BENZENETRICARBOXYLIC ACID AND METHODS OF USE
Methods of treating or preventing cancer and/or a neurodegenerative disorder in a subject are provided. The methods comprise administering to a subject a therapeutically effective amount of 1,2,3-benzenetricarboxylic acid or a hydrate or pharmaceutically acceptable salt thereof.
Latest GEORGETOWN UNIVERSITY Patents:
- Targeted liposomes
- USP13 INHIBITORS AND METHODS OF USE THEREOF
- Methods of identifying novel proteins and antigens in cancer cells
- ENHANCING CHEMOTHERAPY IN MEDULLOBLASTOMA AND GLIOBLASTOMA WITH HIGH BASAL p53 LEVELS
- Enhancing chemotherapy in medulloblastoma and glioblastoma with high basal p53 levels
This application is a continuation of 14/437,727, filed Apr. 22, 2015, which is a U.S. national stage application under 35 U.S.C. §371 of PCT/US2013/066073, filed Oct. 22, 2013, which claims the benefit of U.S. Provisional Application No. 61/716,667, filed Oct. 22, 2012. These applications are incorporated herein by reference in their entireties.
BACKGROUNDDisregulation of the pathways that preserve mitochondrial integrity hallmarks many human diseases including diabetes, neurodegeneration, aging, and cancer. The mitochondrial citrate transporter gene, SLC25A1 or CIC, maps on chromosome 22q11.21, a region amplified in some tumors and deleted in developmental disorders known as velo-cardio-facial and DiGeorge syndromes. Several chromosomal translocations and amplifications involving 22q11.2 have been described in various tumors, while microdeletions of this region give rise to developmental disorders known as velo-cardio-facial (VCFS) and DiGeorge syndromes (DGS) as well as to some forms of schizophrenia.
SUMMARYProvided herein are methods for the use of benzenetricarboxylic acid for treating or preventing cancer and neurodegenerative disorders. The method of treating or preventing cancer in a subject comprises administering to the subject an effective amount of a compound of the following structure:
or a hydrate or pharmaceutically acceptable salt thereof. The method can further comprise administering a second therapeutic agent to the subject. Optionally, the second therapeutic agent is a chemotherapeutic agent. Optionally, the cancer is breast cancer, lung cancer, or bladder cancer.
A method of treating or preventing a neurodegenerative disorder in a subject comprises administering to the subject an effective amount of a compound of the following structure:
or a hydrate or pharmaceutically acceptable salt thereof. Optionally, the neurodegenerative disorder is Parkinson's disease. The method can further comprise administering a second therapeutic agent to the subject. Optionally, the second therapeutic agent is selected from the group consisting of levadopa, a dopamine agonist, an anticholinergic agent, a monoamine oxidase inhibitor, a COMT inhibitor, amantadine, rivastigmine, an NMDA antagonist, a cholinesterase inhibitor, riluzole, an anti-psychotic agent, an antidepressant, and tetrabenazine.The details of one or more embodiments are set forth in the drawings and the description below. Other features, objects, and advantages will be apparent from the description and drawings, and from the claims.
asterisk (*) represents p-value<0.05 and double-asterisk (**) represents p-value<0.01.
Described herein are methods for treating and preventing cancer and/or neurodegenerative disorders in a subject. The methods of treating or preventing cancer or a neurodegenerative disorder in a subject includes administering to the subject a benzenetricarboxylic acid (e.g., 1,2,3-benzenetricarboxylic acid hydrate). The benzenetricarboxylic acid is administered in an effective amount to prevent or treat one or more symptoms of cancer or neurodegenerative disorders.
I. Compounds
A benzenetricarboxylic acid useful in the methods described herein comprises 1,2,3-benzenetricarboxylic acid, as represented by Compound I:
or a hydrate or pharmaceutically acceptable salt thereof.
Optionally, the 1,2,3-benzenetricarboxlic acid is a hydrate as represented by Compound I-A:
In Compound I-A, x is an integer from 1 to 20.
II. Pharmaceutical Formulations
The compounds described herein or derivatives thereof can be provided in a pharmaceutical composition. Depending on the intended mode of administration, the pharmaceutical composition can be in the form of solid, semi-solid or liquid dosage forms, such as, for example, tablets, suppositories, pills, capsules, powders, liquids, or suspensions, preferably in unit dosage form suitable for single administration of a precise dosage. The compositions will include a therapeutically effective amount of the compound described herein or derivatives thereof in combination with a pharmaceutically acceptable carrier and, in addition, may include other medicinal agents, pharmaceutical agents, carriers, or diluents. By pharmaceutically acceptable is meant a material that is not biologically or otherwise undesirable, which can be administered to an individual along with the selected compound without causing unacceptable biological effects or interacting in a deleterious manner with the other components of the pharmaceutical composition in which it is contained.
As used herein, the term carrier encompasses any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations. The choice of a carrier for use in a composition will depend upon the intended route of administration for the composition. The preparation of pharmaceutically acceptable carriers and formulations containing these materials is described in, e.g., Remington's Pharmaceutical Sciences, 21st Edition, ed. University of the Sciences in Philadelphia, Lippincott, Williams & Wilkins, Philadelphia Pa., 2005. Examples of physiologically acceptable carriers include buffers, such as phosphate buffers, citrate buffer, and buffers with other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrins; chelating agents, such as EDTA; sugar alcohols, such as mannitol or sorbitol; salt-forming counterions, such as sodium; and/or nonionic surfactants, such as TWEEN® (ICI, Inc.; Bridgewater, N.J.), polyethylene glycol (PEG), and PLURONICS™ (BASF; Florham Park, N.J.).
Compositions containing the compound described herein or derivatives thereof suitable for parenteral injection may comprise physiologically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (propyleneglycol, polyethyleneglycol, glycerol, and the like), suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.
These compositions may also contain adjuvants, such as preserving, wetting, emulsifying, and dispensing agents. Prevention of the action of microorganisms can be promoted by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and the like. Isotonic agents, for example, sugars, sodium chloride, and the like may also be included. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.
Solid dosage forms for oral administration of the compounds described herein or derivatives thereof include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the compounds described herein or derivatives thereof is admixed with at least one inert customary excipient (or carrier), such as sodium citrate or dicalcium phosphate, or (a) fillers or extenders, as for example, starches, lactose, sucrose, glucose, mannitol, and silicic acid, (b) binders, as for example, carboxymethylcellulose, alignates, gelatin, polyvinylpyrrolidone, sucrose, and acacia, (c) humectants, as for example, glycerol, (d) disintegrating agents, as for example, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate, (e) solution retarders, as for example, paraffin, (f) absorption accelerators, as for example, quaternary ammonium compounds, (g) wetting agents, as for example, cetyl alcohol, and glycerol monostearate, (h) adsorbents, as for example, kaolin and bentonite, and (i) lubricants, as for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures thereof. In the case of capsules, tablets, and pills, the dosage forms may also comprise buffering agents.
Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethyleneglycols, and the like.
Solid dosage forms such as tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings and others known in the art. They may contain opacifying agents and can also be of such composition that they release the active compound or compounds in a certain part of the intestinal tract in a delayed manner. Examples of embedding compositions that can be used are polymeric substances and waxes. The active compounds can also be in micro-encapsulated form, if appropriate, with one or more of the above-mentioned excipients.
Liquid dosage forms for oral administration of the compounds described herein or derivatives thereof include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compounds, the liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, solubilizing agents, and emulsifiers, as for example, ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propyleneglycol, 1,3-butyleneglycol, dimethylformamide, oils, in particular, cottonseed oil, groundnut oil, corn germ oil, olive oil, castor oil, sesame oil, glycerol, tetrahydrofurfuryl alcohol, polyethyleneglycols, and fatty acid esters of sorbitan, or mixtures of these substances, and the like.
Besides such inert diluents, the composition can also include additional agents, such as wetting, emulsifying, suspending, sweetening, flavoring, or perfuming agents.
Suspensions, in addition to the active compounds, may contain additional agents, as for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, or mixtures of these substances, and the like.
Compositions of the compounds described herein or derivatives thereof for rectal administrations are optionally suppositories, which can be prepared by mixing the compounds with suitable non-irritating excipients or carriers, such as cocoa butter, polyethyleneglycol or a suppository wax, which are solid at ordinary temperatures but liquid at body temperature and, therefore, melt in the rectum or vaginal cavity and release the active component.
Dosage forms for topical administration of the compounds described herein or derivatives thereof include ointments, powders, sprays, and inhalants. The compounds described herein or derivatives thereof are admixed under sterile conditions with a physiologically acceptable carrier and any preservatives, buffers, or propellants as may be required. Ophthalmic formulations, ointments, powders, and solutions are also contemplated as being within the scope of the compositions.
The compositions can include one or more of the compounds described herein and a pharmaceutically acceptable carrier. As used herein, the term pharmaceutically acceptable salt refers to those salts of the compound described herein or derivatives thereof that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of subjects without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit/risk ratio, and effective for their intended use, as well as the zwitterionic forms, where possible, of the compounds described herein. The term salts refers to the relatively non-toxic, inorganic and organic acid addition salts of the compounds described herein. These salts can be prepared in situ during the isolation and purification of the compounds or by separately reacting the purified compound in its free base form with a suitable organic or inorganic acid and isolating the salt thus formed. Representative salts include the hydrobromide, hydrochloride, sulfate, bisulfate, nitrate, acetate, oxalate, valerate, oleate, palmitate, stearate, laurate, borate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, naphthylate mesylate, glucoheptonate, lactobionate, methane sulphonate, and laurylsulphonate salts, and the like. These may include cations based on the alkali and alkaline earth metals, such as sodium, lithium, potassium, calcium, magnesium, and the like, as well as non-toxic ammonium, quaternary ammonium, and amine cations including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. (See S. M. Barge et al., J. Pharm. Sci. (1977) 66, 1, which is incorporated herein by reference in its entirety, at least, for compositions taught therein.)
Administration of the compounds and compositions described herein or pharmaceutically acceptable salts thereof can be carried out using therapeutically effective amounts of the compounds and compositions described herein or pharmaceutically acceptable salts thereof as described herein for periods of time effective to treat a disorder. The effective amount of the compounds and compositions described herein or pharmaceutically acceptable salts thereof as described herein may be determined by one of ordinary skill in the art and includes exemplary dosage amounts for a mammal of from about 0.5 to about 200 mg/kg of body weight of active compound per day, which may be administered in a single dose or in the form of individual divided doses, such as from 1 to 4 times per day. Alternatively, the dosage amount can be from about 0.5 to about 150 mg/kg of body weight of active compound per day, about 0.5 to 100 mg/kg of body weight of active compound per day, about 0.5 to about 75 mg/kg of body weight of active compound per day, about 0.5 to about 50 mg/kg of body weight of active compound per day, about 0.5 to about 25 mg/kg of body weight of active compound per day, about 1 to about 20 mg/kg of body weight of active compound per day, about 1 to about 10 mg/kg of body weight of active compound per day, about 20 mg/kg of body weight of active compound per day, about 10 mg/kg of body weight of active compound per day, or about 5 mg/kg of body weight of active compound per day. Those of skill in the art will understand that the specific dose level and frequency of dosage for any particular subject may be varied and will depend upon a variety of factors, including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the species, age, body weight, general health, sex and diet of the subject, the mode and time of administration, rate of excretion, drug combination, and severity of the particular condition.
III. Methods of Making the Compounds
The compounds described herein can be prepared in a variety of ways known to one skilled in the art of organic synthesis or variations thereon as appreciated by those skilled in the art. The compounds described herein can be prepared from readily available starting materials. Optimum reaction conditions may vary with the particular reactants or solvents used, but such conditions can be determined by one skilled in the art.
Variations on Compound I include the addition, subtraction, or movement of the various constituents as described for each compound. Similarly, when one or more chiral centers are present in a molecule, the chirality of the molecule can be changed. Additionally, compound synthesis can involve the protection and deprotection of various chemical groups. The use of protection and deprotection, and the selection of appropriate protecting groups can be determined by one skilled in the art. The chemistry of protecting groups can be found, for example, in Wuts and Greene, Protective Groups in Organic Synthesis, 4th Ed., Wiley & Sons, 2006, which is incorporated herein by reference in its entirety. The synthesis and subsequent testing of various compounds as described by Compound I to determine efficacy is contemplated.
Reactions to produce the compounds described herein can be carried out in solvents, which can be selected by one of skill in the art of organic synthesis. Solvents can be substantially nonreactive with the starting materials (reactants), the intermediates, or products under the conditions at which the reactions are carried out, i.e., temperature and pressure. Reactions can be carried out in one solvent or a mixture of more than one solvent. Product or intermediate formation can be monitored according to any suitable method known in the art. For example, product formation can be monitored by spectroscopic means, such as nuclear magnetic resonance spectroscopy (e.g., 1H or 13C) infrared spectroscopy, spectrophotometry (e.g., UV-visible), or mass spectrometry, or by chromatography such as high performance liquid chromatography (HPLC) or thin layer chromatography.
Optionally, the compounds described herein can be obtained from commercial sources. The compounds can be obtained from, for example, Sigma-Aldrich (St. Louis, Mo.).
IV. Methods of Use
Provided herein are methods to treat, prevent, or ameliorate cancer or neurodegenerative disorders in a subject. The methods include administering to a subject an effective amount of one or more of the compounds or compositions described herein, or a hydrate or pharmaceutically acceptable salt thereof. The method can include selecting a subject with cancer or a neurodegenerative disease, using methods within the art. The expression “effective amount,” when used to describe an amount of compound in a method, refers to the amount of a compound that achieves the desired pharmacological effect or other effect, for example, an amount that results in tumor growth rate reduction. The compounds and compositions described herein or pharmaceutically acceptable salts thereof are useful for treating cancer and neurodegenerative disorders in humans, including, without limitation, pediatric and geriatric populations, and in animals, e.g., veterinary applications.
Optionally, the cancer is breast cancer, lung cancer, or bladder cancer. Optionally, the cancer is brain cancer, colorectal cancer, cervical cancer, gastrointestinal cancer, genitourinary cancer, head and neck cancer, ovarian cancer, pancreatic cancer, prostate cancer, renal cancer, skin cancer, or testicular cancer.
Optionally, the neurodegenerative disorder is Parkinson's disease. Optionally, the neurodegenerative disorder is Alexander disease, Alper's disease, Alzheimer disease, amyotrophic lateral sclerosis, ataxia telangiectasia, Batten disease (also known as Spielmeyer-Vogt-Sjogren-Batten disease), Canavan disease, Cockayne syndrome, Corticobasal degeneration, Creutzfeldt-Jakob disease, Huntington disease, Kennedy's disease, Krabbe disease, Lewy body dementia, Machado-Joseph disease, Spinocerebellar ataxia type 3, multiple sclerosis, multiple system atrophy, Pelizaeus-Merzbacher disease, Pick's disease, Primary lateral sclerosis, Refsum's disease, Sandhoff disease, Schilder's disease, Spielmeyer-Vogt-Sjogren-Batten disease (also known as Batten disease), Spinocerebellar ataxia (multiple types with varying characteristics), Spinal muscular atrophy, Steele-Richardson-Olszewski disease, Tay-Sachs, Transmissible spongiform encephalopathies (TSE), and Tabes dorsalis.
The method of treating or preventing cancer and neurodegenerative disorders in a subject can further comprise administering to the subject a therapeutic agent or radiation therapy or a combination thereof. Thus, the provided compositions and methods can include one or more additional agents. The one or more additional agents and the compounds described herein or pharmaceutically acceptable salts or prodrugs thereof can be administered in any order, including concomitant, simultaneous, or sequential administration. Sequential administration can be temporally spaced order of up to several days apart. The methods can also include more than a single administration of the one or more additional agents and/or the compounds described herein or pharmaceutically acceptable salts or prodrugs thereof. The administration of the one or more additional agents and the compounds described herein or pharmaceutically acceptable salts or prodrugs thereof can be by the same or different routes and concurrently or sequentially.
Therapeutic agents include, but are not limited to, chemotherapeutic agents. A chemotherapeutic agent is a compound or composition effective in inhibiting or arresting the growth of an abnormally growing cell. Thus, such an agent may be used therapeutically to treat cancer as well as other diseases marked by abnormal cell growth. Illustrative examples of chemotherapeutic compounds include, but are not limited to, bexarotene, gefitinib, erlotinib, gemcitabine, paclitaxel, docetaxel, topotecan, irinotecan, temozolomide, carmustine, vinorelbine, capecitabine, leucovorin, oxaliplatin, bevacizumab, cetuximab, panitumumab, bortezomib, oblimersen, hexamethylmelamine, ifosfamide, CPT-11, deflunomide, cycloheximide, dicarbazine, asparaginase, mitotant, vinblastine sulfate, carboplatin, colchicine, etoposide, melphalan, 6-mercaptopurine, teniposide, vinblastine, antibiotic derivatives (e.g. anthracyclines such as doxorubicin, liposomal doxorubicin, and diethylstilbestrol doxorubicin, bleomycin, daunorubicin, and dactinomycin); antiestrogens (e.g., tamoxifen); antimetabolites (e.g., fluorouracil (FU), 5-FU, methotrexate, floxuridine, interferon alpha-2B, glutamic acid, plicamycin, mercaptopurine, and 6-thioguanine); cytotoxic agents (e.g., carmustine, BCNU, lomustine, CCNU, cytosine arabinoside, cyclophosphamide, estramustine, hydroxyurea, procarbazine, mitomycin, busulfan, cisplatin, vincristine and vincristine sulfate); hormones (e.g., medroxyprogesterone, estramustine phosphate sodium, ethinyl estradiol, estradiol, megestrol acetate, methyltestosterone, diethylstilbestrol diphosphate, chlorotrianisene, and testolactone); nitrogen mustard derivatives (e.g., mephalen, chlorambucil, mechlorethamine (nitrogen mustard) and thiotepa); and steroids (e.g., bethamethasone sodium phosphate).
Therapeutic agents further include, but are not limited to, levadopa, a dopamine agonist, an anticholinergic agent, a monoamine oxidase inhibitor, a COMT inhibitor, amantadine, rivastigmine, an NMDA antagonist, a cholinesterase inhibitor, riluzole, an anti-psychotic agent, an antidepressant, and tetrabenazine.
Any of the aforementioned therapeutic agents can be used in any combination with the compositions described herein. Combinations are administered either concomitantly (e.g., as an admixture), separately but simultaneously (e.g., via separate intravenous lines into the same subject), or sequentially (e.g., one of the compounds or agents is given first followed by the second). Thus, the term combination is used to refer to concomitant, simultaneous, or sequential administration of two or more agents.
The methods and compounds as described herein are useful for both prophylactic and therapeutic treatment. For prophylactic use, a therapeutically effective amount of the compounds and compositions or pharmaceutically acceptable salts thereof as described herein are administered to a subject prior to onset (e.g., before obvious signs of cancer or a neurodegenerative disorder), during early onset (e.g., upon initial signs and symptoms of cancer or a neurodegenerative disorder), or after the development of cancer or a neurodegenerative disorder. Prophylactic administration can occur for several days to years prior to the manifestation of symptoms of cancer or a neurodegenerative disorder. Therapeutic treatment involves administering to a subject a therapeutically effective amount of the compounds and compositions or pharmaceutically acceptable salts thereof as described herein after cancer or a neurodegenerative disorder is diagnosed.
V. Kits
Also provided herein are kits for treating or preventing cancer or a neurologic disorder in a subject. A kit can include any of the compounds or compositions described herein. For example, a kit can include Compound I. A kit can further include one or more additional agents, such as a chemotherapeutic agent (e.g., gemcitabine, paclitaxel, or tamoxifen), levadopa, a dopamine agonist, an anticholinergic agent, a monoamine oxidase inhibitor, a COMT inhibitor, amantadine, rivastigmine, an NMDA antagonist, a cholinesterase inhibitor, riluzole, an anti-psychotic agent, an antidepressant, and/or tetrabenazine. A kit can include an oral formulation of any of the compounds or compositions described herein. A kit can additionally include directions for use of the kit (e.g., instructions for treating a subject), a container, a means for administering the compounds or compositions, and/or a carrier.
As used herein the terms treatment, treat, or treating refer to a method of reducing or delaying the progression of one or more symptoms of a disease or condition in a subject with cancer or a neurodegenerative disorder. Thus in the disclosed method, treatment can refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the severity of one or more symptoms of the disease or condition. For example, a method for treating cancer is considered to be a treatment if there is a 10% reduction in one or more symptoms or signs (e.g., size of the tumor or rate of tumor growth) of the disease in a subject as compared to a control. As used herein, control refers to the untreated condition (e.g., the tumor cells not treated with the compounds and compositions described herein). Thus the reduction can be a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percent reduction in between 10% and 100% as compared to native or control levels. It is understood that treatment does not necessarily refer to a cure or complete ablation of the disease, condition, or symptoms of the disease or condition.
As used herein, the terms prevent, preventing, and prevention of a disease or disorder refer to an action, for example, administration of a composition or therapeutic agent, that occurs before or at about the same time a subject begins to show one or more symptoms of the disease or disorder, which inhibits or delays onset or severity of one or more symptoms of the disease or disorder. For example, the method is considered to be a prevention of a neurodegenerative disorder if there is a reduction or delay in onset, incidence, severity, or recurrence of neurodegeneration, or one or more symptoms of neurodegeneration (e.g., tremor, weakness, memory loss, rigidity, spasticity, atrophy, dementia) in a subject susceptible to neurodegeneration compared to control subjects susceptible to neurodegeneration that did not receive a compound as described herein. The reduction or delay in onset, incidence, severity, or recurrence of neurodegeneration can be a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percent reduction in between 10% and 100% as compared to native or control levels.
As used herein, references to decreasing, reducing, or inhibiting include a change of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater as compared to a control level. Such terms can include, but do not necessarily include, complete elimination.
As used herein, subject means both mammals and non-mammals. Mammals include, for example, humans; non-human primates, e.g., apes and monkeys; cattle; horses; sheep; rats; mice; pigs; and goats. Non-mammals include, for example, fish and birds.
Throughout this application, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application.
The examples below are intended to further illustrate certain aspects of the methods and compositions described herein, and are not intended to limit the scope of the claims.
EXAMPLES Example 1Mechanistically, CIC promotes the efflux across the mitochondria of tricarboxylic citrate in exchange for dicarboxylic cytosolic malate (the citrate malate antiport), leading to important metabolic adjustments (see
Citrate, which is produced predominantly in the mitochondria via glucose-derived pyruvate, serves as a key substrate for the generation of energy and as an allosteric modulator of several enzymes as well. In the mitochondria, citrate is oxidized via the Krebs cycle and
Oxidative Phosphorylation (OXOPHOS), while in the cytoplasm it supports lipid synthesis and blunts glycolysis by inhibiting phosphofructokinase-1 (PFK1). Additionally, the entry of malate into the mitochondria in exchange for citrate stimulates OXOPHOS and is coupled to the transport of one proton. This modality of exchange maintains both electroneutrality across the mitochondrial membrane and OXOPHOS, because malate enters into the Krebs cycle in place of citrate.
The majority of tumor cells display alterations in metabolism relative to normal cells that are intimately connected with cancer development, progression, and invasiveness. These metabolic changes center in large part upon the different utilization of citrate compared to normal cells.
Mitochondrial DNA mutations, the hypoxic and nutrient restricted microenvironment, as well as oncogenic mutations that reduce the activity of mitochondrial enzymes, all contribute to oxidative and respiration stress endured by these organelles. Consequently, cancer cells produce radical oxygen species (ROS), which increase oxidative burden, but also work to the advantage of tumors because low ROS levels produced by the stroma or within cancer cells promote proliferation. This oxidative instability is at the same time also a double edge sword and a vulnerable aspect of cancer cells, given that enhancing ROS production leads to tumor killing and to activation of a specialized form of autophagy, termed mitophagy. Although activation of mitophagy in the adjacent stroma feeds cancer cells with nutrients required for proliferation, avoidance of mitophagy within the tumor appears instead to be advantageous to cancer growth at least in some conditions.
MethodsCells, reagents, antibodies, primers. Cells were grown in Dulbecco's modified Eagle's medium (DMEM, 5 mM glucose, with glutamine and pyruvate from Invitrogen; Carlsbad, Calif.) and supplemented with 10% fetal calf serum (FCS). Early passage cell lines or frozen pellets were used for screening of CIC expression levels (
forward: 5′-TCGCCGACCGTTGACTATTCTCT-3′ (SEQ. ID NO: 1); Reverse:5′ AAGATTATTACAAATGCATGGGC-3′ (SEQ. ID NO: 2). The zebrafish NADH-dehydrogenase: forward: 5′-AGGGTTGCTGGGATGGCAGAGCTCGGTA-3′ (SEQ. ID NO: 3); reverse:5′ CACTCCATCAAAGTGACCCCTTAGCAT-3′ (SEQ. ID NO: 4). The zebrafish p53: forward: 5′-ACATGA AATTGCCAGAGTATGTGTC-3′ (SEQ. ID NO: 5); Reverse: 5′
TCGGATAGCCTAGTGCGAGC 3′ (SEQ. ID NO: 6).
Strategy for the generation of CIC wild-type and CIC mutant expressing vectors, and of stable cell lines. The two cDNA clones expressing human untagged CIC and epitope tagged CIC were cloned into the pcDNA4/TO tetracycline regulated vector (Santa Cruz Biotech, T-Rex system). Stable tetracycline inducible cell lines were obtained.
Quantification of metabolites, ATP, oxygen, ROS, MMP and mitochondrial mass. The concentration of citrate, lactate, isocitrate, and malate were assessed using specific kits from BioVision (Milpitas, Calif.). Cellular ATP levels were determined via the ATP kit (Promega; Fitchburg, Wis.), while oxygen consumption rates were measured using the BD oxygen biosensor systems (OBS) from BD Bioscience (Franklin Lakes, N.J.). Triplicate samples of 50,000 cells were seeded onto 96-well OBS plates. The number of cells was determined at each time point by sampling cells seeded into side-by-side plates. Fluorescence was measured from the bottom of the well every 24 h and measurements were normalized by subtracting the reading from the same well prior to the addition of the cells (blank). For measurement of reactive oxygen species (ROS), H2DCFDA was used (Invitrogen). Mitochondrial mass was assessed by using mitotracker green (Invitrogen), as per manufacturer instructions, or nonyl acridine orange at a final concentration of 300 nM, followed by analysis by flow cytometry. Mitochondrial membrane potential (MMP) was studied with the JC1 assay kit from Cayman Chemical (Ann Arbor, Mich.).
Mice and tumors. To produce tumor xenografts, 5×106 cells were resuspended in PBS and injected subcutaneously in the flanks of female nude mice. For drug treatments, mice were randomized to receive either PBS or a PBS solution of BTA at a concentration 26 mg/kg which was administered via intra-peritoneal route three times a week. Mice were pre-treated twice prior to the inoculation of tumor cell lines. Once detectable tumors started to form, their size was measured with a caliper in three dimensions. Serial measurements were made at two-three day intervals after the identification of the initial cellular mass to determine growth curves in vivo. Tumor volume was calculated using the formula for a prolate spheroid: volume=(4/3)×a2b, where a is the width and b is the length. All animals were sacrificed when the tumors exceeded 1.5 cm. At the completion of experiments, tumors were excised, weighed and statistical significance of differences in tumor volume were made using two factor repeated measures analysis of variance followed by Fisher's last significant difference test for multiple comparisons. The trial administration of BTA to explore its toxic effects, was conducted on 8 non immuno-compromized mice, randomized in two groups, and injected for five consecutive months. Animals were monitored once a week for the presence of signs of disease, particularly neurological disturbances or weight loss, and they were weighted periodically.
Statistical analysis. Data are expressed as means±standard deviations (SD). The two-tailed Student t test was used for all statistical analysis of experiments presented and Excel was used for statistical calculations. Significant differences are indicated using the standard Michelin Guide scale (P<0.05, significant; P<0.01, highly significant; P<0.001, extremely significant).
ResultsCIC levels are elevated in human cancers and its activity is required for tumor proliferation in vitro. The transcription rate of the CIC promoter is enhanced by several oncogenic pathways including mutant forms of p53 and Myc, while it is repressed by the tumor suppressor PTEN. CIC mRNA levels are elevated in various cancer cell lines and human tumors correlating with poor survival rates or with the development of metastatic disease (
To specifically probe the relevance of the citrate export activity of CIC on proliferation, a non-cleavable benzene-tricarboxylate analog (BTA; Compound I) that suppresses CIC-dependent transport of citrate in vivo was used. A CIC mutant protein was designed where three amino acid residues necessary for citrate export, K190, N194 and R198, were replaced with C190, 1194 and C198, respectively. The CIC-DN mutant did not affect mitochondrial localization or embedding in the mitochondrial membrane (
CIC modestly but reproducibly enhanced the proliferation potential of H1299 cells, and rescued growth inhibition due to BTA treatment (
These results provide the first line of evidence that inhibition of CIC hampers cancer cell proliferation, show that CIC is a target of the anti-proliferative action of BTA in vivo, and demonstrate the importance of the citrate export pathway activity of CIC in regulation of growth.
Inhibition of CIC inhibits tumorigenesis in vivo, but is non-toxic to adult normal tissues. To explore whether CIC affects tumor development in vivo, stable lung cancer (H1299) and SV40 T-antigen transformed embryonic kidney (293T) cell lines expressing tetracycline inducible CIC or CIC-DN were generated (
CIC inhibition leads to mitochondrial dysfunction, destabilizes MMP and enhances glycolysis. The molecular mechanisms by which CIC affects proliferation were examined. The function of CIC has been primarily linked to glucose-derived fatty acid (FA) synthesis, because of its role in citrate export. Therefore, the metabolism of D-[1,6-13C2] glucose via NMR mass spectrometry was studied. In support of the proposed role of CIC in promoting de novo lipogenesis, both BTA and CIC-DN severely reduced the ability of cells to convert glucose into FA. However, the total FA levels, which can be synthesized also from glycerol and amino acids, were modestly reduced at 16 hours after BTA treatment, but at later time points they were increased. Furthermore, incubation of BTA-treated cells with the lipid precurson, palmitic acid was not sufficient to rescue proliferation. Thus, depletion of lipids unlikely represents the only mechanism by which CIC inhibition affects tumor growth.
Since CIC is a mitochondrial protein, the mitochondrial morphology was examined. Immuno-fluorescence experiments showed that in CIC-expressing cells the mitochondria were highly interconnected, while in cells harboring CIC-DN the mitochondrial network was dispersed with fewer and fragmented mitochondria (
The collapse of MMP indicated that CIC dysfunction perturbs the proton gradient, which is directly linked to the exchange between citrate and malate promoted by CIC, as well as the flux of anaplerotic substrates across the mitochondrial membrane. Specifically, the depletion of citrate induced by CIC inhibition would predictably lower the levels of malate and isocitrate, which are produced via citrate oxidation and isomerization, respectively. Further, the shift of metabolism towards glycolysis due to blocking of CIC activity may consume pyruvate in the cytoplasm for lactate production, thus rendering pyruvate less available for mitochondrial metabolism. Pyruvate, citrate, and isocitrate can all enter the Krebs cycle at various steps generating reducing equivalents for the electron transport chain, which in turn stabilize MMP. The levels of several anaplerotic substrates in cells where CIC was inhibited were measured. The levels of malate and isocitrate were reduced (
The ability of CIC to restrain the glycolytic addiction of tumor cells leads to a growth advantage. The above data indicated that CIC inhibition exacerbates the Warburg effect, a metabolic trait that is proposed to promote malignancy. Glycolysis is metabolically advantageous when glucose is abundant, because in these conditions it can generate ATP at faster rates compared to OXHOPHOS. By contrast, rapidly growing tumors surpass the ability of the microenvironment to provide nutrients, and switch towards alternative metabolic pathways, including OXHOPHOS, for energy production. Thus, CIC can be important for adaptation when glucose is limiting. Likely due to the enhanced glycolytic behavior, at high concentrations of glucose (25 mM) oxygen consumption rates and ATP levels were not significantly modified in cells where CIC was inhibited compared to control cells. However, at lower, yet physiological glucose levels (5 mM), cells expressing CIC consumed more oxygen and produced more ATP relatively to BTA-treated or CIC-DN -expressing cells (
CIC is induced by mitochondrial respiration injury and prevents mitochondrial depolarization and depletion. The mitochondria of tumor cells undergo oxidative stress due to mtDNA and to oncogenic mutations that affect the activity of mitochondrial enzymes involved in respiration. Mitochondrial damage in turn triggers quality control systems consisting of mitochondria degradation via autophagy/mitophagy. Thus, CIC can exert a protective role on mitochondrial damage and disposal. First, immuno-fluorescence and cellular sub-fractionation experiments demonstrated recruitment of the autophagic machinery in the form of the active-lipidated form of LC3 and of lysosomes, to the mitochondria of cells expressing CIC-DN or treated with BTA, but not in CIC containing cells (
Nonyl-Acridine Orange (NOA) (
Autophagy can be organelle selective or proceed as a bulk degradation process of multiple cellular compartments. CIC did not interfere with global autophagic flux in response to the mTOR inhibitor, rapamycin, or to glucose restriction, suggesting that it might specifically affect mitophagy (
These results indicate that CIC is a sensor and an effector of mitochondrial stress. Via its citrate export ability, CIC stabilizes membrane potential minimizing mitochondrial depletion. By contrast, cells where CIC is inhibited trigger autophagic clearance of mitochondria.
The knock-down of the CIC orthologous gene in zebrafish induces mitochondrial loss and activation of autophagy. Genes that promote tumorigenesis are often necessary for embryonic development, and some of these genes are metabolic modulators, given that embryogenesis and tumorigenesis are energetically demanding. Additionally, whether changes of CIC dosage affect embryogenesis in the model organism zebrafish was investigated. This approach was possible because human and zebrafish CIC proteins display a high degree of homology. By using a morpholino-based (MO) knock-down strategy, it was found that the CIC MO led to a stark dose-dependent phenotype, and produced a relatively small percentage of dead embryos (34%,
The diagram in
The compounds and methods of the appended claims are not limited in scope by the specific compounds and methods described herein, which are intended as illustrations of a few aspects of the claims and any compounds and methods that are functionally equivalent are within the scope of this disclosure. Various modifications of the compounds and methods in addition to those shown and described herein are intended to fall within the scope of the appended claims. Further, while only certain representative compounds, methods, and aspects of these compounds and methods are specifically described, other compounds and methods and combinations of various features of the compounds and methods are intended to fall within the scope of the appended claims, even if not specifically recited. Thus, a combination of steps, elements, components, or constituents may be explicitly mentioned herein; however, all other combinations of steps, elements, components, and constituents are included, even though not explicitly stated.
Claims
1. A method of treating or preventing cancer in a subject, comprising: or a hydrate or pharmaceutically acceptable salt thereof.
- administering to the subject an effective amount of a compound of the following structure:
2. The method of claim 1, further comprising administering a second therapeutic agent to the subject.
3. The method of claim 2, wherein the second therapeutic agent is a chemotherapeutic agent.
4. The method of claim 1, wherein the cancer is breast cancer.
5. The method of claim 1, wherein the cancer is lung cancer.
6. The method of claim 1, wherein the cancer is bladder cancer.
7. A method of treating or preventing a neurodegenerative disorder in a subject, comprising: or a hydrate or pharmaceutically acceptable salt thereof.
- administering to the subject an effective amount of a compound of the following structure:
8. The method of claim 7, wherein the neurodegenerative disorder is Parkinson's disease.
9. The method of claim 7, further comprising administering a second therapeutic agent to the subject.
10. The method of claim 9, wherein the second therapeutic agent is selected from the group consisting of levadopa, a dopamine agonist, an anticholinergic agent, a monoamine oxidase inhibitor, a COMT inhibitor, amantadine, rivastigmine, an NMDA antagonist, a cholinesterase inhibitor, riluzole, an anti-psychotic agent, an antidepressant, and tetrabenazine.
Type: Application
Filed: Dec 12, 2016
Publication Date: Mar 30, 2017
Applicant: GEORGETOWN UNIVERSITY (Washington, DC)
Inventor: Maria Laura Avantaggiati (Kensington, MD)
Application Number: 15/375,319