INDUCED PLURIPOTENT STEM CELLS
This document provides methods and materials related to induced pluripotent stem cells. For example, induced pluripotent stem cells, compositions containing induced pluripotent stem cells, methods for obtaining induced pluripotent stem cells, and methods for using induced pluripotent stem cells are provided. In addition, methods and materials for using induced pluripotent stem cells to repair tissue (e.g., cardiovascular tissue) in vivo as well as methods and materials for using induced pluripotent stem cells to assess their therapeutic potential in appropriate animal models are provided.
This application is a divisional of U.S. application Ser. No. 13/058,154, filed Apr. 27, 2011, which is a National Stage Application under 35 U.S.C. § 371 of International Application No. PCT/US2009/053314, filed Aug. 10, 2009, which claims the benefit of U.S. Provisional Application Ser. No. 61/273,654, filed Aug. 5, 2009; U.S. Provisional Application Ser. No. 61/271,341, filed Jul. 20, 2009; and U.S. Provisional Application Ser. No. 61/087,492, filed Aug. 8, 2008. The disclosures of the prior applications are considered part of (and are incorporated by reference in) the disclosure of this application.
STATEMENT AS TO FEDERALLY SPONSORED RESEARCHThis invention was made with government support under R01HL083439 and T32HL007111 awarded by National Institutes of Health. The government has certain rights in the invention.
BACKGROUND 1. Technical FieldThis document relates to methods and materials involved in making and using induced pluripotent stem cells.
2. Background InformationStem cells are characterized by the ability of self-renewal and differentiation into a diverse range of cell types. The two broad types of mammalian stem cells are embryonic stem (ES) cells and adult stem cells. Adult stem cells or progenitor cells replenish specialized cells to repair or maintain regenerative organs. Most adult stem cells are lineage-restricted and generally referred to by their tissue origin, such as adipose-derived stem cells. ES cell lines are derived from the epiblast tissue of the inner cell mass of a blastocyst or early morula stage embryos. ES cells are pluripotent and give rise to derivatives of the three germinal layers, i.e., the ectoderm, endoderm and mesoderm.
SUMMARYThis document provides methods and materials related to induced pluripotent stem cells. For example, this document provides induced pluripotent stem cells, compositions containing induced pluripotent stem cells, methods for obtaining induced pluripotent stem cells, and methods for using induced pluripotent stem cells (e.g., methods for using induced pluripotent stem cells to repair cardiovascular tissue). In some cases, the induced pluripotent stem cells and compositions containing induced pluripotent stem cells can be used to assess their therapeutic potential in appropriate animal models. For example, induced pluripotent stem cells of mouse origin that were created using human factors can be assessed in mice for therapeutic potential and for safety (e.g., the ability to not form cancerous cells).
In general, one aspect of this document features an induced pluripotent stem cell comprising nucleic acid encoding one or more polypeptides selected from the group consisting of a human Oct3/4 POU family polypeptide (e.g., a human Oct3/4 polypeptide), a human Sox family polypeptide, a human Klf family polypeptide, a human Myc family polypeptide, a human Nanog polypeptide, and a human Lin28 polypeptide, wherein the origin of the induced pluripotent stem cell is a non-human species. The non-human species can be selected from the group consisting of mouse, rat, hamster, guinea pig, rabbit, cat, dog, pig, sheep, goat, cow, horse, and monkey species. The induced pluripotent stem cell can be induced from a somatic cell. The somatic cell can be selected from the group consisting of skin, lung, heart, stomach, brain, liver, blood, kidney, and muscle cells. The human Sox family polypeptide can be a Sox2 polypeptide. The human Klf family polypeptide can be a Klf4 polypeptide. The human Myc family polypeptide can be a c-Myc polypeptide. The induced pluripotent stem cell can comprise nucleic acid encoding the human Oct3/4 POU family polypeptide (e.g., a human Oct3/4 polypeptide), the human Sox2 polypeptide, the human Klf4 polypeptide, and the human c-Myc polypeptide.
In another aspect, this document features an induced pluripotent stem cell comprising nucleic acid encoding one or more polypeptides selected from the group consisting of a non-human Oct3/4 POU family polypeptide (e.g., a non-human Oct3/4 polypeptide), a non-human Sox family polypeptide, a non-human Klf family polypeptide, a non-human Myc family polypeptide, a non-human Nanog polypeptide, and a non-human Lin28 polypeptide, wherein the origin of the induced pluripotent stem cell is human. The one or more polypeptides can be of mouse, rat, hamster, guinea pig, rabbit, cat, dog, pig, sheep, goat, cow, horse or monkey origin. The induced pluripotent stem cell can be induced from a human somatic cell. The human somatic cell can be selected from the group consisting skin, lung, heart, stomach, brain, liver, blood, kidney, and muscle cells. The non-human Sox family polypeptide can be a Sox2 polypeptide. The non-human Klf family polypeptide can be a Klf4 polypeptide. The non-human Myc family polypeptide can be a c-Myc polypeptide. The induced pluripotent stem cell can comprise nucleic acid encoding the non-human Oct3/4 POU family polypeptide (e.g., a non-human Oct3/4 polypeptide), a non-human Sox2 polypeptide, a non-human Klf4 polypeptide, and a non-human c-Myc polypeptide.
In another aspect, this document features an induced pluripotent stem cell, wherein the induced pluripotent stem cell was obtained using nucleic acid encoding one or more polypeptides selected from the group consisting of a human Oct3/4 POU family polypeptide (e.g., a human Oct3/4 polypeptide), a human Sox family polypeptide, a human Klf family polypeptide, a human Myc family polypeptide, a human Nanog polypeptide, and a human Lin28 polypeptide, wherein the origin of the induced pluripotent stem cell is a non-human species. The non-human species can be selected from the group consisting of mouse, rat, hamster, guinea pig, rabbit, cat, dog, pig, sheep, goat, cow, horse, and monkey species. The induced pluripotent stem cell can be induced from a somatic cell. The somatic cell can be selected from the group consisting of skin, lung, heart, stomach, brain, liver, blood, kidney, and muscle cells. The human Sox family polypeptide can be a Sox2 polypeptide. The human Klf family polypeptide can be a Klf4 polypeptide. The human Myc family polypeptide can be a c-Myc polypeptide. The induced pluripotent stem cell can comprise nucleic acid encoding the human Oct3/4 POU family polypeptide (e.g., a human Oct3/4 polypeptide), a human Sox2 polypeptide, a human Klf4 polypeptide, and a human c-Myc polypeptide.
In another aspect, this document features an induced pluripotent stem cell, wherein the induced pluripotent stem cell was obtained using nucleic acid encoding one or more polypeptides selected from the group consisting of a non-human Oct3/4 POU family polypeptide (e.g., a non-human Oct3/4 polypeptide), a non-human Sox family polypeptide, a non-human Klf family polypeptide, a non-human Myc family polypeptide, a non-human Nanog polypeptide, and a non-human Lin28 polypeptide, wherein the origin of the induced pluripotent stem cell is human. The one or more polypeptides can be of mouse, rat, hamster, guinea pig, rabbit, cat, dog, pig, sheep, goat, cow, horse or monkey origin. The induced pluripotent stem cell can be induced from a human somatic cell. The human somatic cell can be selected from the group consisting skin, lung, heart, stomach, brain, liver, blood, kidney, and muscle cells. The non-human Sox family polypeptide can be a Sox2 polypeptide. The non-human Klf family polypeptide can be a Klf4 polypeptide. The non-human Myc family polypeptide can be a c-Myc polypeptide. The induced pluripotent stem cell can comprise nucleic acid encoding the non-human Oct3/4 POU family polypeptide (e.g., a non-human Oct3/4 polypeptide), a non-human Sox2 polypeptide, a non-human Klf4 polypeptide, and a non-human c-Myc polypeptide.
In another aspect, this document features an induced pluripotent stem cell, wherein the induced pluripotent stem cell was obtained using a non-integrating vector comprising nucleic acid encoding one or more polypeptides selected from the group consisting of an Oct3/4 POU family polypeptide (e.g., a human Oct3/4 polypeptide), a Sox family polypeptide, a Klf family polypeptide, a Myc family polypeptide, a Nanog polypeptide, and a Lin28 polypeptide, wherein the induced pluripotent stem cell lacks the nucleic acid. The vector can be a viral vector. The vector can be a non-viral vector.
In another aspect, this document features a method for obtaining a population of induced pluripotent stem cells, wherein the method comprises (a) providing cells with nucleic acid encoding Oct3/4, Sox2, Klf4, and c-Myc polypeptides, and (b) culturing the cells with medium lacking serum under conditions to obtain the population of induced pluripotent stem cells. The medium can lack feeder cells. The medium can lack non-human feeder cells.
In another aspect, this document features a method for repairing diseased heart tissue in a mammal. The method comprises, or consists essentially of, administering induced pluripotent stem cells to the mammal under conditions wherein the diseased heart tissue is repaired, wherein the induced pluripotent stem cells were obtained using one or more polypeptides or nucleic acid encoding the one or more polypeptides selected from the group consisting of a Oct3/4 POU family polypeptide (e.g., a Oct3/4 polypeptide), a Sox family polypeptide, a Klf family polypeptide, a Myc family polypeptide, a Nanog polypeptide, and a Lin28 polypeptide. The administering step can comprise an intramyocardial administration. Progeny of the induced pluripotent stem cells can become engrafted into heart tissue of the mammal. Progeny of the induced pluripotent stem cells can become engrafted into heart tissue of the mammal without disrupting cytoarchitecture. The method can restore contractile performance, ventricular wall thickness, or electrical stability. The method can restore contractile performance, ventricular wall thickness, and electrical stability. The administering step can result in the regeneration of cardiac, smooth muscle, or endothelial tissue. The administering step can result in the regeneration of cardiac, smooth muscle, and endothelial tissue. In some cases, the induced pluripotent stem cells were induced from somatic cells. The somatic cells can be selected from the group consisting of skin, lung, heart, stomach, brain, liver, blood, kidney, and muscle cells. The Sox family polypeptide can be a human or non-human Sox2 polypeptide. The Klf family polypeptide can be a human or non-human Klf4 polypeptide. The Myc family polypeptide can be a human or non-human c-Myc polypeptide. The induced pluripotent stem cells can comprise nucleic acid encoding a human Oct3/4 POU family polypeptide (e.g., a human Oct3/4 polypeptide), a human Sox2 polypeptide, a human Klf4 polypeptide, and a human c-Myc polypeptide. The Oct3/4 POU family polypeptide can be a human Oct3/4 polypeptide. The Nanog polypeptide can be a human Nanog polypeptide. The Lin28 polypeptide can be a human Lin28 polypeptide. In some cases, the induced pluripotent stem cells were induced from human somatic cells.
In another aspect, this document features a method for regenerating cardiovascular tissue in a mammal. The method comprises, or consists essentially of, administering induced pluripotent stem cells to the mammal under conditions wherein progeny of the induced pluripotent stem cells become engrafted with cardiovascular tissue of the mammal, wherein the induced pluripotent stem cells were obtained using one or more polypeptides or nucleic acid encoding the one or more polypeptides selected from the group consisting of an Oct3/4 POU family polypeptide (e.g., a human Oct3/4 polypeptide), a Sox family polypeptide, a Klf family polypeptide, a Myc family polypeptide, a Nanog polypeptide, and a Lin28 polypeptide. The administering step can comprise an intramyocardial administration. The progeny can become engrafted into heart tissue of the mammal. The progeny can become engrafted into heart tissue of the mammal without disrupting cytoarchitecture. The method can restore contractile performance, ventricular wall thickness, or electrical stability. The method can restore contractile performance, ventricular wall thickness, and electrical stability. The administering step can result in the regeneration of cardiac, smooth muscle, or endothelial tissue. The administering step can result in the regeneration of cardiac, smooth muscle, and endothelial tissue. In some cases, the induced pluripotent stem cells were induced from somatic cells. The somatic cells can be selected from the group consisting of skin, lung, heart, stomach, brain, liver, blood, kidney, and muscle cells. The Sox family polypeptide can be a human or non-human Sox2 polypeptide. The Klf family polypeptide can be a human or non-human Klf4 polypeptide. The Myc family polypeptide can be a human or non-human c-Myc polypeptide. The induced pluripotent stem cells can comprise nucleic acid encoding a human Oct3/4 POU family polypeptide (e.g., a human Oct3/4 polypeptide), a human Sox2 polypeptide, a human Klf4 polypeptide, and a human c-Myc polypeptide. The Oct3/4 POU family polypeptide can be a human Oct3/4 polypeptide. The Nanog polypeptide can be a human Nanog polypeptide. The Lin28 polypeptide can be a human Lin28 polypeptide. In some cases, the induced pluripotent stem cells were induced from human somatic cells.
In another aspect, this document features a population of cardiomyoctes derived from induced pluripotent stem cells. The induced pluripotent stem cells were obtained using a human Oct3/4 POU family polypeptide (e.g., a human Oct3/4 polypeptide), a human Sox family polypeptide, and a human Klf family polypeptide or nucleic acid encoding the human Oct3/4 polypeptide, the human Sox family polypeptide, and the human Klf family polypeptide, wherein the origin of the induced pluripotent stem cell is human, and wherein the induced pluripotent stem cells were not contacted with an exogenous human c-Myc polypeptide. The induced pluripotent stem cell was induced from a human somatic cell. The human somatic cell can be selected from the group consisting skin, lung, heart, stomach, brain, liver, blood, kidney, and muscle cells. The human Sox family polypeptide can be a Sox2 polypeptide. The human Klf family polypeptide can be a Klf4 polypeptide. The induced pluripotent stem cell can comprise nucleic acid encoding the human Oct3/4 polypeptide, a human Sox2 polypeptide, and a human Klf4 polypeptide.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.
This document provides methods and materials related to induced pluripotent stem cells. For example, this document provides induced pluripotent stem cells that were induced using polypeptides from a species that is different from the species from which the cells were obtained. An example of such induced pluripotent stem cells includes mouse cells that were induced to form induced pluripotent stem cells using human polypeptides. Other examples include rat, dog, cow, pig, and monkey (e.g., Rhesus monkey) cells that were induced to form induced pluripotent stem cells using human polypeptides. In some cases, an induced pluripotent stem cell provided herein can be a human cell that was induced to form an induced pluripotent stem cell using non-human polypeptides (e.g., polypeptides of mouse, rat, pig, dog, or monkey origin).
This document also provides induced pluripotent stem cells that were induced using polypeptides from a species that is the same species from which the cells were obtained. An example of such induced pluripotent stem cells includes human cells that were induced to form induced pluripotent stem cells using human polypeptides.
The polypeptides used to induce the formation of induced pluripotent stem cell can include any combination of Oct3/4 polypeptides, Sox family polypeptides (e.g., Sox2 polypeptides), Klf family of polypeptides (e.g., Klf4 polypeptides), Myc family polypeptides (e.g., c-Myc), Nanog polypeptides, and Lin28 polypeptides. For example, nucleic acid vectors designed to express Oct3/4, Sox2, Klf4, and c-Myc polypeptides can be used to obtain induced pluripotent stem cells. In some cases, Oct3/4, Sox2, Klf4, and c-Myc polypeptides can be directly delivered into target cells to obtain induced pluripotent stem cells using a polypeptide transfection method (e.g., liposome or electroporation). In one embodiment, nucleic acid vectors designed to express Oct3/4, Sox2, and Klf4 polypeptides, and not a c-Myc polypeptide, can be used to obtain induced pluripotent stem cells. In some cases, Oct3/4, Sox2, and Klf4 polypeptides can be directly delivered into target cells to obtain induced pluripotent stem cells using a polypeptide transfection method. An Oct3/4 polypeptide can have the amino acid sequence set forth in GenBank® Accession Numbers BC117435 (e.g., GI No. 109659099). An Sox2 polypeptide can have the amino acid sequence set forth in GenBank® Accession Numbers BC013923 (e.g., GI No. 33869633). A Klf4 polypeptide can have the amino acid sequence set forth in GenBank® Accession Numbers BC029923 (e.g., GI No. 20987475). A c-Myc polypeptide can have the amino acid sequence set forth in GenBank® Accession Numbers BC000141 (e.g., GI No. 12652778). A Nanog polypeptide can have the amino acid sequence set forth in GenBank® Accession Numbers BC099704.1 (e.g., GI No. 71043476). A Lin28 polypeptide can have the amino acid sequence set forth in GenBank® Accession Numbers BC028566 (e.g., GI No. 33872076).
Any appropriate cell type can be used to obtain induced pluripotent stem cells. For example, skin, lung, heart, liver, blood, kidney, or muscle cells can be used to obtain induced pluripotent stem cells. Such cells can be obtained from any type of mammal including, without limitation, humans, mice, rats, dogs, cats, cows, pigs, or monkeys. In addition, any stage of the mammal can be used, including mammals at the embryo, neonate, newborn, or adult stage. For example, fibroblasts obtained from an adult human patient can be used to obtain induced pluripotent stem cells. Such induced pluripotent stem cells can be used to treat that same human patient (or to treat a different human) or can be used to create differentiated cells that can be used to treat that same human patient (or a different human). For example, somatic cells from a human patient can be treated as described herein to obtain induced pluripotent stem cells. The obtained induced pluripotent stem cells can be differentiated into cardiomyocytes that can be implanted into that same human patient. In some cases, the obtained induced pluripotent stem cells can be directly administered to that same human patient.
Any appropriate method can be used to introduce nucleic acid (e.g., nucleic acid encoding polypeptides designed to induce pluripotent stem cells from cells) into a cell. For example, nucleic acid encoding polypeptides (e.g., Oct3/4, Sox2, Klf4, and c-Myc polypeptides) designed to induce pluripotent stem cells from other cells (e.g., non-embryonic stem cells) can be transferred to the cells using recombinant viruses that can infect cells, or liposomes or other non-viral methods such as electroporation, microinjection, transposons, phage integrases, or calcium phosphate precipitation, that are capable of delivering nucleic acids to cells. The exogenous nucleic acid that is delivered typically is part of a vector in which a regulatory element such as a promoter is operably linked to the nucleic acid of interest. The promoter can be constitutive or inducible. Non-limiting examples of constitutive promoters include cytomegalovirus (CMV) promoter and the Rous sarcoma virus promoter. As used herein, “inducible” refers to both up-regulation and down regulation. An inducible promoter is a promoter that is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer, the DNA sequences or genes will not be transcribed. The inducer can be a chemical agent such as a protein, metabolite, growth regulator, phenolic compound, or a physiological stress imposed directly by, for example heat, or indirectly through the action of a pathogen or disease agent such as a virus.
Additional regulatory elements that may be useful in vectors, include, but are not limited to, polyadenylation sequences, translation control sequences (e.g., an internal ribosome entry segment, IRES), enhancers, or introns. Such elements may not be necessary, although they can increase expression by affecting transcription, stability of the mRNA, translational efficiency, or the like. Such elements can be included in a nucleic acid construct as desired to obtain optimal expression of the nucleic acids in the cells. Sufficient expression, however, can sometimes be obtained without such additional elements.
Vectors also can include other elements. For example, a vector can include a nucleic acid that encodes a signal peptide such that the encoded polypeptide is directed to a particular cellular location (e.g., the cell surface) or a nucleic acid that encodes a selectable marker. Non-limiting examples of selectable markers include puromycin, adenosine deaminase (ADA), aminoglycoside phosphotransferase (neo, G418, APH), dihydrofolate reductase (DHFR), hygromycin-B-phosphtransferase, thymidine kinase (TK), and xanthin-guanine phosphoribosyltransferase (XGPRT). Such markers are useful for selecting stable transformants in culture.
Any appropriate viral vectors can be used to introduce stemness-related factors, such as Oct3/4, Klf4, Sox2 and c-Myc. Examples of viral vectors include, without limitation, vectors based on DNA or RNA viruses, such as adenovirus, adeno-associated virus (AAV), retroviruses, lentiviruses, vaccinia virus, measles viruses, herpes viruses, baculoviruses, and papilloma virus vectors. See, Kay et al., Proc. Natl. Acad. Sci. USA, 94:12744-12746 (1997) for a review of viral and non-viral vectors. Viral vectors can be modified so the native tropism and pathogenicity of the virus has been altered or removed. The genome of a virus also can be modified to increase its infectivity and to accommodate packaging of the nucleic acid encoding the polypeptide of interest. In some cases, the induced pluripotent stem cells provided herein can be obtained using viral vectors that do not integrate into the genome of the cells. Such viral vectors include, without limitation, adenoviral vectors, AAV vectors, baculovirus vectors, and herpesvirus vectors. For example, cells obtained from a human can be provided nucleic acid encoding human Oct3/4, Sox2, Klf4, and c-Myc polypeptides using viral vectors that do not integrate the exogenous nucleic acid into the cells. Once the polypeptides are expressed and induced pluripotent stem cells are obtained, the induced pluripotent stem cells can be maintained in culture such that the induced pluripotent stem cells are devoid of the exogenous nucleic acid.
Any appropriate non-viral vectors can be used to introduce stemness-related factors, such as Oct3/4, Klf4, Sox2, and c-Myc. Examples of non-viral vectors include, without limitation, vectors based on plasmid DNA or RNA, retroelement, transposon, and episomal vectors. Non-viral vectors can be delivered to cells via liposomes, which are artificial membrane vesicles. The composition of the liposome is usually a combination of phospholipids, particularly high-phase-transition-temperature phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations. Transduction efficiency of liposomes can be increased by using dioleoylphosphatidylethanolamine during transduction. See, Felgner et al., J. Biol. Chem., 269:2550-2561 (1994). High efficiency liposomes are commercially available. See, for example, SuperFect® from Qiagen (Valencia, Calif.).
In some cases, induced pluripotent stem cells can be obtained using culture conditions that do not involve the use of serum or feeder cells. For example, cells obtained from a human can be provided nucleic acid encoding human Oct3/4, Sox2, Klf4, and c-Myc polypeptides and cultured using media lacking serum (e.g., human or non-human serum) and lacking feeder cells (e.g., human or non-human feeder cells).
The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
EXAMPLES Example 1 Generating Mouse and Human iPS Cells Using Human Stem Cell-Associated FactorsThe following studies were performed to establish effective methods for generating an iPS cell line capable of multilineage differentiation from somatic fibroblasts. These results include generating both mouse and human iPS cells using human stem cell-associated factors.
Generation of HIV vectors expressing stem cell-related factors. Human sequences were used to generate reprogramming vector sets that could be tested in evolutionary distant somatic cell types. Human factor cDNAs were amplified by PCR, and the PCR products were cloned into a HIV vector plasmid, pSIN-CSGWdlNotI vector, resulting in HIV-based lentiviral vectors encoding human Oct-3/4, Sox2, Klf4, c-Myc, Nanog, and Lin28. For improved transduction efficiency in mouse and rhesus cells, the modified HIV packaging construct with a H87Q Capsid mutation, pEx-QV, was used to produce infectious HIV vectors. After infection of human 293 T cells with the infectious vectors, robust transgene expression was verified by immunoblotting with specific antibodies (
Ectopic expression of Oct3/4, Sox2, Klf4, and c-Myc in human somatic cells led to formation of iPS-like colonies. Human iPS cells form sharp-edged, flat, tightly-packed colonies similar to human ES cells, and express human ES-specific markers (Takahashi et al., Cell, 131:861-72 (2007) and Yu et al., Science, 318:1917-20 (2007)). Human somatic cells (primary cardiac fibroblasts HCF (ScienCell), foreskin-derived fibroblasts BJ (ATCC), fetal lung fibroblasts MRC-5 (ATCC)) were infected with different combinations of lentiviral vectors. Three weeks after co-cultivation with mouse feeder cells, ES/iPS-like colonies were observed in cells infected with Oct3/4, Sox2, Klf4, and c-Myc vectors (
Putative human iPS clones express alkaline phosphatase and human ES/iPS-specific markers. Colonies selected for human ES/iPS-like morphology from HCF, BJ1 and MRC-5 cells were analyzed for alkaline phosphatase expression. Putative iPS clones, which were grown on feeder cells for three days, were fixed for one minute in 2% paraformaldehyde and then stained with the first red violet solution for 15 minutes at room temperature (Millipore, ES cell characterization kit). All putative human iPS clones tested expressed alkaline phosphatase (
Derivation of putative mouse iPS cells. When mouse embryonic fibroblasts were infected with four HIV vectors expressing human pluripotent genes, numerous (>500) mouse ES/iPS-like colonies were generated (
Derivation of mouse iPS-like colonies from adult mouse somatic cells. To test if human iPS-related factors can reprogram adult mouse somatic cells, mouse lung-, kidney-, tail-, and heart-derived cells from a six weeks old B16-GFP transgenic mouse and a factor VIII knockout mouse were infected with HIV vectors expressing human Oct3/4, Sox2, Klf4, and c-Myc. Numerous ES-like colonies were formed ten days after vector infection, especially in the lung-derived cells, and putative iPS clones were successfully expanded on mouse feeder cells.
Expression of gastrulation during in vitro differentiation of iPS-derived embryoid body. In order to verify the pluripotency, the in vitro differentiation potential of the putative iPS cells was analyzed. An iPS clone was differentiated into embryoid bodies (EB), and the gastrulation markers in undifferentiated iPS cells and EB were examined by RT-PCR. Significant induction of gastrulation markers was evident in EB, indicating derivation of germ layers from transformed fibroblasts (
In vitro differentiation of mouse iPS cells into embryoid bodies capable of rhythmic contractions. The putative iPS cells were tested for the ability to differentiate into cardiomyocytes. iPS-derived embryoid bodies were successfully differentiated into beating cardiomyocytes, evidence of the formation of contractile cardiomyocytes with pacemaker activity.
Mouse iPS cell engraftment into host molura. A MEF-derived iPS clone was labeled with GFP by infecting the cells with a GFP-expressing HIV vector. GFP-labeled iPS cells were efficiently incorporated into developing morula to form a chimera blastocyte, a property limited to genuine ES cells (
Xenografts of iPS cells in nude mice generate teratoma-like masses. Human and mouse ES cells form teratomas after cell injection into immunodeficient mice, an assay that has become the accepted standard for demonstrating their developmental pluripotency. Immunodeficient mice were subcutaneously injected with mouse iPS clones or parental MEF cells. Injection of 500,000 iPS cells resulted in formation of a subcutaneous tumor that enlarged to 1 cm diameter within 4 weeks (
Derivation of putative iPS cells from rat cells. The ability of human iPS-related factors to reprogram rat somatic cells into ES-like progeny was tested. Normal rat kidney cells were infected with HIV vectors expressing human Oct3/4, Sox2, Klf4, and c-Myc. Vector-infected cells were co-cultured with mouse SNL feeder cells for eight days. Many iPS-like colonies were observed, and 12 colonies were picked for further characterization. Only two of the 12 colonies maintained the iPS-like morphology for two weeks in the presence of mouse LIF (
Derivation of putative iPS cells from rhesus monkey cells. Rhesus monkey kidney derived cells were infected with HIV vectors expressing human Oct3/4, Sox2, Klf4, and c-Myc. Vector-infected cells were co-cultured with mouse SNL feeder cells for ten days in serum-free media (HuESGro, Millipore) supplemented with human b-FGF. Six putative rhesus monkey iPS clones with sharp-edged, flat and tightly-packed colonies similar to human iPS cells were identified (
These results demonstrate the feasibility of reprogramming of human and mouse cells with defined human factors. For example, these results demonstrate that HIV vectors expressing human Oct3/4, Sox2, Klf4, c-Myc, Nanog, and Lin28 can be used to derivate iPS cells from rat, dog, and rhesus monkey cells, thereby allowing appropriate efficacy and toxicology testing of autologous iPS cells in appropriate animal models.
Efficient iPS derivation from experimental animals can enable preclinical efficacy testing of autologous iPS cells in proper models. Use of the vectors expressing human stem cell factors can allow direct toxicology testing of the same vectors used in human trials.
The influence of systemic administration of autologous iPS cells in mice and rats can be examined. For example, autologous iPS cells can be genetically label with Luciferase, GFP, and LacZ with HIV vectors, and their in vivo distribution (examples of live-imaging are shown in
The following is performed to further characterize the ability of human factors to reprogram mouse fibroblast cells into iPS cells. Fibroblasts are isolated from a GFP transgenic C57/BL6 mouse tail. 5×104 cells are infected with HIV vectors expressing human Oct3/4, Sox2, Klf4, and c-Myc at multiplicity of infection of 10. Transduced cells are cultured in the normal growth medium for fibroblast cells for four days, and then are spread in a 10-cm plate on a mouse SNL feeder cells. One day after the passage, culture supernatants are changed to LIF- and FCS-containing ES media. One third of the culture supernatants are replaced daily. The cells are monitor for up to 3 weeks. 24 iPS-like colonies are picked up for expansion. The remaining cells on the 10-cm plates are fixed by 4% paraformaldehyde for one min, are treated with freshly prepared first red substrate for AP staining (Millipore) for 15 minutes at room temperature, and then are counted for the number of iPS-like colonies.
The 24 clonal iPS-like cells are expanded, and their authenticity is screened by mouse ES/iPS-specific marker SSEA1 and alkaline phosphatase expression. Five iPS-like colonies with strong SSEA and alkaline phosphatase expression are further characterized to demonstrate the pluripotency. The clones are examined for the telomerase activity (TRAPEZE telomerase kit), in vitro differentiation through embryoid bodies (EB), pluripotency-associated gene expression, and the ability to form teratomas and are used to generate chimeric mice.
Mouse ES and iPS culture. Mouse ES and iPS cells are maintained in Glasgow's Minimum Essential Medium (BioWhittaker-Cambrex) supplemented with pyruvate and L-glutamine (Cellgro), non-essential amino acids (Cellgro), β-mercaptoethanol (Sigma-Aldrich), 10% FCS (Invitrogen), and leukemia inhibitory factor (Chemicon International).
EB formation. Mouse iPS cells are differentiated into three-layer embryoid bodies using the hanging-drop method in differentiation media supplemented with 20% FCS and TNF-α (Invitrogen) as described elsewhere (Nelson et al., Stem Cells, 26:1464-73 (2008)). In vitro differentiation of mouse iPS cells into embryoid bodies capable of rhythmic contractions is performed as described elsewhere (Nelson et al., Stem Cells, 26:1464-73 (2008)).
Cells. 293T (ATCC), MRC-5 (ATCC), BJ (ATCC) and SNL feeder cells (MMRRC) are maintained in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% FCS and antibiotics. Primary mouse, rat, dog, and pig fibroblast cells are cultured in DMEM supplemented with 10% fetal calf serum (FCS) and antibiotics.
HIV-based vectors. HIV-based vectors are prepared by transfection of 293T cells with three plasmids, pMD-G, pEx-QV, and stem cell-related gene-expressing vector plasmid, as described elsewhere (Ikeda et al., Gene Ther., 9:932-8 (2002); Ikeda et al., Nat. Biotechnol., 21:569-72 (2003); Strang et al., Gene Ther., 11:591-8 (2004); and Sakuma et al., Gene Ther., 14:185-9 (2007)).
Immunostaining. Immunostaining to detect cell surface markers is performed as described elsewhere (Noser et al., Mol. Ther., 15:1531-6 (2007) and Palmowski et al., J. Immunol., 172:1582-7 (2004)).
Example 3 Reprogramming Somatic Cells from Rat, Dog, Pig, and Rhesus Monkey CellsThe following is performed to further characterize the generation of iPS cells from diverse species with vectors expressing defined human stem cell-related factors. Rat and pig lung-derived primary cells (less than 5 passages) and dog cardiac fibroblast cells are used to derive rat, dog, and pig iPS cells. Rhesus monkey lung-derived fibroblast cells (DBL-FRhL-2, ATCC CL-160), fetal epithelial cells (FrhK4, ATCC CRL-1688), primary peripheral blood monocytes (Dr. DeRavin, NIAID) and primary hepatocytes (Celsis Invitro Technologies) are used to derive iPS cells from rhesus monkey. 5×104 cells are infected with various combinations of HIV vectors expressing human Oct3/4, Sox2, Klf4, c-Myc, Nanog, and Lin28 at multiplicity of infection of 10. Transduced cells are cultured in the normal growth medium for fibroblast cells for 4 days, and then are spread in a 10-cm plate on a mouse SNL feeder cells. One day after the passage, the medium is changed to specific ES media (Table 1). For rat iPS cell derivation, mouse ES media supplemented with 1000 units of rat LIF (Millipore) is used. For dog and pig iPS cell derivation, mouse ES media supplemented with mouse LIF (Chemicon International) and human LIF (Millipore) are used, respectively. For rhesus monkey iPS cells, b-FGF-containing HuESGRo medium is used. One third of the culture supernatants are replaced daily. The cells are monitored for up to 3 weeks. 24 iPS-like colonies are picked up for expansion. The remaining cells on the 10-cm plates are fixed by 4% paraformaldehyde for 1 minute, treated with freshly prepared first red substrate for AP staining (Millipore) for 15 minutes at room temperature, and then counted for the number of iPS-like colonies.
The 24 clonal iPS-like cells are expanded, and their authenticity screened by mouse ES/iPS-specific marker and alkaline phosphatase expression. Five iPS-like colonies with strong SSEA1 (SSEA4 for rhesus iPS cells) and alkaline phosphatase expression are further characterized to demonstrate the pluripotency. The clones are examined for the telomerase activity (TRAPEZE telomerase kit), in vitro differentiation through EB, pluripotency-associated gene expression, and teratoma formation.
Rat, dog, and pig iPS culture. Mouse ES/iPS media is used with rat LIF, human LIF, or mouse LIF for rat, dog, and pig iPS cells, respectively.
Rhesus monkey iPS culture. Human iPS cells are maintained in serum-free HESGro medium (Millipore) supplemented with basic fibroblast growth factor (8 ng/mL).
Cells. 293T (ATCC), MRC-5 (ATCC), BJ (ATCC) and SNL feeder cells (MMRRC) are maintained in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% FCS and antibiotics. Primary mouse, rat, dog, and pig fibroblast cells are cultured in DMEM supplemented with 10% fetal calf serum (FCS) and antibiotics.
HIV-based vectors. HIV-based vectors are prepared by transfection of 293T cells with three plasmids, pMD-G, pEx-QV, and stem cell-related gene-expressing vector plasmid, as described elsewhere (Ikeda et al., Gene Ther., 9:932-8 (2002); Ikeda et al., Nat. Biotechnol., 21:569-72 (2003); Strang et al., Gene Ther., 11:591-8 (2004); and Sakuma et al., Gene Ther., 14:185-9 (2007)).
Immunostaining. Immunostaining to detect cell surface markers is performed as described elsewhere (Noser et al., Mol. Ther., 15:1531-6 (2007) and Palmowski et al., J. Immunol., 172:1582-7 (2004)).
Example 4 Generating iPS Cells without Using Mouse Feeder Cells and Fetal Calf SerumiPS-like colonies were formed when HCF, BJ, and MRC-5 cells were infected with HIV vectors expressing Oct3/4, Sox2, Klf4, and c-Myc and simply maintained in a serum-free media (HESGro, Millipore, containing b-FGF) for two weeks (
Ectopic expression of pluripotent genes can rely on the host environment to achieve reprogramming of a non-stem into a stem cell phenotype. To secure optimal induction of pluripotent reprogramming, the influence of the intracellular background environment on the efficiency of iPS generation can be delineated amongst target somatic cells. iPS cells are derived from various murine and human somatic cell lines originating from different tissues and different age groups, and the most efficient cell source for iPS generation is determine. In order to verify pluripotent outcome, putative iPS cell clones are characterized by the following criteria: (i) degree of expression of pluripotent markers (e.g., human SSEA-4, TRA-1-60 and TRA-1-81; mouse SSEA-1); (ii) extent of telomerase activity (i.e., TRAPEZE telomerase kit); (iii) propensity for in vitro and in vivo three germinal layer formation (e.g., embryoid body generation); (iv) completeness in utero organogenesis (i.e., hybrid iPS/blastomere development for mouse iPS cells); and (v) robustness of tissue-specific differentiation (e.g., cardiomyocytes). Ranking of cytotypes based on the listed criteria is used to determine the optimal intracellular environment for efficient production of iPS cells.
Reprogramming-associated signaling cascades are induced by ectopic gene expression, and ultimately reshape cellular phenotypes through transformation of genome-wide expression profile. Bioinformatics and network biology in combination with microarray, high-throughput transcriptome analysis is used to chart gene networks responsible for maintaining pluripotency in ES cells (Yu et al., Science, 318:1917-20 (2007) and Evans & Kaufman, Nature, 292:154-6 (1981)). This technology has identified critical pathways and patterns of gene expression synchronized to coordinate differentiation (Martin, Proc. Natl. Acad. Sci. USA, 78:7634-8 (1981) and Thomson et al., Science, 282:1145-7 (1998)). The reverse engineering approach to chart re-programming processes in response to transient ectopic pluripotent gene expression should thus provide valuable insight to the signaling pathways required to generate safe iPS cells.
Comparison of benchmarked ES cell transcriptomes with iPS-derived cytotypes is performed in order to reveal the roadmap for effective reprogramming of somatic tissues and advance safe iPS derivation strategies without activation of oncogenic networks that can increase long-term risk of uncontrolled growth.
5×104 cells derived from skin, bone marrow, heart, lung, kidney, and liver of B16-GFP transgenic mice at different ages (new born, 6 weeks old, and 1 year old) are transduced with HIV vectors expressing Oct3/4, Sox2, Klf4, and c-Myc at multiplicity of infection of 10. Primary human cardiac fibroblasts, hepatocytes, neonate, and adult dermal fibroblasts and mesenchymal stem cells (ScienCell) are also transduced. The transduced cells are cultured in the specific growth media for 4 days, and are spread in a 10-cm plate on SNL feeder cells. The medium is changed to LIF- and FCS-containing media for mouse iPS generation, while serum-free growth media with b-FGF is used for human iPS derivation. One third of the culture supernatants is replaced daily. The cells are monitored for up to 4 weeks, and the number of iPS-like colonies on the plates is counted. The colonies are expanded, and iPS clones are obtained from each group. Their authenticity is verified by surface marker expression. Skin-derived mouse iPS clones from different age groups and iPS clones from different tissues of a 6 week-old mouse (2 clones/group), as well as human iPS clones from different primary tissues are further characterized as shown in Table 2.
Clonal expansion of iPS cells can produce a homogenous cell population amendable to transcription profiling using genome-wide analysis. Transcriptome profiling of parental cytotype in comparison to progenitor cells at sequential stages of reprogramming is achieved during iPS cellular induction. Mouse embryonic fibroblasts are profiled according to transcriptome expression and are used as a reference point to compare iPS-like clones identified by characteristic morphology upon ectopic gene expression. To identify subtle expression network changes predictive of safe and effective reprogramming, iPS-like clones with and without transient expression of oncogenes such as c-Myc are compared to traditional ES cell lines through mRNA isolation, microarray data collection, and bioinformatics network analysis.
Genomics. Total RNA is extracted at selected reprogramming stages using a combination of gDNA Eliminator and RNeasy columns (Qiagen). cDNA is prepared from total RNA samples using MMLV Reverse Transcriptase (Invitrogen). Samples are subjected to microarray analysis by labeled cRNA hybridization to the mouse genome 430 2.0 GeneChip (Affymetrix) (Behfar et al., J. Exp. Med., 204:405-20 (2007); Nelson et al., Stem Cells, 26:1464-73 (2008); Perez-Terzic et al., Nat. Clin. Pract. Cardiovasc. Med., 4 Suppl 1, S68-76 (2007); and Chung et al., Nat. Clin. Pract. Cardiovasc. Med., 4 Suppl 1, S60-7 (2007)). Real-time PCR is performed using a standard TaqMan® PCR kit protocol on an Applied Biosystems 7900HT Sequence Detection System (Applied Biosystems). Comparisons between groups are performed by Student's t tests with 95% confidence intervals.
Gene Expression Profiling. Gene expression changes of microarray data acquired using the GeneChip Scanner 3000 (Affymetrix, Inc, Santa Clara, Calif.) are profiled with the Genespring GX 7.3 analysis software suite (Agilent Technologies). The derived gene list is limited to report transcripts with expression levels above background and then is subjected to 1-way ANOVA, using a Benjamini-Hochberg post hoc multiple testing correction for all P<0.01. Differentially expressed genes (P<0.05) are excluded from subthreshold transcripts using Volcano plot analysis, according to a minimum 1.5-fold change, and ontologically dissected to determine physiological system priority emphasized within changing transcripts. Molecular interactions of expression profiles comprising pluripotent gene expression are examined and formatted for Cytoscape 2.2, which provides an ad hoc network map of integrated up- and downregulated candidate genes driving the pluripotent switch.
Example 6 Establishing Genomic Modification-Free Technology for Safe Production of iPS CellsRetroviral or lentiviral vector integration has risks associated with insertional mutagenesis. Use of oncogenic c-Myc during reprogramming is also problematic for clinical application of the resulting iPS cells, as sustained c-Myc expression can increase the risk of tumor formation in iPS-derived cells in vivo. In order to avoid these risks, iPS cells can be generated without integrating vectors and continuous c-Myc expression. Derivation of iPS cells with transient expression from non-integrating vectors can solve both problems, as the resulting iPS cells carry no genomic modifications.
Since retroviral promoters are rapidly silenced in mouse or human ES cells (Wolf & Goff, Cell, 131:46-57 (2007)), expression of stem cell factors from the introduced retroviral vectors was also silenced in iPS cells (Takahashi et al., Cell, 131:861-72 (2007)). This observation indicates that the stem cell factors are only required to initiate the reprogramming step, but are not mandatory to maintain the resulting iPS phenotype.
It is hypothesized that initiation of the reprogramming step by non-integrating vectors is sufficient to generate iPS cells. To test this hypothesis, and improve upon the iPS derivation strategy, a genomic modification-free strategy for iPS generation is developed. As non-integrating vectors, AAV and integrase-negative HIV vectors are used (
HIV-based vectors generally integrating into host genome before they express significant levels of transgene products. However, recent studies have shown that HIV-based vectors generated with a packaging construct with non-functional viral integrase can express transgene for long term without integrating into host genome (Negri et al., Mol. Ther., 15:1716-23 (2007); Apolonia et al., Mol. Ther., 15:1947-54 (2007); and Saenz et al., J. Virol., 78:2906-20 (2004)). Similarly, although wildtype AAV can site-specifically integrate into AAVS1 site at chromosome 19 (Philpott et al., J. Virol., 76:5411-21 (2002) and Philpott et al., Proc. Natl. Acad. Sci. USA, 99:12381-5 (2002)), this AAV integration step is mediated by ectopic AAV viral enzyme Rep and a viral cis sequence in the p5-rep region. Since AAV-based vectors do not carry viral Rep protein nor the p5-rep sequence, they do not integrate into host genome (Flotte et al., Proc. Natl. Acad. Sci. USA, 90:10613-7 (1993) and Kaplitt et al., Nat. Genet., 8:148-54 (1994)). Infection of AAV and integrase-negative HIV vectors can lead to transient transgene expression without vector integration into host genome. Such non-integrating vectors are used to express the stem cell-related genes and establish genomic modification-free iPS cells.
An additional risk with iPS preparation is the current use of animal-derived biological reagents that preclude clinical grade production and utilization in practice. iPS colonies are established in the absence of fetal calf serum and mouse feeder cells. After successful reprogramming of human somatic cells by non-integrating vectors, genetic modification-free iPS cells are established without using FCS and mouse feeder cells.
Non-integrating HIV vectors expressing human stem cell-related factors are generated using a packaging construct with mutations in the viral integrase (Saenz et al., J. Virol., 78:2906-20 (2004)). The vectors are concentrated about 100-fold by ultracentrifugation as described elsewhere (Strang et al., Gene Ther., 11:591-8 (2004) and Strang et al., J. Virol., 79:1765-71 (2005)). AAV serotypes 2 and 9 vectors expressing the four human factors Oct3/4, Sox2, Klf4 and c-Myc are generate. AAV vectors are concentrated and are purified through ultracentrifugation through cesium chloride gradients. Transgene expression in the cells infected by 10 μL of the concentrated non-integrating HIV and AAV vectors is verified. 5×104 human skin-derived and cardiac fibroblast cells and mouse tail-derived fibroblasts are consecutively infected with 200 μL of concentrated vectors for 3-14 days. The transduced cells are cultured in the specific growth media for the first 4 days, and are spread in a 10-cm plate with inactivated SNL feeder cells. The medium is changed to LIF- and FCS-containing mouse ES media for mouse iPS generation, while serum-free growth media with 40 ng/mL of b-FGF is used for human iPS derivation. One third of the culture supernatants is replaced daily. The cells are monitored for up to 4 weeks, and the number of iPS-like colonies on the plates is counted. Obtained iPS-like colonies are isolated to confirm absence of vector integration by sensitive Q-PCR and FISH methods. Representative iPS clones are characterize for their pluripotency as described herein, and the transcriptomes between the iPS made with or without integrating vectors are compared. In order to demonstrate increased safety, iPS-derived chimeric mice are generated using mouse iPS cells made with or without integrating vectors (two clones each), and their respective long-term risk of tumorigenicity is compared.
Mitotically inactivated MRC-5, HCF, and BJ cells are tested to determine whether they can support prolonged undifferentiated growth of human iPS cells. It is determined whether iPS cells can be generated by using autologous human cells as feeders. Genomic modification-free iPS cells are generated by using autologous human cells as feeders.
Primary mouse cells. B16-GFP transgenic mice were obtained from Dr. Richard A. Vile (Mayo Clinic). Bone marrow, skin, heart, lung, stomach, spleen, kidney, liver, and tail is harvested, and tissue-derived primary cell cultures are established as described elsewhere (Noser et al., J. Virol., 80:7769-74 (2006); Strang et al., J. Virol., 79:1765-71 (2005); and Relander et al., Mol. Ther., 11:452-9 (2005)). Cells are transduced by HIV vectors, and iPS generation efficiency is monitored.
Mouse ES and iPS culture. Mouse ES and iPS cells are maintained in Glasgow's Minimum Essential Medium (BioWhittaker-Cambrex) supplemented with pyruvate and L-glutamine (Cellgro), non-essential amino acids (Cellgro), β-mercaptoethanol (Sigma-Aldrich), 10% fetal calf serum (FCS) (Invitrogen), and leukemia inhibitory factor (Chemicon International).
Primary human cells. Primary cardiac fibroblasts, pulmonary fibroblasts, hepatocytes, neonate and adult dermal fibroblasts, and mesenchymal stem cells (ScienCell) are cultured in specific media (ScienCell) and are used for iPS induction.
Human iPS culture. Human iPS cells are maintained in serum-free HuESGro medium (Millipore) supplemented with basic fibroblast growth factor (40 ng/mL).
EB formation. Mouse iPS cells are differentiated into three-layer embryoid bodies using the hanging-drop method in differentiation media supplemented with 20% FCS and TNF-α (Invitrogen) as described herein. In vitro differentiation of mouse iPS cells into embryoid bodies capable of rhythmic contractions are performed as described herein.
Cell lines. 293T (ATCC), MRC-5 (ATCC), BJ (ATCC), and SNL feeder cells (MMRRC) are maintained in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% FCS and antibiotics.
HIV-based vectors. HIV-based integrating vectors are prepared by transfection of 293T cells by using Fugene-6 (Roche) as described elsewhere (Ikeda et al., Gene Ther., 9:932-8 (2002); Ikeda et al., Nat. Biotechnol., 21:569-72 (2003); Strang et al., Gene Ther., 11:591-8 (2004); and Sakuma et al., Gene Ther., 14:185-9 (2007)). For efficient transduction of mouse cells, pEx-QV packaging construct is used (Ikeda et al., J. Virol., 78:11816-22 (2004)). The non-integrating HIV-packaging construct, which carries a mutation in the viral integrase, is used to generate non-integrating HIV vectors expressing defined human factors.
AAV vector. Helper-free AAV vectors based on AAV serotypes 2 and 9 are generated by transient transfection of 293T cells with pHelper, pRepCap, or pRep2Cap9 and pAAV-MCV-derived vector constructs (Stratagene).
Immunoblotting. Immunoblotting is performed to detect Oct3/4, Sox2, Klf4, c-Myc, Nanog, and Lin28 as described herein.
Immunostaining. Immunostaining is performed to detect cell surface markers as described herein.
Genomics. Total RNA is extracted at selected reprogramming stages using a combination of gDNA Eliminator and RNeasy columns (Qiagen). cDNA is prepared from total RNA samples using MMLV Reverse Transcriptase (Invitrogen). Samples are subjected to microarray analysis by labeled cRNA hybridization to the mouse genome 430 2.0 GeneChip (Affymetrix) (Behfar et al., J. Exp. Med., 204:405-20 (2007); Nelson et al., Stem Cells, 26:1464-73 (2008); Perez-Terzic et al., Nat. Clin. Pract. Cardiovasc. Med., 4 Suppl 1, S68-76 (2007); and Chung et al., Nat. Clin. Pract. Cardiovasc. Med. 4 Suppl 1, S60-7 (2007)). Real-time PCR is performed using a standard TaqMan® PCR kit protocol on an Applied Biosystems 7900HT Sequence Detection System (Applied Biosystems). Comparisons between groups are performed by Student's t tests with 95% confidence intervals.
Gene Expression Profiling. Gene expression changes of microarray data acquired using the GeneChip Scanner 3000 (Affymetrix, Inc, Santa Clara, Calif.) are profiled with the Genespring GX 7.3 analysis software suite (Agilent Technologies). The derived gene list is limited to report transcripts with expression levels above background and then is subjected to 1-way ANOVA, using a Benjamini-Hochberg post hoc multiple testing correction for all P<0.01. Differentially expressed genes (P<0.05) are excluded from subthreshold transcripts using Volcano plot analysis, according to a minimum1.5-fold change, and ontologically dissected to determine physiological system priority emphasized within changing transcripts. Molecular interactions of expression profiles comprising pluripotent gene expression are examined and formatted for Cytoscape 2.2, which provides an ad hoc network map of integrated up- and downregulated candidate genes driving the pluripotent switch.
Achieving efficient and safe iPS derivation provides an essential platform for realizing individualized cell therapy. For clinical iPS application, a further understanding of the influence of intracellular environment on the reprogramming efficiency is helpful. The studies provided herein can be extended into broad ranges of human populations including young and old, healthy and diseased donors. Reprogramming efficiency can be lower from older and diseased donors. If this is the case, further optimization of the gene transfer vectors, combination of defined stem cell factors, and vector transduction conditions can be used to improve the reprogramming efficiency particularly from old and diseased subjects. Through this approach, disease-specific iPS libraries can be generated. Such patient-specific iPS libraries can provide a valuable platform to study patient-specific disease development mechanisms in vitro. They can also increase the efficiency of patient-specific drug discovery. Thus, the methods and materials provided herein can be used for autologous iPS-mediated cell therapies as well as for tools to assess patient-specific disease development, drug screening, and drug toxicity (
pSIN-CSGWdlNotI-derived transfer vectors were generated with human OCT3/4, SOX2, KLF4 and c-MYC cDNAs (Open Biosystems; Nelson et al. Clin. Translation Sci., 2:118-126 (2009)). The packaging plasmid, pCMVR8.91, was engineered with H87Q mutation in the HIV-1 capsid region for increased transduction efficiency of purified infectious supernatants (Nelson et al. Clin. Translation Sci., 2:118-126 (2009)). Mouse embryonic fibroblasts, obtained from embryos at 14.5 days post-coitum (dpc), were expanded in maintenance medium containing Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal calf serum (FCS), 1% L-glutamine (Invitrogen) and 1% penicillin/streptomycin, and plated at 105/24-wells prior to transduction for 12 hours with infectious supernatants. Transduced fibroblasts were replated at confluence, and iPS isolated in 2 weeks for clonal expansion. Cells were labeled with HIV vectors carrying LacZ (pLenti6/UbC/V5-GW/LacZ, Invitrogen) or luciferase (pSIN-Luc) (Hasegawa et al., Clin. Cancer Res., 15:6170-6178 (2006)).
Pluripotent InductionR1-derived embryonic stem cells and iPS were expanded in embryonic stem cell media. Cells were fixed with 3% paraformaldehyde, permeabilized, and stained with anti-SSEA-1 antibody (MAB4301; dilution 1:50; Chemicon) along with secondary goat anti-mouse Alexa Fluor 568 (1:250; Invitrogen). Nuclei were labeled with 4,6′-diamidino-2-phenylindole (DAPI; Invitrogen). For ultrastructural evaluation, cells were examined on Hitachi 4700 field emission scanning or JEOL 1200 EXII transmission electron microscopes (Perez-Terzic et al., Nat. Clin. Pract. Cardiovasc. Med., 4(Suppl. 1):S68-S76 (2007)). Growth and differentiation potential were determined upon subcutaneous injection in anesthetized (2-3% isoflurane) athymic nude mice. Cryopreserved tissue was processed for hematoxylin/eosin procedures (Yamada et al., Stem Cells, 26:2644-2653 (2008) and Behfar et al., J. Exp. Med., 204:405-420 (2007)).
DifferentiationiPS were differentiated into embryoid bodies using the hanging-drop method (Behfar et al., FASEB J., 16:1558-1566 (2002)). Expression of pre-cardiac mesoderm and cardiac differentiation markers was detected by RT-PCR. Total RNA was extracted with a combination of gDNA Eliminator and RNeasy columns (Qiagen). cDNA was prepared from RNA samples using Superscript III First Strand Synthesis System (Invitrogen). Mouse GAPDH (4352932E; Applied Biosystems) was used as control. Analyzed genes included Gata4 (Mm00484689_m1), Myocd (Mm00455051_m1), and Mef2c (Mm01340839_m1; Applied Biosystems).
Diploid AggregationContribution to embryonic development was assessed through diploid aggregation (Nelson et al., Phil. Trans. R. Soc. B., 364:269-276 (2009)). Host embryos from CD-1 superovulated females were collected at 2.5 dpc. Fibroblasts or iPS were partially digested using trypsin 0.25%-EDTA (Invitrogen), and 8-15 cell clumps were placed with paired embryos denuded of zona pellucida. The aggregation complex was incubated for 24 hours (in 5% CO2/5% O2/90% N2) until blastocyst cavitation (Nelson et al., Phil. Trans. R. Soc. B., 364:269-276 (2009)). Chimeric embryos were transplanted into anesthetized (2-3% isoflurane) pseudopregnant surrogate CD-1 mothers, harvested at 9.5 dpc, and analyzed for distribution of LacZ-labeled progenitors (Nelson et al., Phil. Trans. R. Soc. B., 364:269-276 (2009)).
iPS TherapyMale, 8-12 weeks old C57BL/6 or athymic nude mice were anesthetized (1.5-2% isoflurane), intubated (Mini Vent 845, Hugo Sacks Electronik), and left coronary artery ligated with a 9-0 suture under direct visualization following minimally invasive thoracotomy. Myocardial ischemia was confirmed by electrocardiography, echocardiography, and color change of left ventricular wall. Fibroblasts or iPS (200,000/10 μL of differentiation medium) were transplanted with four injections of 2.5 μL within 30 minutes after ligation. Cryosections (7 μm-thickness) were processed for hematoxylin/eosin, Masson's trichrome, luciferase and β-gal staining (Yamada et al., Stem Cells, 26:2644-2653 (2008) and Behfar et al., J. Exp. Med., 204:405-420 (2007)). Sections were labeled with luciferase (1:5000, Sigma) or β-galactosidase antibody (1:5000, Abcam) coupled with Alexa-568 secondary antibody (1:1000, Invitrogen) and co-localized with α-actinin (1:200, Sigma), smooth muscle actin (1:200, Abcam), CD31 (1:200, Abcam), or SSEA-1 (1:50, Chemicon) antibodies all paired with Alexa-488 antibody (1:1000, Invitrogen).
Live Cell Imaging and Heart PerformanceLuciferase-transfected fibroblasts or iPS were cultured for multiple passages including a freeze/thaw cycle prior to expansion and transplantation. Cells were tracked with the IVIS 200 Bioluminescence Imaging System (Xenogen) following intra-peritoneal injection of 150 mg/kg D-luciferin (Xenogen), and signals analyzed with the Living Image Software (Xenogen). Ventricular performance was quantified by echocardiography (RMV-707B scanhead, Vevo770, Visual Sonics). Ejection fraction (%) was calculated as [(LVVd−LVVs)/LVVd]×100, where LVVd is left ventricular end-diastolic volume (μL) and LVVs, left ventricular end-systolic volume (μL). Left ventricular fractional shortening (% FS) was calculated as [(LVDd−LVDs)/LVDd]×100, where LVDd is left ventricular end-diastolic dimension (mm) and LVDs, left ventricular end-systolic dimension (mm) (Yamada et al., Stem Cells, 26:2644-2653 (2008)). Electrical activity was monitored by electrocardiography (MP150, Biopac). Data was collected and analyzed by blinded investigators.
Statistical AnalysisResults are presented as mean±SEM. Median is additionally reported when grouped data were compared with nonparametric Mann-Whitney U test. Comparison between groups over time was performed by two-way repeated-measures ANOVA. Kaplan-Meier analysis was applied with log-rank testing. p<0.05 was predetermined as significant, and all values >0.001 were reported.
Results Nuclear Reprogramming Resets Primitive Morphology and Unlocks Functional Pluripotency.Transduced with human stemness factors, OCT3/4, KLF4, SOX2 and c-MYC, reprogrammed fibroblasts were isolated according to compact clusters of embryonic stem cell-like morphology distinct from monomorphic, single-cell layers of parental fibroblasts (
Chimeric Embryos Authenticate iPS-Derived Patterning of Normal Cardiogenesis.
As iPS differentiated within 5-day-old embryoid bodies (
iPS Engraft into Infarcted Immunocompetent Adult Hearts.
In contrast to fibroblasts unable to proliferate even after prolonged incubation, subcutaneous injection of iPS clones within an immunodeficient adult environment demonstrated aggressive growth (
Within immunocompetent hosts, recovery of post-ischemic cardiac performance was compared in randomized cohorts transplanted with parental fibroblasts versus derived iPS. Monitored by echocardiography, irreversible occlusion of the epicardial coronary blood flow consistently impaired anterior wall motion, depressed global cardiac function, and halved ejection fraction (EF) from 82±3% before infarction (n=8) to 38±3% within 1-day post-infarction (n=12;
Beyond functional deterioration, maladaptive remodeling with detrimental structural changes prognosticates poor outcome following ischemic injury. Here, iPS-based intervention attenuated global left ventricular diastolic diameter (LVDd). Pre-infarction LVDd measured 3.2±0.1 mm (median 3.1 mm), but increased post-infarction to 4.9±0.1 mm (median 4.9 mm) by 4-weeks of fibroblast treatment (n=6) a value significantly higher (p=0.007) than 4.2±0.2 mm (median 4.2 mm) with iPS treatment (n=6;
Histological analysis demarcated de-muscularization and extensive scarring within left ventricles distal to coronary ligation in hearts treated with fibroblasts 4 weeks following transplantation (
Mouse embryonic fibroblasts (MEFs) were obtained from embryos at 14.5 days post coitum (dpc). Internal organs and the head were removed prior to digestion with 0.25% trypsin-EDTA (Invitrogen, Carlsbad, Calif., USA). Digestion was performed three times. Obtained suspension was inactivated with equal volume of EmbryoMax Dulbecco's modified Eagle's medium (DMEM; Millipore, Billerica, Mass., USA) supplemented with 10% fetal calf serum (FCS), 1% L-glutamine (Invitrogen), and penicillin/streptomycin (Invitrogen). Resulting fibroblasts were plated and grown to confluence in the same medium for two passages. Transduced MEFs were maintained in DMEM (Millipore) supplemented with pyruvate (Lonza, Basel, Switzerland) and L-glutamine (Invitrogen), nonessential amino acids (Mediatech, Herndon, Va., USA), 2-mercaptoethanol (Sigma-Aldrich, St. Louis, Mo., USA), 15% FCS (Invitrogen), and LIF (Millipore).
HIV Packaging PlasmidThe parental packaging plasmid pCMVR8.9129 was used to engineer modifications in the HIV-1 capsid region for increased vector transduction efficiency (Ikeda et al., J. Virol., 78(21):11816-11822 (2004) and Kootstra et al., Proc. Natl. Acad. Sci. USA, 100(3):1298-1303 (2003)). To generate HIV-1 packaging constructs carrying the capsid mutations, the ApaI, BglII, and SpeI sites in the uncoding region of pCMVR8.9129 were deleted (p8.9Ex). Naturally occurring capsid amino acid substitutions, which affect the HIV cyclophilin A (Cyp A) dependency, were introduced into the capsid region of the gag gene, resulting in pEx-HV, pEx-QI, and pEx-QV. Vesicular stomatitis virus glycoprotein G (VSV-G)-expressing plasmid, pMD.G (Zufferey et al., Nat. Biotechnol., 15(9):871-875 (1997)) was used for pseudotyping HIV-1 vector particles. Infectious HIV vectors were generated by packaging a green fluorescent protein (GFP)-carrying HIV vector genome with the modified constructs and VSV-G, and vector amounts were normalized by the levels of endogenous reverse transcriptase (RT) activity in vector particles. Human, simian, and murine cell lines were infected with various amounts of GFP-expressing vectors, and GFP-positive cell populations were analyzed using fluorescence-activated cell sorting (FACScan, BD Biosciences, Franklin Lake, N.J., USA) and automated quantification (CELL QUEST software; Becton Dickinson, Franklin Lake, N.J., USA). Vector infectivity in each target cell line was determined by infectious units per nanogram RT activity. For MEF transduction, GFP-carrying HIV vectors were generated with a conventional HIV packaging construct (p8.9Ex) or a packaging construct with the V83L, H87Q, and 191V capsid substitutions (pEx-QV). To determine transduction efficiencies, 5×104 MEFs were infected with increasing amounts of unconcentrated vectors overnight. The number of infected MEFs was determined by GFP-positive cells using FACScan.
HIV-Based Transfer VectorspSIN-CSGWdlNotI was generated by deleting one of the two NotI sites in the GFP-expressing HIV vector construct, pSIN-SEW (Demaison et al., Hum. Gene Ther., 13(7):803-813 (2002)), which allowed one-step cloning of genes of interest by BamHI and NotI. Transfer vectors were generated with full-length human Oct3/4, Sox2, Klf4, and c-Myc cDNAs (Open Biosystems, Huntsville, Ala., USA) amplified using the primer pairs Oct3/4 (5′-ATAGGATCCGCCACCATGGCGGGACACCTGGCTTCGGAT-3′ (SEQ ID NO:1) and 5′-ATAGCGGCCGCTCAGTTTGAATGCATGGGAGAGCC-3′ (SEQ ID NO:2), BamHI-NotI), Sox2 (5′-ATAGGATCCACCATGTACAACATGATGGAGACGGAGC-3′ (SEQ ID NO:3) and 5′-ATAGCGGCCGCTCACATGTGTGAGAGGGGCAGTGT-3′ (SEQ ID NO:4), BamHI-NotI), Klf4 (5′-GACGAATTCGGATCCACCATGAGGCAGCCACCTGGCGAGTCTG-3′ (SEQ ID NO:5) and 5′-GACCTCGAGCGGCCGCTTAAAAATGCCTCTTCATGTGTAAG-3′ (SEQ ID NO:6), BamHI-XhoI), and c-Myc (5′-GCCTGATCAAGGCTCTCCTTGCAGCTGCTTAGACG-3′ (SEQ ID NO:7) and 5′-ATAGCGGCCGCTTACGCACAAGAGTTCCGTAGCTG-3′ (SEQ ID NO:8), BclI-NotI) cloned into the pSIN-CSGWdlNotI, resulting in pSIN-Oct3/4, pSIN-Sox2, pSIN-Klf4, and pSIN-c-Myc. Human sternness-related factors were driven by a spleen focus-forming virus (SFFV) promoter. HIV vectors were produced by transient transfection of 293T cells using FuGene6 (Roche, Indianapolis, Ind., USA) with a weight ratio of 2:1:1 of vector to packaging to VSV-G plasmids (Ikeda et al., J. Virol., 78(21):11816-11822 (2004)). Transfected cells were washed and grown for 48 hours, and supernatants were harvested and passed through a 0.45-μm filter. Vector supernates (10 mL) were concentrated by ultracentrifugation (104 g, 2 hours at 4° C.), resuspended in 500 μL of serum-free media, aliquoted, and stored at −80° C. For reprogramming, vector titers were determined in MEFs by FACS for GFP-expressing vectors and by immunostaining for sternness factor-encoding vectors.
Western Blot293T/17 cells (CRL-11268; ATCC, Manassas, Va., USA) were maintained in DMEM (Invitrogen) supplemented with 10% FCS and antibiotics. Western blots were run on 12% SDS-PAGE gels and transferred to PVDF membranes using the semi-dry method. The membranes were then blocked overnight. Anti-Oct4 (no. 2750S) and anti-Sox2 (no. 2748S) antibodies (Cell Signaling, Boston, Mass., USA), anti-c-Myc antibody (Santa Cruz Biotechnology, Santa Cruz, Calif., USA), and anti-KLF4 (ab26648-25) antibody (Abeam, Cambridge, Mass., USA) were used to verify the expression of human sternness factors in vector-infected cells.
ImmunofluorescenceTo determine the expression levels, native and transduced MEFs were labeled with anti-Oct4, anti-Sox2, anti-c-Myc, and anti-KLF4 antibodies along with the FITC-conjugated donkey anti-mouse IgG secondary antibody for c-Myc (Jackson Immuno Research, West Grove, Pa., USA), and fluorescein isothiocyanate (FITC)-conjugated donkey anti-rabbit IgG for Oct3/4, Sox2, and Klf4 (Jackson Immuno Research). To determine reactivation of pluripotent markers, isolated cell lines were stained with anti-SSEA1 antibody (MAB4301; dilution 1:50; Chemicon International) and anti-Ki67 antibody (1:200; Neomarkers, Fremont, Calif., USA) along with secondary antibodies, goat anti-mouse Alexa Fluor 568 (1:250) and goat anti-rabbit Alexa Fluor 488 (1:250; Invitrogen), to visualize markers of undifferentiation. The nuclei were labeled with 4,6′-diamidino-2-phenylindole (DAPI; Invitrogen).
In Vitro DifferentiationTransduced cells were differentiated into three-layer embryoid bodies (EBs) using the hanging-drop method in differentiation media supplemented with 20% FCS without LIF (Behfar et al., FASEB J., 16(12):1558-1566 (2002); Perez-Terzic et al., Circ. Res., 92(4):444-452 (2003); and Behfar et al., J. Exp. Med., 204(2):405-420 (2007)). Briefly, 25-μL drops from a 25,000 cell/mL suspension were cultured on the lid of a plate for 48 hours. EBs were then flushed and kept in suspension for two days to allow spontaneous differentiation for a total of five days.
Detection of Gastrulation MarkersExpression of pluripotency and gastrulation markers was detected by RT-PCR. Total RNA was extracted with a combination of gDNA Eliminator and RNeasy columns (Qiagen, Valencia, Calif., USA). cDNA was prepared from total RNA samples using Superscript III First Strand (Invitrogen). Mouse GAPDH (4352932E; Applied Biosystems, Foster City, Calif., USA) was used as control. Analyzed genes included Fgf4 (Mm00438917_m1), Gsc (Mm00650681_g1), Sox17 (Mm00488363_m1), Pou5f1 (Mm00658129_gH), Zic1 (Mm01239008_mH), and Sox2 (Mm00488369_s1; Applied Biosystems).
Teratoma FormationNative and transduced fibroblasts were injected subcutaneously into the flank skin of anesthetized athymic nude mice at a dose of 500,000/50 μL medium. Tumor growth was monitored daily until the tissue was harvested. Tumors were processed by rapid freezing and cut by cryosections at 7-μm thickness to be stained with standard hematoxylin/eosin procedures.
Chimeric Blastocyst FormationIn vivo contribution of transduced cells to embryonic development was assessed through diploid aggregation with preimplantation morula. CD1 females at 3 weeks of age were superovulated using intraperitoneal injection of pregnant mare serum gonadotropin and human chorionic gonadotrophin, followed by pairing with adult CD1 males for timed pregnancy. Embryos at 2.5 days dpc were harvested, washed in EmbryoMax M2 medium (Millipore), and denuded from zona pelucida to produce morula competent for stem cell integration. After washing through M2 and EmbryoMax KSOM (Millipore) solutions, the embryos were plated as pairs in microwells to facilitate aggregation. Engineered stem cells were labeled for in vivo imaging by infection with a GFP-carrying HIV vector generated with a conventional HIV packaging construct (p8.9Ex). Labeled cells cultured for at least two passages after thawing were partially digested using trypsin 0.25%-EDTA (Invitrogen) and preplated for 45 minutes to allow attachment of feeders to the plate. Floating clumps (8-15 cells) were individually picked and washed in M2 medium and KSOM medium before being placed adjacent to the pair of embryos in microwells. The aggregation complex was incubated in a table-top incubator (Thermofisher, Waltham, Mass., USA) with continuous flow of a humidified gas mixture (5% CO2/5% O2/90% N2) for 24 hours until cavitation of the blastocysts (Nelson et al., Phil. Trans. R. Soc. B., 364(1514):269-276 (2008)).
In Utero OrganogenesisCD1 females in estrus were identified and paired with vasectomized studs two days prior to aggregation to produce pseudopregnant mice. Surrogate mothers were anesthetized (2-3% inhaled isofiurane), their uteruses were dissected through a minimal flank incision, and blastocyst-stage chimeric aggregates containing transduced cells were transferred into the distal portion of the uterus. Pregnancy was supported by pseudopregnant females until 9.5 dpc when embryos were harvested and analyzed for transduced cell distribution using an LSM 510 laser scanning confocal microscope (Carl Zeiss, Oberkochen, Germany).
Results Engineered HIV Vector Packaging Constructs for Improved Transduction Efficiency Across SpeciesEfficient HIV infection requires Cyp A in target human cells, with sequence variations in the Cyp A-binding loop of the capsid protein affecting viral infectivity. Capsid mutations were used here to improve infectivity of HIV-based vectors across species in order to test human stemness-related factors in nonhuman cell types (
Human sequences were used to generate reprogramming vector sets to be tested in evolutionary distant somatic cell types. Gene sequences demonstrated a high degree of conservation, with the lowest percentage of homologies noted between Oct3/4 orthologs at 84%. This degree of homology is similar to the sequence for LIF, which does not conserve maintenance of pluripotency in human (Daheron et al., Stem Cells., 22(5):770-778 (2004)) as required for mouse stem cells (
To determine whether human stemness-related factors can reprogram mouse somatic cells, ectopic gene expression was achieved in MEFs. A GFP-expressing vector was infected into MEFs at a multiplicity of infection (MOI) of 20 as the control to determine any spontaneous cellular changes (
To identify the diversity of lineage differentiation, gene expression analysis was performed according to protocols established for embryonic stem cells (Behfar et al., J. Exp. Med., 204(2):405-420 (2007); Faustino et al., Genome Biol., 9:R6 (2008); and Nelson et al., Stem Cells., 26(6):1464-1473 (2008)). Parental MEFs provided the baseline for gene expression comparison. Following viral transduction, derived progenitors were differentiated in three-dimensional cultures to allow spontaneous germ layer formation. Sequential differentiation produced EBs at day 5 with dense compaction of cells within a sphere of tissue (
Pluripotent cells form spontaneous teratomas following transplantation into immunodeficient mice, an established assay to demonstrate multilineage developmental capacity. Here, immunodeficient mice were subcutaneously injected with native MEFs or transduced counterparts. Only transduced cells gave rise to tumors, following injection at a dose of 500,000 cells, that enlarged to 1 cm in diameter within 4 weeks, in contrast to undetectable growth for native MEFs injected on the contralateral side (
Contribution of Transduced Progeny into Ex Utero Blastocysts
A hallmark characteristic of pluripotent stem cells is the ability to incorporate into 8-cell embryos and form morula capable of developing into chimera blastocysts (Wood et al., Nature, 365(6441):87-89 (1993)). Primitive stem cell populations engraft within host 8-cell embryos to form mosaic blastocysts, but are universally excluded upon the loss of functional pluripotency Stewart, J. Embryol. Exp. Morphol., 58:289-302 (1980) and Fujii and Martin, Dev. Biol., 74(1): 239-244 (1980)) despite persistent expression of stem cell markers (Nagy et al., Development, 110(3):815-821 (1990)). In order to determine the ability of reprogrammed MEFs to incorporate into early-stage morula, the cells were lentivirally labeled with GFP, expanded in vitro, and prepared for diploid aggregation with unlabeled embryos (
High-Fidelity Organogenesis from Transduced Progeny
Beyond ex vivo characterization, chimeric embryos establish in situ competency of transduced progeny during natural embryogenesis. Pluripotent stem cells contain the capacity to give rise to all lineages of the developing embryo upon blastocyst integration in a stochastic pattern, depending on the location of blastomere integration during early stage of preimplantation development (Nagy et al., Development, 110(3):815-821 (1990)). Mosaic embryos produced by diploid aggregation using GFP-labeled progenitors were transferred to the uterus of a pseudopregnant surrogate for in utero implantation and differentiation. Chimeric embryos were harvested at 9.5 dpc and analyzed for engraftment and differentiation of nonnative progeny. Embryos that demonstrated normal morphology and appropriate developmental stages of organogenesis were visualized for GFP expression. Transduced progenitors were identified throughout the embryo in multiple developing organs that included central nervous tissue (
Induced pluripotent stem (iPS) cells represent the newest platform for gene and cell therapy. HIV-1 vectors carrying human pluripotency genes, OCT3/4, SOX2, KLF4 and c-MYC, were used to reprogram primary human fibroblasts and keratinocytes into iPS cells. The resulting iPS cell clones were positive for human embryonic stem (ES) cell markers (alkaline phosphatase, SSEA4, TRA-1-60, and TRA-1-81) and expressed other pluripotency-related genes, such as hTERT, Nanog, and GDF3. Use of human feeder cells and serum-free media allowed for the generation of xeno-free human iPS cells. To determine whether human stemness-related factors can reprogram mouse somatic cells, murine fibroblast cells were infected with these HIV-1 vectors. Despite the variations in primary amino acid sequences between human and mouse factors, expression of human OCT3/4, SOX2, KLF4, and c-MYC efficiently reprogrammed mouse cells into iPS cells. The resulting iPS cells expressed stem cell markers, differentiated in vitro into all three germ layers according to gastrulation gene expression profiles, and formed in vivo teratoma with multilineage potential. Moreover, the iPS cells were incorporated into a mouse morula to produce blastomeres capable of developing into chimeric embryos with competent organogenesis. The interspecies nuclear reprogramming suggests the evolutionary conserved process of induced pluripotency. This system was applied to generate iPS cells from a factor VIII (FVIII) knockout mouse for hemophilia A gene and cell therapy applications. The tail fibroblast-derived iPS cells exhibited ES-like phenotypes and could be differentiated into beating cardiomyocytes. Since liver sinusoidal endothelial cells produce FVIII in vivo, different in vitro endothelial differentiation protocols using wildtype and FVIII knockout iPS cells can be examined.
Example 10 iPS Programmed without c-MYC Yield Proficient Cardiogenesis for Functional Heart Chimerism Fibroblast TransductionMouse embryonic fibroblasts (MEF), plated in Dulbecco's modified Eagle's medium with 10% FCS, 1% L-glutamine and penicillin/streptomycin (Invitrogen) at 105 per 24-well plate, were infected for 12 hours with full-length human OCT3/4, SOX2 and KLF4 cDNAs (Open Biosystems) using a lentivirus system. The rationale for using human genes for reprogramming was to determine whether human cDNA is phylogenetically conserved to produce iPS with cardiogenic potential. MEF were maintained in Dulbecco's modified Eagle's medium supplemented with pyruvate (Lonza) and L-glutamine, non-essential amino acids (Mediatech), 2-mercaptoethanol (Sigma-Aldrich), 15% FCS and LIF (Millipore). Within three weeks, iPS clones were isolated and labeled with LacZ and luciferase using pLenti6/UbC/V5-GW/LacZ (Invitrogen) and a pSIN-Luc luciferase-expressing vector. Vector integration was PCR confirmed from genomic DNA (Sigma-Aldrich, XNAT2) using primers for OCT4-R AGCCGCCTTGGGGCACTAGCCC (SEQ ID NO:9), KLF4-R CGCAAGCCGCACCGGCTCCGCC (SEQ ID NO:10), SOX2-R AGCCTCGTCGATGAACGGCCGC (SEQ ID NO:11), and SFFVprom-F CTCACTCGGCGCGCCAGTCCTC (SEQ ID NO:12). PCR products were resolved on 1% agarose gel electrophoresis.
Cell Sorting and Electron MicroscopyLacZ labeled clonal populations were trypsinized, incubated with Fluorescein di[β-D-galactopyranoside] (Sigma-Aldrich, F2756), and sorted using a FACS Aria SE flow cytometer (BD Biosciences). On fixation with 1% glutaraldehyde and 4% formaldehyde in 0.1 M phosphate buffered saline (pH 7.2), cells were examined on a Hitachi 4700 field emission scanning microscope. For ultrastructural evaluation, fixed cells were ultramicrotome cut, and stained with lead citrate prior to examination on a JEOL 1200 EXII electron microscope.
Immunostaining and Confocal MicroscopyCells were stained with anti-SSEA1 antibody (MAB4301; dilution 1:50; Millipore) along with secondary goat anti-mouse IgG Alexa Fluor 568 (Sigma A11031; 1:250) or alkaline phosphatase detection kit (Millipore, SCR004). Immunostaining of derivatives was performed using monoclonal mouse anti-alpha-actinin (Sigma A7811, 1:200), rabbit anti-connexin 43 (Zymed 483000, 1:200), rabbit anti-Mef2c (proteintech 10056-1-AP, 1:50), monoclonal mouse anti-myosin light chain 2a (MLC2a, Synaptic Systems 311011, 1:250), and anti-cardiac troponin I (Abcam 47003, 1:500). Secondary antibodies (Invitrogen) were used at a 1:250 dilution (i.e., goat anti-mouse IgG Alexa Fluor 568, donkey anti-mouse IgG Alexa Fluor 488, and goat anti-rabbit IgG Alexa Fluor 488). Nuclei were labeled with 4,6′-diamidino-2-phenylindole (DAPI; Invitrogen). Images were taken using laser confocal microscopy (Zeiss LSM 510 Axiovert). For LacZ staining, samples were fixed with 0.25% gluteraldehyde for 15 minutes at room temperature prior to β-galactosidase staining.
In Vivo and In Vitro DifferentiationTransduced fibroblasts were injected subcutaneously into the flank skin of anesthetized athymic nude mice or immunocompetent C57BL/6 strain of mice at 500,000/50 μL medium. Local growth was monitored daily until tissue was harvested and processed by rapid freezing and cryosectioned for hematoxylin/eosin procedures. Separately, iPS were differentiated into three-layer embryoid bodies (EB) using the hanging-drop method. Digital serial images were analyzed with Metamorph (Visitron Universal Imaging).
Gene ExpressionExpression of pluripotent, gastrulation, and cardiac markers was detected by RT-PCR. Mouse Gapdh (4352932E; Applied Biosystems) was used as control. Analyzed genes included Sox2 (Mm00488369_s1), Oct4 (Mm00658129_gH), Fgf4 (Mm00438917_m1), Gsc (Mm00650681_g1), Sox17 (Mm00488363_m1), Mesp2 (Mm00655937_m1), Tbx5 (Mm00803521_m1), Nkx2.5 (Mm00657783_m1), and Mef2c (Mm01340839_m1; Applied Biosystems).
Patch Clamp and Calcium ImagingDerived cardiomyocytes, enriched by dual interface Percoll gradient (Invitrogen) (Hodgson et al., Am. J. Physiol. Heart Circ. Physiol., 287:H471-479 (2004)), were plated on laminin coated coverglass for >24 hours. Membrane electrical activity was determined by patch-clamp recording in the whole cell configuration using current- or voltage-clamp mode (Axopatch 1C, Axon Instruments). Action potential profiles and voltage-current relations were acquired and analyzed with the Bioquest software. Cells were superfused with Tyrode solution containing (in mM) 137 NaCl, 5.4 KCl, 2 CaCl2, 1 MgCl2, 10 HEPES, and 10 glucose (with pH adjusted to 7.3 with NaOH) or calcium-free Tyrode in which CaCl2 was replaced by EGTA 5 mM. Patch pipettes (5-10 MΩ) containing (in mM) 140 KCl, 1 MgCl2, 10 HEPES, 5 EGTA, and supplemented with 5 mM ATP (with pH adjusted to 7.3 with KOH) were used for electrophysiological measurements performed at 34±1° C. set by a Peltier thermocouple temperature controller. To assess intracellular Ca2+ dynamics, cells were loaded with the Ca2+-fluorescent probe Fluo 4-AM (Invitrogen), imaged with a Zeiss LSM live 5 laser confocal microscope, and analyzed using LSM software.
Chimeric Blastocyst Formation and In Utero OrganogenesisCD1 embryos were harvested at 2.5 days post coitum (dpc) and plated as pairs in microwells for diploid aggregation. LacZ-labelled cells cultured for at least two passages after thawing were partially digested using trypsin 0.25%-EDTA and pre-plated for 45 minutes to allow attachment of feeders. Floating clumps (8-15 cells) were co-incubated with embryo pairs in microwells. The aggregation complex was incubated for 24 hours until cavitation of blastocysts. Surrogate mothers were anesthetized (2-3% inhaled isoflurane), uterus dissected through a minimal flank incision, and blastocyst-stage chimeric aggregates transferred into the uterus. Pseudopregnant females supported pregnancy until days 8.0-9.5 dpc, when embryos were harvested and analyzed for LacZ-labelled progenitors using a ProgRes C3 camera-equipped Zeiss stereo Discovery V20 microscope. Embryos were fixed with 0.25% gluteraldehyde for 15 minutes at room temperature prior to β-galactosidase staining.
Molecular ImagingLuciferase-transfected iPS were cultured for multiple passages including a freeze/thaw cycle prior to expansion and transplantation into recipients. Cells were tracked with the IVIS 200 Bioluminescence Imaging System (Xenogen) following intra-peritoneal injection of 150 mg/kg D-luciferin (Xenogen), and signals analyzed with the Living Image Software (Xenogen).
Electrocardiography and EchocardiographyIn age-matched control and iPS-chimera mice under anesthesia (1.5% isoflurane), heart rate and rhythm were measured using 4-limb lead electrocardiography (MP150, Biopac). Cardiac structure and left ventricular contractility were quantified by trans-thoracic echocardiography using a 30 MHz MS400 transducer (Vevo2100, Visual Sonics).
StatisticsData were presented as mean±SEM. Student's t test was used to evaluate significance of PCR data. Wilcoxon test was used to evaluate physiological parameters between chimeric and non-chimeric cohorts. A p value<0.05 was predetermined.
ResultsPhylogenetically Conserved Nuclear Reprogramming with Human Stemness Factor Independent of c-MYC
MEFs grown in monolayers demonstrated contact inhibition upon culture confluency. Elongated flat cells typical of fibroblasts provided a homogenous population of starting somatic tissue (
Three Factor iPS-Derived Embryoid Bodies Unmask Reproducible Cardiogenic Potential
Distinct 3F-iPS clones consistently yielded clusters of undifferentiated cells capable of generating embryoid spheroids at day 5 following a hanging-drop protocol, and differentiated in three-dimensional cultures throughout a 12-day period (
Functional Cardiogenesis Derived from 3F-iPS
iPS differentiating within embryoid bodies (EB) were examined daily to quantify the percentage of EB that acquired cardiac phenotype tracked by spontaneous beating activity. Independent clones derived by three-factor reprogramming revealed consistent progression of beating activity as early as seven days following progeny differentiation (
Non-coerced diploid aggregation at the morula stage allows competent pluripotent stem cells to assimilate within a developing embryo and contribute to chimeric organogenesis. 3F-iPS labeled with LacZ and luciferase expression cassettes were clonally expanded and allowed aggregation with two, 8-cell morula embryos (
In one experiment, the beating activity observed in iPS reprogrammed with four factors (SOX2, OCT4, KLF4, and cMYC; n=2) was compared to the beating activity observed in iPS reprogrammed with three factors (SOX2, OCT4, and KLF4; n=2) and in an embryonic stem cell line (ESC) during day 7 to 11 of differentiation. The three factor iPS exhibited a similar trend as reference ESC (
In summary, these results demonstrate that transgenic expression of three human sternness factors, SOX2, OCT4, and KLF4, can reset fibroblasts (e.g., murine fibroblasts) to the pluripotent ground state. Transduction without c-MYC reversed cellular ultrastructure into a primitive archetype and induced stem cell markers generating three-germ layers, all qualifiers of acquired pluripotency. Three-factor induced iPS (3F-iPS) clones reproducibly demonstrated cardiac differentiation properties characterized by vigorous beating activity of embryoid bodies and robust expression of cardiac Mef2c, alpha-actinin, connexin 43, MLC2a, and troponin I. In vitro isolated iPS-derived cardiomyocytes demonstrated functional excitation-contraction coupling. Chimerism with 3F-iPS derived by morula-stage diploid aggregation was sustained during prenatal heart organogenesis, and contributed in vivo to normal cardiac structure and overall performance in adult tumor-free offspring. Thus, 3F-iPS bioengineered without c-MYC achieve highest stringency criteria for bona fide cardiogenesis enabling reprogrammed fibroblasts to yield de novo heart tissue compatible with native counterpart throughout embryologic development and into adulthood.
Other EmbodimentsIt is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
1. A population of cardiomyocytes derived from induced pluripotent stem cells, wherein said induced pluripotent stem cells were obtained using a human Oct3/4 polypeptide, a human Sox family polypeptide, and a human Klf family polypeptide or nucleic acid encoding said human Oct3/4 polypeptide, said human Sox family polypeptide, and said human Klf family polypeptide, wherein the origin of said induced pluripotent stem cell is human, and wherein said induced pluripotent stem cells were not contacted with an exogenous human cMyc polypeptide.
2. The population of cardiomyocytes of claim 1, wherein said induced pluripotent stem cell was induced from a human somatic cell.
3. The population of cardiomyocytes of claim 2, wherein said human somatic cell is selected from the group consisting skin, lung, heart, stomach, brain, liver, blood, kidney, and muscle cells.
4. The induced pluripotent stem cell of claim 1, wherein said human Sox family polypeptide is a Sox2 polypeptide.
5. The population of cardiomyocytes of claim 1, wherein said human Klf family polypeptide is a Klf4 polypeptide.
6. The population of cardiomyocytes of claim 1, wherein said induced pluripotent stem cell comprising nucleic acid encoding said human Oct3/4 polypeptide, a human Sox2 polypeptide, and a human Klf4 polypeptide.
Type: Application
Filed: Jul 2, 2018
Publication Date: Nov 8, 2018
Applicant: Mayo Foundation for Medical Education and Research (Rochester, MN)
Inventors: Yasuhiro Ikeda (Rochester, MN), Andre Terzic (Rochester, MN), Timothy J. Nelson (Rochester, MN), Amber A. Mael (Madison, WI), Almudena J. Martinez Fernandez (Rochester, MN), Satsuki Yamada (Rochester, MN)
Application Number: 16/025,693