree of differentiation, proliferation and atypical appearance of the tumor cells. Examples of generally employed grading systems include Gleason grading for prostatic carcinomas and the Nottingham Histological Grade (NHG) grading for breast carcinomas.

Accurate staging and grading is crucial for a correct diagnosis and may provide an instrument to predict a prognosis. The diagnostic and prognostic information for a specific tumor subsequently determines an adequate therapeutic strategy for a given cancer patient. A commonly used method, in addition to histochemical staining of tissue sections, to obtain more information regarding a tumor is immunohistochemical staining. IHC allows for the detection of protein expression patterns in tissues and cells using specific antibodies. The use of IHC in clinical diagnostics allows for the detection of immunoreactivity in different cell populations, in addition to the information regarding tissue architecture and cellular morphology that is assessed from the histochemically stained tumor tissue section. IHC can be involved in supporting the accurate diagnosis, including staging and grading, of a primary tumor as well as in the diagnostics of metastases of unknown origin. The most commonly used antibodies in clinical practice today include antibodies against cell type “specific” proteins, e.g., PSA (prostate), MelanA (melanocytes) and Thyroglobulin (thyroid gland), and antibodies recognizing intermediate filaments (epithelial, mesenchymal, glial), cluster of differentiation (CD) antigens (hematopoietic, sub-classification of lymphoid cells) and markers of malignant potential, e.g., Ki67 (proliferation), p53 (commonly mutated tumor suppressor gene) and HER-2 (growth factor receptor).

Aside from IHC, the use of in situ hybridization for detecting gene amplification and gene sequencing for mutation analysis are evolving technologies within cancer diagnostics. In addition, global analysis of transcripts, proteins or metabolites adds relevant information. However, most of these analyses still represent basic research and have yet to be evaluated and standardized for the use in clinical medicine.

Testicular Cancer

Although testicular cancer only accounts for approximately 1% of all male cancers, it is the most common cancer in men between 20 and 40 years of age. The incidence rate varies between regions: In Asia and Africa the disease is uncommon, with an age standardized incidence of approximately 1/100,000, but in the Nordic countries the incidence is relatively high compared to the rest of the world, with Denmark, Norway, and Sweden all in the top-ten in world incidence rates. Denmark has the highest incidence rate of approximately 10/100,000, Norway is close behind with approximately 9/100,000, and in Sweden the corresponding ratio is approximately 5/100,000. During the last 30 years, there has been a substantial increase in incidence in the western world, with as much as twice as many cases in some countries.

The majority of testicular cancers are germ cell tumors, and there are two main systems for classification of these tumors: The British Testicular Tumor Panel System (BTTP) and the WHO classification system. Most pathologists use the WHO system, since it is somewhat more comprehensive. The two main classes, according to both systems, are seminomas and non-seminomatous germ cell tumors (NSGCT). Seminomas are the most common pure germ cell tumors accounting for approximately 50% of germ cell tumors. Since these tumors are generally very sensitive to both radiation and chemotherapy the cure rate is high; for localized disease more than 95%, and for metastatic disease between 85 and 95%.

NSGCT can be divided into Embryonal carcinomas, Yolk sac tumors, Choriocarcinoma, and Teratomas. NSGCT are generally not as sensitive to radiation as seminomas, but with the exception of teratomas, most NSGCT are highly sensitive to platinum-based chemotherapy. The tumor specific 10-year survival is approximately 90% for NSGCT.

Tumor Markers

Among the prognostic tumor markers routinely measured are human chorionic gonadotropin (HCG), α-fetoprotein (AFP) and lactate dehydrogenase (LD).

HCG is a glucoprotein that is produced in the placenta, and it is present only in very small amounts in adults. It shares some similarity with other hormones, and false positives may therefore occur. Raised HCG-levels can be seen in 60-70% of patients with NSGCT and in 15-20% of patients with seminoma. Lightly raised levels can also be found in some other cancers.

AFP is another glucoprotein that is only present in low amounts in adults, it is normally produced in certain foetal tissues. In tumor tissue it is produced by yolk sac cells in NSGCT, but these cells are not present in seminomas. Raised AFP-levels in serum can be seen in 60-70% of patients with NSGCT. Somewhat raised levels can also be found in patients with other cancers.

Raised levels of either (or both) marker(s) can be seen in 60-80% of NSGCT patients, and both markers have prognostic value in advanced disease.

LD is an enzyme that is present in all human cells, and is thus a less specific marker than HCG and AFP. However, it may be of clinical value, especially in patients without other measurable tumor markers.

Diagnostic markers of pre-stages of testicular cancer include Placental-Like Alkaline Phosphatase (FLAP), Octamer-3/4 (OCT3/4) and RNA Binding Motif protein Y (RBMY).

Diagnosis of Testicular Cancer

Testicular cancer is normally diagnosed with ultrasound. If cancer cannot be excluded, orchiectomy (surgical removal of the testicle) is normally performed and the biopsy material is analyzed. A biopsy may also be taken from the contralateral testicle. Often, the level of tumor markers is also measured.

Staging of testicular cancer can be done according to several systems, one example is the Royal Marsden Hospital (RMH) system. In the RMH-system, stage I represents localized disease, stage I Mk+ represents raised levels of tumor markers, and in stage II(A-D) abdominal lymph nodes are involved. For stages I-IIB survival is nearly 100%. In stage III supradiaphragmatic lymph nodes are involved, and in stage IV there are metastases present outside the lymphatic system (normally lung metastases).

Prognostic Factors

Patients can be stratified into three prognostic groups, good-risk, intermediate-risk, and poor-risk, based on a classification scheme developed by the International Germ Cell Cancer Collaborative Group (IGCCCG). For NSGCT, the 5-year overall survival for the good-prognosis group can be more than 90% in some parts of the world, for the intermediate-prognosis group it can be around 75%, and for the poor-prognosis group it can be around 48%. For seminomas there is no poor-prognosis group, and the good-prognosis group covers 90% of patients with a 5-year overall survival of approximately 90%. The seminoma intermediate-prognosis group has a 5-year overall survival of 72%.

A number of risk factors have been identified, such as tumor marker increase (see above), size and number of metastases, number and type of metastatic sites, histopathology of the primary tumor, and age of the patient.

Treatment of Testicular Cancer

In stage I seminomas, radiation therapy may be given as adjuvant. In more advanced stages, chemotherapy is normally applied.

Patients with NSGCT are usually given chemotherapy as primary treatment. A frequently applied treatment is a combination treatment consisting of bleomycin, etoposide and cisplatin (BEP). With this treatment, 80% of patients with advanced NSGCT are cured, but the remaining 20% fail curative treatment.

SUMMARY OF THE PRESENT DISCLOSURE

The present disclosure can be summarized in the following itemized embodiments:

1. Method for determining whether a mammalian subject belongs to a first or a second group, wherein subjects of the first group have a higher risk of having a testicular disorder than subjects of the second group, comprising the steps of:

    • a) evaluating an amount of RBM3 protein or RBM3 mRNA in at least part of an earlier obtained sample comprising biological material from a testicle of said subject and determining a sample value corresponding to the evaluated amount;
    • b) comparing said sample value with a predetermined reference value; and
      • if said sample value is higher than said reference value,
    • c1) concluding that the subject belongs to the first group; and
      • if said sample value is lower than or equal to said reference value,
    • c2) concluding that the subject belongs to the second group.

2. Method according to item 1, wherein said sample comprises seminal fluid or cells from the testicle.

3. Method according to item 1 or 2, wherein said sample comprises tissue material from the testicle.

4. Method according to anyone of the preceding items, wherein the evaluation of step a) is limited to cells other than sertoli cells.

5. Method according to anyone of the preceding items, wherein the evaluation of step a) is limited to the nuclei of cells of said sample.

6. Method according to anyone of items 1-5, wherein the testicular disorder is selected from testicular cancer in situ, atrophy, and infertility.

7. Method for determining whether a mammalian subject having a testicular cancer belongs to a first or a second group, wherein the prognosis of subjects of the first group is better than the prognosis of subjects of the second group, comprising the steps of:

    • a) evaluating an amount of RBM3 protein or RBM3 mRNA in at least part of a sample earlier obtained from the subject and determining a sample value corresponding to the evaluated amount;
    • b) comparing said sample value with a predetermined reference value; and
      • if said sample value is higher than said reference value,
    • c1) concluding that the subject belongs to the first group; and
      • if said sample value is lower than or equal to said reference value,
    • c2) concluding that the subject belongs to the second group.

8. Method for determining the level of intensity of a treatment of a mammalian subject having a testicular cancer, comprising the steps of:

    • a) evaluating the amount of RBM3 protein or RBM3 mRNA present in at least part of a sample earlier obtained from said subject, and determining a sample value corresponding to said amount;
    • b) comparing the sample value obtained in step b) with a reference value; and,
    • if said sample value is higher than said reference value,
    • c1) concluding that said subject should be given a treatment of a first intensity; and
    • if said sample value is lower than or equal to said reference value,
    • c2) concluding that said subject should be given a treatment of a second intensity,
    • wherein the second intensity is higher than the first intensity.

9. Method according to item 8, wherein said treatment comprises a platinum-based treatment.

10. Method according to item 9, wherein said platinum-based treatment is selected from carboplatin, paraplatin, oxaliplatin, satraplatin, picoplatin and cisplatin treatment

11. Method according to item 7, wherein said prognosis is a probability of survival, such as overall survival, progression free survival or testicular cancer specific survival.

12. Method according to any one of items 7-11, wherein said testicular cancer is a testicular germ-cell cancer.

13. Method according to any one of items 7-12, wherein said testicular cancer is non-seminomatous.

14. Method according to any one of items 7-13, wherein said sample is a body fluid sample, stool sample or cytology sample.

15. Method according to item 14, wherein said body fluid sample is selected from the group consisting of blood, plasma, serum, cerebral fluid, urine, seminal fluid, semen and exudate.

16. Method according to any one of items 7-15, wherein said sample comprises tumor cells derived from a testicle of said subject.

17. Method according to any one of items 7-16, wherein said sample is a testicular cancer tissue sample.

18. Method according to item 16 or 17, wherein the evaluation of step a) is limited to the nuclei and/or cytoplasms of tumor cells of said sample.

19. Method according to any one of the preceding items, wherein said reference value is a value corresponding to a predetermined amount of RBM3 protein or RBM3 mRNA in a reference sample.

20. Method according to any one of the preceding items, wherein the sample value of step a) is determined as being either 1, corresponding to detectable RBM3 protein in the sample, or 0, corresponding to no detectable RBM3 protein in the sample.

21. Method according to any one of the preceding items, wherein the reference value of step b) corresponds to a reference sample having no detectable RBM3 protein.

22. Method according to any one of the preceding items, wherein the reference value of step b) is 0.

23. Method according to any one of the preceding items, wherein said reference value is a nuclear fraction, a nuclear intensity, cytoplasmic fraction, a cytoplasmic intensity or a combination thereof.

24. Method according to item 23, wherein said reference value is a nuclear or cytoplasmic fraction of 0-25%, such as 0-10%.

25. Method according to item 23, wherein said reference value is an absent or weak nuclear or cytoplasmic intensity.

26. Method according to any one of the preceding items, wherein the amino acid sequence of the RBM3 protein comprises a sequence selected from:

i) SEQ ID NO:1; and

ii) a sequence which is at least 85% identical to SEQ ID NO:1.

27. Method according to any one of the preceding items, wherein the amino acid sequence of the RBM3 protein comprises or consists of a sequence selected from:

i) SEQ ID NO:2; and

ii) a sequence which is at least 85% identical to SEQ ID NO:2.

28. Method according to any one of the preceding items, wherein step a) comprises:

aI) applying to said sample a quantifiable affinity ligand capable of selective interaction with the RBM3 protein to be evaluated, said application being performed under conditions that enable binding of the affinity ligand to RBM3 protein present in the sample; and

aII) quantifying the affinity ligand bound to said sample to evaluate said amount.

29. Method according to any one of items 1-27, wherein step a) comprises:

a1) applying to said sample a quantifiable affinity ligand capable of selective interaction with the RBM3 protein to be quantified, said application being performed under conditions that enable binding of the affinity ligand to RBM3 protein present in the sample;

a2) removing non-bound affinity ligand; and

a3) quantifying affinity ligand remaining in association with the sample to evaluate said amount.

30. Method according to item 28 or 29, wherein the quantifiable affinity ligand is selected from the group consisting of antibodies, fragments thereof and derivatives thereof.

31. Method according to item 30, wherein said quantifiable affinity ligand is obtainable by a process comprising a step of immunizing an animal with a peptide whose amino acid sequence consists of a sequence selected from SEQ ID NO:4 and 5.

32. Method according to item 30, wherein said quantifiable affinity ligand is obtainable by a process comprising a step of immunizing an animal with an RBM3 fragment which consists of 20 amino acids or less, such as 15 amino acids or less, and comprises a sequence selected from SEQ ID NO:6-19.

33. Method according to item 32, wherein said quantifiable affinity ligand is obtainable by a process comprising a step of immunizing an animal with an RBM3 fragment which consists of 20 amino acids or less, such as 15 amino acids or less, and comprises a sequence selected from SEQ ID NO:8, 16 and 17.

34. Method according to item 28 or 29, wherein said quantifiable affinity ligand is an oligonucleotide molecule.

35. Method according to item 28 or 29, wherein the quantifiable affinity ligand is a protein ligand derived from a scaffold selected from the group consisting of staphylococcal protein A and domains thereof, lipocalins, ankyrin repeat domains, cellulose binding domains, γ crystallines, green fluorescent protein, human cytotoxic T lymphocyte-associated antigen 4, protease inhibitors, PDZ domains, peptide aptamers, staphylococcal nuclease, tendamistats, fibronectin type III domain and zinc fingers.

36. Method according to any one of items 28-35, wherein said quantifiable affinity ligand is capable of selective interaction with a peptide whose amino acid sequence consists of a sequence SEQ ID NO:1.

37. Method according to any one of items 28-36, wherein said quantifiable affinity ligand is capable of selective interaction with a peptide consisting of an amino acid sequence selected from SEQ ID NO:4 and 5.

38. Method according to any one of items 28-37, wherein said quantifiable affinity ligand is capable of selective interaction with an RBM3 fragment which consists of 20 amino acids or less, such as 15 amino acids or less, and comprises an amino acid sequence selected from SEQ ID NO:6-19.

39. Method according to any one of items 28-38, wherein said quantifiable affinity ligand is capable of selective interaction with an RBM3 fragment which consists of 20 amino acids or less, such as 15 amino acids or less, and comprises a sequence selected from SEQ ID NO:8, 16 and 17.

40. Method according to any one of items 28-39, wherein said quantifiable affinity ligand comprises a label selected from the group consisting of fluorescent dyes and metals, chromophoric dyes, chemiluminescent compounds and bioluminescent proteins, enzymes, radioisotopes, particles and quantum dots.

41. Method according to any one of items 28-40, wherein said quantifiable affinity ligand is detected using a secondary affinity ligand capable of recognizing said quantifiable affinity ligand.

42. Method according to item 41, wherein said secondary affinity ligand is capable of recognizing said quantifiable affinity ligand comprises a label selected from the group consisting of fluorescent dyes and metals, chromophoric dyes, chemiluminescent compounds and bioluminescent proteins, enzymes, radioisotopes, particles and quantum dots.

43. Kit for carrying out a method according to item 1, which comprises

a) a quantifiable affinity ligand capable of selective interaction with an RBM3 protein; and

b) reagents necessary for quantifying the amount of said quantifiable affinity ligand

c) a quantifiable affinity ligand capable of selective interaction with a protein selected from Placental-Like Alkaline Phosphatase (PLAP), Octamer-3/4 (OCT3/4) and (RNA Binding Motif protein Y) RBMY; and

d) reagents necessary for quantifying the amount of the quantifiable affinity ligand of c),

wherein the reagents of b) and d) are the same or different.

44. Kit for carrying out a method according to item 7 or 8, which comprises

a) a quantifiable affinity ligand capable of selective interaction with an RBM3 protein; and

b) reagents necessary for quantifying the amount of said quantifiable affinity ligand

c) a quantifiable affinity ligand capable of selective interaction with a protein selected from human chorionic gonadotropin (HCG), α-fetoprotein (AFP) and lactate dehydrogenase (LD); and

d) reagents necessary for quantifying the amount of the quantifiable affinity ligand of c),

wherein the reagents of b) and d) are the same or different.

45. Kit according to item 43 or 44, in which said quantifiable affinity ligand is selected from the group consisting of antibodies, fragments thereof and derivatives thereof.

46. Kit according to item 45, in which said quantifiable affinity ligand is obtainable by a process comprising a step of immunizing an animal with a protein whose amino acid sequence consists of SEQ ID NO:1.

47. Kit according to item 45, in which said quantifiable affinity ligand is obtainable by a process comprising a step of immunizing an animal with a peptide whose amino acid sequence consists of an amino acid sequence selected from SEQ ID NO:4 and 5.

48. Kit according to item 45, in which said quantifiable affinity ligand is obtainable by a process comprising a step of immunizing an animal with an RBM3 fragment which consists of 20 amino acids or less, such as 15 amino acids or less, and comprises an amino acid sequence selected from SEQ ID NO:6-19.

49. Kit according to item 48, in which said quantifiable affinity ligand is obtainable by a process comprising a step of immunizing an animal with an RBM3 fragment which consists of 20 amino acids or less, such as 15 amino acids or less, and comprises an amino acid sequence selected from SEQ ID NO:8, 16 and 17.

50. Kit according to item 43 or 44, in which said quantifiable affinity ligand is a protein ligand derived from a scaffold selected from the group consisting of staphylococcal protein A and domains thereof, lipocalins, ankyrin repeat domains, cellulose binding domains, γ crystallines, green fluorescent protein, human cytotoxic T lymphocyte-associated antigen 4, protease inhibitors, PDZ domains, peptide aptamers, staphylococcal nuclease, tendamistats, fibronectin type III domain and zinc fingers.

51. Kit according to item 43 or 44, in which said quantifiable affinity ligand is an oligonucleotide molecule.

52. Kit according to any one of items 43-51, in which said quantifiable affinity ligand is capable of selective interaction with an RBM3 protein comprising, or consisting of, a sequence selected from:

i) SEQ ID NO:1; and

ii) a sequence which is at least 85% identical to SEQ ID NO:1.

53. Kit according to any one of items 43-52, in which said quantifiable affinity ligand is capable of selective interaction with an RBM3 protein comprising, or consisting of, a sequence selected from:

i) SEQ ID NO:2; and

ii) a sequence which is at least 85% identical to SEQ ID NO:2.

54. Kit according to any one of items 43-53, in which said quantifiable affinity ligand is capable of selective interaction with an RBM3 fragment consisting of an amino acid sequence selected SEQ ID NO:4 and 5.

55. Kit according to any one of items 43-54, in which said quantifiable affinity ligand is capable of selective interaction with an RBM3 fragment which consists of 20 amino acids or less, such as 15 amino acids or less, and comprises an amino acid sequence selected from SEQ ID NO:6-19.

56. Kit according to any one of items 43-55, in which said quantifiable affinity ligand is capable of selective interaction with an RBM3 fragment which consists of 20 amino acids or less, such as 15 amino acids or less, and comprises an amino acid sequence selected from SEQ ID NO:8, 16 and 17.

57. Kit according to any one of items 43-56, in which said quantifiable affinity ligand comprises a label selected from the group consisting of fluorescent dyes and metals, chromophoric dyes, chemiluminescent compounds and bioluminescent proteins, enzymes, radioisotopes, particles and quantum dots.

58. Kit according to any one of items 43-57, in which said reagents necessary for quantifying said amount of said quantifiable affinity ligand comprise a secondary affinity ligand capable of recognizing said quantifiable affinity ligand.

59. Kit according to item 58, in which said secondary affinity ligand comprises a label selected from the group consisting of fluorescent dyes or metals, chromophoric dyes, chemiluminescent compounds and bioluminescent proteins, enzymes, radioisotopes, particles and quantum dots.

60. Kit according to any one of items 43-59, further comprising at least one reference sample for provision of a reference value.

61. Kit according to item 60, in which at least one reference sample is a sample comprising no detectable RBM3 protein.

62. Kit according to item 60 or 61, in which at least one reference sample comprises RBM3 protein.

63. Kit according to any one of items 60-62, in which at least one reference sample comprises an amount of RBM3 protein corresponding to a nuclear or cytoplasmic fraction of 0-25%.

64. Kit according to any one of items 60-63, in which at least one reference sample comprises an amount of RBM3 protein corresponding to a absent or weak nuclear or cytoplasmic intensity.

65. Kit according to any one of items 60-64, in which at least one reference sample comprises an amount of RBM3 protein corresponding to a value being higher than said reference value.

66. Kit according to item 65, in which at least one reference sample comprises an amount of RBM3 protein corresponding to a strong nuclear or cytoplasmic intensity.

67. Kit according to item 65 or 66, in which at least one reference sample comprises an amount of RBM3 protein corresponding to a nuclear or cytoplasmic fraction of 75% or higher.

68. Kit according to any one of items 60-67, comprising:

a first reference sample comprising an amount of RBM3 protein corresponding to a value (positive reference value) being higher than a reference value; and

a second reference sample comprising an amount of RBM3 protein corresponding to a value (negative reference value) being lower than or equal to said reference value.

69. Kit according to any one of items 60-68, in which said reference sample comprises a cell line.

70. RBM3 protein fragment which consists of 50 amino acids or less and comprises an amino acid sequence selected from SEQ ID NO:4-19.

71. RBM3 protein fragment according to item 70, which consists of 29 amino acids or less.

72. RBM3 protein fragment according to item 70 or 71, which consists of 20 amino acids or less and comprises an amino acid sequence selected from SEQ ID NO:6-19.

73. RBM3 protein fragment according to item 72, which consists of 20 amino acids or less and comprises an amino acid sequence selected from SEQ ID NO:8, 16 and 17.

74. RBM3 protein fragment according to item 72 or 73, which consists of 15 amino acids or less.

75. Use in vitro of an RBM3 protein or an RBM3 mRNA molecule as a diagnostic marker for a testicular disorder, such as testicular cancer in situ.

76. Use according to item 75, wherein said protein is provided in a sample of testicular tissue, semen or seminal fluid.

77. Use in vitro of an RBM3 protein or an RBM3 mRNA molecule as a prognostic marker for testicular cancer.

78. Use according to item 77, wherein said protein is provided in a sample from a subject having a testicular cancer.

79. Use according to item 78, wherein said sample is a testicular cancer sample.

80. Use according to anyone of items 77-79, wherein said marker is a marker of a relatively good prognosis for testicular cancer.

81. Use in vitro of an RBM3 protein, or an antigenically active fragment thereof, for the selection or purification of a diagnostic agent for a testicular disorder, such as testicular cancer in situ, or a prognostic agent for establishing a prognosis for a mammalian subject having a testicular cancer.

82. Use of an RBM3 protein, or an antigenically active fragment thereof, for the production of a diagnostic agent for a testicular disorder, such as testicular cancer in situ, or a prognostic agent for establishing a prognosis for a mammalian subject having a testicular cancer.

83. Use according to item 81 or 82, wherein said prognostic agent is an affinity ligand capable of selective interaction with the RBM3 protein or the antigenically active fragment thereof.

84. Use according any one of items 75-83, wherein the amino acid sequence of the RBM3 protein comprises a sequence selected from:

i) SEQ ID NO:1; and

ii) a sequence which is at least 85% identical to SEQ ID NO:1.

85. Use according any one of items 75-84, wherein the amino acid sequence of the RBM3 protein comprises or consists of a sequence selected from:

i) SEQ ID NO:2; and

ii) a sequence which is at least 85% identical to SEQ ID NO:2.

86. Use of an antigenically active fragment according to any one of items 81-83, wherein the fragment is a fragment according to anyone of items 70-74.

87. Affinity ligand, which is obtainable by a process comprising a step of immunizing an animal with a peptide whose amino acid sequence consists of sequence SEQ ID NO:4 or 5 or a RBM3 protein fragment which consists of 20 amino acids or less, such as 15 amino acids or less, and comprises an amino acid sequence selected from SEQ ID NO:6-19.

88. Affinity ligand, which is obtainable by a process comprising a step of immunizing an animal with a peptide whose amino acid sequence consists of SEQ ID NO:5 or a RBM3 protein fragment which consists of 20 amino acids or less, such as 15 amino acids or less, and comprises a sequence selected from SEQ ID NO:8, 16 and 17.

89. Affinity ligand capable of selective interaction with a peptide whose amino acid sequence consists of SEQ ID NO:4 or 5 or an RBM3 fragment which consists of 20 amino acids or less, such as 15 amino acids or less, and comprises an amino acid sequence selected from SEQ ID NO:6-19.

90. Affinity ligand capable of selective interaction with a peptide whose amino acid sequence consists of SEQ ID NO:5 or an RBM3 fragment which consists of 20 amino acids or less, such as 15 amino acids or less, and comprises an amino acid sequence selected from SEQ ID NO:8, 16 and 17.

91. Use in vitro of an affinity ligand capable of selective interaction with an RBM3 protein as a diagnostic agent for a testicular disorder, such as testicular cancer in situ, or a prognostic agent for testicular cancer.

92. Use according to item 91, wherein the affinity ligand is an affinity ligand according to any one of items 87-90.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows Western blot results for Anti-RBM3, 1B5 and 6F11.

FIG. 2 shows RBM3 protein expression in testicular cancer patients. Patients were split into four different prognosis groups: poor prognosis, intermediate prognosis, good prognosis, and seminomas.

FIG. 3 shows the RBM3 protein expression in testicular cancer patients. Patients were split into two different groups: diseased or survived.

FIG. 4 shows Western blot results for, from left to right, 7F5, 10F1, 12A10, 12C9, 14D9 and anti-RBM3. Thus, lanes 1 through 5 show the monoclonal antibodies while lane 6 shows the polyclonal anti-RBM3 antibody.

FIG. 5 shows alignment of SEQ ID NO:4 as well as the peptides used for epitope mapping of the monoclonal antibodies.

 DESCRIPTION

As a first aspect of the present disclosure, there is provided a method for determining whether a mammalian subject belongs to a first or a second group, wherein subjects of the first group have a higher risk of having a testicular disorder than subjects of the second group, comprising the steps of:

    • a) evaluating an amount of RBM3 protein or RBM3 mRNA in at least part of an earlier obtained sample comprising biological material from a testicle of said subject, and determining a sample value corresponding to the evaluated amount;
    • b) comparing said sample value with a predetermined reference value; and
      • if said sample value is higher than said reference value,
    • c1) concluding that the subject belongs to the first group; and
      • if said sample value is lower than or equal to said reference value,
    • c2) concluding that the subject belongs to the second group.

This first aspect of the present disclosure is based on the inventors' finding that RBM3 generally is highly expressed in tissue of testicular cancer in situ, whereas the RBM3 expression in normal testicular tissue is generally low. The inventors thus conclude that the presence of RBM3 in biological material from a testicle is a marker of testicular cancer in situ, or of other conditions associated with an elevated risk for subsequent development of testicular cancer. Based partly on the findings of the present disclosure and partly on data published by other researchers, the inventors further conclude that RBM3 is likely to be a marker for testicular disorders in general, not only of pre-stages of testicular cancer. Examples of other testicular disorders are atrophy and sertoli cell-only syndrome, which are associated with infertility or cancer risk. Without being limited by any specific scientific theory, the inventors believe that the RBM3 may be an oncogene that is turned on as a protection against testicular disorders.

This finding may find various applications. Firstly, subjects showing high RBM3 expression in a testicle may be closely monitored and/or further examined (e.g. with ultra sound), and possibly, the testicle in question may be surgically removed to avoid development and spread of cancer. Further, if a subject is diagnosed with cancer in one testicle, an RBM3 measurement may indicate if the other testicle is also at risk of developing cancer. Also, it may be particularly relevant to monitor subjects having cryptorchidism with RBM3 measurements according to the present disclosure, because such subjects already have an elevated risk of developing cancer.

The biological material of the sample of step a) of the first aspect may comprise seminal fluid or cells from the testicle. Further, the cells may for example be part of tissue material from the testicle. The tissue material may be obtained from a previously performed testicle biopsy. Such biopsies are often performed when a subject shows symptoms of a testicle disorder or during a fertility examination. Collection of seminal fluid may be a more convenient way of obtaining biological material from the testicle, which also saves the subject the discomfort of the biopsy.

In embodiments of the first aspect, the evaluation of step a) may be limited to cells other than sertoli cells. The inventors have found that sertoli cells of normal testicular tissue express some RBM3 protein, and the precision of the method of the first aspect may thus be increased if sertoli cells are excluded from the evaluation of step a). An example of cells other than sertoli cells that may be relevant in the evaluation is spermatogonia or more differentiated forms thereof.

Further, the inventors have found that cells of testicular cancer in situ primarily (but not exclusively) express RBM3 protein in the nucleus. In embodiments of the first aspect, the evaluation of step a) may thus be limited to the nuclei of cells of said sample.

It follows from the discussion above that, according to one embodiment of the first aspect, the difference between the first and the second group may be that subjects of the first group have a higher risk of having testicular cancer in situ than subjects of the second group.

In a similar embodiment, the difference between the first and the second group may be that subjects of the first group have a higher risk of developing testicular cancer, such as a testicular germ-cell tumor, than subjects of the second group.

A physician assessing the risk of a subject developing cancer may assign to someone else, such as a lab worker, to perform step a), and optionally step b) of the method of the first aspect, while performing step c), and optionally b), himself.

As indicated in the background section, the cure rate of subjects diagnosed with testicular cancer is comparatively high. Accordingly, the inventors conclude that there is an interest in even better stratification of patients to avoid over treatment in low-risk groups, and focusing the more intense treatment strategies on the patients that are in most need of them.

As a second aspect of the present disclosure, there is thus provided a method for determining whether a mammalian subject having a testicular cancer belongs to a first or a second group, wherein the prognosis of subjects of the first group is better than the prognosis of subjects of the second group, comprising the steps of:

    • a) evaluating an amount of RBM3 protein or RBM3 mRNA in at least part of a sample earlier obtained from the subject and determining a sample value corresponding to the evaluated amount;
    • b) comparing said sample value with a predetermined reference value; and
      • if said sample value is higher than said reference value,
    • c1) concluding that the subject belongs to the first group; and
      • if said sample value is lower than or equal to said reference value,
    • c2) concluding that the subject belongs to the second group.

This second aspect of the present disclosure is based on the inventors' finding that testicular cancer subjects showing high levels of RBM3 expression generally have a greater chance of survival than such subjects showing low levels of RBM3 expression. In addition to being a diagnostic marker of a testicular disorder (such as testicular cancer in situ), RBM3 is thus a prognostic marker for testicular cancer.

The suggested protective role of the RBM3 (see above) may explain why it is up-regulated in pre-stages of testicular cancer and in testicular cancers of good prognosis. Accordingly, the low RBM3 protein levels in testicular cancers of poor prognosis may be an indication of malfunctioning protection against the cancer.

The prognostic indication entails a number of benefits. For example, prognostic information may form the basis of a physician's decision regarding the treatment of a subject. The prognosis for a testicular cancer subject normally reflects the level of aggressiveness of the cancer and, if a particularly aggressive form of a cancer is identified, a painful or in any other sense unpleasant treatment which normally is avoided may anyway be considered. Further, if less aggressive forms can be identified, over-treatment may be avoided. As a further example, the RBM3 protein or the RBM3 mRNA has a great potential for example in a panel for making predictions or prognoses or for the selection of a treatment regimen.

In the method of the second aspect, it is determined whether a testicular cancer subject belongs to a first or a second group, wherein subjects of the first group generally have a better prognosis than subjects of the second group. The division of testicular cancer subjects into the two groups is determined by comparing samples values from the subjects with a reference value. The reference value is thus the determinant for the size of the respective groups; the higher the reference value, the fewer the subjects in the first group and the lower the likelihood that a tested subject belongs to the first group. As the prognosis generally improves as the sample value increases, a high reference value may in some instances be selected to identify subjects with a particularly good prognosis. Guided by the present disclosure, the person skilled in the art may select relevant reference values without undue burden. This is further discussed below.

The first and the second group may consist exclusively of subjects having testicular cancers of the same or similar stage, differentiation grade and/or subtype as the tested subject. Further, the groups may consist only of subjects having the same or similar age, race, geographic residence, genetic characteristics or medical status or history, such as testicular cancer history.

Consequently, a physician may use the method according to the second aspect to obtain additional information regarding the prognosis of an testicular cancer subject, which in turn may help him to select the most appropriate treatment regimen. For example, a subject shown to belong to the first group using the method of the second aspect may be given a less aggressive treatment than what would otherwise have been considered, and vice versa.

As a third aspect of the present disclosure, there is thus provided a method for determining the level of intensity of a treatment of a mammalian subject having a testicular cancer, comprising the steps of:

    • a) evaluating the amount of RBM3 protein or RBM3 mRNA present in at least part of a sample earlier obtained from said subject, and determining a sample value corresponding to said amount;
    • b) comparing the sample value obtained in step b) with a reference value; and,
    • if said sample value is higher than said reference value,
    • c1) concluding that said subject should be given a treatment of a first intensity; and
    • if said sample value is lower than or equal to said reference value,
    • c2) concluding that said subject should be given a treatment of a second intensity,
    • wherein the second intensity is higher than the first intensity.

The level of intensity may for example be measured as the average daily or weekly dose of a therapeutic agent given to the subject. A treatment of the second intensity may thus be applied more frequently or in higher individual doses than a treatment of the first intensity. The treatment of the second intensity may also comprise application of a more aggressive therapy than the treatment of the first intensity. For example, the treatment of the second intensity may be a combination treatment while the treatment of the first intensity is a mono-therapy. Yet another possibility is that the treatment of the second intensity is applied for a longer period than the treatment of the first intensity.

In an embodiment of the third aspect, c1) may thus be concluding that said subject should undergo treatment during a first period and c2) may be concluding that said subject should undergo treatment during a second period, wherein the second period is longer than the first period.

Platinum-based treatment is frequently applied to testicular cancer subjects. A platinum-based treatment comprises application of a platinum-based therapeutic agent. Carboplatin including paraplatin, oxaliplatin, satraplatin, picoplatin and cisplatin are some platinum-based therapeutic agents tested or used in the clinic today.

In embodiments of the third aspect, the platinum-based treatment may thus be application of an agent selected from carboplatin, oxaliplatin, satraplatin, picoplatin and cisplatin.

The treatment of the first intensity may for example be application of a combination of bleomycin, etoposide and cisplatin whereas the treatment of the first intensity may be application of only one or two of these agents.

In the context of the present disclosure, “prognosis” refers to the prediction of the course or outcome of a disease and its treatment. For example, prognosis may also refer to a determination of chance of survival or recovery from a disease, as well as to a prediction of the expected survival time of a subject. A prognosis may specifically involve establishing the likelihood for survival of a subject during a period of time into the future, such as three years, five years, ten years or any other period of time. A prognosis may further be represented by a single value or a range of values.

In embodiments, the prognosis may be a probability of survival. There are several ways to measure “survival”. The survival of the present disclosure may for example be overall survival, progression free survival or testicular cancer specific survival. Further, the “survival” may be measured over different periods, such as five, ten or 15 years. Accordingly, the survival may be a five-year, ten-year or 15-year survival.

The samples of Examples below are from testicular germ-cell cancers. In embodiments of the second or third aspect, the testicular cancer is thus a testicular germ-cell cancer.

In general, subjects having seminomatous testicular cancer have a very good prognosis. It may thus be more relevant to establish a prognosis for a subject having a non-seminomatous testicular cancer. Further, RBM3 is shown to be prognostically relevant for such subjects in Examples below. In embodiments of the second or third aspect, the testicular cancer may thus be non-seminomatous.

In embodiments of the method of the second or third aspect, the sample may be a body fluid sample. For example, the body fluid sample may be selected from the group consisting of blood, plasma, serum, cerebral fluid, urine, seminal fluid, semen, lymph and exudate. Alternatively, the sample may be a cytology sample or a stool sample.

The level of expression of RBM3 protein or RBM3 mRNA may preferably be measured intracellularly or in sample derived from cells. Thus, the body fluid, cytology or stool sample may for example comprise cells, such as tumor cells derived from a testicle of the subject

In further embodiments of the method of the second or third aspect, the sample may be a testicular tumor tissue sample, e.g. from an earlier surgical removal of a testicle.

Further, the inventors have noted that nuclear expression of RBM3 protein is particularly relevant for determining prognoses or selecting treatments.

Thus, the evaluation of step a) of the second or third aspect may be limited to the nuclei of tumor cells of said sample. Consequently, when a tissue sample is examined, only the nuclei of tumor cells may be taken into consideration. Such examination may for example be aided by immunohistochemical staining.

Regarding step a) of the methods of the present disclosure, an increase in the amount of RBM3 protein or RBM3 mRNA typically results in an increase in the sample value, and not the other way around. However, in some embodiments, the evaluated amount may correspond to any of a predetermined number of discrete sample values. In such embodiments, a first amount and a second, increased, amount may correspond to the same sample value. In any case, an increase in the amount of RBM3 protein or RBM3 mRNA will not result in a decrease in the sample value in the context of the present disclosure.

However inconvenient, but in an equivalent fashion, the evaluated amounts may be inversely related to sample values if the qualification between step b) and c) is inverted. For example, the qualification between step b) and c1) is inverted if the phrase “if the sample value is higher than the reference value” is replaced with “if the sample value is lower than the reference value”.

In general, when deciding on a suitable treatment strategy for a patient having testicular cancer, the physician responsible for the treatment may take several parameters into account, such as the result of an immunohistochemical evaluation, patient age, tumor subtype, stage and grade, general condition and medical history, such as testicular cancer history. To be guided in the decision, the physician may perform a test, or order a test performed, according to the second or third aspect. Further, the physician may assign to someone else, such as a lab worker, to perform step a), and optionally step b), while performing step c), and optionally b), himself.

Further, in the context of the methods of the present disclosure, “earlier obtained” refers to obtained before the method is performed. Consequently, if a sample earlier obtained from a subject is used in a method, the method does not involve obtaining the sample from the subject, i.e., the sample was previously obtained from the subject in a step separate from the method.

Except otherwise stated, all the methods and uses of the present disclosure, may be carried out entirely in vitro.

Further, in the context of the present disclosure, “a mammalian subject having a testicular cancer” refers to a mammalian subject having a testicular tumor or a mammalian subject which has had a testicular tumor removed, wherein the removal of the tumor refers to killing or removing the tumor by any appropriate type of surgery or therapy. In the method and use aspects of the present disclosure, “a mammalian subject having testicular cancer” also includes the cases wherein the mammalian subject is suspected of having a testicular cancer at the time of the performance of the use or method and the testicular cancer diagnosis is established later.

Further, in the context of the present disclosure, the “reference value” refers to a predetermined value found to be relevant for making decisions or drawing conclusions regarding the diagnosis, prognosis or a suitable treatment strategy for the subject.

Step a) of the methods of the above aspects involve evaluating an amount of RBM3 protein or RBM3 mRNA present in at least part of the sample, and determining a sample value corresponding to the amount. The “at least part of the sample” refers to a relevant part or relevant parts of the sample for establishing the diagnosis or prognosis or drawing conclusions regarding suitable treatments. The person skilled in the art understands which part or parts that are relevant under the circumstances present when performing the method.

Further, in step a) an amount is evaluated and a sample value corresponding to the amount is determined. Consequently, an exact measurement of the amount of RBM3 protein or RBM3 mRNA is not required for obtaining the sample value. For example, the amount of RBM3 protein may be evaluated by visual inspection of a stained tissue sample and the sample value may then be categorized as for example “high” or “low” based on the evaluated amount.

The person skilled in the art understands how to perform such evaluation and determination. Further, the present disclosure provides guidance.

The evaluation and determination of step a) requires some kind of processing or manipulation of the sample. It is not possible to determine the sample value by mere inspection. Various techniques, of which some are presented below, for such evaluation and determination, are well known to the skilled person. The methods of the present disclosure are therefore not limited to any specific technique or techniques for the performance of step a).

When performing the methods according to the above aspects, it may be convenient to use zero as the reference value, because in such case, it has only to be established in step a) whether RBM3 protein or RBM3 mRNA is present in the sample or not.

Thus, in embodiments of the methods of the above aspects, the sample value of step a) may be either 1, corresponding to detectable RBM3 protein in the sample, or 0, corresponding to no detectable RBM3 protein in the sample. Consequently, in such embodiments, the evaluation of the sample is digital: RBM3 protein is considered to be either present or not. In the context of the present disclosure, “no detectable RBM3 protein” refers to an amount of RBM3 protein that is so small that it is not, during normal operational circumstances, detectable by a person or an apparatus performing the step a). The “normal operational circumstances” refer to the laboratory methods and techniques a person skilled in the art would find appropriate for performing the methods of the present disclosure.

Accordingly, in embodiments of the methods of the present disclosure, the reference value of step b) may be 0. And it follows that, in further embodiments of the methods of the present disclosure, the reference value of step b) may correspond to a reference sample having no detectable RBM3 protein or RBM3 mRNA (see below).

In the context of the present disclosure, the terms “sample value” and “reference value” are to be interpreted broadly. The quantification of RBM3 protein or RBM3 mRNA to obtain these values may be done via automatic means, via a scoring system based on visual or microscopic inspection of samples, or via combinations thereof. However, it is also possible for a skilled person, such as a person skilled in the art of histopathology, to determine the sample and reference values by inspection, e.g., of tissue slides that have been prepared and stained for RBM3 protein expression. Determining that the sample value is higher than the reference value may thus correspond to determining, upon visual or microscopic inspection, that a sample tissue slide is more densely stained than a reference tissue slide. The sample value may also be compared to a reference value given by a literal reference, such as a reference value described in wording or by a reference picture. Consequently, the sample and/or reference values may in some cases be mental values that the skilled person determines upon inspection and comparison.

One or more of the steps of the methods of the present disclosure may be implemented in an apparatus. For example, step a) and optionally step b) may be performed in an automatic analysis apparatus, and such apparatus may be based on a platform adapted for immunohistochemical analysis. As an example, one or more tissue sample(s) from the subject in question may be prepared for immunohistochemical analysis manually and then loaded into the automatic analysis apparatus, which gives the sample value of step a) and optionally also performs the comparison with the reference value of step b). The operator performing the analysis, the physician ordering the analysis or the apparatus itself may then draw the conclusion of step c). Consequently, software adapted for drawing the conclusion of step c) may be implemented on the apparatus.

A reference value, found to be relevant for establishing a diagnosis or prognosis or making treatment decisions, for use as comparison with the sample value from the subject, may be provided in various ways. With the knowledge of the teachings of the present disclosure, the skilled artisan can, without undue burden, provide relevant reference values for performing the methods of the present disclosure.

The person performing the methods of the above aspects may, for example, adapt the reference value to the desired information. Referring to the second aspect, the reference value may for example be adapted to yield the most significant information with regard to survival.

In embodiments of the method of the first aspect, the reference value may correspond to the amount of RBM3 protein or RBM3 mRNA measured in a reference sample of normal testicular tissue. The amount of protein expression of the reference sample may be previously established.

In embodiments of the method of the second or third aspect, the reference value may correspond to the amount of RBM3 protein or RBM3 mRNA measured in a reference sample comprising or being derived from tumor cells, such as a reference sample of tumor tissue. The amount of protein expression of the reference sample may preferably be previously established.

Consequently, the reference value may be provided by the amount of RBM3 protein or RBM3 mRNA measured in a reference sample comprising (or being derived from) cells expressing a predetermined amount of RBM3 protein or RBM3 mRNA.

Further, the reference value may for example be provided by the amount of RBM3 protein or RBM3 mRNA measured in a reference sample comprising cell lines, such as cancer cell lines, expressing a predetermined, or controlled, amount of RBM3 protein or RBM3 mRNA. The person skilled in the art understands how to provide such cell lines, for example guided by the disclosure of Rhodes et al. (2006) The biomedical scientist, p 515-520.

Consequently, in embodiments of the methods of the present disclosure, the reference value may be a predetermined value corresponding to the amount of RBM3 protein or RBM3 mRNA in a reference sample.

However, as discussed further below, the amount of RBM3 protein in the reference sample does not have to directly correspond to the reference value. The reference sample may also provide an amount of RBM3 protein that helps a person performing the method to assess various reference values. For example, the reference sample(s) may help in creating a mental image of the reference value by providing a “positive” reference value and/or a “negative” reference value.

One alternative for the quantification of RBM3 protein expression in a sample, such as the sample earlier obtained from the subject or the reference sample, is the determination of the fraction of cells in the sample that exhibit RBM3 protein expression over a certain level. The fraction may for example be: a “cellular fraction”, wherein the RBM3 protein expression of the whole cells is taken into account; a “cytoplasmic fraction”, wherein the RBM3 protein expression of only the cytoplasms of the cells is taken into account; or a “nuclear fraction”, wherein the RBM3 protein expression of only the nuclei of the cells is taken into account. The nuclear or cytoplasmic fraction may for example be classified as <2%, 2-25%, >25-75% or >75% immunoreactive cells of the relevant cell population. The “cytoplasmic fraction” corresponds to the percentage of relevant cells in a sample that exhibits a positive staining in the cytoplasm, wherein a medium or distinct and strong immunoreactivity in the cytoplasm is considered positive and no or faint immunoreactivity in the cytoplasm is considered negative. The “nuclear fraction” corresponds to the percentage of relevant cells in a sample that exhibits a positive staining in the nucleus, wherein a medium or distinct and strong immunoreactivity in the nucleus is considered positive and no or faint immunoreactivity in the nucleus is considered negative. The person skilled in the art of pathology understands which cells that are relevant under the conditions present when performing the method and may determine a cytoplasmic or nuclear fraction based on his general knowledge and the teachings of the present disclosure. Further, the skilled artisan understands how to perform corresponding measurements employing the “cellular fraction”.

Another alternative for the quantification of RBM3 protein expression in a sample, such as the sample earlier obtained from the subject or the reference sample, is the determination of the overall staining intensity of the sample. The intensity may for example be: a “cellular intensity”, wherein the RBM3 protein expression of the whole cells is taken into account; a “cytoplasmic intensity”, wherein the RBM3 protein expression of only the cytoplasms of the cells is taken into account, or a “nuclear intensity”, wherein the RBM3 protein expression of only the nuclei of the cells is taken into account. Cytoplasmic and nuclear intensity is subjectively evaluated in accordance with standards used in clinical histopathological diagnostics. Outcome of a cytoplasmic intensity determination may be classified as: absent=no overall immunoreactivity in the cytoplasms of relevant cells of the sample, weak=faint overall immunoreactivity in the cytoplasms of relevant cells of the sample, moderate=medium overall immunoreactivity in the cytoplasms of relevant cells of the sample, or strong=distinct and strong overall immunoreactivity in the cytoplasms of relevant cells of the sample. Outcome of a nuclear intensity determination may be classified as: absent=no overall immunoreactivity in the nuclei of relevant cells of the sample, weak=faint overall immunoreactivity in the nuclei of relevant cells of the sample, moderate=medium overall immunoreactivity in the nuclei of relevant cells of the sample, or strong=distinct and strong overall immunoreactivity in the nuclei of relevant cells of the sample. In some embodiments, the weak and moderate values may be combined into a weak/moderate value. The person skilled in the art understands which cells that are relevant under the conditions present when performing the method and may determine a nuclear or cytoplasmic intensity based on his general knowledge and the teachings of the present disclosure. Further, the skilled artisan understands how to perform corresponding measurements employing the “cellular intensity”.

Although RBM3 protein is expressed in both the nucleus and the cytoplasm of testicular cells, the inventors have found that the nuclear expression may be particularly relevant. In embodiments of the methods of the above aspects, the reference value may thus be a nuclear fraction, a nuclear intensity or a combination thereof. Accordingly, the sample value may be a nuclear fraction, a nuclear intensity or a combination thereof.

As indicated in the figures, various fractions and intensities may function as a relevant reference value.

Thus, in embodiments of the methods of the above aspects, the criterion for the conclusion in step c) is that the sample value is higher than a nuclear or cytoplasmic fraction of 0%, 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 75%, 80%, 90% or 95%.

In alternative or complementing embodiments of the methods of the above aspects, the reference value of step b) is a nuclear or cytoplasmic fraction of 95% or lower, such as 90% or lower, such as 85% or lower, such as 80% or lower, such as 75% or lower, such as 70% or lower, such as 65% or lower, such as 60% or lower, such as 55% or lower, such as 50% or lower, such as 45% or lower, such as 40% or lower, such as 35% or lower, such as 30% or lower, such as 25% or lower, such as 20% or lower, such as 15% or lower, such as 10% or lower, such as 5% or lower, such as 2% or lower, such as 1% or lower, such as 0%.

Further, in embodiments of the methods of the above aspects, the criterion for the conclusion in step c) may be a sample value, which is higher than absent cytoplasmic or nuclear intensity, such as higher than weak cytoplasmic or nuclear intensity, such as higher than moderate cytoplasmic or nuclear intensity. In alternative or complementing embodiments of the methods of the above aspects, the reference value of step b) may be a moderate cytoplasmic or nuclear intensity of RBM3 protein expression or lower, such as a weak cytoplasmic or nuclear intensity of RBM3 protein expression or lower, such as an absent cytoplasmic or nuclear intensity.

Also, in embodiments of the methods of the above aspects, the reference value may be a combination or a function of a fraction value and an intensity value. The reference value may thus involve two, and even more, criteria.

In general, the selection of an intensity value and/or a fraction value as the reference value may depend on the staining procedure, e.g., on the type and amount/concentration of the employed antibody and on the type and concentration of the staining reagents.

The inventors have found that a relatively low reference value may be particularly relevant for making diagnostic conclusions according to the first aspect, especially if the monoclonal antibody 1B5 (see below) is employed. Here, “relatively low” reference values refer to nuclear or cytoplasmic fractions of 25% or lower, such as 10% or lower, a weak nuclear or cytoplasmic intensity or lower, such as an absent nuclear or cytoplasmic intensity or a staining score (SS, see Examples, section 8a) of 1 or lower, such as 0.

In Examples, section 8, it is shown that 100% of the testicular cancer subjects showing the highest levels of RBM3 protein expression survived and in Examples, section 9, all subjects diagnosed with testicular cancer in situ showed the highest levels of RBM3 protein expression. Thus, a relatively high reference value may also be particularly relevant for making diagnostic or prognostic conclusions according to the above aspects. Here, a “relatively high” reference value refer to nuclear or cytoplasmic fractions of 50% or higher, a moderate nuclear or cytoplasmic intensity or a staining score (SS, see Examples, section 8A) of 2.

Guided by the present disclosure, a person skilled in the art, e.g., a pathologist understands how to perform the evaluation yielding a fraction, such as a cellular, cytoplasmic or nuclear fraction, or an intensity, such as a cellular, cytoplasmic or nuclear intensity. For example, the skilled artisan may use a reference sample comprising a predetermined amount of RBM3 protein for establishing the appearance of a certain fraction or intensity.

However, a reference sample may not only be used for the provision of the actual reference value, but also for the provision of an example of a sample with an amount of RBM3 protein that is higher than the amount corresponding to the reference value. As an example, in histochemical staining, such as in immunohistochemical staining, the skilled artisan may use a reference sample for establishing the appearance of a stained sample having a high amount of RBM3 protein, e.g., a positive reference. Subsequently, the skilled artisan may assess the appearances of samples having lower amounts of RBM3 protein, such as the appearance of a sample with an amount of RBM3 protein corresponding to the reference value. In other words, the skilled artisan may use a reference sample to create a mental image of a reference value corresponding to an amount of RBM3 protein which is lower than that of the reference sample. Alternatively, or as a complement, in such assessments, the skilled artisan may use another reference sample having a low amount of RBM3 protein, or lacking detectable RBM3 protein, for establishing the appearance of such sample, e.g., as a “negative reference”.

For example, if a moderate nuclear intensity is used as the reference value, two reference samples may be employed: a first reference sample having no detectable RBM3 protein, and thus corresponding to an absent nuclear intensity, which is lower than the reference value; and a second reference sample having an amount of RBM3 protein corresponding to a strong nuclear intensity, which is higher than the reference value.

Consequently, in the evaluation, the skilled artisan may use a reference sample for establishing the appearance of a sample with a high amount of RBM3 protein. Such reference sample may be a sample comprising tissue expressing a high amount of RBM3 protein, such as a sample comprising tissue having a pre-established high expression of RBM3 protein.

Accordingly, the reference sample may provide an example of a strong nuclear intensity (NI). With the knowledge of the appearance of a sample with strong NI, the skilled artisan may then divide samples into the NI categories absent, weak, moderate and strong. This division may be further assisted by a reference sample lacking detectable RBM3 protein (negative reference), i.e., a reference sample providing an absent nuclear intensity. Also, the reference sample may provide an example of a sample with a nuclear fraction (NF) higher than 75%. With the knowledge of the appearance of a sample with more than 75% positive cells, the skilled artisan may then evaluate the NF of other samples having e.g., a lower percentage of positive cells. This division may be further assisted by a reference sample essentially lacking RBM3 protein (negative reference), i.e., a reference sample providing a low NF (e.g., <5%, such as <2%), or a NF of 0.

As mentioned above, cell lines expressing a controlled amount of RBM3 protein may be used as the reference, in particular as a positive reference.

One or more pictures may also be provided as the “reference sample”. For example, such a picture may show an example of a tissue slide stained with a certain antibody during certain conditions and exhibiting a certain nuclear intensity and/or fraction. The above discussion about the “reference sample” applies mutatis mutandis to pictures.

The cell lines or pictures may also form part of the kit according to the present disclosure (see below).

Further, the skilled person should recognize that the usefulness of the methods according to the above aspects is not limited to the quantification of any particular variant of the RBM3 protein present in the subject in question, as long as the protein is encoded by the relevant gene and presents the relevant pattern of expression. As a non-limiting example, the RBM3 protein may comprise a sequence selected from:

i) SEQ ID NO:1; and

ii) a sequence which is at least 85% identical to SEQ ID NO:1.

In some embodiments, sequence ii) above is at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical or at least 99% identical to SEQ ID NO:1.

As another non-limiting example, the RBM3 protein may comprise, or consists of, a sequence selected from:

i) SEQ ID NO:2; and

ii) a sequence which is at least 85% identical to SEQ ID NO:2.

In some embodiments, sequence ii) above is at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical or at least 99% identical to SEQ ID NO:2.

The term “% identical”, as used in the context of the present disclosure, is calculated as follows. The query sequence is aligned to the target sequence using the CLUSTAL W algorithm (Thompson, J. D., Higgins, D. G. and Gibson, T. J., Nucleic Acids Research, 22: 4673-4680 (1994)). The amino acid residues at each position are compared, and the percentage of positions in the query sequence that have identical correspondences in the target sequence is reported as % identical. Also, the target sequence determines the number of positions that are compared. Consequently, in the context of the present disclosure, a query sequence that is shorter than the target sequence can never be 100% identical to the target sequence. For example, a query sequence of 85 amino acids may at the most be 85% identical to a target sequence of 100 amino acids.

In some embodiments, step a) of the methods of the above aspects may comprise:

obtaining biological material from the subject, excising or selecting a relevant part of the biological material to obtain said sample and optionally arranging the sample on a solid phase to facilitate the evaluation of step a). Step a) may thus, as an example, comprise obtaining tissue material from the subject, optionally fixating the tissue material in paraffin or formalin, histo-processing the tissue material to obtain a section which constitute said sample and optionally mounting said sample on a transparent slide, such as a glass slide, for microscopy.

In embodiments of the methods of the aspects above, the RBM3 protein may be detected and/or quantified through the application to the sample of a detectable and/or quantifiable affinity ligand, which is capable of selective interaction with the RBM3 protein. The application of the affinity ligand is performed under conditions that enable binding of the affinity ligand to RBM3 protein in the sample.

To concretize, in embodiments of the methods of the aspects above, step a) may comprise:

a1) applying to said sample a quantifiable affinity ligand capable of selective interaction with the RBM3 protein to be evaluated, said application being performed under conditions that enable binding of said affinity ligand to RBM3 protein present in said sample;

a2) removing non-bound affinity ligand; and

a3) quantifying the affinity ligand remaining in association with said sample to evaluate said amount.

“Affinity ligand remaining in association with the sample” refers to affinity ligand which was not removed in step a2), e.g., the affinity ligand bound to the sample. Here, the binding may for example be the interaction between antibody and antigen.

However, in some embodiments, the removal of non-bound affinity ligand according to a2), e.g. the washing, is not always necessary. Thus, in some embodiments of the methods of the aspects above, step a) may comprise:

aI) applying to said sample a quantifiable affinity ligand capable of selective interaction with the RBM3 protein to be evaluated, said application being performed under conditions that enable binding of said affinity ligand to RBM3 protein present in said sample;

aII) quantifying the affinity bound to said sample to evaluate said amount.

In the context of the present disclosure, “specific” or “selective” interaction of e.g., an affinity ligand with its target or antigen means that the interaction is such that a distinction between specific and non-specific, or between selective and non-selective, interaction becomes meaningful. The interaction between two proteins is sometimes measured by the dissociation constant. The dissociation constant describes the strength of binding (or affinity) between two molecules. Typically the dissociation constant between an antibody and its antigen is from 10−7 to 10−11 M. However, high specificity/selectivity does not necessarily require high affinity. Molecules with low affinity (in the molar range) for its counterpart have been shown to be as selective/specific as molecules with much higher affinity. In the case of the present disclosure, a specific or selective interaction refers to the extent to which a particular method can be used to determine the presence and/or amount of a specific protein, the target protein, under given conditions in the presence of other proteins in a tissue sample or fluid sample of a naturally occurring or processed biological fluid. In other words, specificity or selectivity is the capacity to distinguish between related proteins. Specific and selective are sometimes used interchangeably in the present description. For example, the specificity or selectivity of an antibody may be determined as in Examples, Section 2, below, wherein analysis is performed using a protein array set-up, a suspension bead array and a multiplexed competition assay, respectively. Specificity and selectivity determinations are also described in Nilsson P et al. (2005) Proteomics 5:4327-4337.

It is regarded as within the capabilities of those of ordinary skill in the art to select or manufacture the proper affinity ligand and to select the proper format and conditions for detection and/or quantification. Nevertheless, examples of affinity ligands that may prove useful, as well as examples of formats and conditions for detection and/or quantification, are given below for the sake of illustration.

Thus, in embodiments of the present disclosure, the affinity ligand may be selected from the group consisting of antibodies, fragments thereof and derivatives thereof, i.e., affinity ligands based on an immunoglobulin scaffold. The antibodies and the fragments or derivatives thereof may be isolated. Antibodies comprise monoclonal and polyclonal antibodies of any origin, including murine, rabbit, human and other antibodies, as well as chimeric antibodies comprising sequences from different species, such as partly humanized antibodies, e.g., partly humanized mouse antibodies. Polyclonal antibodies are produced by immunization of animals with the antigen of choice. The polyclonal antibodies may be mono-specific. Monoclonal antibodies of defined specificity can be produced using the hybridoma technology developed by Köhler and Milstein (Köhler G and Milstein C (1976) Eur. J. Immunol. 6:511-519). The antibody fragments and derivatives of the present disclosure are capable of selective interaction with the same antigen (e.g. RBM3 protein) as the antibody they are fragments or derivatives of. Antibody fragments and derivatives comprise Fab fragments, consisting of the first constant domain of the heavy chain (CH1), the constant domain of the light chain (CL), the variable domain of the heavy chain (VH) and the variable domain of the light chain (VL) of an intact immunoglobulin protein; Fv fragments, consisting of the two variable antibody domains VH and VL (Skerra A and Plückthun A (1988) Science 240:1038-1041); single chain Fv fragments (scFv), consisting of the two VH and VL domains linked together by a flexible peptide linker (Bird R E and Walker B W (1991) Trends Biotechnol. 9:132-137); Bence Jones dimers (Stevens F J et al. (1991) Biochemistry 30:6803-6805); camelid heavy-chain dimers (Hamers-Casterman C et al. (1993) Nature 363:446-448) and single variable domains (Cai X and Garen A (1996) Proc. Natl. Acad. Sci. U.S.A. 93:6280-6285; Masat L et al. (1994) Proc. Natl. Acad. Sci. U.S.A. 91:893-896), and single domain scaffolds like e.g., the New Antigen Receptor (NAR) from the nurse shark (Dooley H et al. (2003) Mol. Immunol. 40:25-33) and minibodies based on a variable heavy domain (Skerra A and Plückthun A (1988) Science 240:1038-1041).

In some embodiments, the affinity ligand of the present disclosure is capable of selective interaction with a peptide consisting of the amino acid sequence SEQ ID NO:1. As described below under Examples, Section 1b, the RBM3 fragment SEQ ID NO:1 was designed to lack transmembrane regions to ensure efficient expression in E. coli, and to lack any signal peptide, since those are cleaved off in the mature protein. SEQ ID NO:1 was thus designed for immunizations. In addition, the protein fragment was designed to consist of a unique sequence with low homology with other human proteins, to minimize cross reactivity of generated affinity reagents, and to be of a suitable size to allow the formation of conformational epitopes and still allow efficient cloning and expression in bacterial systems. Accordingly, in the cases wherein the affinity ligand is an antibody or fragment o derivative thereof, the affinity ligand may be obtainable by a process comprising a step of immunizing an animal with a peptide whose amino acid sequence consists of the sequence SEQ ID NO:1. For example, the immunization process may comprise primary immunization with the protein in Freund's complete adjuvant. Also, the immunization process may further comprise boosting at least two times, in intervals of 2-6 weeks, with the protein in Freund's incomplete adjuvant. Processes for the production of antibodies or fragments or derivatives thereof against a given target are known in the art.

Further, as described below under Examples, Section 4, two epitope regions (SEQ ID NO:4 and SEQ ID NO:5) have been identified within SEQ ID NO:1. The relevance of SEQ ID NO:4 is for example confirmed in Examples, Sections 6, 8 and 11. The relevance of SEQ ID NO:5 is for example confirmed in Examples, Sections 6 and 7. The affinity ligand may thus be obtainable by a process comprising a step of immunizing an animal with a peptide whose amino acid sequence consists of SEQ ID NO:4 or SEQ ID NO:5. Also, the antibody or fragment may be obtainable by a process comprising a step of immunizing an animal with an RBM3 fragment which consists of 20 amino acids or less, such as 15 amino acids or less, and comprises a sequence selected from SEQ ID NO:6-19.

For a further discussion about SEQ ID NO:4-19, see below.

In the context of the present disclosure, a “mono-specific antibody” is one or a population of polyclonal antibodies which has been affinity purified on its own antigen, thereby separating such mono-specific antibodies from other antiserum proteins and non-specific antibodies. This affinity purification results in antibodies that bind selectively to its antigen. In the case of the present disclosure, the polyclonal antisera are purified by a two-step immunoaffinity based protocol to obtain mono-specific antibodies selective for the target protein. Antibodies directed against generic affinity tags of antigen fragments are removed in a primary depletion step, using the immobilized tag protein as the capturing agent. Following the first depletion step, the serum is loaded on a second affinity column with the antigen as capturing agent, in order to enrich for antibodies specific for the antigen (see also Nilsson P et al. (2005) Proteomics 5:4327-4337).

Polyclonal and monoclonal antibodies, as well as their fragments and derivatives, represent the traditional choice of affinity ligands in applications requiring selective biomolecular recognition, such as in the detection and/or quantification of RBM3 protein according to the method aspects above. However, those of skill in the art know that, due to the increasing demand of high throughput generation of selective binding ligands and low cost production systems, new biomolecular diversity technologies have been developed during the last decade. This has enabled a generation of novel types of affinity ligands of both immunoglobulin as well as non-immunoglobulin origin that have proven equally useful as binding ligands in biomolecular recognition applications and can be used instead of, or together with, immunoglobulins.

The biomolecular diversity needed for selection of affinity ligands may be generated by combinatorial engineering of one of a plurality of possible scaffold molecules, and specific/selective affinity ligands are then selected using a suitable selection platform. The scaffold molecule may be of immunoglobulin protein origin (Bradbury A R and Marks J D (2004) J. Immunol. Meths. 290:29-49), of non-immunoglobulin protein origin (Nygren P Å and Skerra A (2004) J. Immunol. Meths. 290:3-28), or of an oligonucleotide origin (Gold L et al. (1995) Annu. Rev. Biochem. 64:763-797).

A large number of non-immunoglobulin protein scaffolds have been used as supporting structures in development of novel binding proteins. Non-limiting examples of such structures, useful for generating affinity ligands against RBM3 protein for use according to the present disclosure, are staphylococcal protein A and domains thereof and derivatives of these domains, such as protein Z (Nord K et al. (1997) Nat. Biotechnol. 15:772-777); lipocalins (Beste G et al. (1999) Proc. Natl. Acad. Sci. U.S.A. 96:1898-1903); ankyrin repeat domains (Binz H K et al. (2003) J. Mol. Biol. 332:489-503); cellulose binding domains (CBD) (Smith G P et al. (1998) J. Mol. Biol. 277:317-332; Lehtiö J et al. (2000) Proteins 41:316-322); γ crystallines (Fiedler U and Rudolph R, WO01/04144); green fluorescent protein (GFP) (Peelle B et al. (2001) Chem. Biol. 8:521-534); human cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) (Hufton S E et al. (2000) FEBS Lett. 475:225-231; Irving R A et al. (2001) J. Immunol. Meth. 248:31-45); protease inhibitors, such as Knottin proteins (Wentzel A et al. (2001) J. Bacteriol. 183:7273-7284; Baggio R et al. (2002) J. Mol. Recognit. 15:126-134) and Kunitz domains (Roberts B L et al. (1992) Gene 121:9-15; Dennis M S and Lazarus R A (1994) J. Biol. Chem.269:22137-22144); PDZ domains (Schneider S et al. (1999) Nat. Biotechnol. 17:170-175); peptide aptamers, such as thioredoxin (Lu Z et al. (1995) Biotechnology 13:366-372; Klevenz B et al. (2002) Cell. Mol. Life Sci. 59:1993-1998); staphylococcal nuclease (Norman T C et al. (1999) Science 285:591-595); tendamistats (McConell S J and Hoess R H (1995) J. Mol. Biol. 250:460-479; Li R et al. (2003) Protein Eng. 16:65-72); trinectins based on the fibronectin type III domain (Koide A et al. (1998) J. Mol. Biol. 284:1141-1151; Xu L et al. (2002) Chem. Biol. 9:933-942); and zinc fingers (Bianchi E et al. (1995) J. Mol. Biol. 247:154-160; Klug A (1999) J. Mol. Biol. 293:215-218; Segal D J et al. (2003) Biochemistry 42:2137-2148).

The above-mentioned examples of non-immunoglobulin protein scaffolds include scaffold proteins presenting a single randomized loop used for the generation of novel binding specificities, protein scaffolds with a rigid secondary structure where side chains protruding from the protein surface are randomized for the generation of novel binding specificities, and scaffolds exhibiting a non-contiguous hyper-variable loop region used for the generation of novel binding specificities.

In addition to non-immunoglobulin proteins, oligonucleotides may also be used as affinity ligands. Single stranded nucleic acids, called aptamers or decoys, fold into well-defined three-dimensional structures and bind to their target with high affinity and specificity. (Ellington A D and Szostak J W (1990) Nature 346:818-822; Brody E N and Gold L (2000) J. Biotechnol. 74:5-13; Mayer G and Jenne A (2004) BioDrugs 18:351-359). The oligonucleotide ligands can be either RNA or DNA and can bind to a wide range of target molecule classes.

For selection of the desired affinity ligand from a pool of variants of any of the scaffold structures mentioned above, a number of selection platforms are available for the isolation of a specific novel ligand against a target protein of choice. Selection platforms include, but are not limited to, phage display (Smith G P (1985) Science 228:1315-1317), ribosome display (Hanes J and Plückthun A (1997) Proc. Natl. Acad. Sci. U.S.A. 94:4937-4942), yeast two-hybrid system (Fields S and Song O (1989) Nature 340:245-246), yeast display (Gai S A and Wittrup K D (2007) Curr Opin Struct Biol 17:467-473), mRNA display (Roberts R W and Szostak J W (1997) Proc. Natl. Acad. Sci. U.S.A. 94:12297-12302), bacterial display (Daugherty P S (2007) Curr Opin Struct Biol 17:474-480, Kronqvist N et al. (2008) Protein Eng Des Sel 1-9, Harvey B R et al. (2004) PNAS 101(25):913-9198), microbead display (Nord O et al. (2003) J Biotechnol 106:1-13, WO01/05808), SELEX (System Evolution of Ligands by Exponential Enrichment) (Tuerk C and Gold L (1990) Science 249:505-510) and protein fragment complementation assays (PCA) (Remy I and Michnick S W (1999) Proc. Natl. Acad. Sci. U.S.A. 96:5394-5399).

Thus, in embodiments of the present disclosure, the affinity ligand may be a non-immunoglobulin affinity ligand derived from any of the protein scaffolds listed above, or an oligonucleotide molecule.

As mentioned above, the RBM3 protein fragment SEQ ID NO:1 was designed to consist of a unique sequence with low homology with other human proteins and to minimize cross reactivity of generated affinity reagents. Consequently, in embodiments of the present disclosure, the affinity ligand may be capable of selective interaction with a polypeptide consisting of the amino acid sequence SEQ ID NO:1.

As described below under Examples, Section4, the epitope regions SEQ ID NO:4 and 5 has been identified within SEQ ID NO:1. Thus, in some embodiments, the affinity ligand of the present disclosure is capable of selective interaction with a peptide consisting of an amino acid sequence selected from SEQ ID NO:4 and 5.

Further, as described above under Examples, Section 5, another four epitope regions (SEQ ID NO:6-9) have been identified. Thus, in some embodiments, the affinity ligand of the present disclosure is capable of selective interaction with an RBM3 fragment which consists of 20 amino acids or less, such as 15 amino acids or less, and comprises a sequence selected from SEQ ID NO:6-9.

Also, as described above under Examples, Section 6, another ten epitope regions (SEQ ID NO:10-19) have been identified. Thus, in some embodiments, the affinity ligand of the present disclosure is capable of selective interaction with an RBM3 fragment which consists of 20 amino acids or less, such as 15 amino acids or less, and comprises a sequence selected from SEQ ID NO:10-19.

Antibodies having selectivity for a single epitope region (such as monoclonal antibodies) may provide for increased reproducibility in detection analyses as compared to antibodies generated against a longer peptide sequence (such as a PrEST or a full-length protein). The antibodies selective for a single epitope region may also provide for distinct and strong staining in immunohistochemical analyses. These benefits, independently or jointly, may be valuable when and making treatment predictions or decisions regarding treatments according to the present disclosure. In FIG. 1, a benefit (increased selectivity) of monoclonal antibodies according to the present disclosure as compared to a polyclonal antibody is illustrated.

The monoclonal antibodies 6F11 and 1 B5 are considered to be particularly beneficial. In FIG. 1, 6F11 and 1 B5 are both shown to be more selective than a polyclonal anti-RBM3 antibody. Further, 1 B5 is shown to be more selective than 6F11. 1 B5 is also employed in Examples, Sections 8 and 9 below.

SEQ ID NO:17, to which 1B5 is shown to bind in Examples, Section 6, is within SEQ ID NO:5. In preferred embodiments of the present disclosure, the affinity ligand is thus capable of selective interaction with an RBM3 fragment which consists of SEQ ID NO:5, and in particularly preferred embodiments of the present disclosure, the affinity ligand is capable of selective interaction with an RBM3 fragment which consists of 20 amino acids or less, such as 15 amino acids or less, and comprises the sequence SEQ ID NO:17.

6F11 is shown to bind to SEQ ID NO:8 and SEQ ID NO:16. In other preferred embodiments of the present disclosure, the affinity ligand is thus capable of selective interaction with an RBM3 fragment which consists of 20 amino acids or less, such as 15 amino acids or less, and comprises a sequence selected from SEQ ID NO:8 and 16. Note that SEQ ID NO:8 and 16 are overlapping and that such a fragment may comprise the sequences of both SEQ ID NO:8 and 16.

The detection and/or quantification of the affinity ligand capable of selective interaction with the RBM3 protein may be accomplished in any way known to the skilled person for detection and/or quantification of binding reagents in assays based on biological interactions. Accordingly, any affinity ligand described above may be used to quantitatively and/or qualitatively detect the presence of the RBM3 protein. These “primary” affinity ligands may be labeled themselves with various markers or may in turn be detected by secondary, labeled affinity ligands to allow detection, visualization and/or quantification. This can be accomplished using any one or more of a multitude of labels, which can be conjugated to the affinity ligand capable of interaction with RBM3 protein or to any secondary affinity ligand, using any one or more of a multitude of techniques known to the skilled person, and not as such involving any undue experimentation.

Non-limiting examples of labels that can be conjugated to primary and/or secondary affinity ligands include fluorescent dyes or metals (e.g., fluorescein, rhodamine, phycoerythrin, fluorescamine), chromophoric dyes (e.g., rhodopsin), chemiluminescent compounds (e.g., luminal, imidazole) and bioluminescent proteins (e.g., luciferin, luciferase), haptens (e.g., biotin). A variety of other useful fluorescers and chromophores are described in Stryer L (1968) Science 162:526-533 and Brand L and Gohlke J R (1972) Annu. Rev. Biochem. 41:843-868. Affinity ligands can also be labeled with enzymes (e.g., horseradish peroxidase, alkaline phosphatase, beta-lactamase), radioisotopes (e.g., 3H, 14C, 32P, 35S or 125I) and particles (e.g., gold). In the context of the present disclosure, “particles” refer to particles, such as metal particles, suitable for labeling of molecules. Further, the affinity ligands may also be labeled with fluorescent semiconductor nanocrystals (quantum dots). Quantum dots have superior quantum yield and are more photostable compared to organic fluorophores and are therefore more easily detected (Chan et al. (2002) Curr Opin Biotech. 13: 40-46). The different types of labels can be conjugated to an affinity ligand using various chemistries, e.g., the amine reaction or the thiol reaction. However, other reactive groups than amines and thiols can be used, e.g., aldehydes, carboxylic acids and glutamine.

The method aspects above may be put to use in any of several known formats and set-ups, of which a non-limiting selection is discussed below.

In a set-up based on histology, the detection, localization and/or quantification of a labeled affinity ligand bound to its RBM3 protein target may involve visualizing techniques, such as light microscopy or immunofluorescence microscopy. Other methods may involve the detection via flow cytometry or luminometry.

Biological material from the subject may be used for obtaining the sample for detection and/or quantification of RBM3 protein. The sample may thus be an earlier obtained sample. If using an earlier obtained sample in a method, no steps of the method are practiced on the human or animal body.

The affinity ligand may be applied to the sample for detection and/or quantification of the RBM3 protein. This procedure enables not only detection of RBM3 protein, but may in addition show the distribution and relative level of expression thereof.

The method of visualization of labels on the affinity ligand may include, but is not restricted to, fluorometric, luminometric and/or enzymatic techniques. Fluorescence is detected and/or quantified by exposing fluorescent labels to light of a specific wavelength and thereafter detecting and/or quantifying the emitted light in a specific wavelength region. The presence of a luminescently tagged affinity ligand may be detected and/or quantified by luminescence developed during a chemical reaction. Detection of an enzymatic reaction is due to a color shift in the sample arising from a chemical reaction. Those of skill in the art are aware that a variety of different protocols can be modified in order for proper detection and/or quantification.

In embodiments of the methods of the above aspects, the sample may be immobilized onto a solid phase support or carrier, such as nitrocellulose or any other solid support matrix capable of immobilizing RBM3 protein present in the biological sample applied to it. Some well-known solid state support materials useful in the present invention include glass, carbohydrate (e.g., Sepharose), nylon, plastic, wool, polystyrene, polyethene, polypropylene, dextran, amylase, films, resins, cellulose, polyacrylamide, agarose, alumina, gabbros and magnetite. After immobilization of the biological sample, primary affinity ligand selective for RBM3 protein may be applied, e.g., as described in Examples, Sections 8 and 9, of the present disclosure. If the primary affinity ligand is not labeled in itself, the supporting matrix may be washed with one or more appropriate buffers known in the art, followed by exposure to a secondary labeled affinity ligand and washed once again with buffers to remove unbound affinity ligands. Thereafter, selective affinity ligands may be detected and/or quantified with conventional methods. The binding properties for an affinity ligand may vary from one solid state support to the other, but those skilled in the art should be able to determine operative and optimal assay conditions for each determination by routine experimentation.

Consequently, in embodiments of the methods of the above aspects, the quantifiable affinity ligand of al) or al) may be detected using a secondary affinity ligand capable of recognizing the quantifiable affinity ligand. The quantification of a3) or all) may thus be carried out by means of a secondary affinity ligand with affinity for the quantifiable affinity ligand. As an example, the secondary affinity ligand may be an antibody or a fragment or a derivative thereof.

As an example, one available method for detection and/or quantification of the RBM3 protein is by linking the affinity ligand to an enzyme that can then later be detected and/or quantified in an enzyme immunoassay (such as an EIA or ELISA). Such techniques are well established, and their realization does not present any undue difficulties to the skilled person. In such methods, the biological sample is brought into contact with a solid material or with a solid material conjugated to an affinity ligand against the RBM3 protein, which is then detected and/or quantified with an enzymatically labeled secondary affinity ligand. Following this, an appropriate substrate is brought to react in appropriate buffers with the enzymatic label to produce a chemical moiety, which for example is detected and/or quantified using a spectrophotometer, fluorometer, luminometer or by visual means.

As stated above, primary and any secondary affinity ligands can be labeled with radioisotopes to enable detection and/or quantification. Non-limiting examples of appropriate radiolabels in the present disclosure are 3H, 14C, 32P, 35S or 125I. The specific activity of the labeled affinity ligand is dependent upon the half-life of the radiolabel, isotopic purity, and how the label has been incorporated into the affinity ligand. Affinity ligands are preferably labeled using well-known techniques (Wensel T G and Meares C F (1983) in: Radioimmunoimaging and Radioimmunotherapy (Burchiel S W and Rhodes B A eds.) Elsevier, New York, pp 185-196). A thus radiolabeled affinity ligand can be used to visualize RBM3 protein by detection of radioactivity in vivo or in vitro. Radionuclear scanning with e.g., gamma camera, magnetic resonance spectroscopy or emission tomography function for detection in vivo and in vitro, while gamma/beta counters, scintillation counters and radiographies are also used in vitro.

In the Examples below, the protein expression of the RBM3 gene is detected and found to correlate with diagnostic and prognostic indications. However, the present disclosure also encompasses the mRNA expression of the RBM3 gene as the inventors have found the RBM3 mRNA level and the RBM3 protein level to co-vary in other types of cancer tissue in which RBM3 is also of prognostic significance.

Methods for detecting and quantifying biomarkers on the mRNA level are well known within the art.

According to one such method, total cellular RNA is purified from cells by homogenization in the presence of nucleic acid extraction buffer, followed by centrifugation. Nucleic acids are then precipitated, in order to remove DNA by treatment with DNase and precipitation. The RNA molecules are then separated by gel electrophoresis on agarose gels according to standard techniques, and transferred to nitrocellulose filters by, e.g., the so-called “Northern” blotting technique. The RNA is then immobilized on the filters by heating. Detection and quantification of specific RNA is accomplished using appropriately labeled DNA or RNA probes complementary to the RNA in question. See, for example, Molecular Cloning: A Laboratory Manual (Sambrook J.et al., (1989) 2nd edition, Cold Spring Harbor Laboratory Press). Methods for the preparation of labeled DNA and RNA probes, and the conditions for hybridization thereof to target nucleotide sequences, are described in Molecular Cloning: A Laboratory Manual (Sambrook J.et al., (1989) 2nd edition, Cold Spring Harbor Laboratory Press). For example, the nucleic acid probe may be labeled with, e.g., a radionuclide such as 3H, 32P, 33P, 14C, or 35S; a heavy metal; or a ligand capable of functioning as a specific binding pair member for a labeled ligand (e.g., biotin, avidin, or an antibody), a fluorescent molecule, a chemiluminescent molecule, an enzyme, or the like.

Probes may be labeled to high specific activity by either the nick translation method (Rigby et al., (1977) J. Mol Biol, 113: 237-251), or by the random priming method (Fienberg, (1983) Anal. Biochem., 132: 6-13). The latter can be a method for synthesizing 32P-labeled probes of high specific activity from RNA templates. For example, by replacing preexisting nucleotides with highly radioactive nucleotides according to the nick translation method, it is possible to prepare 32P- labeled nucleic acid probes with a specific activity well in excess of 10 cpm/microgram. Autoradiographic detection of hybridization then can be performed by exposing hybridized filters to photographic film. Densitometric scanning of the photographic films exposed by the hybridized filters provides an accurate measurement of biomarker levels. Using another approach, biomarker levels can be quantified by computerized imaging systems, such as the Molecular Dynamics 400-B 2D Phosphorimager (Amersham Biosciences, Piscataway, N.J., USA).

Where radionuclide labeling of DNA or RNA probes is not practical, the random-primer method can be used to incorporate an analogue, for example, the dTTP analogue 5-(N-(N-biotinyl-epsilon-aminocaproyl)-3-aminoallyl)deoxyuridine triphosphate, into the probe molecule. The biotinylated probe oligonucleotide can be detected by reaction with biotin-binding proteins, such as avidin, streptavidin, and antibodies (e.g., anti-biotin antibodies) coupled to fluorescent dyes or enzymes that produce color reactions.

In addition to Northern and other RNA blotting hybridization techniques, determining the levels of RNA transcript may be accomplished using the technique of in situ hybridization. This technique requires fewer cells than the Northern blotting technique, and involves depositing whole cells onto a microscope cover slip and probing the nucleic acid content of the cell with a solution containing radioactive or otherwise labeled nucleic acid (e.g., cDNA or RNA) probes. This technique is particularly well-suited for analyzing tissue biopsy samples from subjects.

The relative number of RNA transcripts in cells can also be determined by reverse transcription of RNA transcripts, followed by amplification of the reverse-transcribed transcripts by polymerase chain reaction (RT-PCR). The levels of RNA transcripts can be quantified in comparison with an internal standard, for example, the level of mRNA from a standard gene present in the same sample. The person skilled in the art is capable of selecting suitable genes for use as an internal standard. The methods for quantitative RT-PCR and variations thereof are within the skill in the art.

Any suitable primers can be used for the quantitative RT-PCR. Preferably, the primers are specific to RBM3 It is within the skill in the art to generate primers specific to RBM3 (e.g. starting from SEQ ID NO:3). Primers can be of any suitable length, but are preferably between 19 and 23 (e.g., 19, 20, 21, 22, or 23) nucleotides. Ideally, amplicon length should be 50 to 150 (up to 250 may be necessary but then optimization of the thermal cycling protocol and reaction components may be necessary) bases for optimal PCR efficiency. Designing primers that generate a very long amplicon may lead to poor amplification efficiency. Information about primer design and optimal amplicon size may for example be found at www.ambion.com.

In some instances, it may be desirable to use microchip technology to detect biomarker expression. The microchip can be fabricated by techniques known in the art. For example, probe oligonucleotides of an appropriate length, e.g., 40 nucleotides, are 5′-amine modified at position C6 and printed using commercially available microarray systems, e.g., the GENEMACHINE OmniGrid 100 Microarrayer and Amersham CODELINK activated slides. Labeled cDNA oligomer corresponding to the target RNAs is prepared by reverse transcribing the target RNA with labeled primer. Following first strand synthesis, the RNA/DNA hybrids are denatured to degrade the RNA templates. The labeled target cDNAs thus prepared are then hybridized to the microarray chip under hybridizing conditions, e.g., 6 times SSPE/30% formamide at 25° C. for 18 hours, followed by washing in 0.75 times TNT at 37° C. for 40 minutes. At positions on the array, where the immobilized probe DNA recognizes a complementary target cDNA in the sample, hybridization occurs. The labeled target cDNA marks the exact position on the array where binding occurs, thereby allowing automatic detection and quantification. The output consists of a list of hybridization events, which indicate the relative abundance of specific cDNA sequences, and therefore the relative abundance of the corresponding complementary biomarker, in the subject sample. According to one embodiment, the labeled cDNA oligomer is a biotin-labeled cDNA prepared from a biotin-labeled primer. The microarray is then processed by direct detection of the biotin-containing transcripts using, e.g., Streptavidin-Alexa647 conjugate, and scanned utilizing conventional scanning methods. Image intensities of each spot on the array are proportional to the abundance of the corresponding biomarker in the subject sample.

The use of the array has one or more advantages for mRNA expression detection. First, the global expression of several to thousands of genes can be identified in a single sample at one time. Second, through careful design of the oligonucleotide probes, the expression of both mature and precursor molecules can be identified. Third, in comparison with Northern blot analysis, the chip requires a small amount of RNA.

The RBM3 mRNA (as well as the RBM3 protein) may for example be extracted from formalin-fixed, paraffin-embedded tumor tissue. Accordingly, the sample of the methods of the present disclosure may be formalin-fixed and/or paraffin-embedded tissue.

As discussed above in connection with the first aspect, RBM3 is a diagnostic marker for testicular cancer in situ. Placental-Like Alkaline Phosphatase (PLAP), Octamer-3/4 (OCT3/4) and (RNA Binding Motif protein Y) RBMY are other markers of pre-stages of testicular cancer. In order to provide for an accurate diagnosis, the inventors have realized the value of combining affinity ligands targeting the RBM3 protein and at least one of the other diagnostic markers in a single kit.

As a fourth aspect of the present disclosure, there is thus provided a kit for carrying out a method according the first aspect, which comprises:

a) a quantifiable affinity ligand capable of selective interaction with an RBM3 protein; and

b) reagents necessary for quantifying the amount of said quantifiable affinity ligand

c) a quantifiable affinity ligand capable of selective interaction with a protein selected from Placental-Like Alkaline Phosphatase (PLAP), Octamer-3/4 (OCT3/4) and (RNA Binding Motif protein Y) RBMY; and

d) reagents necessary for quantifying the amount of the quantifiable affinity ligand of c),

wherein the reagents of b) and d) are the same or different.

Further, as discussed above in connection with the first aspect, RBM3 is a prognostic marker for testicular cancer. Human chorionic gonadotropin (HCG), a-fetoprotein (AFP) and lactate dehydrogenase (LD) are other prognostic markers in testicular cancer. In order to provide for an accurate prognosis, the inventors have realized the value of combining affinity ligands targeting the RBM3 protein and at least one of the other prognostic markers in a single kit.

As a fifth aspect of the present disclosure, there is thus provided a kit for carrying out a method according to the second or third aspect, which comprises

a) a quantifiable affinity ligand capable of selective interaction with an RBM3 protein; and

b) reagents necessary for quantifying the amount of said quantifiable affinity ligand

c) a quantifiable affinity ligand capable of selective interaction with a protein selected from human chorionic gonadotropin (HCG), a-fetoprotein (AFP) and lactate dehydrogenase (LD); and

d) reagents necessary for quantifying the amount of the quantifiable affinity ligand of c),

wherein the reagents of b) and d) are the same or different.

Accordingly, the same reagents, such as the same secondary antibody, may be used for quantifying both the anti-RBM3 protein affinity ligand and the affinity ligand targeting the other marker.

Various components of the kits may be selected and specified as described above in connection with the method aspects of the present disclosure.

Thus, the kit according to the fourth or fifth aspect comprises an affinity ligand against an RBM3 protein, an affinity ligand against another marker as well as other means that help to quantify the specific and/or selective affinity ligands after they have bound specifically and/or selectively to their respective targets. For example, the kits may contain a secondary affinity ligand for detecting and/or quantifying a complex formed by the targets and the affinity ligands. The kits may also contain various auxiliary substances other than affinity ligands, to enable the kits to be used easily and efficiently. Examples of auxiliary substances include solvents for dissolving or reconstituting lyophilized protein components of the kits, wash buffers, substrates for measuring enzyme activity in cases where an enzyme is used as a label, target retrieval solution to enhance the accessibility to antigens in cases where paraffin or formalin-fixed tissue samples are used, and substances such as reaction arresters, e.g., endogenous enzyme block solution to decrease the background staining and/or counterstaining solution to increase staining contrast, that are commonly used in immunoassay reagent kits.

The kit according to the kit aspects may also advantageously comprise a reference sample for provision of, or yielding, the reference value to be used for comparison with the sample value. For example, the reference sample may comprise a predetermined amount of RBM3 protein. Such a reference sample may for example be constituted by a tissue sample containing the predetermined amount of RBM3 protein. The tissue reference sample may then be used in the determination of the RBM3 expression status in the sample being studied, by manual, such as ocular, or automated comparison of expression levels in the reference tissue sample and the subject sample. As another example, the reference sample may comprise cell lines, such as cancer cell lines, expressing a predetermined, or controlled, amount of RBM3 protein. The person skilled in the art understands how to provide such cell lines, for example guided by the disclosure of Rhodes et al. (2006) The biomedical scientist, p 515-520. As an example, the cell lines may be formalin fixed. Also, such formalin fixed cell lines may be paraffin embedded.

The wording “reference sample for provision of the reference value” is to be interpreted broadly in the context of the present disclosure. The reference sample may comprise an amount of RBM3 protein actually corresponding to the reference value, but it may also comprise an amount of RBM3 protein corresponding to a value being higher than the reference value. In the latter case, the “high” value may be used by a person performing the method as an upper reference (positive reference) for assessing, e.g., the appearance of, a reference value which is lower than the “high” value. The person skilled in the art of immunohistochemistry understands how to do such an assessment. Further, as an alternative or a complementing example, the skilled person may use another reference sample comprising a low amount of RBM3 protein for provision of a “low” value in such an assessment, e.g., as a negative reference. This is further discussed above in connection with the method aspects.

Consequently, in embodiments of the kit aspects, the reference sample may comprise an amount of RBM3 protein corresponding to the reference value. As an example, the reference sample may comprise an amount of RBM3 protein corresponding to a nuclear or cytoplasmic fraction of 95% or lower, such as 90% or lower, such as 85% or lower, such as 80% or lower, such as 75% or lower, such as 70% or lower, such as 65% or lower, such as 60% or lower, such as 55% or lower, such as 50% or lower, such as 45% or lower, such as 40% or lower, such as 35% or lower, such as 30% or lower, such as 25% or lower, such as 20% or lower, such as 15% or lower, such as 10% or lower, such as 5% or lower, such as 2% or lower, such as 1% or lower, such as 0%.

Alternatively, or as a complement, the reference sample may comprise an amount of RBM3 protein corresponding to a moderate nuclear or cytoplasmic intensity or lower, such as a weak nuclear or cytoplasmic intensity or lower, such as an absent nuclear or cytoplasmic intensity.

The provision of fraction values and intensity values is discussed above in connection with the method aspects.

Further, in alternative or complementing embodiments of the kit aspects, the kits may comprise a reference sample comprising an amount of RBM3 protein corresponding to a value being higher than the reference value. In these embodiments, the reference sample may for example comprise an amount of RBM3 protein corresponding to a nuclear or cytoplasmic fraction of 75% or higher and/or a strong nuclear or cytoplasmic intensity.

In yet further alternative or complementing embodiments of the kit aspects, the kits may comprise a reference sample comprising an amount of RBM3 protein corresponding to a value being lower than or equal to the reference value, e.g., an absent nuclear or cytoplasmic intensity and/or a nuclear or cytoplasmic fraction of <2%, such as 0%.

The kits may thus comprise: a reference sample comprising an amount of RBM3 protein corresponding to a predetermined reference value; a reference sample comprising an amount of RBM3 protein corresponding to a value being higher than a predetermined reference value; and/or a reference sample comprising an amount of RBM3 protein corresponding to a value being lower than or equal to a predetermined reference value.

Consequently, embodiments of the kits may comprise: a first reference sample comprising an amount of RBM3 protein being higher than a predetermined reference value; and a second reference sample comprising an amount of RBM3 protein being lower than or equal to the predetermined reference value.

In embodiments of the kit aspects, the reference sample may be a tissue sample, such as a tissue sample adapted to ocular or microscopic evaluation. As an example, the tissue reference sample may be fixated in paraffin or buffered formalin and/or histo-processed to sections (e.g., μm-thin sections) that are mounted on microscopic glass-slides. The tissue reference sample may be further adapted to staining with affinity ligands, such as antibodies, against an RBM3 protein.

Consequently, in embodiments of the kit aspects, the reference sample may be adapted to directly, or indirectly, provide any relevant reference value, such as any one of the reference values discussed above.

Further embodiments of the reference sample of the kit aspects are discussed above in connection with the reference values and reference samples of the method aspects.

RBM3 may also be detected on the mRNA level. Such detection may for example be an in situ mRNA analysis or a quantitative RT-PCR mRNA analysis. Further, the mRNA of a sample may be copied into cDNA to increase stability prior to detection.

Thus, as a configuration of the fifth aspect, there is provided a kit comprising at least one probe or primer for detection and/or quantification of RBM3 mRNA or RBM3 cDNA.

As described herein, additional information may be obtained if the levels of both RBM3 and another relevant biomarker is analyzed. Thus, in an embodiment, the kit of the configuration of the third aspect may further comprise:

a probe or primer for detection and/or quantification of the mRNA or cDNA one or more of PLAP, OCT3/4, RBMY, HCG, AFP and LD.

A probe or primer according to the configuration of the third aspect may for example be a single or double stranded oligonucleotide that is complementary to a part of the mRNA or cDNA in question. The RBM3 cDNA is represented by SEQ ID NO:3. If the probe is double stranded, it is denaturated prior to detection/hybridization to become single stranded, e.g. by means of heating.

The length of the probe(s) or primer(s) may for example be at least 5, such as at least 10, such as at least 15, such as at least 20, such as at least 25, such as at least 30, such as at least 50, such as at least 75, such as at least 100, such as at least 150 consecutive nucleotides.

A primer is normally shorter than a probe.

The kit may comprise further auxiliary products. Examples of such products are described above in connection with the discussion about mRNA analysis. Thus, the kit of the configuration of the third aspect may for example comprise one or more auxiliary products selected from the group consisting of a pre-treatment solution (for preparing the sample), a proteolytic enzyme such as pepsin, a second probe (to be used as a reference), a buffer such as a wash buffer and a fluorescence mounting medium (if fluorescent labels are used). The probes of the configuration of the third aspect may be labeled or conjugated to other chemical moieties. This is also exemplified above in connection with the discussion about mRNA analysis.

Further, the probes of the configuration of the third aspect may for example be arranged on a solid phase, optionally together with probes for one of the other targets. Examples of such other probes are thus those capable of detecting the mRNA of PLAP, OCT3/4, RBMY, HCG, AFP and LD.

Following the findings presented above, the inventors have realized several uses for the RBM3 protein and fragments thereof and the RBM3 mRNA.

Thus, as a sixth aspect of the present disclosure, there is provided an RBM3 protein fragment which consists of 50 amino acids or less and comprises a sequence selected from SEQ ID NO:4-19.

In embodiments of the sixth aspect, the fragment consists of 29 amino acids or less.

In further embodiments of the sixth aspect, the fragment consists of 20 amino acids or less, such as 15 amino acids or less, and comprises a sequence selected from SEQ ID NO:6-19.

Possible uses of such fragments are described below.

As a first configuration of a seventh aspect of the present disclosure, there is provided a use of an RBM3 protein or an RBM3 mRNA molecule as a diagnostic marker for a testicular disorder, such as testicular cancer in situ.

The use of the first configuration may be entirely in vitro, e.g., on previously obtained samples.

In the context of the present disclosure, “diagnostic marker” refers to something material which presence indicates a medical condition. The marker may thus be a biomarker, such as a human protein. It is to be understood that the presence of the diagnostic marker, or a relatively high level thereof, is indicative of a relatively high likelihood of having the testicular disorder. Here, the “relatively high likelihood” is high in comparison with a subject not expressing such high levels of the diagnostic marker.

As a second configuration of the seventh aspect, there is provided a use of an RBM3 protein or an antigenically active fragment thereof for the production, selection or purification of a diagnostic agent for a testicular disorder, such as testicular cancer in situ.

An “antigenically active fragment” refers to a fragment of sufficient size to be capable of generating an affinity ligand capable of selective interaction with the fragment.

The selection and purification may be in vitro, while the production may be in vivo.

In the context of the present disclosure, “diagnostic agent” refers to an agent having at least one property being valuable in an establishment of a diagnosis. For example, the diagnostic agent may be capable of selective interaction with the diagnostic marker.

The diagnostic agent may thus be an affinity ligand capable of selective interaction with the RBM3 protein or the antigenically active fragment thereof. Examples of such affinity ligands are discussed above in connection with the method aspects.

Guided by the teachings of the present disclosure, the person skilled in the art understands how to use the RBM3 protein or fragment in the production, selection or purification of the diagnostic agent. For example, the use may comprise affinity purification on a solid support onto which the RBM3 protein or fragment thereof has been immobilized. The solid support may for example be arranged in a column. Further, the use may comprise selection of affinity ligands having specificity for the RBM3 protein or fragment thereof using a solid support onto which the RBM3 protein or fragment thereof has been immobilized. Such solid support may be well plates (such as 96 well plates), magnetic beads, agarose beads or sepharose beads. Further, the use may comprise analysis of affinity ligands on a soluble matrix, for example using a dextran matrix, or use in a surface plasmon resonance instrument, such as a Biacore™ instrument, wherein the analysis may for example comprise monitoring the affinity of a number of potential affinity ligands for the immobilized RBM3 protein or fragment thereof.

Also, for the production of the diagnostic agent, the RBM3 protein or the antigenically active fragment thereof may be used in an immunization of an animal, such as a rabbit or mouse.

Such use may be involved in a method comprising the steps:

    • i) immunizing an animal using the RBM3 protein or the antigenically active fragment thereof as the antigen;
    • ii) obtaining serum comprising the diagnostic agent from the immunized animal; and, optionally,
    • iii) isolating the diagnostic agent from the serum.
    • Alternatively the steps following the first step may be:
    • ii′) obtaining cells from the immunized animal, which cells comprise DNA encoding the diagnostic agent,
    • iii′) fusing the cells with myeloma cells to obtain at least one clone, and
    • iv′) obtaining the diagnostic agent expressed by the clone.

As a first configuration of an eighth aspect of the present disclosure, there is provided a use of an RBM3 protein or an RBM3 mRNA molecule as a prognostic marker for testicular cancer.

The use of the first configuration may be entirely in vitro, e.g., on previously obtained samples.

In the context of the present disclosure, “prognostic marker” refers to something material which presence indicates a prognosis. The marker may thus be a biomarker, such as a human protein. It is to be understood that the presence of the prognostic marker, or a relatively high level thereof, is indicative of a relatively good prognosis. Here, the “relatively good prognosis” is good in comparison with a comparable testicular cancer subject not expressing such high levels of the prognostic marker.

As a second configuration of the eighth aspect, there is provided a use of an RBM3 protein or an antigenically active fragment thereof for the production, selection or purification of a prognostic agent for testicular cancer.

The selection and purification may be in vitro, while the production may be in vivo.

In the context of the present disclosure, “prognostic agent” refers to an agent having at least one property being valuable in an establishment of a prognosis, e.g., a prognosis for a mammalian subject having a testicular cancer. For example, the prognostic agent may be capable of selective interaction with the prognostic marker.

The prognostic agent may thus be an affinity ligand capable of selective interaction with the RBM3 protein or the antigenically active fragment thereof. Examples of such affinity ligands are discussed above in connection with the method aspects.

The testicular cancer of the eighth aspect may for example be a testicular germ-cell cancer. Further, in alternative or complementary embodiments, it may be non-seminomatous.

The above discussion about and embodiments of the seventh aspect applies mutatis mutandis to the eighth aspect.

In embodiments of the seventh or eighth aspect, the amino acid sequence of the RBM3 protein may comprise a sequence selected from:

i) SEQ ID NO:1; and

ii) a sequence which is at least 85% identical to SEQ ID NO:1.

In some embodiments, sequence ii) is at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical or at least 99% identical to SEQ ID NO:1.

Further, in embodiments of the seventh or eighth aspect the amino acid sequence of the RBM3 protein may comprise or consist of a sequence selected from:

i) SEQ ID NO:2; and

ii) a sequence which is at least 85% identical to SEQ ID NO:2.

In some embodiments, sequence ii) is at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical or at least 99% identical to SEQ ID NO:2.

The antigenically active fragment of the seventh or eighth aspect may for example be any one of the fragments of the sixth aspect.

As a ninth aspect of the present disclosure, there is provided an affinity ligand capable of selective interaction with an RBM3 protein.

Different embodiments of such an affinity ligand are discussed above in connection with the method aspects.

As a first configuration of a tenth aspect of the present disclosure, there is provided a use of an affinity ligand according to the ninth aspect as a diagnostic agent for a testicular disorder, such as testicular cancer in situ.

As a second configuration of a tenth aspect of the present disclosure, there is provided a use of an affinity ligand according to the ninth aspect as a prognostic agent for testicular cancer. The testicular cancer may for example be a testicular germ-cell cancer. Also, it may for example be non-seminomatous.

Such uses may for example be performed in vitro, e.g., involving the determination of the amount of RBM3 in at least part of a sample earlier obtained from the subject.

In an equivalent manner, there is provided a use of an affinity ligand capable of selective interaction with an RBM3 protein in the manufacture of a diagnostic agent for a testicular disorder, such as testicular cancer in situ, or a prognostic agent for testicular cancer.

EXAMPLES Mono-Specific Polyclonal Antibodies 1. Generation of Antigen a) Materials and Methods

A suitable fragment of the target protein encoded by the EnsEMBL Gene ID ENSG00000102317 was selected using bioinformatic tools with the human genome sequence as template (Lindskog M et al (2005) Biotechniques 38:723-727, EnsEMBL, www.ensembl.org). The fragment was used as template for the production of a 134 amino acid long fragment corresponding to amino acids 18-151 (SEQ ID NO:1) of the RBM3 protein (SEQ ID NO:2; EnsEMBL entry no. ENSP00000365946).

A fragment of the RBM3 gene transcript containing nucleotides 281-682, of EnsEMBL entry number ENST00000376755 (SEQ ID NO:3), was isolated by a SuperscriptTM One-Step RT-PCR amplification kit with Platinum® Taq (Invitrogen) and a human total RNA pool panel as template (Human Total RNA, BD Biosciences Clontech). Flanking restriction sites Notl and Ascl were introduced into the fragment through the PCR amplification primers, to allow in-frame cloning into the expression vector (forward primer: GACGAGCAGGCACTGGAAG (SEQ ID NO:27), reverse primer: GTAATTTCCTCCTGAGTAGC (SEQ ID NO:28). Then, the downstream primer was biotinylated to allow solid-phase cloning as previously described, and the resulting biotinylated PCR product was immobilized onto Dynabeads M280 Streptavidin (Dynal Biotech) (Larsson M et al (2000) J. Biotechnol. 80:143-157). The fragment was released from the solid support by Notl-Ascl digestion (New England Biolabs), ligated into the pAff8c vector (Larsson M et al, supra) in frame with a dual affinity tag consisting of a hexahistidyl tag for immobilized metal ion chromatography (IMAC) purification and an immunopotentiating albumin binding protein (ABP) from streptococcal protein G (Sjölander A et al (1997) J. Immunol. Methods 201:115-123; St{dot over (a)}hl S et al (1999) Encyclopedia of Bioprocess Technology: Fermentation, Biocatalysis and Bioseparation (Fleckinger MC and Drew SW, eds) John Wiley and Sons Inc., New York, pp 49-63), and transformed into E. coli BL21(DE3) cells (Novagen). The sequences of the clones were verified by dye-terminator cycle sequencing of plasmid DNA amplified using TempliPhi DNA sequencing amplification kit (GE Healthcare, Uppsala, Sweden) according to the manufacturer's recommendations.

BL21(DE3) cells harboring the expression vector were inoculated in 100 ml 30 g/I tryptic soy broth (Merck KGaA) supplemented with 5 g/; yeast extract (Merck KGaA) and 50 mg/l kanamycin (Sigma-Aldrich) by addition of 1 ml of an overnight culture in the same culture medium. The cell culture was incubated in a 1 liter shake flask at 37° C. and 150 rpm until the optical density at 600 nm reached 0.5-1.5. Protein expression was then induced by addition of isopropyl-β-D-thiogalactopyranoside (Apollo Scientific) to a final concentration of 1 mM, and the incubation was continued overnight at 25° C. and 150 rpm. The cells were harvested by centrifugation at 2400 g, and the pellet was re-suspended in 5 ml lysis buffer (7 M guanidine hydrochloride, 47 mM Na2HPO4, 2.65 mM NaH2PO4, 10 mM Tris-HCl, 100 mM NaCl, 20 mM mercaptoethanol; pH=8.0) and incubated for 2 hours at 37° C. and 150 rpm. After centrifugation at 35300 g, the supernatant containing the denatured and solubilized protein was collected.

The His6-tagged fusion protein was purified by immobilized metal ion affinity chromatography (IMAC) on columns with 1 ml Talon® metal (Co2+) affinity resin (BD Biosciences Clontech) using an automated protein purification procedure (Steen J et al (2006) Protein Expr. Purif. 46:173-178) on an ASPEC XL4TM (Gilson). The resin was equilibrated with 20 ml denaturing washing buffer (6 M guanidine hydrochloride, 46.6 mM Na2HPO4, 3.4 mM NaH2PO4, 300 mM NaCl, pH 8.0-8.2). Clarified cell lysates were then added to the column. Thereafter, the resin was washed with a minimum of 31.5 ml washing buffer prior to elution in 2.5 ml elution buffer (6 M urea, 50 mM NaH2PO4, 100 mM NaCl, 30 mM acetic acid, 70 mM Na-acetate, pH 5.0). The eluted material was fractioned in three pools of 500, 700 and 1300 μl. The 700 μl fraction, containing the antigen, and the pooled 500 and 1300 μl fractions were stored for further use.

The antigen fraction was diluted to a final concentration of 1 M urea with phosphate buffered saline (PBS; 1.9 mM NaH2PO4, 8.1 mM Na2HPO4, 154 mM NaCl) followed by a concentration step to increase the protein concentration using Vivapore 10/20 ml concentrator with molecular weight cut off at 7500 Da (Vivascience AG). The protein concentration was determined using a bicinchoninic acid (BCA) micro assay protocol (Pierce) with a bovine serum albumin standard according to the manufacturer's recommendations. The protein quality was analyzed on a Bioanalyzer instrument using the Protein 50 or 200 assay (Agilent Technologies).

b) Results

A gene fragment corresponding to nucleotides 281-682 of the full-lengths transcript of RBM3 (SEQ ID NO:3) was successfully isolated by RT-PCR from a human RNA pool using primers specific. The fragment codes for amino acids 18 to 151 of the target protein RBM3 (SEQ ID NO:2). The 134 amino acid fragment (SEQ ID NO:1) of the target protein (SEQ ID NO:2) was designed to lack transmembrane regions to ensure efficient expression in E. coli, and to lack any signal peptide, since those are cleaved off in the mature protein. In addition, the protein fragment was designed to consist of a unique sequence with low homology with other human proteins, to minimize cross reactivity of generated affinity reagents, and to be of a suitable size to allow the formation of conformational epitopes and still allow efficient cloning and expression in bacterial systems.

A clone encoding the correct amino acid sequence was identified, and, upon expression in E. coli, a single protein of the correct size was produced and subsequently purified using immobilized metal ion chromatography. After dilution of the eluted sample to a final concentration of 1 M urea and concentration of the sample to 1 ml, the concentration of the protein fragment was determined to be 10.4 mg/ml and was 96.0% pure according to purity analysis.

2. Generation of Antibodies a) Materials and Methods

The purified RBM3 fragment as obtained above was used as antigen to immunize a rabbit in accordance with the national guidelines (Swedish permit no. A 84-02). The rabbit was immunized intramuscularly with 200 μg of antigen in Freund's complete adjuvant as the primary immunization, and boosted three times in four week intervals with 100 μg antigen in Freund's incomplete adjuvant.

Antiserum from the immunized animal was purified by a three-step immunoaffinity based protocol (Agaton C et al (2004) J. Chromatogr. A 1043:33-40; Nilsson P et al (2005) Proteomics 5:4327-4337). In the first step, 7 ml of total antiserum was buffered with 10×PBS to a final concentration of 1×PBS (1.9 mM NaH2PO4, 8.1 mM Na2HPO4, 154 mM NaCl), filtered using a 0.45 μm pore-size filter (Acrodisc®, Life Science) and applied to an affinity column containing 5 ml N-hydroxysuccinimide-activated Sepharose™ 4 Fast Flow (GE Healthcare) coupled to the dual affinity tag protein His6-ABP (a hexahistidyl tag and an albumin binding protein tag) expressed from the pAff8c vector and purified in the same way as described above for the antigen protein fragment. In the second step, the flow-through, depleted of antibodies against the dual affinity tag His6-ABP, was loaded at a flow rate of 0.5 ml/min on a 1 ml Hi-Trap NHS-activated HP column (GE Healthcare) coupled with the RBM3 protein fragment used as antigen for immunization (SEQ ID NO:1). The His6-ABP protein and the protein fragment antigen were coupled to the NHS activated matrix as recommended by the manufacturer. Unbound material was washed away with 1×PBST (1×PBS, 0.1% Tween20, pH 7.25), and captured antibodies were eluted using a low pH glycine buffer (0.2 M glycine, 1 mM EGTA, pH 2.5). The eluted antibody fraction was collected automatically, and loaded onto two 5 ml HiTrap™ desalting columns (GE Healthcare) connected in series for efficient buffer exchange in the third step. The second and third purification steps were run on the AKTAxpress™ platform (GE Healthcare). The antigen selective (mono-specific) antibodies (msAbs) were eluted with PBS buffer, supplemented with glycerol and NaN3 to final concentrations of 40% and 0.02%, respectively, for long term storage at −20° C. (Nilsson P et al (2005) Proteomics 5:4327-4337).

The specificity and selectivity of the affinity purified antibody fraction were analyzed by binding analysis against the antigen itself and against 94 other human protein fragments in a protein array set-up (Nilsson P et al (2005) Proteomics 5:4327-4337). The protein fragments were diluted to 40 μg/ml in 0.1 M urea and 1×PBS (pH 7.4) and 50 μl of each were transferred to the wells of a 96-well spotting plate. The protein fragments were spotted in duplicate and immobilized onto epoxy slides (SuperEpoxy, TeleChem) using a pin-and-ring arrayer (Affymetrix 427). The slide was washed in 1×PBS (5 min) and the surface was then blocked (SuperBlock®, Pierce) for 30 minutes. An adhesive 16-well silicone mask (Schleicher & Schuell) was applied to the glass before the mono-specific antibodies were added (diluted 1:2000 in 1×PBST to appr. 50 ng/ml) and incubated on a shaker for 60 min. Affinity tag-specific IgY antibodies were co-incubated with the mono-specific antibodies in order to quantify the amount of protein in each spot. The slide was washed with 1×PBST and 1×PBS twice for 10 min each. Secondary antibodies (goat anti-rabbit antibody conjugated with Alexa 647 and goat anti-chicken antibody conjugated with Alexa 555, Molecular Probes) were diluted 1:60000 to 30 ng/ml in 1×PBST and incubated for 60 min. After the same washing procedure, as for the first incubation, the slide was spun dry and scanned (G2565BA array scanner, Agilent), thereafter images were quantified using image analysis software (GenePix 5.1, Axon Instruments).

In addition, the specificity and selectivity of the affinity-purified antibody were analyzed by Western blot. Western blot was performed by separation of total protein extracts from selected human cell lines on pre-cast 10-20% SDS-PAGE gradient gels (Bio-Rad Laboratories) under reducing conditions, followed by electro-transfer to PVDF membranes (Bio-Rad Laboratories) according to the manufacturer's recommendations. The membranes were blocked (5% dry milk, 1× TBST; 0.1 M Tris-HCl, 0.5 M NaCl, 0.1% Tween20) for 1 h at room temperature, incubated with the primary affinity purified antibody (diluted 1:500 in blocking buffer) and washed in TBST. The secondary HRP-conjugated antibody (swine anti-rabbit immunoglobulin/HRP, DakoCytomation) was diluted 1:3000 in blocking buffer and chemiluminescence detection was carried out using a ChemidocTM CCD camera (Bio-Rad Laboratories) and SuperSignal® West Dura Extended Duration substrate (Pierce), according to the manufacturer's protocol.

b) Results

The quality of polyclonal antibody preparations has proven to be dependent on the degree of stringency in the antibody purifications, and it has previously been shown that depletion of antibodies directed against epitopes not originated from the target protein is necessary to avoid cross-reactivity to other proteins and background binding (Agaton C et al (2004) J. Chromatogr. A 1043:33-40). Thus, a protein microarray analysis was performed to ensure that mono-specific polyclonal antibodies of high specificity had been generated by depletion of antibodies directed against the His6-tag as well as of antibodies against the ABP-tag.

To quantify the amount of protein in each spot of the protein array, a two-color dye labeling system was used, with a combination of primary and secondary antibodies. Tag-specific IgY antibodies generated in hen were detected with a secondary goat anti-hen antibody labeled with Alexa 555 fluorescent dye. The specific binding of the rabbit msAb to its antigen on the array was detected with a fluorescently Alexa 647 labeled goat anti-rabbit antibody. Each protein fragment was spotted in duplicates. The protein array analysis shows that the affinity purified mono-specific antibody against RBM3 is highly selective to the correct protein fragment and has a very low background to all other protein fragments analyzed on the array.

The result of the Western blot analysis shows that the antibody specifically detects a single band of approximately 16 kDa in two breast tumor cell lines, T47D and MCF-7. The theoretical molecular weight of RBM3 is 16 kDa (as calculated from the RBM3 amino acid sequence SEQ ID NO:2), corresponding well to the result obtained.

Monoclonal Antibodies 3. Generation of Monoclonal Antibodies. a) Materials and Methods

The purified fragment (SEQ ID NO:1) obtained in Section 1 was used as antigen for production of monoclonal antibodies. Antigen was sent to AbSea Biotechnology Ltd (Beijing, China) and briefly, the antigen was injected subcutaneously into BALB/c mice (4-6 weeks old, female) at three week intervals. The antigen was mixed with complete Freund's adjuvant for the first injection and incomplete Freund's adjuvant for the following injections. Three days before fusion, the mouse was last challenged with antigen intravenously. Hybridomas were generated by fusion of mouse splenocytes with the Sp2/0 myeloma cell line. By screening several cell lines using ELISA, cells that secreted antibodies specific for the antigen (SEQ ID NO:1) were identified and delivered to Atlas Antibodies AB for further characterization. Cell lines that showed positive results in ELISA, Western blot (WB) and immunohistochemistry (IHC) were selected for subcloning, performed by AbSea Biotechnology Ltd.

In addition, the immunohistochemical staining patterns of the monoclonal antibodies were compared to that of the polyclonal anti-RBM3 antibody generated in Section 2. This polyclonal antibody is sometimes referred to herein as “anti-RBM3”.

b) Results

Cell-lines were screened by ELISA (at AbSea) to identify lines that produce monoclonal antibodies (mAbs) that recognize the antigen (SEQ ID NO:1), but not the affinity tag His-ABP. Eight cell-lines showed specific binding to the antigen SEQ ID NO:1 in ELISA and were selected for further testing. For each of the selected eight clones 150-300 μl supernatant was collected, azide was added, and the supernatants were delivered to Atlas Antibodies AB on wet ice. The supernatants were stored at +4° C. upon arrival according to the instructions from AbSea. Further testing of the cell lines resulted in the identification of three interesting cell lines, clones 1 B5, 6F11 and 7G3 that gave positive results in both Western blot and IHC analysis. These clones were selected for subcloning and expansion, performed by AbSea Biotechnology Ltd.

Epitope Mapping

4. Epitope Mapping using Bacterial Display I

RBM3 DNA corresponding to SEQ ID NO:1 (i.e. aa 18-151 of ENSP00000365946 or by 261-682 ENST00000376755) was amplified by PCR using vector pAff8c as template. The amplified DNA was fragmentized to various lengths (approximately 50-150 bp) by sonication, followed by ligation into the staphylococcal display vector (pSCEM2) and transformed into S. Carnosus yielding around 100000 transformants. In-frame DNA fragments were displayed as peptides on the staphylococcal surface. After incubation with antibody (selective for SEQ ID NO:1, obtained as in Section 2 above) and fluorescently labeled secondary reagents, positive and negative cells were separately sorted using flow cytometry in order to isolate epitope and non-epitope presenting cells. Isolated cells were sequenced by pyrosequencing and sequences finally aligned to the RBM3 antigen for identification of epitopes.

A dual-labeling strategy with real-time monitoring of the surface expression level was used (Lofblom, J et al (2005) FEMS MicrobiolLett 248, 189-198). It allowed for normalization of the binding signal with the expression level, provided low cell-to-cell variations and made discrimination of different epitope populations possible. Further, it also allowed for a parallel assay to determine non-binding peptides displayed on the surface.

Two epitopes regions, SEQ ID NO:4

(RGFGFITFTNPEHASVAMRAMNGESLDGR) and SEQ ID NO:5

(RSYSRGGGDQGYGSGRYYDSRPGG), within SEQ ID NO:1 were identified.

5. Epitope Mapping using Luminex

a) Synthetic Peptide Preparation

A PEPscreen library consisting of 25 biotinylated peptides corresponding to the PrEST HPRR232631 (SEQ ID NO:1) on RBM3 was synthesized by Sigma-Genosys (Sigma-Aldrich). The peptides were 15 amino acids long with a 10 amino acid overlap, together covering the entire PrEST-sequence. The peptides were resolved in 80% DMSO to a final concentration of 10 mg/ml.

b) Bead Coupling

Neutravidin (Pierce, Rockford, Ill.) was immobilized on carboxylated beads (COON Microspheres, Luminex-Corp., Austin, Tex.) in accordance to the manufacturer's protocol. Coupling of 106 beads was performed using a filter membrane bottomed microtiter plate (MultiScreen-HTS, Millipore, Billerica, Mass.) as previously described (Larsson et al (2009) J Immunol Methods 15;34(1-2):20-32, Schwenk et al (2007) Mol Cell Proteomics 6(1) 125:32). 25 distinct groups of beads with different color code IDs were activated using 1-Ethyl-3-(3-dimethylamino-propyl) carbodiimide and N-Hydroxysuccinimide. Neutravidin (100 μg/ml in MES) was added to the beads and incubated for 120 min on a shaker. The beads were finally washed, re-suspended, and transferred to micro-centrifuge tubes for storage at 4° C. in a protein containing buffer (BRE, Blocking Reagent for ELISA, Roche, Basel, Switzerland) supplemented with NaN3. All coupled bead populations were treated with sonication in an ultrasonic cleaner (Branson Ultrasonic Corporation, Danbury, CT) for 5 min. The biotinylated peptides were diluted in BRE to a concentration of 20 μM, and 100 μl of each peptide was used in the coupling reaction, which was conducted for 60 min with shaking at RT. Finally, the beads were washed with 3×100 μl BRE buffer and stored at 4° C. until further use.

c) Determination of Binding Specificity

A bead mixture containing all 25 bead IDs was prepared and 45 μl of each antibody diluted to 50 ng/ml in PBS was mixed with 5 μl of the bead mix and incubated for 60 min at RT. A filter bottomed microtiter plate (Millipore) was utilized for washing and following each incubation all wells were washed with 3×100 μl PBST. 50 μl of R-Phycoerythrine labeled anti-rabbit IgG antibody (0.5 μg/ml, Jackson ImmunoResearch) or 50 μl of Alexa Fluor 555 goat anti-mouse IgG were added (0.4 ug/mI) for a final incubation of 60 min at RT.

Measurements were performed using the Luminex LX200 instrumentation with Luminex xPONENT software. For each experiment 50 events per bead ID were counted and the median fluorescence intensity (MFI) was used as a measurement of antibody binding to individual bead populations.

d) Results

The specificities of the monospecific polyclonal antibody (anti-RBM3, HPA003624) and the monoclonal antibody 6F11 were tested in an assay using beads coupled with synthetic biotinylated peptides. Anti-RBM3 showed strong binding to 8 of the peptides, namely 6, 7, 8, 14, 15, 16, 24 and 25, corresponding to three distinct regions on the PrEST sequence, consensus sequences SEQ ID NO: 6, 7, 8 and 9. In particular peptide 24 and 25, corresponding to SEQ ID NO:9 generated a strong signal. The monoclonal antibody 6F11 reacted with two peptides: 15 and 16, corresponding to one distinct region on the PrEST sequence, consensus sequence SEQ ID NO: 8. As both anti-RBM3 and 6F11 bound to peptides 15 and 16, this indicates that these antibodies share one or more epitope(s) within this region. It is notable that SEQ ID NO:6 is within SEQ ID NO:4 and that SEQ ID NO:8 to some extent overlaps with SEQ ID NO:5.

6. Epitope Mapping using Bacterial Display II

RBM3 DNA corresponding to SEQ ID NO:1 (i.e. aa 18-151 of ENSP00000365946 or by 261-682 ENST00000376755) was amplified by PCR using vector pAff8c as template. The amplified DNA was fragmentized to various lengths (approximately 50-150 bp) by sonication, followed by ligation into the staphylococcal display vector (pSCEM2) and transformed into S. Carnosus yielding around 100000 transformants. In-frame DNA fragments were displayed as peptides on the staphylococcal surface. After incubation with antibody (anti-RBM3 obtained in Section 2 and monoclonal antibodies obtained in Section 3) and fluorescently labeled secondary reagents, positive and negative cells were separately sorted using flow cytometry in order to isolate epitope and non-epitope presenting cells. Plasmid DNA from isolated cells was sequenced by Sanger sequencing and sequences were aligned to the RBM3 antigen for identification of epitopes.

A dual-labeling strategy with real-time monitoring of the surface expression level was used (Lofblom, J et al (2005) FEMS Microbiol Lett 248, 189-198). It allowed for normalization of the binding signal with the expression level, provided low cell-to-cell variations and made discrimination of different epitope populations possible. Further, it also allowed for a parallel assay to determine non-binding peptides displayed on the surface.

For the polyclonal antibody, the regions SEQ ID NO:10-15 within SEQ ID NO:1, were identified. In particular, the regions SEQ ID NO:11 and SEQ ID NO:12 were of interest, since they were found within the earlier identified region SEQ ID NO:4. Further, the regions SEQ ID NO:13 and 14 were particularly interesting, since they to a large extent overlapped with previously identified SEQ ID NO:6 and 7, respectively.

For the monoclonal antibody 6F11, the region SEQ ID NO:16 within SEQ ID NO:1 was identified, and this region (SEQ ID NO:16) is within the earlier identified region SEQ ID NO:5. The epitope region of 6F11 identified here in Section 7 has a one-amino acid overlap with the 6F11 epitope region identified in Section 6. The results of Sections 6 and 7 are, however, not in contrast; one of the peptides found to bind 6F11 in Section 6 (peptide 16) comprises SEQ ID NO:16 (and SEQ ID NO:19). The results of Sections 6 and 7 may thus be considered complementary.

For the monoclonal antibody 1B5, the region SEQ ID NO:17 within SEQ ID NO:1 was identified, and this region (SEQ ID NO:17) was also found within the earlier identified region SEQ ID NO:5. For the monoclonal antibody 7G3, the region SEQ ID NO:18 within SEQ ID NO:1 was identified. This region (SEQ ID NO:18) was also found within the earlier identified region SEQ ID NO:5. This region (SEQ ID NO:18) overlaps with the epitope for the 6F11 antibody (SEQ ID NO:16). For the monoclonal antibody 9B11, the region SEQ ID NO:19 within SEQ ID NO:1 was identified.

7. Evaluation of Antibody Specificity a) Material and Methods

The specificity of the polyclonal antibody (anti-RBM3), and two of the monoclonal antibodies (6F11 and 1 B5) were analyzed by Western Blot. Western blot was performed by separation of total protein extracts from selected human cell lines on 17% SDS-PAGE gels under reducing conditions, followed by electro-transfer to PVDF membranes (Bio-Rad Laboratories) according to the manufacturer's recommendations. The membranes were blocked (5% BSA in 1×PBS with 0.1% Tween20) for 1 h at room temperature, incubated with the primary affinity purified antibody (diluted 1:1000 in blocking buffer) and washed in PBST. The secondary HRP-conjugated antibody (sheep anti-mouse immunoglobulin/HRP, GE) was diluted 1:10000 in blocking buffer and chemiluminescence detection was carried out using a ChemidocTM CCD camera (Bio-Rad Laboratories) and Western Blotting Luminol Reagent (Santa Cruz Biotechnologies, Inc), according to the manufacturer's protocol.

b) Results

The results of the Western blot analysis shows that the antibodies specifically detect a band of approximately 16 kDa in the cell lines. The theoretical molecular weight of RBM3 is 16 kDa (as calculated from the RBM3 amino acid sequence SEQ ID NO:2), corresponding well to the result obtained. Additional bands were observed for anti-RBM3 and 6F11. Overall, the results show that the monoclonal antibodies selectively interacting with epitopes within SEQ ID NO:5 were more specific to the target protein than the polyclonal antibody raised against a peptide covering almost all of the RBM3 protein, and that the 1 B5 antibody was even more specific than the 6F11 antibody (see FIG. 1).

8. Fractionation of a Polyclonal Anti-RBM3 Antibody a) Materials and Methods

Peptide specific antibodies were obtained by affinity purification of anti-RMB3 against peptides to which the polyclonal anti-RBM3 antibody was shown to bind in Examples, section 5. Among the peptides chosen was peptide 6 (SEQ ID NO:20), and 600 nmol of biotinylated peptide were diluted with HiTrapTM Streptavidin binding buffer to a final volume of 1100 □I and applied to 1 ml HiTrap™ Streptavidin HP columns (GE Healthcare Bio-Sciences AB, Uppsala, Sweden) for binding. After coupling, columns were washed with HiTrap™ Streptavidin binding buffer to remove unbound peptides (and a blank run was performed on all columns prior to sample loading.) Serum obtained from a New Zeeland white rabbit immunized with the recombinant RBM3 fragment SEQ ID NO: 1 fused to a His6-ABP tag, was purified on a AKTAxpress™ (GE Healthcare) liquid chromatography system on eight columns in a serial mode as follows: two 5 ml His6-ABP columns followed by 5 epitope specific peptide columns and at the end a His6-ABP-RBM3 fusion protein column. After sample loading, the columns were washed and eluted in parallel to obtain separate antibody fractions. The eluted antibody fractions were epitope mapped using BioPlex, as described above. To further improve the epitope resolution for the antibody fraction that bound peptide 6, alanine scanning of the peptide was performed using the following method: Twenty biotinylated synthetic peptides of the sequence TQRSRGFGFITFTNPEHASV (SEQ ID NO: 21), each with a single alanine mutation introduced at every residue (Sigma-Aldrich) were dissolved in DMSO and diluted to 4 pmoles peptide in 100 μL PBS 7.4 supplemented with 1 mg/mL BSA. The peptides were coupled to 20 Bioplex neutravidin coated beads with 20 unique reporter dyes as described above. The antibody fraction binding to peptide 6 was incubated for one hour in PBST with a cocktail of the different beads consisting of around 15,000 beads per ID. The antibodies were subsequently labeled with PE-conjugated secondary reagent (Moss Inc., USA) and analyzed using Bioplex 200 Suspension Array instrumentation with Bio-Plex Manager 5.0 software.

b) Results

When the antibody fraction was epitope mapped, the fractionated antibody bound its expected peptide. The antibody fraction that bound to peptide 6 was confirmed to bind the full-length RBM3 protein (SEQ ID NO:2) by IHC and Western Blot analysis. Preserved antibody binding for the fraction that bound peptide 6 was observed for all amino acid positions except the alanine-substitutions Phe12Ala, Thrl3Ala, and Asnl4Ala of the epitope. The epitope for the antibody fraction was thus determined to include the sequence FTN (SEQ ID NO:22) within SEQ ID NO:4 (see FIG. 5).

9. Generation of Monoclonal Antibodies II a) Materials and Methods

A synthetic peptide (SEQ ID NO: 23), including peptide 6 (SEQ ID NO: 20) and peptide 7 (SEQ ID NO:24) in Section 5 and having a cystein residue added at its N-terminal to which BSA was coupled according to standard procedure, was used as antigen for production of monoclonal antibodies. The antigen was injected subcutaneously into BALB/c mice (4-6 weeks old, female) at three week intervals. The antigen was mixed with complete Freund's adjuvant for the first injection and incomplete Freund's adjuvant for the following injections. Three days before fusion, the mouse was last challenged with antigen intravenously. Hybridomas were generated by fusion of mouse splenocytes with the Sp2/0 myeloma cell line. By screening several cell lines using ELISA, cells that secreted antibodies specific for the antigen (SEQ ID NO:1) were identified. Cell lines that showed positive results in ELISA, Western blot (WB) and immunohistochemistry (IHC) were selected for subcloning. In addition, the immunohistochemical staining patterns of the monoclonal antibodies were compared to that of anti-RBM3.

b) Results

Cell-lines were screened by ELISA to identify lines that produce monoclonal antibodies (mAbs) that recognize the antigen (SEQ ID NO:1), but not the fusion tag, BSA. There were 37 cell-lines showing specific binding to the antigen SEQ ID NO:1 in ELISA and these were selected for further testing. For each of the selected 37 clones 150-300 μl supernatant was collected and azide was added. The supernatants were stored at +4° C. Further testing of the cell lines showed that clones denoted 7F5, 10F1, 12A10, 12C9, and 14D9 gave positive results in both Western blot and IHC analysis. These clones were selected for subcloning and expansion.

10. Evaluation of Antibody Specificity II a) Material and Methods

The specificity of the polyclonal antibody (anti-RBM3), obtained as previously described, and the monoclonal antibodies (7F5, 10F1, 12A10, 12C9, and 14D9), obtained as described in Section 9 above, were analyzed by Western Blot. Western blot was performed by separation of total protein extracts from the human cell line RT4 on 4-20% criterion TGX prep well gels under reducing conditions, followed by electro-transfer to PVDF membranes (Millipore) according to the manufacturer's recommendations. The membranes were blocked (5% milk in 1×TBST (0.1% Tween20)) for 1 h at room temperature, incubated with the primary monoclonal antibody (diluted 1:10 in 1% BSA, 1×TBST) and washed in PBST. The secondary HRP-conjugated antibody (polyclonal goat anti-mouse or polyclonal swine anti-rabbit, both Dako) was diluted 1:3000 in blocking buffer and chemiluminescence detection was carried out using a CCD camera (Syngene) and Immobilon Western Chemiluminescent HRP Substrate (Millipore), according to the manufacturer's protocol.

b) Results

The results of the Western blot analysis shows that the antibodies specifically detect a band of approximately 16 kDa in the RT4 cell line. The theoretical molecular weight of RBM3 is 16 kDa (as calculated from the RBM3 amino acid sequence SEQ ID NO:2), corresponding well to the result obtained. Additional bands were observed for anti-RBM3. Overall, the results show that the monoclonal antibodies were more specific than the polyclonal antibody, (see FIG. 4).

11. Epitope Mapping of Monoclonal Antibodies using Bioplex

a) Material and Methods

The monoclonal antibodies obtained as described in Section 9 were epitope mapped using Bioplex. Synthetic peptide preparation and bead coupling was performed as described in Section 6. A bead mixture containing all 25 bead IDs was prepared and 10 μl of the monoclonal antibodies, diluted 1:10 in PBS-BN (1% BSA), was mixed with 5 μl of the bead mix and incubated for 60 min at RT. A filter bottomed microtiter plate (Millipore) was utilized for washing and following each incubation all wells were washed with 3×100 μl PBST. 25 μl of PE-conjugated goat anti-mouse IgG (Jackson ImmunoResearch) were added (4 ug/ml) for a final incubation of 60 min at RT.

Measurements were performed using BioPlex 200 Suspension Array instrumentation with Bio-Plex Manager 5.0 software. For each experiment 50 events per bead ID were counted and the median fluorescence intensity (MFI) was used as a measurement of antibody binding to individual bead populations.

b) Results

The specificities of the monoclonal antibodies were tested in an assay using beads coupled with synthetic biotinylated peptides. All monoclonals tested showed strong binding to 2 of the peptides, namely peptide 7 (SEQ ID NO: 24) and 8, SEQ ID NO: 25 (see FIG. 5) corresponding to the consensus sequence SEQ ID NO: 26 within SEQ ID NO:4.

12. Testis TMA—Prognosis a) Material and Methods

Tumor material was collected from thirty patients diagnosed with testicular germ-cell tumors (TGCT) at the Department of Pathology, UMAS, between 1995 and 2008. Five of the samples were pure seminoma and 25 were non-seminomatous TGCT. Non-seminomatous TGCT were classified according to the International Germ Cell Cancer Collaborative Group (IGCCC). Four of the 25 samples were cases classified as IGCCC intermediate prognosis and five samples as IGCCC poor prognosis. The remaining 16 non-seminomatous TGCT cases were classified as IGCCC good prognosis. Permission for this study was obtained from the Ethics Committee at Lund University; ref nr 447-07 and 493-09. Five patients died from their disease, 4 of whom were IGCCC poor and 1 IGCCC intermediate. All patients received standard treatment including cisplatin.

Prior to TMA construction, all available haematoxylin and eosin stained slides from each case were histopathologically re-evaluated. The total number of histological subtypes was denoted and areas representing each subtype delineated, including difficult-to-classify areas. Full-face sections, as many as needed to cover all different components in each case, were then stained for SOX-2 (R&D, clone 245610; 1:100) and CD30 (DAKO, clone BER-H2; 1:25), to further refine and revise the classification. A standard set of 4×1 mm cores were taken from each invasive tumor in a proportional fashion, covering up to 3 different components. A semi-automated arraying device was used (TMArrayer; Pathology Devices, Inc, Westminster, Md., USA).

All immunohistochemical stainings were performed in the PT-link system (DAKO, Copenhagen, Denmark), including automated pre-treatment. The slides were incubated for 30 min at room temperature with the primary RBM3 monoclonal antibody 1B5 obtained as in Examples, Section 3, followed by incubation for 30 min at room temperature with goat anti-mouse peroxidase conjugated Envision®. Between all steps, slides were rinsed in wash buffer (Dako). Finally, diaminobenzidine (Dako) was used as chromogen and Harris hematoxylin (Sigma-Aldrich) was used for counterstaining. The slides were mounted with Pertex® (Histolab).

All samples of immunohistochemically stained tissue were manually evaluated under the microscope and annotated by a certified pathologist. Annotation of each sample was performed using a simplified scheme for classification of IHC outcome. Each tissue sample was examined for representativity and immunoreactivity.

Basic annotation parameters included an evaluation of i) subcellular localization (nuclear and/or cytoplasmic/membranous), ii) staining intensity (SI) and iii) fraction of stained cells (FSC). Staining intensity was subjectively evaluated in accordance to standards used in clinical histo-pathological diagnostics and outcome was classified as: absent=no immunoreactivity, weak−moderate=faint to medium immunoreactivity, or strong=distinct and strong immunoreactivity. Also fraction of stained cells was subjectively evaluated in accordance to standards used in clinical histo-pathological diagnostics and outcome was classified as: <2%, 2-25%, >25-75% or >75% immunoreactive cells of the relevant cell population. The skilled artisan will recognize that this annotation procedure is similar to a calculation of an Allred score, see e.g. Allred et al (1998) Mod Pathol 11(2), 155.

For graphic presentation nucleic and cytoplasmic staining were combined to yield a staining score (SS) ranging from 0 to 3. Only intensity was considered, but most positive tumors had a fraction level of >50%. SS=0 was defines as absent expression, SS=1 was defined as a weak expression, SS=2 was defined as a moderate expression, and SS=3 was defined as a strong expression.

b) Results

RBM3 expression was annotated as 0, 1, 2, or 3, with 3 denoting the highest staining score (SS). As can be seen in FIG. 2, the level of RBM3 protein expression correlates with established prognostic categories. Patients that died from their disease consistently show a low level of RBM3 expression. This is also true for patients belonging to the poor prognosis category, while all patients with a high RBM3-expression can be found in the good prognosis category. All patients with seminomas, which in general have a particularly good prognosis, had a high RBM3 expression.

As can be seen in FIG. 3, there was a correlation between RBM3 protein expression and survival. All patients with high RBM3 protein expression were alive at the end of the observation period.

Consequently, a patient diagnosed with a RBM3 high TGCT is more likely to have a longer survival than a patient diagnosed with a RBM3 low TGCT.

13. Testis TMA—Diagnosis a) Material and Methods

Tissue material was collected from 30 patients diagnosed with testicular germ-cell tumors (TGCT) at the Department of Pathology, UMAS, between 1995 and 2008. From this material 15 samples were collected from areas of unclassified intratubular germ cell neoplasia (ITGCN) and 22 samples were collected from normal testis tissue. Permission for this study was obtained from the Ethics Committee at Lund University; ref nr 447-07 and 493-09.

Prior to TMA construction, all available haematoxylin and eosin stained slides from each case were histopathologically re-evaluated. The total number of histological subtypes was denoted and areas representing each subtype delineated, including difficult-to-classify areas. Full-face sections were then stained for SOX-2 (R&D, clone 245610; 1:100) and CD30 (DAKO, clone BER-H2; 1:25), to further refine and revise the classification. A standard set of 2×1 mm cores were taken from each ITGCN and normal tissue. A semi-automated arraying device was used (TMArrayer; Pathology Devices, Inc, Westminster, Md., USA).

All immunohistochemical stainings were performed in the PT-link system (DAKO, Copenhagen, Denmark), including automated pre-treatment. The slides were incubated for 30 min at room temperature with the primary RBM3 monoclonal antibody 1B5 obtained as in Examples, Section 3, followed by incubation for 30 min at room temperature with goat anti-mouse peroxidase conjugated Envision®. Between all steps, slides were rinsed in wash buffer (Dako). Finally, diaminobenzidine (Dako) was used as chromogen and Harris hematoxylin (Sigma-Aldrich) was used for counterstaining. The slides were mounted with Pertex® (Histolab).

All samples of immunohistochemically stained tissue were manually evaluated under the microscope and annotated by a certified pathologist.

Annotation of each sample was performed using a simplified scheme for classification of IHC outcome. Each tissue sample was examined for representativity and immunoreactivity.

Basic annotation parameters included an evaluation of i) subcellular localization (nuclear and/or cytoplasmic/membranous), ii) staining intensity (SI) and iii) fraction of stained cells (FSC). Staining intensity was subjectively evaluated in accordance to standards used in clinical histo-pathological diagnostics and outcome was classified as: absent=no immunoreactivity, weak−moderate=faint to medium immunoreactivity, or strong=distinct and strong immunoreactivity. Also fraction of stained cells was subjectively evaluated in accordance to standards used in clinical histo-pathological diagnostics and outcome was classified as: <2%, 2-25%, >25-75% or >75% immunoreactive cells of the relevant cell population. The skilled artisan will recognize that this annotation procedure is similar to a calculation of an Allred score, see e.g. Allred et al (1998) Mod Pathol 11(2), 155.

Based on both the intensity and fraction of immunoreactive cells, a staining score (SS) was given for each tissue sample ranging from 0 to 3. Only intensity was considered, but most positive tumors had a fraction level of >50%. SS=0 was defines as absent expression, SS=1 was defined as a weak expression, SS=2 was defined as a moderate expression, and SS=3 was defined as a strong expression.

b) Results

RBM3 expression was annotated as 0, 1, 2, or 3, with 3 denoting the highest staining score (SS). All unclassified ITGCN samples showed strong RBM3 protein expression (SS=3), whereas in normal testis tissue, only sertoli cells and spermatogonia expressed RBM3 protein. ITGCN is a precursor of testicular germ cell tumors (TGCT) and is also referred to as cancer in situ (CIS). The strong expressions of RBM3 in all ITGCN cells suggest a role for RBM3 in CIS.

Consequently, these results indicate that testicular cancer in situ can be diagnosed by detection of RBM3 expression.

Claims

1. A method for determining whether a mammalian subject belongs to a first or a second group, wherein subjects of the first group have a higher risk of having a testicular disorder than subjects of the second group, comprising the steps of:

a) evaluating an amount of RNA binding motif protein 3 (RBM3) protein or RBM3 mRNA in at least part of an earlier obtained sample comprising biological material from a testicle of said subject and determining a sample value corresponding to the evaluated amount;
b) comparing said sample value with a predetermined reference value; and, if said sample value is higher than said reference value,
c1) concluding that the subject belongs to the first group; and, if said sample value is lower than or equal to said reference value,
c2) concluding that the subject belongs to the second group.

2. The method according to claim 1, wherein said sample comprises seminal fluid or cells from the testicle.

3. The method according to claim 1, wherein said sample comprises tissue material from the testicle.

4. The method according to claim 1, wherein the evaluation of step a) is limited to cells other than sertoli cells.

5. The method according to claim 1, wherein the evaluation of step a) is limited to the nuclei of cells of said sample.

6. The method according to claim 1, wherein the testicular disorder is selected from the group consisting of testicular cancer in situ, atrophy, and infertility.

7. A method for determining whether a mammalian subject having a testicular cancer belongs to a first or a second group, wherein the prognosis of subjects of the first group is better than the prognosis of subjects of the second group, comprising the steps of:

a) evaluating an amount of RBM3 protein or RBM3 mRNA in at least part of a sample earlier obtained from the subject and determining a sample value corresponding to the evaluated amount;
b) comparing said sample value with a predetermined reference value; and, if said sample value is higher than said reference value,
c1) concluding that the subject belongs to the first group; and, if said sample value is lower than or equal to said reference value,
c2) concluding that the subject belongs to the second group.

8. A method for determining the level of intensity of a treatment of a mammalian subject having a testicular cancer, comprising the steps of:

a) evaluating the amount of RBM3 protein or RBM3 mRNA present in at least part of a sample earlier obtained from said subject, and determining a sample value corresponding to said amount;
b) comparing the sample value obtained in step a) with a reference value; and,
if said sample value is higher than said reference value,
c1) concluding that said subject should be given a treatment of a first intensity; and,
if said sample value is lower than or equal to said reference value,
c2) concluding that said subject should be given a treatment of a second intensity,
wherein the second intensity is higher than the first intensity.

9. The method according to claim 8, wherein said treatment comprises a platinum-based treatment.

10. The method according to claim 9, wherein said platinum-based treatment is selected from carboplatin, paraplatin, oxaliplatin, satraplatin, picoplatin and cisplatin treatment.

11. The method according to claim 1, wherein step a) comprises:

a1) applying to said sample a quantifiable affinity ligand capable of selective interaction with the RBM3 protein to be evaluated, said application being performed under conditions that enable binding of the affinity ligand to RBM3 protein present in the sample; and
a11) quantifying the affinity ligand bound to said sample to evaluate said amount.

12. The method according to claim 11, wherein the quantifiable affinity ligand is selected from the group consisting of antibodies, fragments thereof and derivatives thereof.

13. The method according to claim 11, wherein said quantifiable affinity ligand is capable of selective interaction with a peptide whose amino acid sequence consists of a sequence SEQ ID NO:1. 20

14. A kit for carrying out a method according to claim 1, which comprises

a) a quantifiable affinity ligand capable of selective interaction with an RBM3 protein; and
b) reagents for quantifying the amount of said quantifiable affinity ligand;
c) a quantifiable affinity ligand capable of selective interaction with a protein selected from Placental-Like Alkaline Phosphatase (PLAP), Octamer-3/4 (OCT3/4) and (RNA Binding Motif protein Y) RBMY; and
d) reagents for quantifying the amount of the quantifiable affinity ligand of c),
wherein the reagents of b) and d) are the same or different.

15. The kit for carrying out a method according to claim 7, which comprises

a) a quantifiable affinity ligand capable of selective interaction with an RBM3 protein; and
b) reagents for quantifying the amount of said quantifiable affinity ligand;
c) a quantifiable affinity ligand capable of selective interaction with a protein selected from human chorionic gonadotropin (HCG), a-fetoprotein (AFP) and lactate dehydrogenase (LD); and
d) reagents necessary for quantifying the amount of the quantifiable affinity ligand of c),
wherein the reagents of b) and d) are the same or different.

16. A RBM3 protein fragment which consists of 20 amino acids or less and comprises an amino acid sequence selected from SEQ ID NO:8, 16 and 17.

17. A method of diagnosing a testicular disorder, comprising detecting a RBM3 protein or a RMB3 mRNA molecule. 20

18. The method according to claim 17, wherein the RBM3 protein or RMB3 mRNA molecule is detected in a sample of testicular tissue, semen or seminal fluid.

19. A method of establishing a prognosis for testicular cancer, comprising detecting a RBM3 protein or a RMB3 mRNA molecule.

20. A method of production, selection or purification of a diagnostic agent for a testicular disorder or a prognostic agent for establishing a prognosis for a mammalian subject having a testicular cancer, comprising using a RBM3 protein, or an antigenically active fragment thereof, as an antigen.

21. The method according to claim 20, wherein the antigen is the RBM3 protein fragment defined in claim 16.

22. An affinity ligand capable of selective interaction with a peptide whose amino acid sequence consists of SEQ ID NO:4 or 5 or a RBM3 fragment which consists of 20 amino acids or less and comprises an amino acid sequence selected from SEQ ID NO:8, 16 and 17.

23. A method of diagnosing a testicular disorder, comprising using an affinity ligand capable of selective interaction with a RBM3 protein as a diagnostic agent.

24. A method of establishing a prognosis for testicular cancer, comprising the use of an affinity ligand capable of selective interaction with a RBM3 protein as a prognostic agent.

Patent History
Publication number: 20120040338
Type: Application
Filed: Aug 16, 2011
Publication Date: Feb 16, 2012
Applicant:
Inventors: Karin Jirström (Limhamn), Jakob Eberhard (Lund)
Application Number: 13/210,809
Classifications
Current U.S. Class: Involving Nucleic Acid (435/6.1); 8 To 10 Amino Acid Residues In Defined Sequence (530/328); 6 To 7 Amino Acid Residues In Defined Sequence (530/329); Polyclonal Antibody Or Immunogloblin Of Identified Binding Specificity (530/389.1); Biospecific Ligand Binding Assay (436/501)
International Classification: C12Q 1/68 (20060101); G01N 33/53 (20060101); C07K 16/00 (20060101); C07K 7/08 (20060101); C07K 7/06 (20060101);