CONTROL OF NITROGEN FIXATION IN RHIZOBIA THAT ASSOCIATE WITH CEREALS
Disclosed herein are engineered rhizobia having nif clusters that enable the fixation of nitrogen under free-living conditions, as well as ammonium and oxygen tolerant nitrogen fixation under free-living conditions. Also provided are methods for producing nitrogen for consumption by a cereal crop using these engineered rhizobia.
Latest Massachusetts Institute of Technology Patents:
- Partitioned superconducting cable
- Highly sensitive acoustic fabric including an acoustic fiber transducer
- Terahertz beam steering antenna arrays
- Systems and methods for relative damping of antennas for sensing and tuning in the frequency domain
- Multi-targeted, tunable, sustained delivery of payloads to charged avascular tissues
This application is a national stage filing under 35 U.S.C. § 371 of International Patent Application Number PCT/US2020/023646, filed Mar. 19, 2020, which claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Application Ser. No. 62/820,765, filed Mar. 19, 2019 and under 35 U.S.C. § 120 of U.S. application Ser. No. 16/746,215, filed on Jan. 17, 2020, the entire contents of each of which are incorporated by reference herein.
GOVERNMENT SUPPORTThis invention was made with Government support under Grant No. IOS1331098 awarded by the National Science Foundation (NSF). The government has certain rights in this invention.
BACKGROUND OF THE INVENTIONIn agriculture, nitrogen is a limiting nutrient that needs to be added as fertilizer to those crops that cannot produce it on their own, including the cereals rice, corn, and wheat. In contrast, legumes are able to obtain nitrogen from the atmosphere using nitrogen-fixing bacteria that reside in root nodules. However, the majority of the world's calories are from cereals; thus, it has been a longstanding problem in genetic engineering to transfer this ability to these crops. This would reduce the need for nitrogenous fertilizer and the economic, environmental, and energy burdens that it brings.
SUMMARY OF THE INVENTIONThe present disclosure is based, at least in part, rhizobia and methods for making rhizobia that can fix nitrogen under aerobic free-living conditions. The present disclosure also provides refactored nif-clusters that confer the ability to fix nitrogen under aerobic free-living conditions.
Accordingly, one aspect of the present disclosure provides a rhizobium that can fix nitrogen under aerobic free-living conditions, comprising a symbiotic rhizobium having an exogenous nif cluster, wherein the exogenous nif cluster confers nitrogen fixation capability on the symbiotic rhizobium under aerobic free-living conditions, and wherein the rhizobium is not Azorhizobium caulinodans. In some embodiments, the exogenous nif cluster is from a free-living diazotroph. In some embodiments, the exogenous nif cluster is from a symbiotic diazotroph. In some embodiments, the exogenous nif cluster is from a photosynthetic Alphaproteobacteria. In some embodiments, the exogenous nif cluster is from a Gammaproteobacteria. In some embodiments, the exogenous nif cluster is from a cyanobacteria. In some embodiments, the exogenous nif cluster is from a firmicutes. In some embodiments, the exogenous nif cluster is from Rhodobacter sphaeroides. In some embodiments, the exogenous nif cluster is from Rhodopseudomonas palustris. In some embodiments, the exogenous nif cluster is an inducible refactored nif cluster. In some embodiments, the inducible refactored nif cluster is an inducible refactored Klebsiella nif cluster. In some embodiments, the rhizobium is IRBG74. In some embodiments, the exogenous nif cluster comprises 6 nif genes. In some embodiments, the 6 nif genes are nifHDK(T)Y, nifEN(X), nifJ, nifBQ, nifF, and nifUSVWZM. In some embodiments, each nif gene of the exogenous nif cluster is preceded by a T7 promoter. In some embodiments, the T7 promoter is a wild-type promoter. In some embodiments, the rhizobium further comprises an endogenous nif cluster. In some embodiments, the nif cluster has a nifV gene. In some embodiments, the nifV gene is endogenous. In some embodiments, the exogenous nif cluster further comprises a terminator. In some embodiments, the T7 promoter has a terminator and the terminator is downstream from the T7 promoter. In some embodiments, the exogenous nif cluster is a refactored v3.2 nif cluster as shown in
Another aspect of the present disclosure provides a plant growth promoting bacterium that can fix nitrogen under aerobic free-living conditions, comprising a bacterium having an exogenous nif cluster having at least one inducible promoter, wherein the exogenous nif cluster confers nitrogen fixation capability on the bacterium, under aerobic free-living conditions, and wherein the bacterium is not Azorhizobium caulinodans. In some embodiments, the bacterium is a symbiotic bacterium. In some embodiments, the bacterium is an endophyte. In some embodiments, the endophyte is rhizobium IRBG74. In some embodiments, the bacterium is an epiphyte. In some embodiments, the epiphyte is Pseudomonas protogens PF-5. In some embodiments, the plant growth promoting bacterium is associated with a genetically modified cereal plant. In some embodiments, the genetically modified cereal plant includes an exogenous gene encoding a chemical signal. In some embodiments, the nitrogen fixation is under the control of the chemical signal. In some embodiments, the chemical signal is an opine (e.g., octopine, nopaine, or mannopine), phlorogluconol or rhizopene. In some embodiments, the exogenous nif cluster comprises 6 nif genes. In some embodiments, the 6 nif genes are nifHDK(T)Y, nifEN(X), nifJ, nifBQ, nifF, and nifUSVWZM. In some embodiments, the inducible promoter is a T7 promoter. In some embodiments, the inducible promoter is PA1lacO1 promoter. In some embodiments, the inducible promoter is activated by an agent selected from a group that includes IPTG, sodium salicylate, octapine, nopaline, the quorum signal 3OC6HSL, aTc, cuminic acid, DAPG, and salicylic acid. In some embodiments, the exogenous nif cluster further comprises a terminator. In some embodiments, the inducible promoter has a terminator and the terminator is downstream from the inducible promoter.
Another aspect of the present disclosure provides an Azorhizobium caulinodans capable of inducible ammonium-independent nitrogen fixation in a cereal crop, comprising: (i) a modified nif cluster, wherein an endogenous nifA gene is deleted or altered; and (ii) at least one operon comprising nifA and RNA polymerase sigma factor (RpoN), wherein the operon comprises a regulatory element including an inducible promoter. In some embodiments, the inducible promoter is PA1lacO1 promotor. In some embodiments, the inducible promoter is activated by an agent selected from the group consisting of IPTG, sodium salicylate, octapine, nopaline, the quorum signal 3OC6HSL, aTc, cuminic acid, DAPG, and salicylic acid. In some embodiments, the endogenous nifA gene is altered with at least one of the following substitutions: (i) L94Q, (ii) D95Q, and (iii) both L94Q and D95Q.
Another aspect of the present disclosure provides a method of engineering a rhizobium that can fix nitrogen under aerobic free-living conditions, comprising transferring an exogenous nif cluster to a symbiotic rhizobium, wherein the exogenous nif cluster confers nitrogen fixation capability on the symbiotic rhizobium, under aerobic free-living conditions, and wherein the rhizobium is not Azorhizobium caulinodans. In some embodiments, the exogenous nif cluster comprises 6 nif genes. In some embodiments, the 6 nif genes are nifHDK(T)Y, nifEN(X), nifJ, nifF and nifUSVWZM. In some embodiments, each of the nif genes is preceded by a wild-type T7 promoter. In some embodiments, the exogenous nif cluster is transferred to the rhizobium in a plasmid. In some embodiments, the exogenous nif cluster further comprises a terminator. In some embodiments, the wild-type T7 promoter has a terminator, and the terminator is downstream from the wild-type T7 promoter. In some embodiments, the endogenous NifL gene is deleted.
Another aspect of the present disclosure provides a method of producing nitrogen for consumption by a cereal plant, comprising providing a plant growth promoting bacterium that can fix nitrogen under aerobic free-living conditions in proximity of the cereal plant, wherein the plant growth promoting bacterium is a symbiotic bacterium having an exogenous nif cluster, wherein the exogenous nif cluster confers nitrogen fixation capability on the symbiotic bacterium, enabling nitrogen fixation under aerobic free-living conditions. In some embodiments, the plant growth promoting bacterium is a rhizobium. In some embodiments, the plant growth bacterium is a bacterium as described in the present disclosure. In some embodiments, the cereal plant is a genetically modified cereal plant. In some embodiments, the genetically modified cereal plant includes an exogenous gene encoding a chemical signal. In some embodiments, the nitrogen fixation is under the control of the chemical signal. In some embodiments, the chemical signal is opine, phlorogluconol or rhizopene. In some embodiments, the nitrogen fixation is under the control of a chemical signal. In some embodiments, the chemical signal is a root exudate, biocontrol agent or phytohormone. In some embodiments, the root exudate is selected from the group consisting of sugars, hormones, flavonoids, and antimicrobials. In some embodiments, the chemical signal is vanillate. In some embodiments, the chemical signal is IPTG, aTc, cuminic acid, DAPG, and salicylic acid, 3,4-dihydroxybenzoic acid, 3OC6HSL or 3OC14HSL.
In one aspect, the disclosure also provides a genetically engineered plant that can produce orthogonal carbon sources, such as opines or less common sugars, and bacteria with the corresponding catabolism pathways, which can respond to these signals.
In one aspect, the present disclosure provides a method for making a nitrogen-fixing bacterium, the method comprising a) identifying a host bacterium; b) selecting a donor bacterium having a nif cluster based on evolutionary distance between the host bacterium and the donor bacterium; and c) inserting the nif cluster of the donor bacterium to the host bacterium, thereby making a nitrogen-fixing bacterium. In some embodiments, the evolutionary distance between the host bacterium and the donor bacterium is less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1% substitutions per site in 16S ribosomal RNA gene sequence. In some embodiments, the host bacterium and the donor bacterium are in the same genus, family, order, or class. In some embodiments, the donor bacterium is selected from Klebsiella, Pseudomonas, Azotobacter, Gluconacetobacter, Azospirillum, Azorhizobium, Rhodopseudomonas, Rhodobacter, Cyanothece, or Paenibacillus genus. In some embodiments, the host bacterium is selected from the group consisting of E. coli, Pseudomonas protegens Pf-5, and Rhizobium IRBG74. In some embodiments, the donor bacterium is selected from the group consisting of K. oxytoca, P. stutzeri, A. vinelandii, G. diazotrophicus, A. brasilense, A. caulinodans, R. palustris, R. sphaeroides, Cyanothece, and Paenibacillus. In some embodiments, the host bacterium is E. coli and the donor bacterium is K. oxytoca. In some embodiments, the host bacterium is Pseudomonas protegens Pf-5, and the donor bacterium is P. stutzeri. In some embodiments, the host bacterium is Rhizobium IRBG74, and the donor bacterium is R. sphaeroides. In some embodiments, the host bacterium is a nonsymbiotic bacterium, e.g., Azotobacter, Beijerinckia, or Clostridium bacterium. In some embodiments, the host bacterium is a symbiotic bacterium, e.g., Rhizobium, Frankia, or Azospirillum bacterium. In some embodiments, the host bacterium is symbiotic with a leguminous plant, an actinorhizal plant, or a cereal crop. In some embodiments, the inserted nif cluster is under inducible control.
In one aspect, the present disclosure provides a method of selecting a nif cluster of a donor bacterium that is compatible with a host bacterium, the method comprising a) performing a phylogenetic analysis for the donor bacterium and the host bacterium; b) determining evolutionary distance based on the phylogenetic analysis between the donor bacterium and the host bacterium is less than a reference value; and c) selecting the nif cluster of the donor bacterium for the host bacterium. In some embodiments, the phylogenetic analysis is performed by using distance-matrix, maximum parsimony, maximum likelihood, or Bayesian inference. In some embodiments, the phylogenetic analysis is performed by analyzing ribosomal RNA (e.g., 16s rRNA) substitution rate. In some embodiments, the reference value is 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1% substitutions per site in 16S ribosomal RNA gene sequence. In some embodiments, the reference value is 500, 400, 300, 200, 100, 50, or 10 million years. In some embodiments, the method further comprises inserting the nif cluster to the host bacterium and evaluating the nitrogen fixation activity. In some embodiments, the nif cluster is under inducible control.
In one aspect, the present disclosure provides a bacterium comprising a nif cluster, where the nif cluster is under control of an exogenous control genetic element. In some embodiments, the nif cluster is an endogenous or exogenous nif cluster. In some embodiments, the exogenous control genetic element initiates promoter activities in response to an inducer (e.g., a chemical signal). In some embodiments, the promoter activities are measured by the below equation:
where m(i) is number of transcripts at each position i from the FPKM normalized transcriptomic profiles, γ=0.0067 s−1 is the degradation rate of mRNA and n is the window length before and after xtss. In some embodiments, the inducer is delivered to the bacterium by chemical delivery or biocontrol delivery. In some embodiments, the inducer is a chemical signal in seeds (e.g., cuminic acid), a native root exudate (e.g., arabinose, salicylic acid, vanillic acid, or narigenin), a chemical signal from a bacterium (e.g., 3OC6HSL, 3OC14HSL, DHBA, or DAPG), or a chemical signal from a genetically modified plant (e.g., Nopaline or Octopine).
The details of one or more embodiments of the invention are set forth in the description below. Other features or advantages of the present invention will be apparent from the following drawings and detailed description of several embodiments, and also from the appended claims.
The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. For purposes of clarity, not every component may be labeled in every drawing. It is to be understood that the data illustrated in the drawings in no way limit the scope of the disclosure. In the drawings:
Nitrogen fixation in the root nodules of leguminous plants is a major contributor to world food production and therefore, the practical applications of this field are of major interest. Legumes obtain nitrogen from air through bacteria residing in root nodules, some species of which also associate with cereals but do not fix nitrogen under these conditions. Disabling native regulation can turn on expression, even in the presence of nitrogenous fertilizer and low O2, but continuous nitrogenase production confers an energetic burden.
The present disclosure in some aspects describes the surprising discovery that bacteria can be genetically altered in a manner that will enable the bacteria to deliver fixed nitrogen to cereal crops. Several strategies to implement control over nitrogen fixation in bacteria that live on or inside the roots of cereals are described. At least two approaches can be taken. In one embodiment, the native regulation is replaced. In alternative embodiments, a nif cluster is transferred from another species and placed under inducible control. The Examples section below includes a description of the achievement of these two approaches in multiple species with multiple constructs. For example, A. caulinodans, ammonium-independent control can be achieved using a sensor to drive the co-expression of a NifA mutant and RpoN in a ΔnifA strain. Rhizobium sp. IRBG74 can be engineered to express functional nitrogenase under free living conditions either by transferring a native nif cluster from Rhodobacter or a refactored cluster from Klebsiella. Multiple approaches enable P. protegens Pf-5 to express functional nitrogenase, of which the transfer of the nif cluster from Azotobacter vinelandii DJ yields the highest activity and O2 tolerance.
To date, it has not been shown that a Rhizobium strain can be engineered to fix nitrogen under free-living conditions when it does not do so naturally. Some Rhizobia isolated from legume root nodules are also cereal endophytes, however most are unable to fix nitrogen under free-living conditions (outside of the nodule) (Ramachandran, V. K., East, A. K., Karunakaran, R., Downie, J. A. & Poole, P. S. Adaptation of Rhizobium leguminosarum to pea, alfalfa and sugar beet rhizospheres investigated by comparative transcriptomics. Genome biology 12, R106 (2011); Frans, J. et al. in Nitrogen Fixation 33-44 (Springer, 1990)). There have been reports of cereal yield improvements due to these bacteria, including a 20% increase for rice by Rhizobium sp. IRBG74, but this is likely due to other growth-promoting mechanisms, such as improved nutrient uptake or root formation (Ramachandran, V. K., East, A. K., Karunakaran, R., Downie, J. A. & Poole, P. S. Adaptation of Rhizobium leguminosarum to pea, alfalfa and sugar beet rhizospheres investigated by comparative transcriptomics. Genome biology 12, R106 (2011); Delmotte, N. et al. An integrated proteomics and transcriptomics reference data set provides new insights into the Bradyrhizobium japonicum bacteroid metabolism in soybean root nodules. Proteomics 10, 1391-1400 (2010); Hoover, T. R., Imperial, J., Ludden, P. W. & Shah, V. K. Homocitrate is a component of the iron-molybdenum cofactor of nitrogenase. Biochemistry 28, 2768-2771 (1989)). Azorhizobium caulinodans ORS571 is exceptional because it is able to fix nitrogen in both aerobic free-living and symbiotic states, has been shown to be a rice and wheat endophyte, and does not rely on plant metabolites to produce functional nitrogenase. However, when Rhizobia or Azorhizobium species are living in cereal roots, there is low nitrogenase expression and 15N2 transfer rates suggest any reported uptake is due to bacterial death.
Cereal Crops, Nitrogen Fixation, and BacteriaCereal crops are broadly defined as any grass cultivated for the edible components of its grain (also referred to as caryopsis), composed of the endosperm, germ, and bran. Cereal crops are considered staple crops in many parts of the world. They are grown in greater quantities and provide more food energy worldwide than any other type of crop. Non-limiting examples of cereal crops include maize, rye, barley, wheat, sorghum, oats, millet and rice. As used herein, the terms “cereal crop” and “cereal plant” are used interchangeably.
Nitrogen fixation is the process by which atmospheric nitrogen is assimilated into organic compounds as part of the nitrogen cycle. The fixation of atmospheric nitrogen associated with specific legumes is the result of a highly specific symbiotic relationship with rhizobial bacteria. These indigenous bacteria dwell in the soil and are responsible for the formation of nodules in the roots of leguminous plants as sites for the nitrogen fixation. Most Rhizobium symbioses are confined to leguminous plants. Furthermore, Rhizobium strains which fix nitrogen in association with the agriculturally-important temperate legumes are usually restricted in their host range to a single legume genus.
The nif genes are genes encoding enzymes involved in the fixation of atmospheric nitrogen into a form of nitrogen available to living organisms. The primary enzyme encoded by the nif genes is the nitrogenase complex which converts atmospheric nitrogen (N2) to other nitrogen forms (e.g. ammonia) which the organism can process. As used herein, the term “nif cluster” refers to a gene cluster comprising nif genes. As used herein, the term “refactored” refers to an engineered gene cluster, i.e. its genes have reordered, deleted or altered in some way.
Rhizobia are diazotrophic bacteria. In general, they are gram negative, motile, non-sporulating rods. In terms of taxonomy, they fall into two classes: alphaproteobacteria and betaproteobacteria. Non-limiting examples of rhizobia include Azorhizobium caulinodans, Rhizobium(R.) sp. IRBG74, R. radiobacter, R. rhizogenes, R. rubi, R. vitis, Alfalfa Rhizobia (R. meliloti), Chickpea Rhizobia (Rhizobium sp.), Soybean Rhizobia (Bradyrhizobium japonicum), Leucaena Rhizobia (Rhizobium sp.), R. leguminosarum by trifolii, R. leguminosarum by phaseoli, and Rhizobium leguminosarum by viciae (see for example U.S. Pat. No. 7,888,552, herein incorporated by reference). In some embodiments, the rhizobia of the present invention are Azorhizobium caulinodans. In some embodiments, the rhizobia of the present invention are not Azorhizobium caulinodans.
As used herein, the term “free-living conditions” refers to a bacterium (e.g. rhizobium) that is not within a leguminous root nodule. It generally refers to something that has not formed a parasitic (or dependent) relationship with another organism or is not on a substrate. As used herein, the term “symbiotic” refers to the interaction between two organisms living in close proximity. Close proximity can be about 0.2 μm, 0.4 μm, 0.6 μm, 0.8 μm, 1 μm, 5 μm, 10 μm, 20 μm, 50 μm, 100 μm, 500 μm, 1 mm, 1 cm, 5 cm, 10 cm. Close proximity can also be less than 0.2 μm. In many cases, a symbiotic relationship refers to a mutually beneficial interaction.
As used herein, “aerobic free-living conditions” refer to conditions under which a bacterium is not within a leguminous root nodule and the bacterium is in the presence of oxygen. Aerobic free-living conditions can also be referred to as nonsymbiotic or non-parasitic conditions in the presence of oxygen. The bacterium can be in close proximity to a crop, as defined above.
As used herein, the term “endophyte” refers to a group of organisms, often fungi and bacteria, that live within living plant cells for at least part of its life cycle without having an apparent detrimental effect on the plant cell. This is contrasting with an epiphyte, which is a plant that grows on another plant, without being parasitic.
As used herein, the term “diazotroph” refers to microorganisms that are able to grow without external sources of fixed nitrogen. The group includes some bacteria and some archae. There are free-living and symbiotic diazotrophs. An example of a free-living diazotroph is Klebsiella pneumoniae. K. pneumoniae is a facultative anaerobes—these species can grow either with or without oxygen, but they only fix nitrogen anaerobically.
As used herein, the term “Alphaproteobacteria” refers to a diverse class of bacteria falling under the phylum Proteobacteria. Non-limiting examples of Alphaproteobacteria include species Rhodobacter sphaeroides and Rhodopseudomonas palustris. As used herein, the term “Gammaproteobacteria” refers to another class of bacteria falling under the phylum of Proteobacteria. All proteobacteria are gram negative. As used herein, the term “Cyanobacteria” refers to a phylum of bacteria that obtain their energy through photosynthesis. They are also referred to as Cyanophyta. They have characteristic internal membranes and thylakoids, the latter being for photosynthetic purposes. As used herein, the term “Firmicutes” refer to a phylum of bacteria. This phylum includes the classes Bacilli, Clostridia, and Thermolithobacteria.
Nif GenesTypically, the genes necessary for nitrogen fixation occur together in a gene cluster, including the nitrogenase subunits, the biosynthesis of metalloclusters cluster and, electron transport, and regulator proteins. Nif genes are genes that encode the enzyme involved in nitrogen fixation. In most cases nif genes occur as an operon. Some of these genes encode the subunits for the nitrogenase complex, which is the primary enzyme imparting the ability to convert atmospheric nitrogen (N2) to forms of nitrogen accessible to living organisms. In most genes, the regulation of the nif gene transcription is conducted by NifA protein, which is responsive to nitrogen levels. When there are nitrogen deficits, NtrC activates NifA expression, which in turn leads to the activation of the remaining nif genes. When nitrogen levels are adequate or in excess, NifL protein, encoded by NifL, inhibits NifA activity.
Nif gene pathways are generally sensitive to small changes in expression. Important genes include nifHDK, which form the subunits for nitrogenase. The chaperone NifY is required to achieve full activity and broadens the tolerance to changes in expression level. NifJ and nif regulate electron transport. The nifUSVWZM operon encodes proteins for early Fe—S cluster formation (NifUS) and proteins for component maturation (NifVWZ for Component I and NifM for Component II), whereas nifBQ encodes proteins for FeMo-co core synthesis (NifB) and molybdenum integration (NifQ). NifEN is tolerant to varied expression levels.
Exemplary sequences for various nif genes are provided in Table 5. Non-limiting examples of nif genes include nifH, nifD, nifK, nifE, nifN, nifU, nifS, nifV, nifW, nifX, nifB, nifQ, nifY, nifT, nifJ, nifF, nifX, nifU, and nifS.
Nitrogen Fixation and Regulatory ElementsThe nitrogen fixation (nif) genes are organized as genomic clusters, ranging from a 10.5 kb single operon in Paenibacillus to 64 kb divided amongst three genomic locations in A. caulinodans. Conserved genes include those encoding the nitrogenase enzyme (nifHDK), FeMoCo biosynthesis, and chaperones. Species that can fix nitrogen under more conditions tend to have larger gene clusters that include environment-specific paralogues, alternative electron transport routes, and oxygen protective mechanisms. Often, the functions of many genes in the larger clusters are unknown.
There is evolutionary evidence for the lateral transfer of nif clusters between species (Pascuan, C., Fox, A. R., Soto, G. & Ayub, N. D. Exploring the ancestral mechanisms of regulation of horizontally acquired nitrogenases. Journal of molecular evolution 81, 84-89 (2015); Kechris, K. J., Lin, J. C., Bickel, P. J. & Glazer, A. N. Quantitative exploration of the occurrence of lateral gene transfer by using nitrogen fixation genes as a case study. Proceedings of the National Academy of Sciences 103, 9584-9589 (2006)). However, achieving such a transfer via genetic engineering poses a challenge as many things can go awry, including differences in regulation, missing genes, and the intracellular environment (Frans, J. et al. in Nitrogen Fixation 33-44 (Springer, 1990); Poudel, S. et al. Electron transfer to nitrogenase in different genomic and metabolic backgrounds. Journal of bacteriology 200, e00757-00717 (2018); Thony, B., Anthamatten, D. & Hennecke, H. Dual control of the Bradyrhizobium japonicum symbiotic nitrogen fixation regulatory operon fixR nifA: analysis of cis- and trans-acting elements. Journal of bacteriology 171, 4162-4169 (1989); Han, Y. et al. Interspecies Transfer and Regulation of Pseudomonas stutzeri A1501 Nitrogen Fixation Island in Escherichia coli. Journal of microbiology and biotechnology 25, 1339-1348 (2015)). Nitrogenase is under stringent control because it is oxygen sensitive and energetically expensive: it can make up 20% of the cell mass and each NH3 requires ˜40 ATP. It is also irreversibly deactivated by oxygen. Across species, transcription of nif genes is strongly repressed by fixed nitrogen (ammonia) and oxygen with these signals converging on the NifA regulatory protein that works in concert with the sigma factor RpoN. Diverse, species-specific, and often poorly understood signals control these regulators, including plant-produced chemicals, ATP, reducing power, temperature, and carbon sources. Those bacteria that can fix nitrogen in a wider range of environmental conditions tend to be controlled by more complex regulatory networks.
When a nif cluster is transferred from one species to another, it either preserves its regulation by environmental stimuli or has an unregulated constitutive phenotype. Maintaining the native regulation, notably ammonium repression, limits their use in agriculture because such levels are likely to fluctuate according to soil types, irrigation, and fertilization. Nitrogen-fixing diazotrophs have been engineered to reduce ammonia sensitivity by disrupting NifL or mutating NifA and placing the entire cluster under the control of T7 RNA polymerase (RNAP). Constitutive expression of nitrogenase is also undesirable as it imparts a fitness burden on the cells. For example, when the nif cluster from P. stutzeri A1501 was transferred to P. protegens Pf-5, this was reported to result in sufficient ammonia production to support maize and wheat growth, but the bacteria quickly declined after a month when competing with other species in soil. Constitutive activity is detrimental even before the bacteria are introduced to the soil, impacting production, formulation, and long-term storage. Therefore, uncontrolled nitrogenase production could lead to more expensive production, shorter shelf life, and more in-field variability.
An important aspect of the nif clusters or nif genes the present disclosure is that they can each be under the control of a regulatory element. In some embodiments, 2 or more genes are under the control of a regulatory element. In some embodiments, all the genes are under the control of a regulatory element. The regulatory elements may also be activation elements or inhibitory elements. An activation element is a nucleic acid sequence that when presented in context with a nucleic acid to be expressed will cause expression of the nucleic acid in the presence of an activation signal. An inhibitory signal is a nucleic acid sequence that when presented in context with a nucleic acid to be expressed will cause expression of the nucleic acid unless an inhibitory signal is present. Each of the activation and inhibitory elements may be a promoter, such as a bacteriophage T7 promoter, sigma 70 promoter, sigma 54 promoter, lac promoter, etc. As used herein, the term “promoter” is intended to refer to those regulatory sequences which are sufficient to enable the transcription of an operably linked DNA molecule. Promoters may be constitutive or inducible. As used herein, the term “constitutive promoter” refers to a promoter that is always on (i.e. causing transcription at a constant level). Examples of constitutive promoters include, without limitation, sigma 70 promoter, bla promoter, lacI. promoter, etc. Non-limiting examples of inducible promoters are shown in Table 1. The PA1lacO1 promoter is another example of an inducible promoter that can be used in the present invention.
Inducible promoters allow regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological state, e.g., acute phase, a particular differentiation state of the cell, or in replicating cells only. Inducible promoters and inducible systems are available from a variety of commercial sources, including, without limitation, Invitrogen, Clontech and Ariad. Many other systems have been described and can be readily selected by one of skill in the art. Examples of inducible promoters regulated by exogenously supplied promoters include the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system [WO 98/10088]; the ecdysone insect promoter [No et al, Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)], the tetracycline-repressible system [Gossen et al, Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)], the tetracycline-inducible system [Gossen et al, Science, 268:1766-1769 (1995), see also Harvey et al, Curr. Opin. Chem. Biol., 2:512-518 (1998)], the RU486-inducible system [Wang et al, Nat. Biotech., 15:239-243 (1997) and Wang et al, Gene Ther., 4:432-441 (1997)] and the rapamycin-inducible system [Magari et al, J. Clin. Invest., 100:2865-2872 (1997)]. Still other types of inducible promoters which may be useful in this context are those which are regulated by a specific physiological state, e.g., temperature, acute phase, a particular differentiation state of the cell, or in replicating cells only.
As used herein, the term “terminator” (as referred to as a transcription terminator) is a section of nucleic acid sequence that marks the end of a gene or operon in genomic DNA during transcription. They stop transcription of a polymerase. Terminators can be classified into several groups. At the first group of termination signals the core enzyme can terminate in vitro at certain sites in the absence of any other factors (as tested in vitro). These sites of termination are called intrinsic terminators or also class I terminators. Intrinsic terminators usually share one common structural feature, the so called hairpin or stem-loop structure. On the one hand the hairpin comprises a stem structure, encoded by a dG-dC rich sequence of dyad symmetrical structure. On the other hand the terminator also exhibits a dA-dT rich region at the 3′-end directly following the stem structure. The uridine rich region at the 3′ end is thought to facilitate transcript release when RNA polymerase pauses at hairpin structures. Two or more terminators can be operatively linked if they are positioned to each other to provide concerted termination of a preceding coding sequence. Particularly preferred, the terminator sequences are downstream of coding sequences, i.e. on the 3′ position of the coding sequence. The terminator can e.g. be at least 1, at least 10, at least 30, at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 400, at least 500 nucleotides downstream of the coding sequence or directly adjacent. Examples of terminators include, but are not limited to, T7 terminator, rrnBT1, L3S2P21, tonB, rrnA, rrnB, rrnD, RNAI, crp, his, ilv lambda, M13, rpoC, and trp (see for example U.S. Pat. No. 9,745,588, incorporated herein by reference).
RpoN
As used herein “RpoN” refers to a gene that encodes the sigma factor sigma-54 (σ54, sigma N, or RpoN), a protein in Escherichia coli and other species of bacteria. Sigma factors are initiation factors that promote attachment of RNA polymerase to specific initiation sites and are then released. Bacteria normally only have one functional copy of the alternative sigma factor, σ54 or RpoN, which regulates a complex genetic network that extends into various facets of bacterial physiology, including metabolism, survival in strenuous environments, production of virulence factors, and formation of biofilms. RpoN is one of seven RNA polymerase sigma subunits in E. coli required for promoter-initiated transcription and RpoN plays a major role in the response of E. coli to nitrogen-limiting conditions. Under such conditions, RpoN directs the transcription of at least 14 E. coli operons/regulators in the nitrogen regulatory (Ntr) response. RpoN also plays an important role in stress resistance (e.g. resistance to osmotic stress) and virulence of bacteria. RpoN is structurally and functionally distinct from the other E. coli σ factors. It is able to bind promoter DNA in the absence of core RNA polymerase and it recognizes promoter sequences with conserved GG and GC elements located −24 to −12 nucleotides upstream of the transcription start site. Additionally, Regulatory proteins like NtrB and NtrC can activate σ54 holoenzyme.
Without being bound by theory or mechanism, it is believed that RpoN works in concert with NifA to turn on the transcription of nif clusters. An exemplary sequence for RpoN is provided in Table 5.
Gene Cluster Nucleic AcidsAs used herein, a “gene cluster” or “genetic cluster” refers to a set of two or more genes that encode gene products. A target, naturally occurring, or wild type genetic cluster can be used as the original model for refactoring. In some embodiments, the gene products are enzymes. In some embodiments, the gene products of a genetic cluster function in a biosynthetic pathway. In some embodiments, the gene cluster encodes proteins of the nif nitrogen fixation pathway.
The genetic clusters can encode proteins of a biosynthetic pathway. A biosynthetic pathway, as used herein, refers to any pathway found in a biological system that involves more than one protein. In some instances, these pathways involve 2-1,000 proteins. In other instances the number of proteins involved in a biosynthetic pathway may be 2-500, 2-100, 5-1000, 5-500, 5-100, 5-10, 10-1,000, 10-900, 10-800, 10-700, 10-600, 10-500, 10-400, 10-300, 10-200, 10-100, 50-1,000, 50-500, 50-100, 100-1,000, or 100-500. Examples of biosynthetic pathways include but are not limited to the nitrogen fixation pathway.
In some instances, the refactored genetic clusters have naturally occurring non-coding DNA, naturally occurring regulatory sequences, and/or non-essential genes that have been removed from at least one or in some instances all of the transcriptional units. These can be replaced by synthetic regulatory sequences, not replaced at all or replaced by spacers. A spacer simply refers to a set of nucleotides or analogs thereof that don't have a function such as coding for a protein or in any way regulating the activity of the gene cluster.
The genetic components in the genetic cluster typically will include at least one regulatory element. A synthetic regulatory element is any nucleic acid sequence which plays a role in regulating gene expression and which differs from the naturally occurring regulatory element. It may differ for instance by a single nucleotide from the naturally occurring element. In some cases, it is an exogenous regulatory element (i.e. not identical to the naturally occurring version). Thus, a “regulatory element” refers to a nucleic acid having nucleotide sequences that influence transcription or translation initiation or rate, or stability and/or mobility of a transcription or translation product. Regulatory regions include, without limitation, promoter sequences, ribosome binding sites, ribozymes, enhancer sequences, response elements, protein recognition sites, inducible elements, protein binding sequences, 5′ and 3′ untranslated regions (UTRs), transcriptional start sites, transcription terminator sequences, polyadenylation sequences, introns, and combinations thereof.
The genetic clusters can be expressed in vivo in an organism or in vitro in a cell. The organism or cell can be any organism or cell in which a DNA can be introduced. For example, organisms and cells can include prokaryotes and eukaryotes (i.e. yeast, plants). Prokaryotes include but are not limited to Cyanobacteria, Bacillus subtilis, E. coli, Clostridium, and Rhodococcus. Eukaryotes include, for instance, algae (Nannochloropsis), yeast such as, S. cerevisiae and P. pastoris, plant cells, mammalian cells. Thus, some aspects of this disclosure relate to engineering of a cell to express proteins from the modified genetic clusters.
In some embodiments of the present disclosure provides a genetic cluster includes a nucleotide sequence that is at least about 85% or more homologous or identical to the entire length of a naturally occurring genetic cluster sequence, e.g., at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50% or more of the full length naturally occurring genetic cluster sequence). In some embodiments, the nucleotide sequence is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homologous or identical to a naturally occurring genetic cluster sequence. In some embodiments, the nucleotide sequence is at least about 85%, e.g., is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homologous or identical to a genetic cluster sequence, in a fragment thereof or a region that is much more conserved, such as an essential, but has lower sequence identity outside that region. The disclosure also provides a nucleotide sequence that is at least about 85%, e.g., is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to any nucleotide sequence as described herein or an amino acid sequence that is at least about 85%, e.g., is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to any amino acid sequence as described herein.
Calculations of homology or sequence identity between sequences (the terms are used interchangeably herein) are performed as follows. To determine the percent identity of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). The length of a reference sequence aligned for comparison purposes is at least 80% of the length of the reference sequence, and in some embodiments is at least 90% or 100%. The nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein nucleic acid “identity” is equivalent to nucleic acid “homology”). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
In some embodiments the gene clusters are native gene clusters. In some embodiments, the gene clusters are refactored gene clusters. In some instances, the nucleic acids may include non-naturally occurring nucleotides and/or substitutions, i.e. Sugar or base substitutions or modifications.
One or more substituted sugar moieties include, e.g., one of the following at the 2′ position: OH, SH, SCH3, F, OCN, OCH3OCH3, OCH3O(CH2)n CH3, O(CH2)n NH2 or O(CH2)n CH3 where n is from 1 to about 10; Ci to C10 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF3; OCF3; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; SOCH3; SO2 CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of a nucleic acid; or a group for improving the pharmacodynamic properties of a nucleic acid and other substituents having similar properties. Similar modifications may also be made at other positions on the nucleic acid, particularly the 3′ position of the sugar on the 3′ terminal nucleotide and the 5′ position of 5′ terminal nucleotide. Nucleic acids may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group.
Nucleic acids can also include, additionally or alternatively, nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5-methylcytosine (also referred to as 5-methyl-2′ deoxycytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, isocytosine, pseudoisocytosine, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2-(methylamino)adenine, 2-(imidazolylalkyl)adenine, 2-(aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 5-propynyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl)adenine, 6-aminopurine, 2-aminopurine, 2-chloro-6-aminopurine and 2,6-diaminopurine or other diaminopurines. See, e.g., Kornberg, “DNA Replication,” W. H. Freeman & Co., San Francisco, 1980, pp 75-′ 7′ 7; and Gebeyehu, G., et al. Nucl. Acids Res., 15:4513 (1987)). A “universal” base known in the art, e.g., inosine, can also be included.
Methods to deliver expression vectors or expression constructs into cells, for example, into bacteria, yeast, or plant cells, are well known to those of skill in the art. Nucleic acids, including expression vectors, can be delivered to prokaryotic and eukaryotic cells by various methods well known to those of skill in the relevant biological arts. Methods for the delivery of nucleic acids to a cell, include, but are not limited to, different chemical, electrochemical and biological approaches, for example, heat shock transformation, electroporation, transfection, for example liposome-mediated transfection, DEAE-Dextran-mediated transfection or calcium phosphate transfection. In some embodiments, a nucleic acid construct, for example an expression construct comprising a fusion protein nucleic acid sequence, is introduced into the host cell using a vehicle, or vector, for transferring genetic material. Vectors for transferring genetic material to cells are well known to those of skill in the art and include, for example, plasmids, artificial chromosomes, and viral vectors. Methods for the construction of nucleic acid constructs, including expression constructs comprising constitutive or inducible heterologous promoters, knockout and knockdown constructs, as well as methods and vectors for the delivery of a nucleic acid or nucleic acid construct to a cell are well known to those of skill in the art, and are described, for example, in J. Sambrook and D. Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press; 3rd edition (Jan. 15, 2001); David C. Amberg, Daniel J. Burke; and Jeffrey N. Strathern, Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual, Cold Spring Harbor Laboratory Press (April 2005); John N. Abelson, Melvin I. Simon, Christine Guthrie, and Gerald R. Fink, Guide to Yeast Genetics and Molecular Biology, Part A, Volume 194 (Methods in Enzymology Series, 194), Academic Press (Mar. 11, 2004); Christine Guthrie and Gerald R. Fink, Guide to Yeast Genetics and Molecular and Cell Biology, Part B, Volume 350 (Methods in Enzymology, Vol 350), Academic Press; 1st edition (Jul. 2, 2002); Christine Guthrie and Gerald R. Fink, Guide to Yeast Genetics and Molecular and Cell Biology, Part C, Volume 351, Academic Press; 1st edition (Jul. 9, 2002); Gregory N. Stephanopoulos, Aristos A. Aristidou and Jens Nielsen, Metabolic Engineering: Principles and Methodologies, Academic Press; 1 edition (Oct. 16, 1998); and Christina Smolke, The Metabolic Pathway Engineering Handbook: Fundamentals, CRC Press; 1 edition (Jul. 28, 2009), all of which are incorporated by reference herein.
Phylogenetic AnalysisThe present disclosure also provides methods of selecting a nif cluster of a donor bacterium that is compatible with a host bacterium. The methods involve performing a phylogenetic analysis for the donor bacterium and the host bacterium.
A phylogenetic analysis is a method of estimating the evolutionary relationships. In molecular phylogenetic analysis, the sequence of a common gene or protein can be used to assess the evolutionary relationship of species. In some embodiments, phylogenetic analysis is performed based on the rRNA (e.g., the full-length 16S rRNA gene) sequences. These sequence include e.g., K. oxytoca, BWI76_05380; A. vinelandii, Avin_55000; R. sphaeroides, DQL45_00005; Cyanothece ATCC51142, cce_RNA045; A. brasilense, AMK58_25190; R. palustris, RNA_55; P. protegens, PST_0759; Paenibacillus sp. WLY78, JQ003557. In some embodiments, a multiple sequence alignment can be generated using MUSCLE (Edgar, R. C. J. N. a. r. MUSCLE: multiple sequence alignment with high accuracy and high throughput. 32, 1792-1797 (2004)). A phylogenetic tree is then constructed using the Jukes-Cantor distance model and UPGMA as a tree build method.
As shown in
In some embodiments, the evolutionary distance based on the phylogenetic analysis between the donor bacterium and the host bacterium is less than a reference value. For example, the reference value is 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1% substitutions per site in 16S ribosomal RNA gene sequence. In some embodiments, the reference value is 500, 400, 300, 200, 100, 50, or 10 million years on the phylogenetic tree.
The methods can also involve transferring the nif cluster to the host bacterium and determining the nitrogenase activity.
Genetically Modified PlantsIn some embodiments, this disclosure features genetically-modified plant cells and plants (e.g., genetically-modified cereal plants or cells) comprising at least one recombinant nucleic acid construct described herein. In some embodiments, a nucleic acid construct can encode, for example, a chemical signal synthesis peptide, operably linked in sense orientation to one or more regulatory regions. In some embodiments, the chemical signal synthesis peptide is an opine biosynthetic polypeptide (e.g., from A. tumefaciens) such as octopine synthase or nopaline synthase. In some embodiments, the chemical signal synthesis peptide can produce a chemical signal, which the genetically engineered bacterium can respond. It will be appreciated that because of the degeneracy of the genetic code, a number of nucleic acids can encode a particular opine biosynthetic polypeptide; i.e., for many amino acids, there is more than one nucleotide triplet that serves as the codon for the amino acid. Thus, codons in the coding sequence for a given opine biosynthetic polypeptide can be modified such that expression in a particular plant species is obtained, using appropriate codon bias tables for that species.
In some cases, the regulatory region is a constitutive promoter. In some cases, the regulatory region is an inducible promoter. In some cases, the regulatory region is a root-active promoter that can confer transcription in root tissue, e.g., root endodermis, root epidermis, or root vascular tissues. In some embodiments, root-active promoters can include the root-specific subdomains of the CaMV 35S promoter (Lam et al., Proc. Natl. Acad. Sci. USA, 86:7890-7894 (1989)), root cell specific promoters of Conkling et al., Plant Physiol., 93:1203-1211 (1990), or the tobacco RD2 promoter.
As described herein, a cereal plant or plant cell can be transformed by having a nucleic acid construct integrated into its genome, i.e., can be stably transformed. Stably transformed cells typically retain the introduced nucleic acid with each cell division. A plant or plant cell can also be transiently transformed such that the construct is not integrated into its genome. Transiently transformed cells typically lose all or some portion of the introduced nucleic acid construct with each cell division such that the introduced nucleic acid cannot be detected in daughter cells after a sufficient number of cell divisions. Both transiently transformed and stably transformed transgenic plants and plant cells can be useful in the methods described herein.
Genetically modified plant cells used in methods described herein can constitute part or all of a whole plant. Such plants can be grown in a manner suitable for the species under consideration, either in a growth chamber, a greenhouse, or in a field. As used herein, a genetically modified plant also refers to progeny of an initial engineered plant provided the progeny inherits the construct. Seeds produced by a modified plant can be grown and then selfed (or outcrossed and selfed) to obtain seeds homozygous for the nucleic acid construct.
Modified plants can be grown in suspension culture, or tissue or organ culture. When using solid medium, modified plant cells can be placed directly onto the medium or can be placed onto a filter that is then placed in contact with the medium. When using liquid medium, modified plant cells can be placed onto a flotation device, e.g., a porous membrane that contacts the liquid medium. A solid medium can be, for example, Murashige and Skoog (MS) medium containing agar and a suitable concentration of an auxin, e.g., 2,4-dichlorophenoxyacetic acid (2,4-D), and a suitable concentration of a cytokinin, e.g., kinetin.
When transiently transformed plant cells are used, a reporter sequence encoding a reporter polypeptide having a reporter activity can be included in the transformation procedure and an assay for reporter activity or expression can be performed at a suitable time after transformation. A suitable time for conducting the assay typically is about 1-21 days after transformation, e.g., about 1-14 days, about 1-7 days, or about 1-3 days. The use of transient assays is particularly convenient for rapid analysis in different species, or to confirm expression of a polypeptide whose expression has not previously been confirmed in particular recipient cells.
Techniques for introducing nucleic acids into plants are known and include, without limitation, Agrobacterium-mediated transformation, viral vector-mediated transformation, electroporation and particle gun transformation, e.g., U.S. Pat. Nos. 5,538,880; 5,204,253; 6,329,571 and 6,013,863. If a cell or cultured tissue is used as the recipient tissue for transformation, plants can be regenerated from transformed cultures if desired, by techniques known to those skilled in the art.
A population of modified plants can be screened and/or selected for those members of the population that produce as described chemical signal (e.g., opine) at a desired location (e.g., in the roots) as conferred by expression of the transgene. For example, a population of progeny of a single transformation event can be screened for those plants having a desired level of expression of a polypeptide or nucleic acid.
Control of Nitrogenase ActivityIn some embodiments, the disclosure provides a genetically engineered bacterium that contains a regulatory sequence or a genetic sensor that regulates the nitrogenase activity in response to a chemical signal (e.g., an environmental signal or artificial signal). In some embodiments, the chemical signal can be an environmental signal such as ammonia, IPTG, or oxygen. In some embodiments, the nif cluster is placed under the control of a genetic sensor that can respond to the chemical signal. In some embodiments, the genetic sensor can respond to biocontrol agents or components of added fertilizer and other treatments (e.g., DAPG). In some embodiments, the genetic sensor can respond to root exudates from a plant, including e.g., sugar such as arabinose, hormones such as salicylic acids, flavonoids such as naringenin, antimicrobials such as vanillic acid, and various chemicals that can remodel the microbial community (e.g., cuminic acid). In some embodiments, the genetic sensor can respond to chemicals released by other bacteria including e.g., 3,4-dihydroxybenzoic acid (DHBA), 3OC6HSL or 3OC14HSL.
In some embodiments, sensors for chemicals are used to construct controllers. In some embodiments, a “Marionette” strain of E. coli, which includes sensors for e.g., vanillic acid, DHBA, cuminic acid, 3OC6HSL and 3OC14HSL in the genome, is used to host the nif cluster. In some embodiments, the output promoter of a sensor is used to express T7 RNA polymerase. In some embodiments, the arabinose and naringenin sensors are used to express NifA, which leads to the induction of the nifH promoter and nitrogenase activity. In some embodiments, the arabinose and naringenin sensors are used to express NifA, which leads to the induction of the nifH promoter and nitrogenase activity in P. protegens Pf-5. In some embodiments, the DAPG sensor is used to drive T7 RNAP, which then induces nitrogenase activity. In some embodiments, the DAPG sensor is used to drive T7 RNAP, which then induces nitrogenase activity in R. sp. IRBG74. In some embodiments, the salicylic acid sensor is used to control NifAL94Q/D95Q/RpoN expression, which then activates nitrogenase activity. In some embodiments, the salicylic acid sensor is used to control NifAL94Q/D95Q/RpoN expression, which then activates nitrogenase activity in A. caulinodans.
In some embodiments, a plant is engineered to release an orthogonal chemical signal that can be sensed by a corresponding engineered bacterium. This would have the benefit of only inducing nitrogenase in the presence of the engineered crop. In some embodiments, legumes and Arabidopsis are engineered to produce opines, including nopaline and octopine. In some embodiments, an engineered bacterium contains sensors for nopaline and octopine. In some embodiments, an engineered bacterium contains the LysR-type transcriptional activators OccR (octopine) and NocR (nopaline) and their corresponding promoters. In some embodiments, sensors for nopaline and octopine are used to control the expression of NifAL94Q/D95Q/RpoN, which then activates nitrogenase activity.
The present disclosure also provides methods of selecting a nif cluster or a regulatory element for the nif cluster. The methods involve calculation of genetic-part strengths based on sequencing data. In some embodiments, RNA-seq and Ribosome-footprint profiling is carried out according to the method described herein. In some embodiments, to generate the RNA-seq read profile for each nif cluster, the raw trace profiles can be multiplied by e.g., at least or about 105, 106, 107, 108, or 109 and normalized by respective total reads from coding sequences of each species. In some embodiments, the mRNA expression level of each gene is estimated using total sequencing reads mapped onto the gene, representing fragments per kilobase of transcript per million fragments mapped units (FPKM).
In some embodiments, the activity of a promoter is defined as the change in RNAP flux δJ around a transcription start site xtss. In some embodiments, the promoter strength or the regulatory element strength is calculated using the below equation:
where m(i) is the number of transcripts at each position i from the FPKM-normalized transcriptomic profiles, γ=0.0067 s−1 is the degradation rate of mRNA and n is the window length before and after xtss. In some embodiments, the window length is set to ten. In some embodiments, the Ts is defined as the fold-decrease in transcription before and after a terminator, which can be quantified from the FPKM-normalized transcriptomic profiles as:
where x0 and x1 are the beginning and end positions of the terminator part, respectively. The translation efficiency was calculated by dividing the ribosome density by the FPKM.
DefinitionAs used herein, the equivalent terms “expression” or “gene expression” are intended to refer to the transcription of a DNA molecule into RNA, and the translation of such RNA into a polypeptide.
As used herein, a “gene cluster” refers to a set of two or more genes that encode gene products. As used herein, a “nif gene cluster” refers to a set of two or more genes that encode nitrogen fixation genes.
“Exogenous” with respect to genes indicates that the nucleic acid or gene is not in its natural (native) environment. For example, an exogenous gene can refer to a gene that is from a different species. In contrast, “endogenous” with respect to genes indicates that the gene is in its native environment. As used herein, the terms “endogenous” and “native” are used interchangeably.
As used herein, the term “delete” or “deleted” refers to the removal of a gene (e.g. endogenous gene) from a sequence or cluster. As used herein, the term “alter” or “altered” refers to the modification of one or more nucleotides in a gene or the deletion of one or more base pairs in a gene. This alteration may render the gene dysfunctional. Herein, “ΔnifA” refers to a strain or cluster within which NifA was deleted or altered. Method of deletion and alteration, in the context of genes, are known in the art.
As used herein, the term “chemical signals” refers to chemical compounds. Any substance consisting of two or more different types of atoms (chemical elements) in a fixed stoichiometric proportion can be termed a chemical compound. Chemical signals can be synthetic or natural chemical compounds. In some embodiments of the present invention, a bacterium of the present disclosure or a sensor of the present disclosure is under the control of a chemical signal. In some embodiments, the signal is a native biological signal (e.g. root exudate, biological control agent, etc.). In some embodiments, the chemical signal is a quorum sensing signal from the bacterium. Non-limiting examples of chemical signals include root exudates (as defined below), biocontrol agents (as defined below), phytohormones, vanillate, IPTG, aTc, cuminic acid, DAPG, and salicylic acid, 3,4-dihydroxybenzoic acid, 3OC6HSL and 3OC14HSL.
As used herein, the term “root exudate” refers to chemicals secreted or emitted by plant roots in response to their environment. These allow plant to manipulate or alter their immediate environment, specifically their rhizosphere. Root exudates are a complex mixture of soluble organic substances, which may contain sugars, amino acids, organic acids, enzymes, and other substances. Root exudates include, but are not limited to, ions, carbon-based compounds, amino acids, sterols, sugars, hormones (phytohormones), flavonoids, antimicrobials, and many other chemical compounds. The exudates can serve as either positive regulators or negative regulators.
As used herein, the term “phytohormone” refers plant hormones and they are any of various hormones produced by plants that influence process such as germination, growth, and metabolism in the plant.
As used herein, the term “vanillate” refers to a methoxybenzoate that is the conjugate base of vanillic acid. It is a plant metabolite.
Biological control or biocontrol is a method of controlling pests such as insects, mites, weeds and plant diseases using other organisms. Natural enemies of insect pests, also known as biological control agents, include predators, parasitoids, pathogens, and competitors. Biological control agents of plant diseases are most often referred to as antagonists. Biological control agents of weeds include seed predators, herbivores and plant pathogens. The inducible clusters or promoters of the present invention may be modulated by a secretion of (or chemical otherwise associated with) a biological control agent. Herein, that is referred to as a “biocontrol agent”.
Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present invention to its fullest extent. The following specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. All publications cited herein are incorporated by reference for the purposes or subject matter referenced herein.
EXAMPLESHerein, inducible nitrogenase activity is engineered in two cereal endophytes (Azorhizobium caulinodans ORS571 and Rhizobium sp. IRBG74) and the epiphyte Pseudomonas protegens Pf-5, a maize seed inoculant. For each organism, different strategies are taken to eliminate ammonium repression and place nitrogenase expression under the control of agriculturally-relevant signals, including root exudates, biocontrol agents, and phytohormones. The present disclosure demonstrates that Rhizobium sp. (e.g., IRBG74) can be engineered to fix nitrogen under free living conditions, inter alia, by transferring either a nif cluster from Rhodobacter or Klebsiella. For P. protegens Pf-5, the transfer of an inducible cluster from Azotobacter vinelandii yields the highest ammonia and oxygen tolerance. Collectively, data from the transfer of 12 nif gene clusters between diverse species (including E. coli and 12 additional Rhizobia) help identify the barriers that must be overcome to engineer a bacterium to deliver a high nitrogen flux to a cereal crop and provide a solution such that Rhizobium can be engineered to fix nitrogen under free living conditions.
Materials and MethodsBacterial Strains and Growth Media.
All bacterial strains and their derivatives used in this study are listed in Table 2. E. coli DH10-beta (New England Biolabs, MA, Cat #C3019) was used for cloning. E. coli K-12 MG1655 was used for the nitrogenase assay. P. protegens Pf-5 was obtained from the ATCC (BAA-477). Strains used in this study are listed in Table 3. For rich media, LB medium (10 g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl), LB-Lennox medium (10 g/L tryptone, 5 g/L yeast extract, 5 g/L NaCl), and TY medium (5 g/L tryptone, 3 g/L yeast extract, 0.87 g/L CaCl2.2H2O) were used. For minimal media, BB medium (0.25 g/L MgSO4.7H2O, 1 g/L NaCl, 0.1 g/L CaCl2.2H2O, 2.9 mg/L FeCl3, 0.25 mg/L Na2MoO4.2H2O, 1.32 g/L NH4CH3CO2, 25 g/L Na2HPO4, 3 g/L KH2PO4 pH [7.4]), UMS medium (0.5 g/L MgSO4.7H2O, 0.2 g/L NaCl, 0.375 mg/L EDTA-Na2, 0.16 ZnSO4.7H2O, 0.2 mg/L Na2MoO4.2H2O, 0.25 mg/L H3BO3, 0.2 mg/L MnSO4.H2O, 0.02 mg/L CuSO4.5H2O, 1 mg/L CoCl2.6H2O, 75 mg/L CaCl2.2H2O, 12 mg/L FeSO4.7H2O, 1 mg/L thiamine hydrochloride 2 mg/L D-pantothenic acid hemicalcium salt, 0.1 mg/L biotin, 87.4 mg/L K2HPO, 4.19 g/L MOPS pH [7.0]), and Burk medium (0.2 g/L MgSO4.7H2O, 73 mg/L CaCl2.2H2O, 5.4 mg/L FeCl3.6H2O, 4.2 mg/L Na2MoO4.2H2O, 0.2 g/L KH2PO4, 0.8 g/L K2HPO4 pH [7.4]) were used. Antibiotics were used at the following concentrations (μg/mL): E. coli (kanamycin, 50; spectinomycin, 100; tetracycline, 15; gentamicin, 15). P. protegens Pf-5 (kanamycin, 30; tetracycline, 50; gentamicin, 15; carbenicillin, 50). R. sp. IRBG74 (neomycin, 150; gentamicin, 150; tetracycline, 10; nitrofurantoin, 10). A. caulinodans (kanamycin, 30; gentamicin, 15; tetracycline, 10; nitrofurantoin, 10). Chemicals including inducers used in this study are listed in Table 7.
Strain Construction.
In order to increase transformation efficiency in R. sp. IRBG74, a type-I restriction modification system was inactivated by deleting hsdR, which encodes a restriction enzyme for foreign DNA (this strain was the basis for all experiments) (Ferri, L., Gori, A., Biondi, E. G., Mengoni, A. & Bazzicalupo, M. J. P. Plasmid electroporation of Sinorhizobium strains: The role of the restriction gene hsdR in type strain Rm1021. 63, 128-135 (2010)). A sacB markerless insertion method was utilized to allow replacements of a native locus with synthetic parts by homologous recombination. Two homology arms of −500 bp flanking the hsdR gene were amplified by PCR, cloned and yielded a suicide plasmid pMR-44. The suicide plasmid was mobilized into R. sp. IRBG74 by triparental mating. Single-crossover recombinants were selected for resistance to gentamicin and subsequently grown and plated on LB plates supplemented with 15% sucrose to induce deletion of the vector DNA part containing the counter selective marker sacB which converts sucrose into a toxic product (levan). Two native nif gene clusters encompassing nifHDKENX (genomic location 219.579-227, 127) and nifSW-fixABCX-nifAB-fdxN-nifTZ (genomic location 234, 635-234, 802) of R. sp. IRBG74 were sequentially deleted using pMR45-46. To increase genetic stability recA gene was deleted using the plasmid pMR47. The R. sp. IRBG74 Δnif, hsdR, recA strain was the basis for all experiments unless indicated otherwise. Two homology arms of ˜900 bp flanking the nifA gene were amplified by PCR, cloned and yielded a suicide plasmid pMR-47 to generate nifA deletion in A. caulinodans ORS571, The suicide plasmid pMR47 in E. coli was mobilized into A. caulinodans by triparental mating. Single-crossover recombinants were selected for resistance to gentamicin and subsequently grown and plated on plain TY plates supplemented with 15% sucrose to induce deletion of the vector DNA part. All markerless deletions were confirmed by gentamicin sensitivity and diagnostic PCR. A list of the mutant strains is provided in Table 3.
Plasmid System.
Plasmids with the pBBR1 origin were derived from pMQ131 and pMQ132. Plasmids with the pRO1600 origin were derived from pMQ80. Plasmids with the RK2 origin were derived from pJP2. Plasmids with the RSF1010 origin were derived from pSEVA651. Plasmids with the IncW origin were derived from pKT249. Plasmids used in this study are provided in Table 4.
Phylogenetic Analysis of Nif Clusters.
Phylogenetic analysis was performed based on the full-length 16S rRNA gene sequences (K. oxytoca, BWI76_05380; A. vinelandii, Avin_55000; R. sphaeroides, DQL45_00005; Cyanothece ATCC51142, cce_RNA045; A. brasilense, AMK58_25190; R. palustris, RNA_55; P. protegens, PST_0759; Paenibacillus sp. WLY78, JQ003557). A multiple sequence alignment was generated using MUSCLE (Edgar, R. C. J. N. a. r. MUSCLE: multiple sequence alignment with high accuracy and high throughput. 32, 1792-1797 (2004)). A phylogenetic tree was constructed using the Geneious software (R9.0.5) with the Jukes-Cantor distance model and UPGMA as a tree build method, with bootstrap values from 1,000 replicates.
Nif Cluster Construction.
To obtain large nif clusters on mobilizable plasmids that carry origin of transfer (oriT) for conjugative transfer of the plasmids, the genomic DNAs from K. oxytoca, P. stutzeri, A. vinelandii, A. caulinodans and R. sphaeroides were purified using Wizard genomic DNA purification kit, following the isolation protocol for gram negative bacteria (Promega, Cat #A1120). The genomic DNAs of Cyanothece ATCC51142, A. brasilense ATCC29729, R. palustris ATCC BAA-98, and G. diazotrophicus ATCC49037 were obtained from ATCC. Each nif cluster was amplified into several fragments (4-10 kb) with upstream and downstream 45 bp linkers at the 5′ and 3′ most end of the cluster by PCR with primer sets (Table 2) and assembled onto linearized E. coli-yeast shuttle vectors pMR-1 for E. coli and Rhizobia, and pMR-2 for P. protegens Pf-5 using yeast recombineering. For the nif cluster of Paenibacillus sp. WLY78, the DNA sequence information were gleaned from contig ALJV01 and the DNA of the nif cluster was synthesized by GeneArt gene synthesis (Thermo Fisher Scientific, MA) into four fragments that were used as templates for PCR amplification and assembly. Amplified fragments from two to eight (Table 2) were assembled with a linearized vector into a single large plasmid by one-pot yeast assembly procedure(Shanks, R. M. et al. Saccharomyces cerevisiae-based molecular tool kit for manipulation of genes from gram-negative bacteria. 72, 5027-5036 (2006)). Once assembled, the nif cluster-plasmids were isolated from yeast using Zymoprep Yeast Miniprep kit (Zymo Research Cat #D2004) and transformed into E. coli. The purified plasmid was isolated from E. coli and sequenced to verify the correct assembly and sequence (MGH CCIB DNA Core facility, Cambridge, Mass.). E. coli containing a mutation-free plasmid were stored for further experiments. Plasmids containing nif clusters are provided in Table 4.
Construction of Refactored Nif v3.2.
The six transcriptional units (nifHDKTY, nifENX, nifJ, nifBQ, nifF, nifUSVWZM) were amplified from the plasmid pMR-3 that harbors the native Klebsiella nif cluster. Each unit was divided onto six level-1 module plasmids where the nif genes are preceded by a terminator. T7 promoter wild-type or T7 promoter variant PT7.P2 was placed between a terminator and the first gene of the transcriptional unit. Assembly linkers (˜45 bp) were placed at both ends of the units. The level-1 plasmids (pMR32-37) were provided in Table 4 and 5. Each of the six plasmids was linearized by digestion with restriction enzymes and assembled with a linearized pMR-1 or pMR-2 vector into a single large plasmid by one-pot yeast assembly procedure, yielding pMR38 and pMR39.
Transformation.
Electroporation was used to transfer plasmids into P. protegens Pf-5. A single colony was inoculated in 4 mL of LB and grown for 16 h at 30° C. with shaking at 250 rpm. The cell pellets were washed twice with 2 mL of 300 mM sucrose and dissolved in 100 μl of 300 mM sucrose at RT. A total of 50-100 ng DNA was electroporated and recovered in 1 mL of LB media for 1 h before plating on selective LB plates. Triparental mating was used to transfer DNA from E. coli to Rhizobia. An aliquot of 40 μl of late-log phase (OD600˜0.6) donor cells and 40 μl of late-log phage helper cells containing pRK7013 were mixed with 200 μl of late-log phase (OD600˜0.8) recipient Rhizobia cells and washed in 200 μl of TY medium. Mating was initiated by spotting 20 μl of the mixed cells on TY plates and incubated at 30° C. for 6 h. The mating mixtures were plated on TY medium supplemented with nitrofurantoin to isolate Rhizobia transconjugants.
Construction and Characterization Genetic Parts for Rhizobia.
Genetic part libraries were built on a pBBR1-ori plasmid pMR-1 using Gibson assembly (New England Biolabs, Cat #E2611). The fluorescence proteins, GFPmut3b and mRFP1, were used as reporters. The Anderson promoter library (Anderson, J. et al. BglBricks: A flexible standard for biological part assembly. 4, 1 (2010)) on the BioBricks Registry were utilized for the characterization of constitutive promoters (
Construction and Characterization Genetic Parts for P. protegens.
Genetic part libraries were built on a pRO1600-ori plasmid pMR-2 using Gibson assembly (New England Biolabs, Cat #E2611). The fluorescence proteins, GFPmut3b and mRFP1 were used as reporters. The Anderson promoter library on the BioBricks Registry were utilized for the characterization of constitutive promoters (
Genomic Integration and Characterization of Controllers.
The mini-Tn7 insertion system was used to introduce a controller into the genome of P. protegens Pf-5. The IPTG-inducible T7 RNAP expression system and a tetracycline resistant marker tetA was placed between two Tn7 ends (Tn7L and Tn7R). The controller plasmid pMR-85 was introduced into P. protegens Pf-5 by double transformation with pTNS3 encoding the TnsABCD transposase. A genomically-integrated controller located 25 bp downstream of the stop codon of glmS was confirmed by PCR and sequencing. A markerless insertion method using homologous recombination was employed in R. sp. IRBG74. A controller encoding inducible T7 RNAP system flanked by two homology fragments that enables the replacement of recA was cloned into a suicide plasmid. These controller plasmids (IPTG-inducible, pMR82-84; DAPG-inducible, pMR85) in E. coli was mobilized into R. sp. IRBG74 MR18 (ΔhsdR. Δnif) by triparental mating, generating the controller strains (MR19, 20, 21 and 22, respectively). The controller integration in the genome was confirmed by gentamicin sensitivity and diagnostic PCR. All controllers were characterized in a manner identical to that described in genetic part characterization.
Construction and Characterization of Marionette-Based Controllers.
To regulate nitrogenase expression in the E. coli Marionette MG1655, the yfp in the 12 reporter plasmids was replaced with T7 RNAP while keeping other genetic parts (e.g., promoters and RBSs) unchanged (
Flow Cytometry.
Cultures with fluorescence proteins were analyzed by flow cytometry using a BD Biosciences LSRII Forterssa analyzer with a 488 nm laser and 510/20-nm band pass filter for GFP and a 561 nm laser and 610/20 nm band pass filter for mCherry and mRFP1. Cells were diluted into 96-well plates containing phosphate buffered saline solution (PBS) supplemented with 2 mg/mL kanamycin after incubation. Cells were collected over 20,000 events which were gated using forward and side scatter to remove background events using FlowJo (TreeStar Inc., Ashland, Oreg.). The median fluorescence from cytometry histograms was calculated for all samples. The median autofluorescence was subtracted from the median fluorescence and reported as the fluorescence value in arbitrary unit (au).
Nitrogenase Assay (E. coli and K. oxytoca).
Cultures were initiated by inoculating a single colony into 1 mL of LB supplemented with appropriate antibiotics in 96-deepwell plates (USA Scientific, Cat #18962110) and grown overnight at 30° C., 900 rpm in a Multitron incubator. 5 μl of overnight cultures was diluted into 500 μl of BB medium with 17.1 mM NH4CH3CO2 and appropriate antibiotics in 96-deepwell and incubated for 24 h at 30° C., 900 rpm in a Multitron incubator. Cultures were diluted to an OD600 of 0.4 into 2 mL of BB medium supplemented with appropriate antibiotics, 1.43 mM serine to facilitate nitrogenase depression, and an inducer (if necessary) in 10 mL glass vials with PTFE-silicone septa screw caps (Supelco Analytical, Cat #SU860103). Headspace in the vials was replaced with 100% argon gas using a vacuum manifold. Acetylene freshly generated from CaC2 in a Burris bottle was injected to 10% (vol/vol) into each culture vial to begin the reaction. The acetylene reduction was carried out for 20 h at 30° C. with shaking at 250 rpm in an Innova 44 shaking incubator (New Brunswick) to prevent cell aggregations, followed by quenching via the addition of 0.5 mL of 4 M NaOH to each vial.
Nitrogenase Assay (P. protegens Pf-5).
Cultures were initiated by inoculating a single colony into 1 mL of LB supplemented with appropriate antibiotics in 96-deepwell plates (USA Scientific, Cat #18962110) and grown overnight at 30° C., 900 rpm in a Multitron incubator. 5 μl of overnight cultures was diluted into 500 μl of BB medium with 17.1 mM NH4CH3CO2 and appropriate antibiotics in 96-deepwell and incubated for 24 h at 30° C., 900 rpm in a Multitron incubator. Cultures were diluted to an OD600 of 0.4 into 2 mL of BB medium supplemented with appropriate antibiotics, 1.43 mM serine and an inducer (if necessary) in 10 mL glass vials with PTFE-silicone septa screw caps. Headspace in the vials was replaced with 99% argon and 1% oxygen gas (Airgas, MA USA) using a vacuum manifold. Acetylene was injected to 10% (vol/vol) into each culture vial to begin the reaction. The acetylene reduction was carried out for 20 h at 30° C. with shaking at 250 rpm, followed by quenching via the addition of 0.5 mL of 4 M NaOH to each vial.
Nitrogenase Assays (Rhizobia Strains).
Cultures were initiated by inoculating a single colony into 0.5 mL of TY medium supplemented with appropriate antibiotics in 96-deepwell plates (USA Scientific, Cat #18962110) and grown overnight at 30° C., 900 rpm in a Multitron incubator. 5 μl of overnight cultures was diluted into 500 μl of UMS medium with 30 mM succinate, 10 mM sucrose, and 10 mM NH4C1 and appropriate antibiotics in 96-deepwell and incubated for 24 h at 30° C., 900 rpm in a Multitron incubator. Cultures were diluted to an OD600 of 0.4 into 2 mL of UMS medium plus 30 mM succinate and 10 mM sucrose supplemented with appropriate antibiotics, 1.43 mM serine and an inducer (if necessary) in 10 mL glass vials with PTFE-silicone septa screw caps. Headspace in the vials was replaced with 99% argon and 1% oxygen gas using a vacuum manifold. Acetylene was injected to 10% (vol/vol) into each culture vial to begin the reaction. The acetylene reduction was carried out for 20 h at 30° C. with shaking at 250 rpm, followed by quenching via the addition of 0.5 mL of 4 M NaOH to each vial.
Nitrogenase Assays (A. caulinodans and P. stutzeri).
Cultures were initiated by inoculating a single colony into 0.2 mL of TY medium supplemented with appropriate antibiotics in 96-deepwell plates and grown overnight at 37° C. and 30° C. for A. caulinodans and P. stutzeri, respectively, 900 rpm in a Multitron incubator. 5 μl of overnight cultures was diluted into 500 μl of UMS medium with 30 mM lactate and 10 mM NH4Cl and appropriate antibiotics in 96-deepwell and incubated for 24 h at 37° C. and 30° C. for A. caulinodans and P. stutzeri, respectively, 900 rpm in a Multitron incubator. Cultures were diluted to an OD600 of 0.4 into 2 mL of UMS medium plus 30 mM lactate supplemented with appropriate antibiotics and an inducer (if necessary) in 10 mL glass vials with PTFE-silicone septa screw caps. Headspace in the vials was replaced with 99% argon plus 1% oxygen gas using a vacuum manifold. Acetylene was injected to 10% (vol/vol) into each culture vial to begin the reaction. The acetylene reduction was carried out for 20 h at 30° C. with shaking at 250 rpm, followed by quenching via the addition of 0.5 mL of 4 M NaOH to each vial.
Nitrogenase Assays (A. vinelandii).
Cultures were initiated by inoculating a single colony into 0.5 mL of Burk medium supplemented with appropriate antibiotics in 96-deepwell plates (USA Scientific, Cat #18962110) and grown overnight at 30° C., 900 rpm in a Multitron incubator. 5 μl of overnight cultures was diluted into 500 μl of Burk medium with 17.1 mM NH4CH3CO2 and appropriate antibiotics in 96-deepwell and incubated for 24 h at 30° C., 900 rpm in a Multitron incubator. Headspace in the vials was replaced with 97% argon and 3% oxygen gas (Airgas, MA USA) using a vacuum manifold. Acetylene was injected to 10% (vol/vol) into each culture vial to begin the reaction. The acetylene reduction was carried out for 20 h at 30° C. with shaking at 250 rpm, followed by quenching via the addition of 0.5 mL of 4 M NaOH to each vial.
Nitrogenase Activity Assay in the Presence of Ammonium.
Following overnight incubation in minimal medium with a nitrogen source (described above), cultures were diluted to an OD600 of 0.4 in 2 mL of nitrogen-free minimal medium, 1.43 mM serine (for E. coli and P. protegens Pf-5) and an inducer (for inducible systems) in 10 mL glass vials with PTFE-silicone septa screw caps. Ammonium (17.1 mM NH4CH3CO2 for E. coli and P. protegens Pf-5 and 10 mM NH4Cl for Rhizobia) was added to a nitrogen-free minimal medium when testing ammonium tolerance of nitrogenase activity. Headspace in the vials was replaced with either 100% argon gas for E. coli, 99% argon plus 1% oxygen for Pseudomonas and Rhizobia using a vacuum manifold. Acetylene was injected to 10% (vol/vol) into each culture vial to begin the reaction. The acetylene reduction was carried out for 20 h at 30° C. with shaking at 250 rpm followed by quenching via the addition of 0.5 mL of 4 M NaOH to each vial.
Nitrogenase Activity Assay at Varying Oxygen Levels.
Following overnight incubation in minimal medium with a nitrogen source (described above), cultures were diluted to an OD600 of 0.4 in 2 mL of minimal medium, 1.43 mM serine (for E. coli and P. protegens Pf-5), and an inducer (for inducible systems) in 10 mL glass vials with PTFE-silicone septa screw caps. The vial headspace was replaced with either 100% nitrogen gas for E. coli or 99% nitrogen plus 1% oxygen for P. protegens Pf-5 and A. caulinodans using a vacuum manifold. Cultures were incubated with shaking at 250 rpm at 30° C. for 6 h and 9 h for P. protegens Pf-5 and A. caulinodans, respectively, after which oxygen concentrations in the headspace were recorded with the optical oxygen meter FireStingO2 equipped with a needle-type sensor OXF500PT (Pyro Science, Germany) After the induction period, no oxygen remained in the headspace for all species as confirmed by the oxygen meter. The initial oxygen levels in the headspace were adjusted by injecting pure oxygen via syringe into the headspace of the vials and stabilized with shaking at 250 rpm at 30° C. for 15 m followed by the injection of acetylene to 10% (vol/vol) into each culture vial to begin the reaction and initial oxygen concentrations in the headspace were recorded concomitantly. The oxygen levels in the headspace were maintained around the setting points (<±0.25% 02) while incubating at 250 rpm and 30° C. by injecting oxygen every hour for 3 h with oxygen monitoring before and after oxygen spiking (
Ethylene Quantification.
Ethylene production was analyzed by gas chromatography using an Agilent 7890A GC system (Agilent Technologies, Inc., CA USA) equipped with a PAL headspace autosampler and flame ionization detector as follows. An aliquot of 0.5 mL headspace preincubated to 35° C. for 30 s was injected and separated for 4 min on a GS-CarbonPLOT column (0.32 mm×30 m, 3 microns; Agilent) at 60° C. and a He flow rate of 1.8 mL/min. Detection occurred in a FID heated to 300° C. with a gas flow of 35 mL/min H2 and 400 mL/min air. Acetylene and ethylene were detected at 3.0 min and 3.7 min after injection, respectively. Ethylene production was quantified by integrating the 3.7 min peak using Agilent GC/MSD ChemStation Software.
Sample Preparation for RNA-Seq and Ribosome Profiling.
Cultures of K. oxytoca, E. coli, P. protegens Pf-5 or R. sp. IRBG74 were grown following the same protocol as used for nitrogenase activity assay (described above) with a few changes. Following overnight incubation in minimal medium with a nitrogen source, cultures were diluted to an OD600=0.4 in 25 mL of minimal medium (with an inducer, if needed) and antibiotics in 125 mL Wheaton serum vials (DWK Life Sciences, Cat #223748) with septum stoppers (Fisher Scientific, Cat #FB57873). The vial headspace was replaced with either 100% nitrogen gas for E. coli and K. oxytoca or 99% nitrogen plus 1% oxygen for P. protegens Pf-5 and R. sp. IRBG74 using a vacuum manifold. Cultures grown 6 h at 30° C., 250 rpm were filtered onto a nitrocellulose filter 0.45 μM pore size (Fisher Scientific, Cat #GVS1215305). Cell pellets were combined from three vials using a stainless-steel scoopula, followed by flash-frozen in liquid nitrogen. The frozen pellets were added to 650 μl of frozen droplets of lysis buffer (20 mM Tris (pH 8.0), 100 mM NH4Cl, 10 mM MgCl2, 0.4% Triton X-100, 0.1% NP-40, 1 mM chloramphenicol and 100 U/mL DNase I) in prechilled 25 mL canister (Retsch, Germany, Cat #014620213) in liquid nitrogen and pulverized using TissueLyser II (Qiagen USA) with a setting at 15 Hz for 3 min for 5 times with intermittent cooling between cycles. The pellet was removed by centrifugation at 20,000 rcf at 4° C. for 10 min and the lysate was recovered in the supernatant.
RNA-Seq Experiments.
RNA-seq and Ribosome-footprint profiling was carried out according to the method described earlier with a few modifications(Li, G.-W., Oh, E. & Weissman, J. S. J. N. The anti-Shine—Dalgarno sequence drives translational pausing and codon choice in bacteria. 484, 538 (2012); Li, G.-W., Burkhardt, D., Gross, C. & Weissman, J. S. Quantifying absolute protein synthesis rates reveals principles underlying allocation of cellular resources. Cell 157, 624-635 (2014)). The total RNA was isolated using the hot phenol-SDS extraction method. The rRNA fractions were determined and subtracted from the total using the MICROBExpress kit (Thermo Fisher Scientific, Cat #AM1905). The remaining mRNAs and tRNAs were fragmented by RNA fragmentation reagents (Thermo Fisher Scientific, Cat #AM8740) at 95° C. for 1 m 45 s. RNA fragments (10-45 bp) were isolated from a 15% TBE-Urea polyacrylamide gel (Thermo Fisher Scientific, Cat #EC6885). The 3′ ends of the RNA fragments were dephosphorylated using T4 polynucleotide kinase (1U/μl, New England Biolabs, Cat #M0201S) in a 20 μl reaction volume supplemented with 1 μl of 20 U SUPERase. In at 37° C. for 1 h, after which the denatured fragments (5 pmoles) were incubated at 80° C. for 2 min and ligated to 1 μg of the oligo (/5rApp/CTGTAGGCACCATCAAT/3ddc/, Integrated DNA technologies) (SEQ ID NO: 1) in a 20 μl reaction volume supplemented with 8 μl of 50% PEG 8000, 2 μl of 10×T4 RNA ligase 2 buffer, 1 μl of 200 U/μl truncated K277Q T4 ligase 2 (New England Biolabs, Cat #M0351) and 1 μl of 20 U/μl of SUPERase. In (Invitrogen) at 25° C. for 3 h. The ligated fragments (35-65 bp) were isolated from a 10% TBE-Urea polyacrylamide gel (Invitrogen, Cat #EC6875). cDNA libraries from the purified mRNA products were reverse-transcribed using Superscript III (Thermo Fisher Scientific, Cat #18080044) with oCJ485 primer (/5Phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT/iSp18/CAAGCAGAAGA CGGCATACGAGATATTGATGGTGCCTACAG (SEQ ID NO: 2, SEQ ID NO: 3)) at 50° C. for 30 min and RNA products subsequently were hydrolyzed by the addition of NaOH at a final concentration of 0.1 M, followed by incubation at 95° C. for 15 min. The cDNA libraries (125-150 bp) were isolated from on a 10% TBE-Urea polyacrylamide gel (Invitrogen, Cat #EC6875). The cDNA products were circularized in a 20 μl reaction volume supplemented with 2 μl of 10× CircLigase buffer, 1 μl of 1 mM ATP, 1 μl of 50 mM MnCl2 and 1 μl of CircLigase (Epicenter, Cat #CL4115K) at 60° C. for 2 h and heat-inactivated at 80° C. for 10 min. 5 μl of circularized DNA was amplified using Phusion HF DNA polymerase (New England Biolabs, Cat #M0530) with o231 primer (CAAGCAGAAGACGGCATACGA (SEQ ID NO: 4)) and indexing primers (AATGATACGGCGACCACCGAGATCTACACGATCGGAAGAGCACACGTCTGAACT CCAGTCACNNNNNNACACTCTTTCCCTACAC (SEQ ID NO: 5)) for 7 to 10 cycles. The amplified products (125-150 bp) were recovered from an 8% TBE-Urea polyacrylamide gel (Invitrogen, Cat #EC62152). The purified products were analyzed by BioAnalyzer (Agilent, CA USA) and sequenced with a sequencing primer (CGACAGGTTCAGAGTTCTACAGTCCGACGATC (SEQ ID NO: 6)) using an Illumina HiSeq 2500 with a rapid run mode. To generate the RNA-seq read profile for each nif cluster, the raw trace profiles are multiplied by 107 and normalized by respective total reads from coding sequences of each species (K. oxytoca M5al, CP020657.1; E. coli MG1655, NC_000913.3; P. protegens Pf-5, CP000076; R. sp. IRBG74 HG518322, HG518323, HG518324 and an appropriate plasmid carrying a nif cluster). The mRNA expression level of each gene was estimated using total sequencing reads mapped onto the gene, representing fragments per kilobase of transcript per million fragments mapped units (FPKM).
Ribo-Seq Experiments.
0.5 mg of RNA was diluted into 195 μl of the lysis buffer including 0.5 U RNase inhibitor SUPERase. In (Invitrogen, Cat #AM2694), 5 mM CaCl2 and were treated with 5 μl of 750 U of micrococcal nuclease (Sigma Aldrich, Cat #10107921001) at 25° C. for 1 h to obtain ribosome-protected monosomes. The digestions were quenched by the addition of EGTA to a final concentration of 6 mM and then kept on ice before the isolation of monosomes. Subsequently, the monosome fraction was collected by sucrose density gradient (10-55% w/v) ultracentrifugation at 35,000 rpm for 3 h, followed by a hot phenol-SDS extraction to isolate ribosome-protected mRNA fragments. The mRNA fragments (15-45 bp) were isolated from a 15% TBE-Urea polyacrylamide gel. The 3′ ends of the purified fragments were dephosphorylated and ligated to the modified oligo. cDNA libraries generated by Superscript III were circularized by CircLigase as described above. rRNA products were depleted by a respective biotinylated oligo mix for E. coli and P. protegens Pf-5.5 μl of circularized DNA was amplified using Phusion HF DNA polymerase with o231 primer and indexing primers for 7 to 10 cycles. The amplified products (125-150 bp) were recovered from an 8% TBE-Urea polyacrylamide gel. The purified products were analyzed by BioAnalyzer and sequenced with a sequencing primer (CGACAGGTTCAGAGTTCTACAGTCCGACGATC (SEQ ID NO: 7)) using an Illumina HiSeq 2500 with a rapid run mode. Sequences were aligned to reference sequences using Bowtie 1.1.2 with the parameters—k1—m2—v1. A center-weighting approach was used to map the aligned footprint reads ranging from 22 to 42 nucleotides in length. To map P-site of ribosome from footprint reads, 11 nucleotides from the both ends were trimmed, and the remaining nucleotide were given the same score, normalized by the length of the center region. Aligned reads (10-45 nucleotides) were mapped to the reference with equal weight of each nucleotide. A Python 3.4 script was used to perform the mapping. To generate the Ribo-seq read profile for each nif cluster, the raw trace profiles are multiplied by 108 and normalized by respective total reads from coding sequences of each species. To calculate the ribosome density of each gene, read densities were first normalized in the following ways: (i) The first and last 5 codons of the gene are excluded for the calculation to remove the effects of translation initiation and termination. (ii) A genome-wide read density profile was fitted to an exponential function and the density at each nucleotide on a given gene was corrected using this function. (iii) If the average read density on a gene is higher than 1, a 90% winsorization was applied to reduce the effect of outliers. The sum of normalized reads on a gene was normalized by the gene length and the total read densities on coding sequences to yield the ribosome density.
Calculation of Genetic Part Strengths Based On—Seq Data.
The activity of a promoter is defined as the change in RNAP flux δJ around a transcription start site xtss (Gorochowski, T. E. et al. Genetic circuit characterization and debugging using RNA-seq. 13, 952 (2017)). The promoter strength is calculated by
where m(i) is the number of transcripts at each position I from FPKM-normalized transcriptomic profiles, y=0.0067 s−1 is the degradation rate of mRNA, n is the window length before and after xtss. The window length is set to 10. The terminator strength Ts is defined as the fold-decrease in transcription before and after a terminator, which can be quantified from FPKM-normalized transcriptomic profiles as
where x0 and x1 are the beginning and end positions of the terminator part, respectively. Translation efficiency was calculated by dividing the ribosome density by the FPKM.
nifH Expression Analysis.
Complementation of NifA was tested using plasmid pMR-128 to 130 that contains the sfgfp fused to the nifH promoter in the A. caulinodans ΔnifA mutant. The inducible NifA/RpoN expression was provided by the plasmid pMR-121 into which sfgfp driven by the nifH promoter was added to analyze nifH promoter activity, yielding pMR-131 (
Sequence Alignment.
NifA sequences of R. sphaeroides 2.4.1 (RSP_0547) and A. caulinodans ORS571 (AZC_1049) were obtained from NCBI. NifA protein sequences were aligned with MUSCLE (https://www.ebi.ac.uk/Tools/msa/muscle/) with a default settings (
Results
Performance of Native Nif Clusters in E. coli, P. Protegens Pf-5, and Symbiotic Rhizobia
A set of diverse native nif clusters were cloned in order to determine their relative performance in different strains and the associated species barriers (
203, 715-738 (1988)) and the small (10 kb) cluster from Paenibacillus polymyxa WLY7870 were used. Similarly, the published boundaries (43.7 kb) of the P. stutzeri A1501 (Yan, Y. et al. Nitrogen fixation island and rhizosphere competence traits in the genome of root-associated Pseudomonas stutzeri A1501. Proceedings of the National Academy of Sciences (2008)) and A. vinelandii DJ clusters were used (Hamilton, T. L. et al. Transcriptional profiling of nitrogen fixation in Azotobacter vinelandii. J Bacteriol 193, 4477-4486, doi:10.1128/JB.05099-11 (2011)). A region of the P. stutzeri A1501 nif cluster (Pst1307-Pst1312) was excluded as these genes are predicted to have no effect on nitrogenase. A. vinelandii DJ contains three putative electron transport systems (the Rnf1 and Rnf2 complexes and the Fix complex) located in other regions of the genome. RNA-seq data shows that Rnf2 is not co-expressed with the nif genes, so only the Rnf1 and Fix complexes were included by fusing their DNA to create a single 46.9 kb construct. The nif cluster
(40.1 kb) from Azospirillum brasilense Sp7 was selected because this species is a cereal endophyte and fixes nitrogen in free-living conditions. Several less-studied gene clusters were also cloned in order to probe species barriers. As a representative of cyanobacteria, the gene cluster from Cyanothece sp. ATCC51142 was cloned following published boundaries. Its transcriptional activator PatB occurs outside of the nif cluster, which was cloned along with its native promoter and fused to nif cluster to form a single construct (31.7 kb). Several gene clusters were selected from photosynthetic purple bacteria (Rhodopseudomonas palustris CGA009 (Oda, Y. et al. Functional genomic analysis of three nitrogenase isozymes in the photosynthetic bacterium Rhodopseudomonas palustris. 187, 7784-7794 (2005)) and Rhodobacter sphaeroides 2.4.1 (Haselkorn, R. & Kapatral, V. in Genomes and genomics of nitrogen-fixing organisms, 71-82 (Springer, 2005))) as these are members of the same alphaproteobacteria class as Rhizobia. The mf cluster, encoded on a separate chromosome of
R. sphaeroides 2.4.1, was added to the nif cluster to provide electrons to nitrogenase. Finally, the gene clusters from the sugarcane and rice endosymbiant Gluconacetobacter diazotrophicus PA1 5 (28.9 kb) as well as the three nif clusters from A. caulinodans ORS571 (64 kb)37 were cloned together with an upstream regulator fixLJK, but these were found to be inactive in all species tested, so they are not shown in
Each cluster was amplified from genomic DNA as multiple fragments by PCR and assembled with the plasmid backbone using yeast assembly (see Materials and Methods Section). The P. polymyxa WLY78 cluster was de novo synthesized based on the DNA sequence on contig ALJV01 (Shanks, R. M. et al. Saccharomyces cerevisiae-based molecular tool kit for manipulation of genes from gram-negative bacteria. 72, 5027-5036 (2006)). The clusters were cloned into different plasmid systems to facilitate transfer. For transfer to E. coli and R. sp. IRBG74, the broad-host range plasmid based on a pBBR1 origin was used (a second compatible RK2-origin plasmid was used for the nif cluster from A. caulinodans ORS571). These plasmids contain the RK2 oriT to enable the conjugative transfer of large DNA (see Materials and Methods). For transfer to P. protegens Pf-5, this plasmid system was found to be unstable and produce a mixed population. To transfer into this strain, the Pseudomonas-specific plasmid pRO1600 with the oriT was used. After construction, all of the plasmids were verified using next-generation sequencing (see Materials and Methods Section).
The set of 10 nif clusters were transferred into E. coli MG1655, the cereal epiphyte P. protegens Pf-5, and the cereal endophyte R. sp. IRBG74 to create 30 strains (
The bacteria were grown in appropriate media, including antibiotics, and then evaluated for nitrogenase activity using an acetylene reduction assay (see Methods and Materials Section). E. coli and Pseudomonas were grown at 30° C. in BB minimal media, as described previously71. However, no growth was observed for R. sp. IRBG74 under these conditions. Different media and carbon sources were tested and it was found that UMS media with dicarboxylic acids (malate or succinate), the major carbon source from plants147, with 10 mM sucrose yielded the highest growth rates (
A surprising 6 out of 10 clusters were functional in E. coli MG1655, with the K. oxytoca cluster producing the highest activity (
A single gene cluster, from R. sphaeroides, yielded nitrogenase activity in R. sp. IRBG74 (
Phylogenetic analysis was performed based on the full-length 16S rRNA gene sequences (K. oxytoca, BWI76_05380; A. vinelandii, Avin_55000; R. sphaeroides, DQL45_00005; Cyanothece ATCC51142, cce_RNA045; A. brasilense, AMK58_25190; R. palustris, RNA_55; P. protegens, PST_0759; Paenibacillus sp. WLY78, JQ003557). A multiple sequence alignment was generated using MUSCLE (Edgar, R. C. J. N. a. r. MUSCLE: multiple sequence alignment with high accuracy and high throughput. 32, 1792-1797 (2004)). A phylogenetic tree was constructed using the Geneious software (R9.0.5) with the Jukes-Cantor distance model and UPGMA as a tree build method, with bootstrap values from 1,000 replicates. This phylogenetic tree is shown in
Hereafter, studies were conducted to further characterize the extent to which changes in transcription and translation impacted the differences in activity observed when a native cluster is transferred between species. Differences in promoter activity, ribosome binding sites, and codon usage could change the expression levels of nif genes in detrimental ways. To quantify this effect, RNA-seq and ribosome profiling experiments were performed to evaluate the expression K. oxytoca nif cluster in K. oxytoca as well as E. coli MG1655, P. protegens Pf-5, and R. sp. IRBG74. RNA-seq experiments provide mRNA levels of genes (calculated as FPKM) and can be used to measure the performance of promoters and terminators. Ribosome profiling can be used to quantify protein synthesis rates, ribosome binding site (RBS) strength and ribosome pausing internal to genes. The ribosome density (RD) has been shown to correlate with protein expression rates. The translation efficiency is calculated by normalizing the RD by the number of transcripts (FPKM from Ribo-seq). Ribosome profiling has been applied to determine the relative levels of proteins expressed in multi-subunit complexes.
The RNA-seq profiles in both the sense and antisense direction are very close when compared between K. oxytoca and E. coli (
The ratios between protein expression rates were measured using ribosome profiling (
The following summarizes the results of the transfer of native nif clusters to new species. The most successful recipient was E. coli. However, this is not a viable agricultural strain and activity was eliminated in the presence of 17.1 mM ammonium (
Transfer of Refactored Klebsiella Nif Clusters to R. Sp. IRBG74
The process of refactoring a gene cluster involves the complete reconstruction of the genetic system from the bottom-up, using only well-characterized genetic parts. An exhaustive approach is to recode the genes (to eliminate internal regulation), reorganize into operons, control expression with synthetic ribosome binding sites (RBSs), and use T7 RNAP promoters and terminators. A separate “controller,” carried in a genetically distinct location, links synthetic sensors and circuits to the expression of T7 RNAP. For various applications, this approach has proven useful for transferring multi-gene systems between species, simplifies optimization through part replacement and enzyme mining, and enables the replacement of environmental signals that naturally control the cluster with the stimuli that induce the synthetic sensors (Smanski, M. J. et al. Synthetic biology to access and expand nature's chemical diversity. Nature Reviews Microbiology 14, 135 (2016); Song, M. et al. Control of type III protein secretion using a minimal genetic system. 8, 14737 (2017); Guo, C.-J. et al. Discovery of reactive microbiota-derived metabolites that inhibit host proteases. 168, 517-526. e518 (2017); Ren, H., Hu, P., Zhao, H. J. B. & bioengineering. A plug-and-play pathway refactoring workflow for natural product research in Escherichia coli and Saccharomyces cerevisiae. 114, 1847-1854 (2017)). In previous studies, the Klebsiella nif cluster was refactored, which was subsequently used as a platform to optimize activity by changing the genetic organization and the parts controlling expression. The top variant (v2.1) fully recovered activity in a K. oxytoca nif knockout and is functional in E. coli. To transfer into E. coli, a controller based on the isopropyl-β-D-thiogalactoside (IPTG)-inducible T7 RNAP carried on a plasmid was used (
An advantage of using T7 RNAP is that it is functional in essentially all prokaryotes, so the refactored cluster can be transferred as-is and transcription induced by expressing T7 RNAP in the new host. However, a new controller needs to be built for each host based on regulation and regulatory parts that work in that species. A controller for E. coli was designed based on the IPTG-inducible T7 RNAP carried on a plasmid (pKT249) (
While a handful of inducible systems and sets of genetic parts have been previously described for Rhizobia, a new part collection needed to be built and characterized in order to have those needed to create a controller with sufficient dynamic range. First, a set of 20 constitutive promoters (Anderson, J. et al. BglBricks: A flexible standard for biological part assembly. 4, 1 (2010)) and seven T7 RNAP-dependent promoters (emme, K., Zhao, D. & Voigt, C. A. Refactoring the nitrogen fixation gene cluster from Klebsiella oxytoca. Proceedings of the National Academy of Sciences 109, 7085-7090 (2012)) that were found to span a range of 382-fold and 23-fold expression, respectively, were characterized (
A controller was then constructed by using the optimized IPTG-inducible system to drive the expression of a variant of T7 RNAP (R6232S, N-terminal lon tag, GTG start codon) (
The refactored v2.1 cluster was then transferred to R. sp. IRBG74, but no activity was observed (
Based on these results, a new refactored cluster (v3.2) (
Compared to v2.1, the v3.2 cluster is less active in E. coli but is active in R. sp. IRBG74 (
Replacement of A. caulinodans Nif Regulation with Synthetic Control
The A. caulinodans nif genes are distributed across three clusters in different genomic locations. The regulatory signals converge on the NifA activator that, in concert with the RpoN sigma factor, turns on transcription of the genomic nif clusters. Numerous and not fully characterized environmental signals are integrated upstream of this node, including NtrBC (Kaminski, P. A. & Elmerich, C. J. M. m. The control of Azorhizobium caulinodans nifA expression by oxygen, ammonia and by the HF-I-like protein, NrfA. 28, 603-613 (1998)), NtrXY (Pawlowski, K., Klosse, U., De Bruijn, F. J. M. & MGG, G. G. Characterization of a novel Azorhizobium caulinodans ORS571 two-component regulatory system, NtrY/NtrX, involved in nitrogen fixation and metabolism. 231, 124-138 (1991)), FixLJK(Kaminski, P. & Elmerich, C. J. M. m. Involvement of fixLJ in the regulation of nitrogen fixation in Azorhizobium caulinodans. 5, 665-673 (1991); Kaminski, P., Mandon, K., Arigoni, F., Desnoues, N. & Elmerich, C. J. M. m. Regulation of nitrogen fixation in Azorhizobium caulinodans: identification of a fixK-like gene, a positive regulator of nifA. 5, 1983-1991 (1991)), NrfA (Kaminski, P. A. & Elmerich, C. J. M. m. The control of Azorhizobium caulinodans nifA expression by oxygen, ammonia and by the HF-I-like protein, NrfA. 28, 603-613 (1998)), and PII proteins (e.g., GlnB and GlnK (Michel-Reydellet, N. & Kaminski, P. A. J. J. o. b. Azorhizobium caulinodans Plland GlnK proteins control nitrogen fixation and ammonia assimilation. 181, 2655-2658 (1999))). The clusters (64 kb total, containing 76 genes) were cloned into the plasmid systems described above and transferred into R. sp. IRBG74 and P. protegens Pf-5, but no activity was found in either strain. Overexpression of A. caulinodans NifA and RpoN did not lead to activity and, upon further investigation, these regulators were found to be inactive in these strains. The size of the clusters and the lack of genetic and gene function information would complicate fully refactoring the system. For these reasons, it was decided to modify the regulation controlling nif such that it can be placed under the control of synthetic sensors.
One goal herein was to eliminate ammonium repression of nitrogenase activity, which converges on the regulation of NifA. The native nifA gene was knocked out of the genome using the sacB markerless deletion method (see Materials and Methods), with the intent of placing NifA under inducible control (
The controller was designed to co-express NifA and RpoN and tested for its ability to induce nitrogenase (
In related alphaproteobacteria, mutations have been identified in NifA that abrogate ammonium repression (Paschen, A., Drepper, T., Masepohl, B. & Klipp, W. Rhodobacter capsulatus nifA mutants mediating nif gene expression in the presence of ammonium. FEMS microbiology letters 200, 207-213 (2001); Rey, F. E., Heiniger, E. K. & Harwood, C. S. Redirection of metabolism for biological hydrogen production. Applied and environmental microbiology 73, 1665-1671 (2007)). These mutations occur in the N-terminal GAF domain. Using a multiple sequence alignment, two equivalent residues were identified to mutate in A. caulinodans (L94Q and D95Q) (
Oxygen irreversibly inhibits nitrogenase and represses nif clusters. The inducible nif clusters were tested for oxygen sensitivity, noting that A. caulinodans is an obligate aerobe and fixes nitrogen under micro-aerobic conditions. The tolerance of nitrogenase to oxygen was then assessed as a function of the concentration of oxygen in the headspace, held constant by injecting oxygen while monitoring its level (Methods and
Introduction of Controllable Nif Activity in P. protegens Pf-5
The native K. oxytoca, P. stutzeri, and A. vinelandii nif clusters are all functional in P. protegens Pf-5 (
As with Rhizobia, it was found that first, part libraries for P. protegens Pf-5 had to be built before building controllers with sufficient dynamic range. A range of 20 constitutive promoters and seven T7 promoters that span a range of 778-fold and 24-fold expression, respectively, was characterized (
The inducible systems designed for Rhizobium were transferred as-is to a Pseudomas-specific pRO1600 plasmid (see Materials and Methods). The 3OC6HSL-, aTc-, cuminic acid-, and DAPG-inducible systems were all found to be functional (
To simplify the comparison between clusters, it was sought to build a single, universal controller that could induce all three. Each has a different NifA sequence, so the ability to cross induce the gene clusters was tested. To do this, the nifH promoters from each nif cluster were cloned and fused to gfp to build plasmid-based reporters (see Materials and Methods). The ability of the various NifA homologues to activate the nifH promoters was evaluated in E. coli and P. protegens Pf-5 (
The nitrogenase activity for each of the gene clusters in P. protegens Pf-5 was then assessed (
The native P. stutzeri and A. vinelandii clusters are strongly repressed by ammonium: the presence of 17.1 mM eliminates activity or reduces it 7-fold, respectively (
The inducible nif clusters were tested for oxygen sensitivity. Note that wild-type A. vinelandii is able to fix nitrogen under ambient conditions due to genetic factors internal and external to the cluster. First, it was established that the controller in P. protegens Pf-5 could induce transcription from the three nifH promoters in the presence of oxygen (
To explore the impact of the electron transport chains, several mutants to the A. vinelandii cluster were made (
Control of Nitrogen Fixation with Agriculturally-Relevant Sensors
The careful design and characterization of the controller has the benefit of simplifying the process by which different synthetic sensors can be used to induce nitrogenase expression. By knowing the dynamic range required to go from inactive to active nitrogenase, one can quantitatively select sensors that have the produce a compatible response. This allows different environmental signals—or combinations of signals using genetic logic circuits—to be used to control expression. To demonstrate this, 11 synthetic sensors were selected that respond to a variety of chemical signals of relevance to the rhizosphere and demonstrate that these can be used to create inducible nitrogenase in for example, engineered strains of E. coli (carrying the refactored v2.1 nif), R. sp. IRBG74 (carrying the refactored v3.2 nif), P. protegens Pf-5 (carrying the inducible A. vinelandii nif), and A. caulinodans (inducible nifA/rpoN) (
The roles of the chemical signals in the rhizosphere are shown in
Bacteria either native to the rhizome or added as biocontrol agents introduced as a spray inoculant or seed coating produce chemical signatures. Inoculation of cereals with root colonizing Pseudomonas strains that produce DAPG elicits protection against fungal pathogens. Many bacteria produce quorum molecules, such as N-acyl homoserine lactones, as a means of communication and plants can respond to these signals. The bacterium Sinorhizobium meliloti produces 3OC14HSL, which enhances Medicago nodulation and has been shown to induce systemic resistance in cereals. DHBA can be produced by root colonizing bacteria to increase iron solubility and play a role as a chemoattractant for Agrobacterium and Rhizobium.
Sensors for these chemicals were constructed based on the controllers for each species. For E. coli MG1655, a strain that contains 12 optimized sensors, carried in the genome, that respond to various small molecules (“Marionette”) had been previously constructed (Meyer, A. J., Segall-Shapiro, T. H., Glassey, E., Zhang, J. & Voigt, C. A. J. N. b. Escherichia coli “Marionette” strains with 12 highly optimized small-molecule sensors. 1 (2018).). The response functions of these sensors were characterized in standard units, making it simple to identify those that can be connected to nitrogenase expression without further tuning. Marionette contains sensors for vanillic acid, DHBA, cuminic acid, 3OC6HSL, and 3OC14HSL. For each sensor, the output promoter was transcriptionally fused to T7 RNAP and the response of the responsive promoter (PT7) was measured as a function of inducer concentration (
Plants could be engineered to release an orthogonal chemical signal that could then be sensed by a corresponding engineered bacterium. This would have the benefit of only inducing nitrogenase in the presence of the engineered crop. Further, if the molecule is metabolizable by the engineered bacterium, it could serve as a mechanism around which a synthetic symbiosis could be designed, where the plant provides the carbon and the bacterium fixed nitrogen in an engineered relationship. To this end, legumes and Arabidopsis have been engineered to produce opines, including nopaline and octopine. Sensors were constructed for these two opines for A. caulinodans based on the LysR-type transcriptional activators OccR (octopine) and NocR (nopaline) and their corresponding Pocc and Pnoc promoters (
Towards designing a bacterium that can deliver fixed nitrogen to a cereal crop, this work provides a side-by-side comparison of diverse species, natural nif clusters, and engineering strategies that can be used to obtain inducible nitrogenase activity in a strain that can associate with cereals as an endophyte or epiphyte. To this end, ˜100 strains involving the transfer of 10 natural nif clusters ranging in size from 10 kb to 64 kb to 16 diverse species of Rhizobia, Azorhizobium, Pseudomas, and E. coli were constructed. Different approaches were taken to make these nif clusters inducible, from bioinformatics and protein engineering to complete genetic reconstruction from the ground-up (refactoring). In addition to the highest activity, it is important that nitrogen fixation be robust to the addition of nitrogenous fertilizer (ammonia) and microaerobic environments. For example, an endophyte such as a variant of Azorhizobium where nifA is knocked out of the genome and a nifA mutant and rpoN are complemented on a plasmid can be used to obtain high nitrogenase activities. For an epiphyte, P. protegens Pf-5, is a versatile strain based on the transfer of the A. vinelandii nif cluster and placement of nifA of P. stutzeri under inducible control. In both such cases, nitrogenase activities were obtained that are nearly identical to wild-type A. caulinodans and P. stutzeri, respectively. Neither showed significant repression by ammonia and optimal activity was obtained in 1% oxygen. Based on these strains, it was demonstrated that nitrogenase can be placed under inducible control in response to cereal root exudates (arabinose, salicylic acid), phytohormones (naringenin) and putitive signaling molecules that could be released by genetically modified plants (e.g., can express or exudate nopaline or octopine).
Because R. sp. IRBG74 can fix nitrogen in a legume nodule and also associates with rice, significant effort was directed to engineering this strain to fix nitrogen when cereal-associated. The first attempt was simply complementing nifV, as this is absent in R. sp. IRBG74 and produces a metabolite provided by the plant, but this attempt was unsuccessful. Then, it was found that all of the initial nif clusters transferred, some of which have high activity in P. protegens Pf-5 and E. coli, are non-functional in R. sp. IRBG74, which led to trying clusters from alphaproteobacteria, one of which produced a very low level of activity that was dependent on the nif genes native to R. sp. IRBG74. The previously-published refactored gene clusters based on Klebsiella nif were attempted in R. sp. IRBG74 but these showed no activity. It was only after the construction of a new refactored cluster (v3.2) that activity was obtained under free-living conditions that was not dependent on the native nif genes. This allowed an increase in the expression levels, and an optimum was discovered beyond which activity was lost. This is the first time that nif activity has been engineered in a Rhizobium under free-living conditions that could otherwise not perform this function.
The present disclosure encompasses different degrees of nif pathway re-engineering to promote heterologous transfer. The most ambitious is the complete refactoring of all the nif genes and regulation, where all regulatory genetic parts are replaced, genes are recoded, operons are reorganized, and transcription is performed by the orthogonal T7 RNAP. Initially, the evaluation of performance relied on the overall nitrogenase activity, rather than an understanding of the underlying parts. As such, the first refactored pathway performed poorly. In subsequent studies, better part libraries and DNA assembly and automation platforms enabled the synthesis of many variants. Further, as the cost of RNA-seq declined, it was used to evaluate the performance of internal parts, such as promoters and terminators. This revealed that the first designs were effectively large single operons with little differential control over the transcription levels of individual genes. With these techniques allowed the tailoring of the function of the refactored nif pathway and the discovery that many of the underlying genetic structure were not needed to achieve high activities.
Ribosome profiling, a new technique that enables the measurement of translational parts (e.g., ribosome binding sites), was applied and expression levels were inferred. Further, nitrogenase activity and the function of underlying parts were assessed as the clusters were moved between species. Interestingly, the native Klebsiella nif cluster could be transferred and it performed similarly but the refactored cluster yielded widely varying expression levels in the different hosts, sometimes leading to a total loss in activity. This could be recovered by maintaining the native operon structure in the refactored cluster, implying that it was not due to the synthetic sensors, T7 RNAP, or promoters/terminators. This is one of the hypothesized functions of operons. Achieving this required maintenance of the codon usage and translational coupling of the native cluster. However, this does not mean that it will not be possible to also encode this function synthetically. There have been computational advances that enable the calculation of RBSs internal to upstream genes when encoded on an operon. If coupled with codon optimization algorithms, this would allow the design of de novo genetic parts that achieve a desired degree of translational coupling and expression level.
The present disclosure demonstrates the deregulation of nif clusters in A. caulinodans and P. protegens Pf-5, enabling them to be placed under the control of cereal root exudates. This derepresses the pathway in the presence of exogenous nitrogenous fertilizer—critical for the use of the bacterium as part of an integrated agricultural solution. Further, these organisms retain the ability to fix nitrogen in microaerobic environments, thus avoiding the need for a root nodule that enforces strict anaerobiosis. The complete deregulation of the nif pathway makes the bacterium non-competitive in the soil and lost quickly, thus limiting its impact to particular phases of the growth cycle. Thus, it is demonstrated that nitrogenase can be placed under the control of chemical root exudates.
EMBODIMENTS1. A rhizobium that can fix nitrogen under aerobic free-living conditions, comprising a symbiotic rhizobium having an exogenous nif cluster, wherein the exogenous nif cluster confers nitrogen fixation capability on the symbiotic rhizobium under aerobic free-living conditions, and wherein the rhizobium is not Azorhizobium caulinodans.
2. The rhizobium of paragraph 1, wherein the exogenous nif cluster is from a free-living diazotroph.
3. The rhizobium of paragraph 1, wherein the exogenous nif cluster is from a symbiotic diazotroph.
4. The rhizobium of paragraph 1, wherein the exogenous nif cluster is from a photosynthetic Alphaproteobacteria.
5. The rhizobium of paragraph 1, wherein the exogenous nif cluster is from a Gammaproteobacteria.
6. The rhizobium of paragraph 1, wherein the exogenous nif cluster is from a cyanobacteria.
7. The rhizobium of paragraph 1, wherein the exogenous nif cluster is from a firmicutes.
8. The rhizobium of paragraph 1, wherein the exogenous nif cluster is from Rhodobacter sphaeroides.
9. The rhizobium of paragraph 1, wherein the exogenous nif cluster is from Rhodopseudomonas palustris.
10. The rhizobium of paragraph 1, wherein the exogenous nif cluster is an inducible refactored nif cluster.
11. The rhizobium of paragraph 10, wherein the inducible refactored nif cluster is an inducible refactored Klebsiella nif cluster.
12 The rhizobium of any one of the preceding paragraphs, wherein the rhizobium is IRBG74.
13. The rhizobium of any one of the preceding paragraphs, wherein the exogenous nif cluster comprises 6 nif genes.
14. The rhizobium of paragraph 13, wherein the 6 nif genes are nifHDK(T)Y, nifEN(X), nifJ, nifBQ, nifF, and nifUSVWZM.
15. The rhizobium of paragraphs 13 or 14, wherein each nif gene of the exogenous nif cluster is preceded by a T7 promoter.
16. The rhizobium of paragraph 15, wherein the T7 promoter is a wild-type promoter.
17. The rhizobium of any one of the preceding paragraphs, further comprising an endogenous nif cluster.
18. The rhizobium of any one of the preceding paragraphs, wherein the nif cluster has a nifV gene.
19. The rhizobium of paragraph 18, wherein the nifV gene is endogenous.
20. The rhizobium of any one of the preceding paragraphs, wherein the exogenous nif cluster further comprises a terminator.
21. The rhizobium of any one of paragraphs 15-20, wherein the T7 promoter has a terminator and wherein the terminator is downstream from the T7 promoter.
22. The rhizobium of paragraph 12, wherein the exogenous nif cluster is a refactored rhizobium IRBG74 nif cluster.
23. A plant growth promoting bacterium that can fix nitrogen under aerobic free-living conditions, comprising a bacterium having an exogenous nif cluster having at least one inducible promoter, wherein the exogenous nif cluster confers nitrogen fixation capability on the bacterium, under aerobic free-living conditions, and wherein the bacterium is not Azorhizobium caulinodans.
24. The plant growth promoting bacterium of paragraph 23, wherein the bacterium is a symbiotic bacterium.
25. The plant growth promoting bacterium of paragraph 23, wherein the bacterium is an endophyte.
26. The plant growth promoting bacterium of paragraph 25, wherein the endophyte is rhizobium IRBG74.
27. The plant growth promoting bacterium of paragraph 23, wherein the bacterium is an epiphyte.
28. The plant growth promoting bacterium of paragraph 27, wherein the epiphyte is pseudomonas protogens PF-5.
29. The plant growth promoting bacterium of any one of paragraphs 23-28, wherein the plant growth promoting bacterium is associated with a genetically modified cereal plant.
30. The plant growth promoting bacterium of paragraph 29, wherein the genetically modified cereal plant includes an exogenous gene encoding a chemical signal.
31. The plant growth promoting bacterium of paragraph 29, wherein the nitrogen fixation is under the control of the chemical signal.
32. The plant growth promoting bacterium of paragraphs 30 or 31, wherein the chemical signal is opine, phlorogluconol or rhizopene.
33. The rhizobium of any one of paragraphs 23-32, wherein the exogenous nif cluster comprises 6 nif genes.
34. The rhizobium of paragraph 33, wherein the 6 nif genes are nifHDK(T)Y, nifEN(X), nifJ, nifBQ, nifF, and nifUSVWZM.
35. The rhizobium of any one of paragraphs 23-34, wherein the inducible promoter is a T7 promoter.
36. The rhizobium of any one of paragraphs 23-34, wherein the inducible promoter is PA1lacO1 promoter.
37. The rhizobium of any one of paragraphs 23-36, wherein the inducible promoter is activated by an agent selected from a group that includes IPTG, sodium salicylate, octapine, nopaline, the quorum signal 3OC6HSL, aTc, cuminic acid, DAPG, and salicylic acid.
38. The rhizobium of any one of paragraphs 23-37, wherein the exogenous nif cluster further comprises a terminator.
39. The rhizobium of any one of paragraphs 23-37, wherein the inducible promoter has a terminator and wherein the terminator is downstream from the inducible promoter.
40. An Azorhizobium caulinodans capable of inducible ammonium-independent nitrogen fixation in a cereal crop, comprising:
(i) a modified nif cluster, wherein an endogenous nifA gene is deleted or altered; and
(ii) at least one operon comprising nifA and RNA polymerase sigma factor (RpoN), wherein the operon comprises a regulatory element including an inducible promoter.
41. The Azorhizobium caulinodans of claim 40, wherein the inducible promoter is PA1lacO1 promotor.
42. The Azorhizobium caulinodans of paragraphs 40 or 41, wherein the inducible promoter is activated by an agent selected from IPTG, sodium salicylate, octapine, nopaline, the quorum signal 3OC6HSL, aTc, cuminic acid, DAPG, and salicylic acid.
43. The Azorhizobium caulinodans of any one of paragraphs 40-42, wherein the endogenous nifA gene is altered with at least one of the following substitutions:
(i) L94Q;
(ii) D95Q; and
(iii) both L94Q and D95Q.
44. A method of engineering a rhizobium that can fix nitrogen under aerobic free-living conditions, comprising transferring an exogenous nif cluster to a symbiotic rhizobium, wherein the exogenous nif cluster confers nitrogen fixation capability on the symbiotic rhizobium, under aerobic free-living conditions, and wherein the rhizobium is not Azorhizobium caulinodans.
45. The method of paragraph 44, wherein the exogenous nif cluster comprises 6 nif genes.
46. The method of paragraph 45, wherein the 6 nif genes are nifHDK(T)Y, nifEN(X), nifJ, nifBQ, nijF and nifUSVWZM.
47. The method of paragraph 45 or 46, wherein each of the nif genes is preceded by a wild-type T7 promoter.
48. The method of any one of paragraphs 44-47, wherein the exogenous nif cluster is transferred to the rhizobium in a plasmid.
49. The method of any one of paragraphs 44-48, wherein the exogenous nif cluster further comprises a terminator.
50. The method of any one of paragraphs 47-49, wherein the wild-type T7 promoter has a terminator, and wherein the terminator is downstream from the wild-type T7 promoter.
51. The method of any one of paragraphs 44-50, wherein the endogenous NifL gene is deleted.
52. A method of producing nitrogen for consumption by a cereal plant, comprising providing a plant growth promoting bacterium that can fix nitrogen under aerobic free-living conditions in proximity of the cereal plant, wherein the plant growth promoting bacterium is a symbiotic bacterium having an exogenous nif cluster, wherein the exogenous nif cluster confers nitrogen fixation capability on the symbiotic bacterium, enabling nitrogen fixation under aerobic free-living conditions.
53. The method of paragraph 52, wherein the plant growth promoting bacterium is a rhizobium.
54. The method of paragraph 52, wherein the plant growth bacterium is the bacterium of any one of paragraphs 1-22 and 23-39.
55. The method of any one of paragraphs 52-54, wherein the cereal plant is a genetically modified cereal plant.
56. The method of paragraph 55, wherein the genetically modified cereal plant includes an exogenous gene encoding a chemical signal.
57. The method of paragraph 56, wherein the nitrogen fixation is under the control of the chemical signal.
58. The method of paragraph 56 or 57, wherein the chemical signal is opine, phlorogluconol or rhizopene.
59. The method of any one of paragraphs 52-55, wherein the nitrogen fixation is under the control of a chemical signal.
60. The method of paragraph 57 or 59, wherein the chemical signal is a root exudate, biocontrol agent or phytohormone.
61. The method of paragraph 60, wherein the root exudate is selected from the group consisting of sugars, hormones, flavonoids, and antimicrobials.
62. The method of paragraph 57 or 59, wherein the chemical signal is vanillate.
63. The method of paragraph 57 or 59, wherein the chemical signal is IPTG, aTc, cuminic acid, DAPG, and salicylic acid, 3,4-dihydroxybenzoic acid, 3OC6HSL or 3OC14HSL.
All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features. From the above description, one skilled in the art can easily ascertain the essential characteristics of the present invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, other embodiments are also within the claims.
EQUIVALENTSWhile several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the function and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the inventive teachings is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.
All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.
All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.
The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”
The phrase “and/or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and/or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and/or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and/or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and/or” as defined above. For example, when separating items in a list, “or” or “and/or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e. “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.
As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and/or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
ADDITIONAL TABLES
Claims
1. A rhizobium that can fix nitrogen under aerobic free-living conditions, comprising a symbiotic rhizobium having an exogenous nif cluster, wherein the exogenous nif cluster confers nitrogen fixation capability on the symbiotic rhizobium under aerobic free-living conditions, and wherein the rhizobium is not Azorhizobium caulinodans.
2. The rhizobium of claim 1, wherein the exogenous nif cluster is selected from a group consisting of a free-living diazotroph, a symbiotic diazotroph, a photosynthetic Alphaproteobacteria, a Gammaproteobacteria, a cyanobacteria, a firmicutes, a Rhodobacter sphaeroides, and a Rhodopseudomonas palustris.
3. The rhizobium of claim 1, wherein the exogenous nif cluster is an inducible refactored nif cluster.
4. The rhizobium of claim 3, wherein the inducible refactored nif cluster is an inducible refactored Klebsiella nif cluster.
5. The rhizobium of claim 1, wherein the rhizobium is IRBG74.
6. The rhizobium of claim 1, wherein the exogenous nif cluster comprises 6 nif genes or operons.
7. The rhizobium of claim 6, wherein the 6 nif genes or operons are nifHDK(T)Y, nifEN(X), nifJ, nifBQ, nifF, and nifUSVWZM.
8. The rhizobium of claim 6, wherein each nif gene or operon of the exogenous nif cluster is preceded by a T7 promoter.
9. The rhizobium of claim 1, further comprising an endogenous nif cluster.
10. The rhizobium of claim 1, wherein the exogenous nif cluster further comprises a terminator.
11. The rhizobium of claim 8, wherein the T7 promoter has a terminator and wherein the terminator is downstream from the T7 promoter.
12. The rhizobium of claim 11, wherein the exogenous nif cluster is a refactored rhizobium IRBG74 nif cluster.
13-33. (canceled)
34. A method for making a nitrogen-fixing bacterium, the method comprising:
- a) identifying a host bacterium;
- b) selecting a donor bacterium having a nif cluster based on evolutionary distance between the host bacterium and the donor bacterium;
- c) inserting the nif cluster of the donor bacterium to the host bacterium, thereby making a nitrogen-fixing bacterium.
35. The method of claim 34, wherein the evolutionary distance between the host bacterium and the donor bacterium is less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1% substitutions per site in 16S ribosomal RNA gene sequence.
36. The method of claim 34, wherein the host bacterium and the donor bacterium are in the same genus, family, order, or class.
37-39. (canceled)
40. The method of claim 34, wherein the host bacterium is E. coli and the donor bacterium is K. oxytoca.
41. (canceled)
42. The method of claim 34, wherein the host bacterium is Rhizobium IRBG74, and the donor bacterium is R. sphaeroides.
43. The method of claim 34, wherein the host bacterium is a nonsymbiotic bacterium, e.g., Azotobacter, Beijerinckia, or Clostridium bacterium.
44-45. (canceled)
46. The method of claim 34, wherein the inserted nif cluster is under inducible control.
47-59. (canceled)
Type: Application
Filed: Mar 19, 2020
Publication Date: May 26, 2022
Applicant: Massachusetts Institute of Technology (Cambridge, MA)
Inventors: Christopher A. Voigt (Belmont, MA), Min-Hyung Ryu (Cambridge, MA)
Application Number: 17/440,618