METHOD FOR PREDICTING RESPONSIVENESS TO DRUGS
The present invention provides a novel method to determine the likelihood of effectiveness of a treatment in an individual affected with or at risk for developing cancer. The method involves detecting the presence or absence of Met amplification in an individual. The presence of Met amplification indicates that a Met targeting treatment is likely to be effective. Preferably, the Met targeting treatment is PHA-665752 or PF-02341066. In addition, the present methods allow for the detection of cancer in an individual, wherein the presence of Met amplification indicates that cancer is present and further that it will be treatable, namely with a Met targeting treatment.
Latest THE GENERAL HOSPITAL CORPORATION Patents:
- PERSONALIZED REDIRECTION AND REPROGRAMMING OF T CELLS FOR PRECISE TARGETING OF TUMORS
- Parathyroid hormone polypeptide conjugates and methods of their use
- Highly sensitive in vitro assays to define substrate preferences and sites of nucleic-acid binding, modifying, and cleaving agents
- CAL-T CONSTRUCTS AND USES THEREOF
- System and Method for Restoring Projection Data from CT/DBT Scans with Improved Image Quality
This application is a continuation application of U.S. Utility application Ser. No. 11/887,608, filed Nov. 2, 2007, which is a 371 National Phase Entry Application of International Application PCT/US2006/012678, filed Apr. 5, 2006, which designated the U.S., which claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Patent Application Ser. No. 60/668,419, filed Apr. 5, 2005, and 35 U.S.C. §119(e) of U.S. Provisional Patent Application Ser. No. 60/681,601, filed May 17, 2005 the contents of each of which are herein incorporated by reference in their entirety.
GOVERNMENT SUPPORTThis invention was made with government support under Grant No. PO1 95281 awarded by the National Institutes for Health (NIH). The Government has certain rights in the invention thereto.
SEQUENCE LISTINGThe instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Nov. 22, 2013, is named 32586761.txt and is 27,897 bytes in size.
BACKGROUNDCancers, for example, gastric cancer, prostate cancer, breast cancer, colon cancer, lung cancer, pancreatic cancer, ovarian cancer, cancer of the spleen, testicular cancer, cancer of the thymus, etc., are diseases characterized by abnormal, accelerated growth of epithelial cells. This accelerated growth initially causes a tumor to form. Eventually, metastasis to different organ sites can also occur. Although progress has been made in the diagnosis and treatment of various cancers, these diseases still result in significant mortality.
MET encodes a transmembrane tyrosine kinase receptor for Hepatocyte Growth Factor (HGF, scatter factor), which transduces signals implicated in proliferation, migration and morphogenesis (6-8). Ectopic expression of MET, as well as HGF, confers a tumorigenic and metastatic phenotype in cancer-derived cell lines (9-11), and activating mutations have been reported in both sporadic and inherited forms of renal papillary carcinomas (12). Mutations in MET are rare in breast cancer (13, 14), but tumors with high protein expression appear to have a worse clinical prognosis (15, 16). Furthermore, increased HGF/MET signaling can serve as an initiating event for tumorigenesis, as mice overexpressing either HGF or mutant Met in mammary epithelium develop breast tumors (17-19).
Genetic events that arise and are selected during tumor progression may become essential for tumor survival, a phenomenon generally described as “oncogene addiction” (1). For example, homozygous inactivation of Brca1 alone leads to activation of DNA damage signals and p53-mediated cell cycle arrest; however, simultaneous suppression of p53 allows bypass of this DNA damage checkpoint, and leads to accelerated tumor formation (2-4). The identification of these secondary mutations is important in designing effective treatment for cancers, as targeting one genetic event may not suffice.
It must be remembered that overexpression and amplification are not the same phenomenon. Overexpression can be obtained from a single, unamplified gene, and an amplified gene does not always lead to greater expression levels of mRNA and protein. Thus, it is not possible to predict whether one phenomenon will result in, or is related to, the other. However, in situations where both amplification of a gene and overexpression of the gene product occur in cells or tissues that are in a precancerous or cancerous state, then that gene and its product present both a diagnostic target and a therapeutic opportunity for intervention. Amplification, without overexpression, and overexpression, without amplification, also can be correlated with and indicative of cancers and pre-cancers.
There is a significant need in the art for a satisfactory treatment of cancer, and specifically cancers such as gastric, lung, ovarian, breast, brain, colon and prostate cancers. While tyrosine kinase therapy has proven to be beneficial in many cancer types, its utility is currently limited by our understanding of the individuals in which the therapy is most likely to be effective. Thus, there is a need to identify patients who will most benefit from particular therapies, so as, for example, to limit clinical trial participation to only this subset of individuals and to provide the most appropriate therapy to each individual person in need.
SUMMARYThe inventors of the present invention have surprisingly discovered that the presence of Met amplification predicts responsiveness of an individual to Met targeted treatment. Thus, the present invention provides a novel method to determine the likelihood of effectiveness of a Met targeting treatment in an individual affected with or at risk for developing cancer. The method comprises detecting the presence or absence of Met amplification of said individual. The presence of Met amplification indicates that the Met targeting treatment is likely to be effective. In addition, the present methods allow for the detection of cancer in an individual, wherein the presence of Met amplification indicates that cancer is present and further that it will be treatable, namely with a Met targeting treatment.
In a preferred embodiment, the Met targeting treatment is a tyrosine kinase inhibitor. In a preferred embodiment, the tyrosine kinase inhibitor is a Met tyrosine kinase inhibitor. Preferably, the Met tyrosine kinase inhibitor PHA-665752, (3Z)-5-[(2,6-dichlorobenzyl)sulfonyl]-3-[(3,5-dimethyl-4-{[(2R)-2-(pyrrolidin-1-ylmethyl)pyrrolidin-1-yl]carbonyl}-1H-pyrrol-2-yl)methylene]-1,3-dihydro-2H-indol-2-one (Pfizer, Inc., La Jolla, Calif.). Alternatively, the Met targeting treatment is PF-02341066 (Pfizer, Inc.) or one or more of the c-Met inhibitors described in U.S. Patent Application 20050107391. Also encompassed in the present invention is XL880, an orally available Spectrum Selective Kinase Inhibitor™ (SSKI) from Exelixis. Other Met targeting treatments are known to those of skill in the art and are encompassed herein.
Also encompassed in the present invention are methods of treating an individual affected with or at risk for developing cancer. In this embodiment, an individual is screened for the presence or absence of Met amplification. Individuals identified with Met amplification are therein administered a Met targeting treatment. In one embodiment, the Met targeting treatment is a tyrosine kinase inhibitor. In a preferred embodiment, the Met targeting treatment is a Met inhibitor. The Met inhibitor may be selected from the group consisting of a small molecule inhibitor, a competitive inhibitor, a nucleic acid, an antibody, an antibody fragment, or an aptamer.
Alternatively, the status of Met amplification in an individual is known and a treatment plan is initiated based on this known status. In this embodiment, the presence of Met amplification indicates that a Met targeting treatment will be effective in the treatment or prevention of a cancer. Thus, a Met targeting treatment can be administered to such an individual. Thus, once a patient has been identified as having Met amplification (e.g. the test was done by another physician, at another clinic, or in another country), a Met targeting treatment can be administered.
In one embodiment, the Met amplification assay is performed outside the country of treatment, e.g., the U.S., and the results are provided to the physician, patient or clinic. The results can be sent electronically or can be resident on a web site and screened by the physician, clinic or patient.
The detection of the presence or absence of a Met amplification is accomplished by determining the copy number of the Met gene. In one embodiment the copy number is compared to a positive and negative control sample. The copy number of Met gene may be determined by PCR, qPCR, RT-PCR, Southern Blot, comparative genomic hybridization, microarray based comparative genomic hybridization, fluorescence in situ hybridization (FISH), ligase chain reaction (LCR), transcription amplification, or self-sustained sequence replication.
The cancer may be any cancer known to those of skill in the art, including, but not limited to, gastrointestinal cancer, prostate cancer, ovarian cancer, breast cancer, head and neck cancer, lung cancer, non-small cell lung cancer, cancer of the nervous system, kidney cancer, retina cancer, skin cancer, liver cancer, pancreatic cancer, genital-urinary cancer and bladder cancer. In a preferred embodiment, the cancer is non-small cell lung cancer.
Also encompassed in the methods of the present invention is a kit for detecting the presence or absence of Met amplification.
The present invention provides a novel method to determine the likelihood of effectiveness of an Met targeting treatment in an individual affected with or at risk for developing cancer. The method comprises detecting the presence or absence of Met amplification of said individual. The presence of Met amplification indicates that the Met targeting treatment is likely to be effective. The individual with Met amplification can then be treated with a Met targeting treatment.
In one embodiment of the present invention, the Met targeting treatment is a tyrosine kinase inhibitor. In a preferred embodiment, the tyrosine kinase inhibitor is a Met tyrosine kinase inhibitor. Preferably, the Met tyrosine kinase inhibitor PHA-665752, (3Z)-5-[(2,6-dichlorobenzyl)sulfonyl]-3-[(3,5-dimethyl-4-{[(2R)-2-(pyrrolidin-1-ylmethyl)pyrrolidin-1-yl]carbonyl}-1H-pyrrol-2-yl)methylene]-1,3-dihydro-2H-indol-2-one (Pfizer, Inc., La Jolla, Calif.) or SU11274. Alternatively, the Met targeting treatment is PF-02341066 (Pfizer, Inc.) or one or more of the c-Met inhibitors described in U.S. Patent Application 20050107391, incorporated by reference in its entirety. In an alternative embodiment of the present invention, the Met targeting treatment is an indirect modulator of Met, such as, for example, SU5416, which targets vascular endothelial growth factor (VEGF) and has been shown to display activity against Met.
The methods of the present method allow for the screening of individuals with or at risk for developing cancer, including, but not limited to, solid tumor, solid tumor metastasis and the like. Individuals who have already been diagnosed with cancer are encompassed in the methods of the present invention. Cancers include, but are not limited to, breast, lung, colorectal, prostate, pancreatic, glioma, liver cancer, gastric cancer, head and neck cancers, melanoma, renal cancer, leukemias, myeloma, and sarcomas. Met has been directly implicated in cancers without a successful treatment regimen such as pancreatic cancer, glioma, and hepatocellular carcinoma. medulloblastoma, and mesothelioma. The strong correlation of Met with the biology of metastasis and invasion and disease pathogenesis comprises a novel mechanism for determination of likelihood of drug responsiveness to metastatic cancers.
Detection Methods
According to the methods of the present invention, detecting the presence or absence of Met amplification in a patient with or at risk for developing cancer can be performed in a variety of ways. Such tests are commonly performed using DNA or RNA collected from biological samples, e.g., tissue biopsies, urine, stool, sputum, blood, cells, tissue scrapings, breast aspirates or other cellular materials, and can be performed by a variety of methods.
Gene amplification is a quantitative modification, whereby the actual number of complete coding sequence, i.e. a gene, increases, leading to an increased number of available templates for transcription, an increased number of translatable transcripts, and, ultimately, to an increased abundance of the protein encoded by the amplified gene.
Gene amplification is most commonly encountered in the development of resistance to cytotoxic drugs (antibiotics for bacteria and chemotherapeutic agents for eukaryotic cells) and neoplastic transformation. Transformation of a eukaryotic cell as a spontaneous event or due to a viral or chemical/environmental insult is typically associated with changes in the genetic material of that cell.
The presence of a target gene that has undergone amplification in tumors is evaluated by determining the copy number of the target genes, i.e., the number of DNA sequences in a cell encoding the target protein. Generally, a normal diploid cell has two copies of a given autosomal gene. The copy number can be increased, however, by gene amplification or duplication, for example, in cancer cells, or reduced by deletion. Methods of evaluating the copy number of a particular gene are well known in the art, and include, hybridization and amplification based assays.
Detection and measurement of amplification of the MET gene in a test sample taken from a patient indicates that the patient may have developed a tumor. According to the present invention, the presence of Met amplification predicts the likelihood of effectiveness of Met targeting therapy. Particularly, the presence of amplified MET DNA leads to a diagnosis of cancer or precancerous condition, for example, a gastric cancer, a breast cancer, a colon cancer, a lung cancer, a brain cancer, or an ovarian cancer where Met targeting therapy is likely to be effective.
The present invention therefore provides, in one aspect, methods for detecting Met amplification. In one embodiment, Met amplification is detected by measuring the levels of MET mRNA expression in samples taken from the tissue of suspicion, and determining whether MET is overexpressed in the tissue. The various techniques, including hybridization based and amplification based methods, for measuring and evaluating mRNA levels are provided herein and are known to those of skill in the art.
The present invention also provides, in other aspects, methods for detecting Met amplification in a mammalian tissue by measuring the numbers of MET DNA copy in samples taken from the tissue of suspicion, and determining whether the MET gene is amplified in the tissue. The various techniques, including hybridization based and amplification based methods, for measuring and evaluating DNA copy numbers are provided herein and known to those of skill in the art. The present invention thus provides methods for detecting amplified genes at the DNA level and increased expression at the RNA level, or increased protein expression wherein the results are indicative of tumor progression.
Detecting Gene AmplificationThe present invention encompasses methods of gene amplification known to those of skill in the art, see, for example, Boxer, J. Clin. Pathol. 53: 19-21(2000). Such techniques include in situ hybridization (Stoler, Clin. Lab. Med. 12:215-36 (1990), using radioisotope or fluorophore-labeled probes; polymerase chain reaction (PCR); quantitative Southern blotting, dot blotting and other techniques for quantitating individual genes. Preferably, probes or primers selected for gene amplification evaluation are highly specific, to avoid detecting closely related homologous genes. Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. The antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.
In one embodiment, the biological sample contains nucleic acids from the test subject. The nucleic acids may be mRNA or genomic DNA molecules from the test subject.
In another embodiment, the methods further involve obtaining a control biological sample and detecting Met amplification in this control sample, such that the presence or absence of Met amplification in the control sample is determined. A negative control sample is useful if there is an absence of Met amplification, whereas a positive control sample is useful if there is a presence of Met amplification. For the negative control, the sample may be from the same individual as the test sample (i.e. different location such as tumor versus non-tumor) or may be from a different individual known to have an absence of Met amplification.
In a preferred embodiment of the present invention, gene amplification is detected by polymerase chain reaction (PCR)-based assays. These assays utilize a very small amount of tumor DNA as starting material, are exquisitely sensitive and provide DNA that is amenable to further analysis, such as sequencing, and are suitable for high-volume throughput analysis.
Amplification-Based AssaysIn one embodiment of the present invention, amplification-based assays can be used to measure copy number of the MET gene. In such amplification-based assays, the corresponding MET nucleic acid sequence acts as a template in an amplification reaction (for example, Polymerase Chain Reaction or PCR). In a quantitative amplification, the amount of amplification product will be proportional to the amount of template in the original sample. Comparison to appropriate controls provides a measure of the copy-number of the MET gene, corresponding to the specific probe used. The presence of a higher level of amplification product, as compared to a control, is indicative of amplified Met.
Quantitative PCR
Methods of “quantitative” amplification are well known to those of skill in the art. For example, quantitative PCR involves simultaneously co-amplifying a known quantity of a control sequence using the same primers. This provides an internal standard that may be used to calibrate the PCR reaction. Detailed protocols for quantitative PCR are provided, for example, in Innis et al. (1990) PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc. N.Y. The known nucleic acid sequence for the Met (Accession No.: NM—000245) is sufficient to enable one of skill to routinely select primers to amplify any portion of the gene.
Real Time PCR
Real time PCR is another amplification technique that can be used to determine gene copy levels or levels of mRNA expression. (See, e.g., Gibson et al., Genome Research 6:995-1001, 1996; Heid et al., Genome Research 6:986-994, 1996). Real-time PCR evaluates the level of PCR product accumulation during amplification. This technique permits quantitative evaluation of mRNA levels in multiple samples. For gene copy levels, total genomic DNA is isolated from a sample. For mRNA levels, mRNA is extracted from tumor and normal tissue and cDNA is prepared using standard techniques. Real-time PCR can be performed, for example, using a Perkin Elmer/Applied Biosystems (Foster City, Calif.) 7700 Prism instrument. Matching primers and fluorescent probes can be designed for genes of interest using, for example, the primer express program provided by Perkin Elmer/Applied Biosystems (Foster City, Calif.). Optimal concentrations of primers and probes can be initially determined by those of ordinary skill in the art, and control (for example, beta-actin) primers and probes may be obtained commercially from, for example, Perkin Elmer/Applied Biosystems (Foster City, Calif.). To quantitate the amount of the specific nucleic acid of interest in a sample, a standard curve is generated using a control. Standard curves may be generated using the Ct values determined in the real-time PCR, which are related to the initial concentration of the nucleic acid of interest used in the assay. Standard dilutions ranging from 10-106 copies of the gene of interest are generally sufficient. In addition, a standard curve is generated for the control sequence. This permits standardization of initial content of the nucleic acid of interest in a tissue sample to the amount of control for comparison purposes.
Methods of real-time quantitative PCR using TaqMan probes are well known in the art. Detailed protocols for real-time quantitative PCR are provided, for example, for RNA in: Gibson et al., 1996, A novel method for real time quantitative RT-PCR. Genome Res., 10:995-1001; and for DNA in: Heid et al., 1996, Real time quantitative PCR. Genome Res., 10:986-994.
A TaqMan-based assay also can be used to quantify MET polynucleotides. TaqMan based assays use a fluorogenic oligonucleotide probe that contains a 5′ fluorescent dye and a 3′ quenching agent. The probe hybridizes to a PCR product, but cannot itself be extended due to a blocking agent at the 3′ end. When the PCR product is amplified in subsequent cycles, the 5′ nuclease activity of the polymerase, for example, AmpliTaq, results in the cleavage of the TaqMan probe. This cleavage separates the 5′ fluorescent dye and the 3′ quenching agent, thereby resulting in an increase in fluorescence as a function of amplification.
Other Amplification Methods
Other suitable amplification methods include, but are not limited to ligase chain reaction (LCR) (see Wu and Wallace (1989) Genomics 4:560, Landegren et al. (1988) Science 241:1077, and Barringer et al. (1990) Gene 89:117), transcription amplification (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173), self-sustained sequence replication (Guatelli et al. (1990) Proc. Nat. Acad. Sci. USA 87:1874), dot PCR, and linker adapter PCR, etc.
Hybridization-Based AssaysHybridization assays can be used to detect MET copy number. Hybridization-based assays include, but are not limited to, traditional “direct probe” methods such as Southern blots or in situ hybridization (e.g., FISH), and “comparative probe” methods such as comparative genomic hybridization (CGH). The methods can be used in a wide variety of formats including, but not limited to substrate—(e.g. membrane or glass) bound methods or array-based approaches as described below.
Southern Blot
One method for evaluating the copy number of Met encoding nucleic acid in a sample involves a Southern transfer. Methods for doing Southern Blots are known to those of skill in the art (see Current Protocols in Molecular Biology, Chapter 19, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York, 1995, or Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d Ed. vol. 1-3, Cold Spring Harbor Press, NY, 1989). In such an assay, the genomic DNA (typically fragmented and separated on an electrophoretic gel) is hybridized to a probe specific for the target region. Comparison of the intensity of the hybridization signal from the probe for the target region with control probe signal from analysis of normal genomic DNA (e.g., a non-amplified portion of the same or related cell, tissue, organ, etc.) provides an estimate of the relative copy number of the target nucleic acid. An intensity level that is higher than the control is indicative of amplified Met.
Fluorescence In Situ Hybridization (FISH)
In another embodiment, FISH is used to determine the copy number of the MET gene in a sample. Fluorescence in situ hybridization (FISH) is known to those of skill in the art (see Angerer, 1987 Meth. Enzymol., 152: 649). Generally, in situ hybridization comprises the following major steps: (1) fixation of tissue or biological structure to be analyzed; (2) prehybridization treatment of the biological structure to increase accessibility of target DNA, and to reduce nonspecific binding; (3) hybridization of the mixture of nucleic acids to the nucleic acid in the biological structure or tissue; (4) post-hybridization washes to remove nucleic acid fragments not bound in the hybridization, and (5) detection of the hybridized nucleic acid fragments.
In a typical in situ hybridization assay, cells or tissue sections are fixed to a solid support, typically a glass slide. If a nucleic acid is to be probed, the cells are typically denatured with heat or alkali. The cells are then contacted with a hybridization solution at a moderate temperature to permit annealing of labeled probes specific to the nucleic acid sequence encoding the protein. The targets (e.g., cells) are then typically washed at a predetermined stringency or at an increasing stringency until an appropriate signal to noise ratio is obtained.
The probes used in such applications are typically labeled, for example, with radioisotopes or fluorescent reporters. Preferred probes are sufficiently long, for example, from about 50, 100, or 200 nucleotides to about 1000 or more nucleotides, to enable specific hybridization with the target nucleic acid(s) under stringent conditions.
In some applications it is necessary to block the hybridization capacity of repetitive sequences. Thus, in some embodiments, tRNA, human genomic DNA, or Cot-1 DNA is used to block non-specific hybridization. Thus, in one embodiment of the present invention, the presence or absence of Met amplification is determined by FISH.
Comparative Genomic Hybridization (CGH)
In comparative genomic hybridization methods, a “test” collection of nucleic acids (e.g. from a possible tumor) is labeled with a first label, while a second collection (e.g. from a normal cell or tissue) is labeled with a second label. The ratio of hybridization of the nucleic acids is determined by the ratio of the first and second labels binding to each fiber in an array. Differences in the ratio of the signals from the two labels, for example, due to gene amplification in the test collection, is detected and the ratio provides a measure of the gene copy number, corresponding to the specific probe used. A cytogenetic representation of DNA copy-number variation can be generated by CGH, which provides fluorescence ratios along the length of chromosomes from differentially labeled test and reference genomic DNAs. In another embodiment of the present invention, comparative genomic hybridization may be used to detect the presence or absence of Met amplification.
Microarray Based Comparative Genomic Hybridization
In an alternative embodiment of the present invention, DNA copy numbers are analyzed via microarray-based platforms. Microarray technology offers high resolution. For example, the traditional CGH generally has a 20 Mb limited mapping resolution; whereas in microarray-based CGH, the fluorescence ratios of the differentially labeled test and reference genomic DNAs provide a locus-by-locus measure of DNA copy-number variation, thereby achieving increased mapping resolution. Details of various microarray methods can be found in the literature. See, for example, U.S. Pat. No. 6,232,068; Pollack et al., Nat. Genet., 23(1):41-6, (1999), Pastinen (1997) Genome Res. 7: 606-614; Jackson (1996) Nature Biotechnology 14:1685; Chee (1995) Science 274: 610; WO 96/17958, Pinkel et al. (1998) Nature Genetics 20: 207-211 and others.
The DNA used to prepare the arrays of the invention is not critical. For example, the arrays can include genomic DNA, e.g. overlapping clones that provide a high resolution scan of a portion of the genome containing the desired gene, or of the gene itself. Genomic nucleic acids can be obtained from, e.g., HACs, MACs, YACs, BACs, PACs, P1s, cosmids, plasmids, inter-Alu PCR products of genomic clones, restriction digests of genomic clones, cDNA clones, amplification (e.g., PCR) products, and the like. Arrays can also be produced using oligonucleotide synthesis technology. Thus, for example, U.S. Pat. No. 5,143,854 and PCT Patent Publication Nos. WO 90/15070 and WO 92/10092 teach the use of light-directed combinatorial synthesis of high density oligonucleotide arrays.
Hybridization protocols suitable for use with the methods of the invention are described, e.g., in Albertson (1984) EMBO J. 3: 1227-1234; Pinkel (1988) Proc. Natl. Acad. Sci. USA 85: 9138-9142; EPO Pub. No. 430,402; Methods in Molecular Biology, Vol. 33: In Situ Hybridization Protocols, Choo, ed., Humana Press, Totowa, N.J. (1994), Pinkel et al. (1998) Nature Genetics 20: 207-211, or of Kallioniemi (1992) Proc. Natl Acad Sci USA 89:5321-5325 (1992), etc.
The sensitivity of the hybridization assays may be enhanced through use of a nucleic acid amplification system that multiplies the target nucleic acid being detected. Examples of such systems include the polymerase chain reaction (PCR) system and the ligase chain reaction (LCR) system. Other methods recently described in the art are the nucleic acid sequence based amplification (NASBAO, Cangene, Mississauga, Ontario) and Q Beta Replicase systems.
KitsIn another embodiment of the present invention, kits useful for the detection of Met amplification are disclosed. Such kits may include any or all of the following: assay reagents, buffers, specific nucleic acids or antibodies (e.g. full-size monoclonal or polyclonal antibodies, single chain antibodies (e.g., scFv), or other gene product binding molecules), and other hybridization probes and/or primers, and/or substrates for polypeptide gene products.
In addition, the kits may include instructional materials containing directions (i.e., protocols) for the practice of the methods of this invention. While the instructional materials typically comprise written or printed materials they are not limited to such. Any medium capable of storing such instructions and communicating them to an end user is contemplated by this invention. Such media include, but are not limited to electronic storage media (e.g., magnetic discs, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like. Such media may include addresses to internet sites that provide such instructional materials.
Method of Treating a PatientIn one embodiment, the invention provides a method for selecting a treatment for a patient affected by or at risk for developing cancer by determining the presence or absence of amplified Met.
In certain embodiments, the presence of amplified MET is indicative that a Met targeting treatment will be effective or otherwise beneficial (or more likely to be beneficial) in the individual. Stating that the treatment will be effective means that the probability of beneficial therapeutic effect is greater than in a person not having the appropriate presence MET amplification.
In one embodiment, the treatment involves the administration of a tyrosine kinase inhibitor. In particular, the tyrosine kinase inhibitor is a MET tyrosine kinase inhibitor. The treatment may involve a combination of treatments, including, but not limited to a tyrosine kinase inhibitor in combination with other tyrosine kinase inhibitors, chemotherapy, radiation, etc.
Thus, in connection with the administration of a tyrosine kinase inhibitor, a drug which is “effective against” a cancer indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as a improvement of symptoms, a cure, a reduction in disease load, reduction in tumor mass or cell numbers, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating the particular type of disease or condition.
Met Targeting TreatmentsIn one embodiment of the present invention, the Met targeting treatment is a tyrosine kinase inhibitor. Alternatively and preferably, the Met targeting treatment is specific for the inhibition of Met. For example, a small molecule inhibitor, a competitive inhibitor, an antibody, or a nucleic acid which inhibits Met. In one embodiment of the present invention, the Met targeting treatment is PHA-665752 [(3Z)-5-[(2,6-dichlorobenzyl)sulfonyl]-3-[(3,5-dimethyl-4-{[(2R)-2-(pyrrolidin-1-ylmethyl)pyrrolidin-1-yl]carbonyl}-1H-pyrrol-2-yl)methylene]-1,3-dihydro-2H-indol-2-one (Pfizer, Inc., La Jolla, Calif.); Christensen et al., Cancer Research 63: 7345-7355, (2003)], SU11274 [Sattler et al., Cancer Research 63: 5462-5469 (2003)], or SU5416 [Fong et al., Cancer Research 59:99-106 (1999); Wang et al., J Hepatol 41: 267-273 (2004)]. In a preferred embodiment, the Met targeting treatment is PF-02341066 (Pfizer, Inc.).
Also encompassed in the present invention are c-Met inhibitors described in U.S. patent application 20050107391, incorporated herein by reference in its entirety.
The reversible phosphorylation of tyrosine residues on proteins is an important mechanism of signal transduction. A large variety of natural and synthetic compounds are known to be tyrosine kinase inhibitors. Almost all of these inhibitors block protein kinases by blocking the ATP pocket of the enzymes. Therefore, many have a broad spectrum of activity not only against tyrosine kinases but also against serine/threonine kinases and/or other ATP utilizing proteins. In one embodiment of the present invention, the Met targeting treatment is one such tyrosine kinase inhibitor and may be selected from the following: a member of the geldanamycin family of anisamycin antibiotics, which have been implicated in the down-regulation of the MET at nanomolar concentrations. This class of compounds are currently in clinical trials (NCI) as potential anti-invasive, anti-metastatic agents and are encompassed in the methods of the present invention.
In addition, other examples of Met targeting treatments encompassed in the methods of the present invention are tyrosine kinase inhibitors such as, but not limited to, indrocarbazoles, such as K252a, which is known to inhibit Met mediated signals at nanomolar concentrations, The compound inhibits Met autophosphorylation and prevents activation of its downstream effectors MAPKinase and Akt. It prevents HGF-mediated scattering in MLP-29 cells, reduces Met-driven proliferation in GTL-16 gastric carcinoma cells, and reverses Met mediated transformation of NIH3T3 fibroblasts. K252a and related compounds are promising leads of drugs that may be used against Trk and Met driven cancers [Morotti et al., Oncogene 21:4885-4893, (2002)]. Conceivably, K252a may serve as a lead in the development of Met specific inhibitors.
Also encompassed in the methods of the present invention are inhibitors with selectivity for protein tyrosine kinases. Several classes of compounds are known protein tyrosine kinase inhibitors and my be used in the methods of the present invention. For example, genistein, lavendustin A, tyrphostin 47, herbimycin, staurosporin and radicicol. Herbimycin A is a benzoquinoid ansamycin antibiotic that inhibits a broad spectrum of protein tyrosine kinases by covalently interacting with their kinase domains. Staurosporin is an indole carbazole antibiotic which inhibits a broad spectrum of kinases including scr family members, and serine/threonine kinases. More recently a large number of protein tyrosine kinase inhibitors have been described, all of which are encompassed in the methods of the present invention; 1) bis monocyclic, bicyclic or heterocyclic aryl compounds (WO 92/20642); 2) vinylene-azaindole derivatives (WO 94/14808); 3) 1-cycloprpyl-4-pyridyl-quinolones (U.S. Pat. No. 5,330,992); 4) styryl compounds (U.S. Pat. No. 5,217,999); 2) styryl-substituted pridyl compounds (U.S. Pat. No. 5,302,606); 5) quinazoline derivatives (EP Application No. 0 566 266A1 and U.S. Pat. No. 6,103,728); 6) selenoindoles and selenides (WO 94/03427); 7) tricyclic polyhydroxylic compounds (PCT WO 92/21660); 8) benzylphosphonic acid compounds (PCT WO 91/15495); 9) tyrphostin like compounds (U.S. Pat. No. 6,225,346B1); 10) thienyl compounds (U.S. Pat. No. 5,886,195); and 11) bezodiazepine based compounds (U.S. Pat. No. 6,100,254).
Other tyrosine kinase inhibitors encompassed in the present invention include, but are not limited to the pyrazole pyrimidine PP1, STI-571 (GLEEVEC™), ZD1839, OSI-774, SU101, Aryl and heteroaryl quinazoline compounds, SU 5416, Bis mono- and bicyclic aryl and hetero aryl compounds show selectivity for EGFR and PDGFR (U.S. Pat. No. 5,409,930), Piceatannol (3,4,3,5V-tetrahydroxy-trans-stilbene), and benzodiazepines. Other useful inhibitors include RNA ligands (Jellinek, et al., Biochemistry 33:10450-56; Takano, et al., 1993, Mol. Bio. Cell 4:358A; Kinsella, et al. 1992, Exp. Cell Res. 199:56-62; Wright, et al., 1992, J. Cellular Phys. 152:448-57) and various other tyrosine kinase inhibitors as disclosed in WO 94/03427; WO 92/21660; WO 91/15495; WO 94/14808; U.S. Pat. No. 5,330,992; and Mariani, et al., 1994, Proc. Am. Assoc. Cancer Res. 35:2268.
Also encompassed in the methods of the present invention are methods for the identification of Met tyrosine kinase inhibitors. Methods include, but are not limited to, the use of mutant ligands (U.S. Pat. No. 4,966,849) and soluble receptors and antibodies (Application No. WO 94/10202; Kendall & Thomas, 1994, Proc. Natl. Acad. Sci 90:10705-09; Kim et al., 1993, Nature 362:841-844).
In another embodiment of the present invention, the Met targeting treatment is a small molecule inhibitor. For example, bis monocyclic, bicyclic or heterocyclic aryl compounds (WO 92/20642) and vinylene-azaindole derivatives (WO 94/14808) have been described generally as tyrosine kinase inhibitors. Styryl compounds (U.S. Pat. No. 5,217,999), styryl-substituted pyridyl compounds (U.S. Pat. No. 5,302,606), certain quinazoline derivatives (EP Application No. 0 566 266 A1; Expert Opin. Ther. Pat. (1998), 8(4): 475-478), selenoindoles and selenides (WO 94/03427), tricyclic polyhydroxylic compounds (WO 92/21660) and benzylphosphonic acid compounds (WO 91/15495) have been described as compounds for use as tyrosine kinase inhibitors for use in the treatment of cancer. Anilinocinnolines (WO 97/34876) and quinazoline derivative compounds (WO 97/22596; WO 97/42187) have been described as inhibitors of angiogenesis and vascular permeability.
Other Met targeting treatments useful in the methods of the present invention include nucleic acid ligands to HGF and MET, such as those described in PCT International Publication No. WO 01/09159. Also encompassed in the present invention are MET antagonists described in U.S. Pat. Nos. 5,686,292 and 6,099,841, U.S. Pat. No. 6,174,889, PCT International Publication Nos. WO 00/43373, WO 98/07695 and WO 99/15550.
Particularly useful in the methods of the present invention are compounds which inhibit Met specifically. Inhibitors which modulate MET have been reported and include, but are not limited to the following: indolinone hydrazides (WO05/005378), tetracyclic compounds (WO05/004808; U.S. published patent application No. 2005/0014755), arylmethyl triazolo and imidazopyrazines (WO05/004607), triazolotriazine compounds (WO05/010005), pyrrole compositions (WO05/016920), aminoheteroaryl compounds (WO04/076412; U.S. published patent application No. 2005/0009840), 4,6-diaminosubstituted-2-[oxy or aminoxy]-[1,3,5]triazines (WO04/031184), triarylimidazoles (U.S. published patent application No. 2005/0085473), 2-(2,6-dichlorophenyl)-diarylimidazoles (U.S. published patent application No. 2004/0214874; U.S. published patent application No. 2003/0199691), nucleic acids (U.S. published patent application No. 2003/0049644; U.S. Pat. No. 6,344,321; U.S. Pat. No. 5,646,036; WO01/09159), antibodies (U.S. Pat. No. 5,686,292; U.S. Pat. No. 5,646,036; U.S. published patent application No. 2004/0166544; U.S. published patent application No. 2005/0054019; WO05/016382; WO04/072117), peptide and polypeptides (U.S. Pat. No. 6,214,344; U.S. published patent application No. 2003/0118587; U.S. published patent application No. 2002/0136721 WO04/078778; WO05/030140) and others described in U.S. published patent application No. 2004/0210041; U.S. published patent application No. 2003/0118585; U.S. published patent application No. 2003/0045559; U.S. published patent application No. 2004/0185050.
Other MET inhibitors which can be used in the methods of the invention include but are not limited to the following: substituted 2,3-dihydro-1 h-isoindol-1-one derivatives (U.S. published patent application No. 2005/0054670); Geometrically restricted 3-cyclopentylidene-1,3-dihydroindol-2-ones (U.S. published patent application No. 2005/0038066), Substituted quinolinone derivatives (U.S. published patent application No. 2005/0049253), 5-sulfonamido-substituted indolinone compounds (U.S. published patent application No. 2004/0204407), Cyclic substituted fused pyrrolocarbazoles and isoindolones (U.S. published patent application No. 2004/0186157), Heterocyclic compounds (U.S. published patent application No. 2004/0209892), Indazolinone compositions (U.S. published patent application No. 2004/0167121), Heterocyclic substituted pyrazolones (U.S. published patent application No. 2003/0162775), Benzothiazole derivatives (U.S. published patent application No. 2003/0153568), Pyrazolopyrimidines (U.S. published patent application No. 2002/0156081) and others (U.S. published patent application No. 2004/0116388; U.S. published patent application No. 2004/0019067; U.S. published patent application No. 2003/0004174; U.S. published patent application No. 2003/0199534; U.S. published patent application No. 2002/0052386; U.S. published patent application No. 2003/0069430; U.S. published patent application No. 2004/0198750; U.S. published patent application No. 2004/0127453)
In another aspect, the invention concerns an article of manufacture or package, comprising a container, a composition within the container comprising a MET antagonist, e.g., an anti-MET antibody (or other anti-tumor-specific antigen antibody), optionally a label on or associated with the container that indicates that the composition can be used for treating a condition characterized by overexpression of MET, and a package insert containing instructions to administer the antagonist to patients who have been found to have an amplified MET gene. A therapeutic product may include sterile saline or another pharmaceutically acceptable emulsion and suspension base.
Once identified, such compounds are administered to patients in need of Met targeted treatment, for example, patients affected with or at risk for developing cancer or cancer metastasis.
The route of administration may be intravenous (I.V.), intramuscular (I.M.), subcutaneous (S.C.), intradermal (I.D.), intraperitoneal (I.P.), intrathecal (I.T.), intrapleural, intrauterine, rectal, vaginal, topical, intratumor and the like. The compounds of the invention can be administered parenterally by injection or by gradual infusion over time and can be delivered by peristaltic means.
Administration may be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate permeation. Transmucosal administration may be through nasal sprays, for example, or using suppositories. For oral administration, the compounds of the invention are formulated into conventional oral administration forms such as capsules, tablets and tonics.
For topical administration, the pharmaceutical composition (inhibitor of kinase activity) is formulated into ointments, salves, gels, or creams, as is generally known in the art.
The therapeutic compositions of this invention are conventionally administered intravenously, as by injection of a unit dose, for example. The term “unit dose” when used in reference to a therapeutic composition of the present invention refers to physically discrete units suitable as unitary dosage for the subject, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required diluent; i.e., carrier, or vehicle.
The compositions are administered in a manner compatible with the dosage formulation, and in a therapeutically effective amount. The quantity to be administered and timing depends on the subject to be treated, capacity of the subject's system to utilize the active ingredient, and degree of therapeutic effect desired. Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner and are peculiar to each individual.
The tyrosine kinase inhibitors useful for practicing the methods of the present invention are described herein. Any formulation or drug delivery system containing the active ingredients, which is suitable for the intended use, as are generally known to those of skill in the art, can be used. Suitable pharmaceutically acceptable carriers for oral, rectal, topical or parenteral (including inhaled, subcutaneous, intraperitoneal, intramuscular and intravenous) administration are known to those of skill in the art. The carrier must be pharmaceutically acceptable in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.
As used herein, the terms “pharmaceutically acceptable”, “physiologically tolerable” and grammatical variations thereof, as they refer to compositions, carriers, diluents and reagents, are used interchangeably and represent that the materials are capable of administration to or upon a mammal without the production of undesirable physiological effects.
DEFINITIONSThe term “drug” or “compound” as used herein refers to a chemical entity or biological product, or combination of chemical entities or biological products, administered to a person to treat or prevent or control a disease or condition. The chemical entity or biological product is preferably, but not necessarily a low molecular weight compound, but may also be a larger compound, for example, an oligomer of nucleic acids, amino acids, or carbohydrates including without limitation proteins, oligonucleotides, ribozymes, DNAzymes, glycoproteins, siRNAs, lipoproteins, aptamers, and modifications and combinations thereof.
The term “genotype” in the context of this invention refers to the particular allelic form of a gene, which can be defined by the particular nucleotide(s) present in a nucleic acid sequence at a particular site(s).
As used herein, the terms “effective” and “effectiveness” includes both pharmacological effectiveness and physiological safety. Pharmacological effectiveness refers to the ability of the treatment to result in a desired biological effect in the patient. Physiological safety refers to the level of toxicity, or other adverse physiological effects at the cellular, organ and/or organism level (often referred to as side-effects) resulting from administration of the treatment. “Less effective” means that the treatment results in a therapeutically significant lower level of pharmacological effectiveness and/or a therapeutically greater level of adverse physiological effects.
The term “antibody” is meant to be an immunoglobulin protein that is capable of binding an antigen. Antibody as used herein is meant to include antibody fragments, e.g. F(ab′)2, Fab′, Fab, capable of binding the antigen or antigenic fragment of interest. Preferably, the binding of the antibody to the antigen inhibits the activity of a variant form of EGFR.
The term “humanized antibody” is used herein to describe complete antibody molecules, i.e. composed of two complete light chains and two complete heavy chains, as well as antibodies consisting only of antibody fragments, e.g. Fab, Fab′, F (ab′) 2, and Fv, wherein the CDRs are derived from a non-human source and the remaining portion of the Ig molecule or fragment thereof is derived from a human antibody, preferably produced from a nucleic acid sequence encoding a human antibody.
The terms “human antibody” and “humanized antibody” are used herein to describe an antibody of which all portions of the antibody molecule are derived from a nucleic acid sequence encoding a human antibody. Such human antibodies are most desirable for use in antibody therapies, as such antibodies would elicit little or no immune response in the human patient.
The term “chimeric antibody” is used herein to describe an antibody molecule as well as antibody fragments, as described above in the definition of the term “humanized antibody.” The term “chimeric antibody” encompasses humanized antibodies. Chimeric antibodies have at least one portion of a heavy or light chain amino acid sequence derived from a first mammalian species and another portion of the heavy or light chain amino acid sequence derived from a second, different mammalian species.
Preferably, the variable region is derived from a non-human mammalian species and the constant region is derived from a human species. Specifically, the chimeric antibody is preferably produced from a 9 nucleotide sequence from a non-human mammal encoding a variable region and a nucleotide sequence from a human encoding a constant region of an antibody.
Nucleic acid molecules can be isolated from a particular biological sample using any of a number of procedures, which are well-known in the art, the particular isolation procedure chosen being appropriate for the particular biological sample. For example, freeze-thaw and alkaline lysis procedures can be useful for obtaining nucleic acid molecules from solid materials; heat and alkaline lysis procedures can be useful for obtaining nucleic acid molecules from urine; and proteinase K extraction can be used to obtain nucleic acid from blood (Rolff, A et al. PCR: Clinical Diagnostics and Research, Springer (1994).
The phrases “gene amplification” and “gene duplication” are used interchangeably and refer to a process by which multiple copies of a gene or gene fragment are formed in a particular cell or cell line. The duplicated region (a stretch of amplified DNA) is often referred to as “amplicon.” Usually, the amount of the messenger RNA (mRNA) produced, i.e., the level of gene expression, also increases in the proportion of the number of copies made of the particular gene expressed.
The “copy number of a gene” refers to the number of DNA sequences in a cell encoding a particular gene product. Generally, for a given gene, an animal has two copies of each gene. The copy number can be increased, however, by gene amplification or duplication, or reduced by deletion.
A “cancer” in an animal refers to the presence of cells possessing characteristics typical of cancer-causing cells, such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rate, and certain characteristic morphological features. Often, cancer cells will be in the form of a tumor, but such cells may exist alone within an animal, or may be a non-tumorigenic cancer cell, such as a leukemia cell. In some circumstances, cancer cells will be in the form of a tumor; such cells may exist locally within an animal, or circulate in the blood stream as independent cells, for example, leukemic cells. Examples of cancer include but are not limited to breast cancer, a melanoma, adrenal gland cancer, biliary tract cancer, bladder cancer, brain or central nervous system cancer, bronchus cancer, blastoma, carcinoma, a chondrosarcoma, cancer of the oral cavity or pharynx, cervical cancer, colon cancer, colorectal cancer, esophageal cancer, gastrointestinal cancer, glioblastoma, hepatic carcinoma, hepatoma, kidney cancer, leukemia, liver cancer, lung cancer, lymphoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreas cancer, peripheral nervous system cancer, prostate cancer, sarcoma, salivary gland cancer, small bowel or appendix cancer, small-cell lung cancer, squamous cell cancer, stomach cancer, testis cancer, thyroid cancer, urinary bladder cancer, uterine or endometrial cancer, and vulval cancer.
To “compare” levels of gene expression means to detect gene expression levels in two samples and to determine whether the levels are equal or if one or the other is greater. A comparison can be done between quantified levels, allowing statistical comparison between the two values, or in the absence of quantification, for example using qualitative methods of detection such as visual assessment by a human.
The term “antagonist” is used in the broadest sense, and includes any molecule that partially or fully blocks, inhibits, or neutralizes a biological activity of MET or the transcription or translation thereof. Suitable antagonist molecules specifically include antagonist antibodies or antibody fragments, fragments, peptides, small organic molecules, anti-sense nucleic acids, etc.
“Reducing the level of gene activity” refers to inhibiting the gene product activity in the cell, or lowering the copy number of the gene, or decreasing the level of the gene's transcribed mRNA or translated protein in the cell. Preferably, the level of the particular gene activity is lowered to the level typical of a normal, cancer-free cell, but the level may be reduced to any level that is sufficient to decrease the proliferation of the cell, including to levels below those typical of normal cells.
An “inhibitor of gene activity” is a molecule that acts to reduce or prevent the production and/or accumulation of gene product activity in a cell. The molecule can prevent the accumulation at any step of the pathway from the gene to enzyme activity, e.g. preventing transcription, reducing mRNA levels, preventing translation, or inhibiting the enzyme itself. Such inhibitors can include antisense molecules or ribozymes, repressors of gene transcription, or competitive or non-competitive molecular inhibitors of the gene product.
The phrase “repressor of transcription” refers to a molecule that can prevent the production of mRNA from a particular gene. Preferably, the molecule binds directly or indirectly to a regulatory element of the gene, thereby preventing the transcription of the gene.
The terms “HGF receptor” and “c-Met” and “Met” when used herein refer to a cellular receptor for HGF, which typically includes extracellular domain, a transmembrane domain and an intracellular domain, as well as variants and fragments thereof which retain the ability to bind HGF. The terms “HGF receptor” and “c-Met” and “Met” include the polypeptide molecule that comprises the full-length, native amino acid sequence encoded by the gene variously known as p190MET. The present definition specifically encompasses soluble forms of HGF receptor, and HGF receptor from natural sources, synthetically produced in vitro or obtained by genetic manipulation including methods of recombinant DNA technology. The HGF receptor variants or fragments preferably share at least about 65% sequence identity, and more preferably at least about 75% sequence identity with any domain of the human c-Met amino acid sequence published in Rodrigues et al., Mol. Cell. Biol. 11:2962-2970 (1991); Park et al., Proc. Natl. Acad. Sci., 14:6379-6383 (1987); or Ponzetto et al., Oncogene 6:553-559 (1991). The nucleic acid sequence of the polynucleotide encoding the full-length protein of MET was published by Park et al. (Proc. Natl. Acad. Sci. USA 84: 6379-83 (1987)) and submitted to GenBank under the accession number NM—000245.
EXAMPLES Example 1Mouse mammary tumors derived from a heterozygous Trp53 deletion with a tissue-specific deletion of Brca1 (Brca111/coTrp53+/−MMTV-Cre) (2) were subjected to a whole-genome survey using long oligonucleotide microarrays (Agilent). The use of coding sequence markers for genomic copy number analysis has proven highly effective in identifying gene-centered amplifications and deletions (5). Remarkably, a single recurrent abnormality was evident in 11 of 15 (73%) tumors, namely high level amplification of a locus on chromosome 6 (
10-50 fold amplification of Met was confirmed using quantitative real-time PCR (qPCR) (
No mutations were present in the coding sequence of amplified Met from any of the mammary tumors of Brca1Δ11/coTrp53+/−MMTV-Cre mice, suggesting that overexpression of the wild type receptor is sufficient to confer a selective advantage in tumor cells with this genetic background. Consistent with the presence of DNA amplification, the primary tumors expressed high levels of Met protein (
Amplification of Met was not observed in other common mouse models of mammary carcinogenesis, including MMTV-driven Erbb2 and c-Myc (data not shown), suggesting that the initiating Brca1/p53 lesion in our mouse tumor model may dictate subsequent secondary genetic lesions. In humans, overexpression of the receptor has been reported in many epithelial cancers, but gene amplification in breast cancer has not been systematically analyzed. To extend our findings from the mouse model, we tested a panel of 100 primary human breast cancers. While about 10% of cases had increased MET gene copy number (3-6 copies), no high level Met amplification was found (data not shown). Similarly, no cases of BRCA1− or BRCA2-linked breast tumors (0/9) or breast cancers from patients with TP53-mutant Li-Fraumeni syndrome (0/13) displayed elevated MET gene copy numbers (data not shown). MET amplification therefore is not a common characteristic of human breast cancer.
In contrast, MET amplification has been reported in 10-20% of all primary gastric cancers, including up to 40% in the scirrhous histological subtype (20, 21). Indeed, we found increased MET gene copy numbers in 5/17 (29%) gastric cell lines tested (
Five gastric cancer cell lines with >8-fold MET amplification (Amp+) were compared with 12 cell lines without amplification (Amp−). As expected, Amp+ cells had a dramatic elevation in MET protein expression. Remarkably, these cells also displayed constitutive MET phosphorylation (
To test the potential therapeutic relevance of these observations, we made use of a highly specific MET kinase inhibitor, PHA-665752 (24) (Pfizer). This drug effectively suppressed the constitutive MET autophosphorylation in Amp+ cells. Furthermore, treatment with PHA-665752 also abrogated the baseline phosphorylation of downstream effectors of growth factor receptors, ERK1/2, AKT, STAT3, and FAK in these cells (
In contrast, in Amp− cells where MET is not constitutively autophosphorylated, PHA-665752 had no effect on baseline phosphorylation of ERK1/2, AKT, STAT3 or FAK, indicating that these effectors are likely to be activated through alternative growth factor receptors. In 5/5 Amp+ cells, continued treatment with PHA-665752 led to a dramatic decrease in the number of viable cells (
To confirm that the differential effects of PHA-665752 are truly attributable to its effect on MET, we treated cells with siRNA targeting the MET receptor. Consistent with the drug studies, a marked reduction in cell viability was evident in Amp+ cells following MET knockdown, whereas no such effect was observed in Amp− cells (
Analysis of the role of MET in malignancy has largely focused on its effect in promoting cell motility, invasion and metastasis, rather than its primary transforming potential. However, the ability of MET itself to drive malignant proliferation is evident from its central role in initiating human papillary renal carcinoma (12), and in a number of mouse models with ectopic expression of the activated receptor (17-19). Our observations suggest that even in human cancers where MET alteration may or may not be the initiating genetic event, amplification of the receptor leads to a dependence on its transduced signals (i.e. oncogene addiction (1), thereby identifying a marker of drug response.
As such, MET amplification in gastric and other types of cancers may constitute a molecular marker for targeted therapy, analogous to the BCR-ABL translocation in chronic myeloid leukemia (CML) (27, 28), and activating kinase mutations within c-KIT in gastrointestinal stromal tumors (GIST) (29, 30) and within the epidermal growth factor receptor (EGFR) in non-small cell lung cancer (NSCLC) (31, 32). While our studies focused on cell lines with stable MET amplification on HSRs, tumors with unstable amplification subject to in vivo selection pressures may also prove responsive to MET inhibition. As MET inhibitors enter clinical trials in the near future, our observations highlight an approach in which preclinical studies defining molecular markers of drug susceptibility may help select subsets of cancers most likely to demonstrate a clinical response to such targeted inhibitors.
Materials and Methods:Microarray Screening
Tumors derived from the Brca1Δ11/coTrp53+/−MMTV-Cre animals were histologically analyzed to be over 90% pure. DNA from was extracted from matching pairs of tumor and liver (normal control) of the same animal and processed for microarray analysis as described before (33).
Quantitative Real-Time PCR
The sequences of the PCR primer pairs and fluorogenic MGB probes (all listed from 5′ to 3′) used for DNA copy number analyses:
All samples were done in triplicates and the relative MET copy number was derived by standardizing the input DNA to the control signal (TOP3A for the human samples and Edem1 for the mouse samples).
The sequences of the PCR primer pairs and fluorogenic MGB probes (all listed from 5′ to 3′) used for quantitating relative HGF expression levels are:
All samples were done in triplicates and the relative HGF expression levels was derived by dividing the HGF signal by the GAPDH signal. All values are relative to the lowest expressing cell line, which was assigned an arbitrary expression value of 1.
Mutational Screening
DNA isolated from fresh frozen tissue or cultured cell lines was amplified by direct PCR amplification or nested PCR amplification. Genomic was amplified in a 25 ul reaction consisting of 1× buffer, 50 uM dNTP, 200 nM sense primer, 200 nM antisense primer and 0.8 U Expand Taq (Roche Diagnostics, Germany). Primer sequences and annealing temperatures are provided in the table below. PCR amplicons were purified using exonuclease I (United States Biochemical, Cleveland, Ohio) and shrimp alkaline phosphatase (United States Biochemical, Cleveland, Ohio) and diluted in water prior to sequencing. Bidirectional capillary sequencing was performed using BigDye Terminator v1.1 chemistry (Applied Biosystems, Foster City, Calif.) in combination with an ABI3100 instrument. Internal sequencing primers for exons 4 and 5 of human MET were (exon 4: CCACAAGCCCTGCTAATCTGTTATT (SEQ ID NO 19) and CTTTCTTGGAGAACAAATTAACTAG (SEQ ID NO 20)) and (exon 5: CACCGTTATGACAGGATTTGCACAC (SEQ ID NO 21) and GCTGATGACTCACAGCTAAATGAG (SEQ ID NO 22)). Electropherograms were aligned and reviewed using Sequence Navigator software in combination with Factura.
FISH
Cell lines were grown in the appropriate medium until 70% confluent. Cells were trypsinized, washed in 1×PBS, treated with 0.56% KCl and fixed with 3:1 methanol:acetic acid. Cells were dropped on clean glass slides for interphase and/or metaphase spreads. For FISH in human cells BAC clone CTD-1013N12 containing the full-length MET gene was used. BAC RP11-340A14, mapping to 7q11.2, was used as a control probe. For FISH in mouse cells BAC RP23-173p9 containing the full-length Met gene (6A2 region) was used. BAC RP23-137A12, mapping to 6G3 region, was used as a control probe. All clones were confirmed by PCR using gene-specific or STS markers. Human BAC clones were mapped to normal metaphase spreads to confirm their map positions. BAC DNAs were labeled with Cy3- and FITC-dUTP by nick translation. Metaphase spreads were hybridized with 200 ng of each probe along with 10 ug of Cot-1 DNA in a hybridization buffer containing 50% formamide, 10% dextran sulfate and 2×SSC at 37° C. in a humid chamber for 18-20 hours. Following hybridization slides were washed in 50% formamide/2×SSC pH7.0, and 0.1×SSC solutions at 50° C. Slides were then counterstained with DAPI in antifade solution. Image analysis was performed using the Magnafire software.
Cell Lines
Human gastric cell lines were either purchased from ATCC or were generously donated by Dr. Kay Huebner and Dr. Reuben Lotan. All lines were propagated in RPMI1640 medium supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 50 U/ml penicillin/streptomycin and maintained at 5% CO2 at 37° C.
Immunoblotting
Cells were either directly lysated in 2× sample buffer or in RIPA buffer (150 mM NaCl, 50 mM Tris pH 8.0, 1% NP40, 0.5% DOC, 0.1% SDS, 1 mM EDTA, 10 mM NaF, 1 mM Na-orthovanadate, 1× protease inhibitor cocktail (Roche; Indianapolis, Ind.)). Cell lysates were sonicated for 10 sec and cleared by centrifugation at 14,000 rpm for 10 min at 4° C. Cleared lysates were boiled in sample buffer and loaded onto 10% SDS-PAGE gel. For immunoblotting analysis, proteins were transferred onto Immobilon PVDF membrane (Millipore; Bedford, Mass.) and visualized with Western Lightning Plus chemiluminescence kit (Perkin Elmer; Boston, Mass.).
Antibodies
The phospho-MET (Y1234/Y1235), phospho-AKT (S473), phospho-ERK1/2(T202/Y204), phospho-FAK (Y576/Y577), phospho-STAT3 (Y747), AKT, ERK1/2, STAT3, ERBB2, EGFR, and cleaved caspase-3 antibodies were from Cell Signaling (Beverly, Mass.). The phospho-MET (Y1349) antibody was from Biosource (Camarillo, Calif.). The human MET antibody (C-12) and mouse Met antibody (SP260) were from Santa Cruz Biotechnology (Santa Cruz, Calif.). The β-actin antibody was from Abcam (Cambridge, Mass.). The neutralizing HGF antibody was from R&D Systems (Minneapolis, Minn.). All immunoblots were done with 1:1000 antibody dilution, except for the β-actin antibody, which was used at 1:10000 dilution.
Apoptosis Induction Assay
Cells were plated on coverslips in 12-well dishes and grown to approximately 75% confluency in 10% serum. Subsequently, media was changed to 2% serum and 1 μM PHA-665752. After 72 h the cells were fixed with 4% paraformaldehyde for 20 minutes. Permeabilization with 1% NP40 for 5 minutes was followed by blocking with 3% BSA for 30 minutes. The coverslips were then incubated overnight at 4° C. with cleaved caspase-3 antibody at 1:200 dilution. The next day, the coverslips were washed 3 times with PBS and incubated with a secondary antibody (goat anti-rabbit FITC-conjugated) for 1 h at 1:250 dilution. Following 5 washes with PBS, coverslips were mounted in Vectashield mounting medium containing DAPI (Vector Laboratories; Burlingame, Calif.).
Viability Assays
Cells were plated in 96-well plate in medium containing 4% fetal bovine serum at approximately 4000 cells/well. The next day the cells were treated with increasing concentrations of PHA-665752. Cell viability was measured 96 h later using the MTT assay. Briefly, 10 ul of 5 mg/ml MTT (Thiazolyl blue) solution was added to each well and incubated for about 2 hours at 37° C. For adherent cell lines, the media was removed from each well and the resultant MTT formazan was solubilized in 100 ul of DMSO. For suspension cell lines, the MMT formazan was solubilized by direct addition of 100 ul of acidic isopropanol (0.1N HCl) to each well. The results were quantitated spectrophotometrically using a test wavelength of 570 nm and a reference wavelength of 630 nm.
RNA
RNA was extracted from cultured cells using RNeasy kit from Qiagen (Valencia, Calif.). c-DNA synthesis was performed using SuperScript II Reverse Transcriptase from Invitrogen (Carlsbad, Calif.).
siRNA-Mediated “Knockdown” of Met Expression
The duplexes targeting MET, EGFR, and ERBB2 were custom SMARTpool mixtures from Dharmacon (Lafayette, Colo.). siRNA duplexes were transfected using X-treme Gene transfection reagent from Roche or Lipofectamine 2000 from Invitrogen.
Immunohistochemistry
Immunohistochemistry was performed using Vectastain ABC Kit from Vector Laboratories (Burlingame, Calif.). Mouse Met antibody was used at a 1:100 dilution.
The genetic heterogeneity underlying differential responsiveness of lung cancers to the EGFR tyrosine kinase inhibitors gefitinib and erlotinib is recapitulated in lung-cancer-derived cell lines. Whereas most NSCLC cell lines have an IC50 for gefitinib of 10 μM, rare cell lines harboring activating mutations in EGFR typically demonstrate a 50- to 100-fold enhancement in sensitivity, as measured by cell killing (32, 38-40). To test the predictive value of such an in vitro drug-sensitivity screen, we treated 40 cell lines representing diverse tumor types with gefitinib at concentrations ranging from 100 nM to 10 μM. Extreme sensitivity (100 nM) was observed with NCI-H1650, the only NSCLC cell line in our panel with the del E746-A750 activating mutation in EGFR (
MET Amplification and Constitutive Activation in Human Gastric Cancer Cells.
Overexpression of MET has been reported in many epithelial cancers, but gene amplification is most common in gastric cancer, where 10-20% of all primary tumors and up to 40% of the scirrhous histological subtype have increased MET gene copy numbers (21, 42-43). Analysis of a panel of gastric cancer cell lines by using qPCR identified increased MET gene copy number in 5 of 17 (29%) cases (
As expected, all 5 Amp+ cells displayed dramatic elevation in MET protein expression, compared with the 12 Amp− cells (
MET Amplification As Molecular Marker of Susceptibility to a Tyrosine Kinase Inhibitor. To test the potential therapeutic relevance of these observations, we treated gastric cancer cell lines with the specific MET kinase inhibitor PHA-665752. This small-molecule inhibitor has an IC50 against MET of 9 nM, compared with an IC50 of 3.8 μM and >10 μM for EGFR and platelet-derived growth factor receptor, respectively (24). In 5 of 5 Amp+ cells, treatment with PHA-665752 for 96 h resulted in a dramatic reduction in cell numbers, whereas treatment had no effect in any of the 12 Amp− cells (P=0.00016, Fisher's exact test, two-sided) (
To confirm that the differential effects of PHA-665752 are truly attributable to its effect on MET, we transfected cells with small interfering (si)RNA targeting the MET receptor transcript. Effective and specific knockdown of MET protein expression was demonstrated by immunoblotting analysis (
To address the mechanism by which PHA-665752 triggers cell death in Amp+ cells, we first tested the effect of drug treatment on MET-dependent signaling. PHA-665752 (50 nM) effectively suppressed the constitutive MET autophosphorylation in Amp+ cells (
Suppression of essential growth-factor-mediated survival pathways has been linked to the induction of apoptosis. Consistent with this model, both cleaved caspase-3-staining and PARP-cleavage assays demonstrated apoptosis in Amp+ cells treated with PHA-665752 but not in Amp− cells under identical conditions (
Cellular Proliferation and Viability Assays. Cells were plated in 96-well plates in medium containing 4% FBS at 4,000 cells per well and, after 24 h, treated with various concentrations of either gefitinib or PHA-665752. For quantitation of cellular proliferation, cells were fixed at appropriate time points in 4% paraformaldehyde, and all plates were stained simultaneously by using the fluorescent nucleic acid stain SYTO60 (Molecular Probes) at 1:8,000 dilution in PBS. Quantitation was done by measuring the absorption at 700 nm by using the Odyssey Imaging System (LI-COR, Lincoln, Nebr.). The relative cell number was obtained by normalizing treated samples to matched untreated specimens. For quantitation of cell viability, cultures were stained after 4 days by using the MTT assay. Briefly, 10 ul of 5 mg/ml MTT (Thiazolyl blue) solution was added to each well and incubated for 2 h at 37° C. For adherent cell lines, the media was removed from each well, and the resultant MTT formazan was solubilized in 100 μl of DMSO. For nonadherent cell lines, the MTT formazan was solubilized by direct addition of 100 μl of acidic isopropanol (0.1 N HCl) to each well. The results were quantitated spectrophotometrically by using a test wavelength of 570 nm and a reference wavelength of 630 nm.
FISH and Mutational Analysis. Bacterial artificial chromosome clone CTD-1013N12, containing the full-length MET gene, was used for FISH. PAC RP4-620P6, mapping to 7p21, was used as a control probe. FISH was performed as described in ref 44. For mutational analysis, genomic DNA was amplified by PCR and sequenced bidirectionally by using BigDye Terminator v1.1 chemistry (Applied Biosystems). Primer sequences and annealing temperatures are provided herein.
siRNA-Mediated “Knockdown” of MET Expression and Immunoblotting Analysis. The duplexes targeting MET, EGFR, and ERBB2 transcripts were custom SMARTpool mixtures from Dharmacon (Lafayette, Colo.). siRNA duplexes were transfected by using Lipofectamine 2000 from Invitrogen following the manufacturer's instructions. Briefly, cells were plated in 4% serum and transfected the next day with siRNAs at a final concentration of 40 nM for 5 h, followed by change of culture medium. The transfection was repeated on day 2 under the same conditions. Cell viability was assayed 4 days from the time of the first transfection, by using the MTT assay.
Antibodies. The phospho-MET (Y1234/Y1235), phospho-AKT (S473), phopho-ERK1/2(T202/Y204), phospho-FAK (Y576/Y577), phospho-STAT3 (Y727), AKT, ERK1/2, STAT3, ERBB2, EGFR, cleaved PARP, and cleaved caspase-3 antibodies were from Cell Signaling Technology (Beverly, Mass.). The phospho-MET (Y1349) antibody was from BioSource International (Camarillo, Calif.). The total MET antibody (C-12) was from Santa Cruz Biotechnology. The -actin antibody was from Abcam (Cambridge, Mass.). The neutralizing HGF goat antibody was from R & D Systems, and the matched goat IgG control antibody was from Sigma. All immunoblots were done with 1:1,000 antibody dilution, except for the -actin antibody, which was used at 1:10,000 dilution.
Apoptosis Induction Assay. Cells were plated on coverslips in 12-well dishes and grown to 75% confluency in 10% serum, followed by incubation in 4% serum and PHA-665752. After 72 h, cells were fixed with 4% paraformaldehyde for 20 min, permeabilized by using 1% Nonidet P-40 for 5 min, and blocked with 3% BSA for 30 min. The coverslips were then incubated overnight at 4° C. with cleaved caspase-3 antibody at 1:200 dilution. The next day, the coverslips were washed three times with PBS and incubated with a secondary antibody (goat anti-rabbit FITC-conjugated) for 1 h at 1:250 dilution. After five washes with PBS, coverslips were mounted in Vectashield mounting medium containing DAPI (Vector Laboratories), and staining was visualized by fluorescent microscopy.
REFERENCES
- 1. I. B. Weinstein, Science 297, 63 (2002).
- 2. S. G. Brodie et al., Oncogene 20, 7514 (2001).
- 3. X. Xu et al., Nat. Genet. 22, 37 (1999).
- 4. X. Xu, et al., Nat. Genet. 28, 266 (2001).
- 5. C. Brennan et al., Cancer Res. 64, 4744 (2004).
- 6. A. Bertotti, P. M. Comoglio, Trends Biochem. Sci. 28, 527 (2003).
- 7. C. Birchmeier, W. Birchmeier, E. Gherardi, G. F. Vande Woude, Nat. Rev. Mol. Cell. Biol. 4, 915 (2003).
- 8. P. C. Ma, G. Maulik, J. Christensen, R. Salgia, Cancer Metastasis Rev. 22, 309 (2003).
- 9. S. Rong et al., Mol. Cell. Biol. 12, 5152 (1992).
- 10. S. Rong, S. Segal, M. Anver, J. H. Resau, G. F. Vande Woude, Proc. Natl. Acad. Sci. U.S.A. 91, 4731 (1994).
- 11. R. Abounader et al., Faseb J. 16, 108 (2002).
- 12. L. Schmidt et al., Nat. Genet. 16, 68 (1997).
- 13. J. H. Lee et al., Oncogene 19, 4947 (2000).
- 14. I. Bieche, M. H. Champeme, R. Lidereau, Int. J. Cancer 82, 908 (1999).
- 15. E. Lengyel et al., Int. J. Cancer 113, 678 (2005).
- 16. J. Y. Kang et al., Cancer Res. 63, 1101 (2003).
- 17. M. I. Gallego, B. Bierie, L. Hennighausen, Oncogene 22, 8498 (2003).
- 18. M. Jeffers et al., Proc. Natl. Acad. Sci. U.S.A. 95, 14417 (1998).
- 19. H. Takayama et al., Proc. Natl. Acad. Sci. U.S.A. 94, 701 (1997).
- 20. M. Nakajima et al., Cancer 85, 1894 (1999).
- 21. H. Kuniyasu et al., Biochem. Biophys. Res. Commun. 189, 227 (1992).
- 22. J. D. Bergstrom, A. Hermansson, T. Diaz de Stahl, N. E. Heldin, Br. J. Cancer 80, 650 (1999).
- 23. P. J. Brennan, T. Kumagai, A. Berezov, R. Murali, M. I. Greene, Oncogene 19, 6093 (2000).
- 24. J. G. Christensen et al., Cancer Res. 63, 7345 (2003).
- 25. C. Ponzetto et al., Oncogene 6, 553 (1991).
- 26. A. Hellman et al., Cancer Cell 1, 89 (2002).
- 27. B. J. Druker et al., N. Engl. J. Med. 344, 1038 (2001).
- 28. B. J. Druker et al., N. Engl. J. Med. 344, 1031 (2001).
- 29. D. A. Tuveson et al., Oncogene 20, 5054 (2001).
- 30. S. Hirota et al., Science 279, 577 (1998).
- 31. T. J. Lynch et al., N. Engl. J. Med. 350, 2129 (2004).
- 32. J. G. Paez et al., Science 304, 1497 (2004).
- 33. C. Brennan et al., Cancer Res. 64, 4744 (2004).
- 34. S. G. Brodie et al., Oncogene 20, 7514 (2001).
- 35. A. S. Wong et al., Oncogene 20, 1318 (2001).
- 36. R. Warn et al., Exp. Cell Res. 267, 258 (2001).
- 37. N. Chattopadhyay, R. J. MacLeod, J. Tfelt-Hansen, E. M. Brown, Am. J. Physiol. Endocrinol. Metab. 284, E219 (2003).
- 38. Koizumi, F., Shimoyama, T., Taguchi, F., Saijo, N. & Nishio, K. (2005) Int. J. Cancer 116, 36-44.
- 39. Sordella, R., Bell, D. W., Haber, D. A. & Settleman, J. (2004) Science 305, 1163-1167.
- 40. Tracy, S., Mukohara, T., Hansen, M., Meyerson, M., Johnson, B. E. & Janne, P. A. (2004) Cancer Res 64, 7241-7244.
- 41. Rege-Cambrin, G., Scaravaglio, P., Carozzi, F., Giordano, S., Ponzetto, C., Comoglio, P. M. & Saglio, G. (1992) Cancer Genet. Cytogenet 64, 170-173.
- 42. Nessling, M., Solinas-Toldo, S., Wilgenbus, K. K., Borchard, F. & Lichter, P. (1998) Genes Chromosomes Cancer 23, 307-316.
- 43. Sakakura, C., Mori, T., Sakabe, T., Ariyama, Y., Shinomiya, T., Date, K., Hagiwara, A., Yamaguchi, T., Takahashi, T. & Nakamura, Y., et al. (1999) Genes Chromosomes Cancer 24, 299-305.
- 44. Mohapatra, G., Moore, D. H., Kim, D. H., Grewal, L., Hyun, W. C., Waldman, F. M., Pinkel, D. & Feuerstein, B. G. (1997) Genes. Chromosomes Cancer 20, 311-319.
The references cited throughout the application are incorporated herein by reference in their entirety.
Claims
1. A method for identifying a cancer in an individual that is susceptible to treatment comprising:
- a. isolating a biological sample from an individual; and
- b. detecting the presence or absence of amplification of the Met gene, wherein the presence of amplification indicates that the cancer is susceptible to treatment.
Type: Application
Filed: Nov 22, 2013
Publication Date: Jun 12, 2014
Applicant: THE GENERAL HOSPITAL CORPORATION (Boston, MA)
Inventors: Daniel A. Haber (Chesnut Hill, MA), Gromoslaw A. Smolen (Cambridge, MA)
Application Number: 14/087,299
International Classification: C12Q 1/68 (20060101);