HEATED NANOWELLS FOR POLYNUCLEOTIDE SYNTHESIS

Devices for the manufacturing of high-quality building blocks, such as oligonucleotides, are described herein. Nano-scale devices allow for selective control over reaction conditions. Further, methods and devices described herein allow for the rapid construction of large libraries of highly accurate nucleic acids.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
CROSS-REFERENCE

This application is a continuation of U.S. patent application Ser. No. 17/122,988, filed Dec. 15, 2020, which is a continuation of U.S. patent application Ser. No. 16/165,952, filed Oct. 19, 2018, now U.S. Pat. No. 10,894,242 issued Jan. 19, 2021, which claims the benefit of U.S. provisional patent application No. 62/575,287 filed on Oct. 20, 2017, all of which are incorporated herein by reference in their entirety.

SEQUENCE LISTING

The instant application contains a Sequence Listing which has been submitted electronically in .xml format and is hereby incorporated by reference in its entirety. Said .xml copy, created on Jun. 30, 2023, is named 44854-744_302_SL.xml and is 685 bytes in size.

BACKGROUND

De novo gene synthesis is a powerful tool for basic biological research and biotechnology applications. While various methods are known for the design and synthesis of relatively short fragments in a small scale, these techniques often suffer from predictability, scalability, automation, speed, accuracy, and cost.

BRIEF SUMMARY

Provided herein are devices for polynucleotide synthesis comprising: a solid support comprising a surface; a plurality of structures for polynucleotide extension located on the surface, wherein each structure has a width of about 10 nm to about 1000 nm, wherein each structure is in contact with a heating unit, and wherein the heating unit comprises at least one electrode; and a solvent distributed across the surface, wherein the solvent is a polar solvent. Further provided herein are devices wherein the surface comprises at least 30,000 loci for nucleic acid synthesis. Further provided herein are devices wherein the surface comprises at least 50,000 loci for nucleic acid synthesis. Further provided herein are devices wherein the surface comprises at least 100,000 loci for nucleic acid synthesis. Further provided herein are devices wherein the surface comprises at least 200,000 loci for nucleic acid synthesis. Further provided herein are devices wherein the surface comprises at least 1,000,000 loci for nucleic acid synthesis. Further provided herein are devices wherein the one or more electrodes are addressable electrodes that heats one or more individual loci. Further provided herein are devices wherein the solid support further comprises a cooling unit. Further provided herein are devices wherein the distance between the centers of any two structures is about 10 nm to about 1000 nm. Further provided herein are devices wherein the distance between the centers of any two structures is about 100 nm to about 500 nm. Further provided herein are devices wherein the distance between the centers of any two structures is about 20 nm to about 300 nm. Further provided herein are devices wherein the distance between the centers of any two structures is about 100 nm. Further provided herein are devices wherein the distance between the centers of any two structures is about 200 nm. Further provided herein are devices wherein the distance between the centers of any two structures is about 500 nm. Further provided herein are devices wherein each structure comprises a 3-dimensional structure, wherein the 3-dimensional structure is a nanowell, a nanowire, a nanopost, or a nanorod. Further provided herein are devices wherein the solvent has a density of about 0.5 to about 1.5 g/mL. Further provided herein are devices wherein the solvent comprises a nitrile group. Further provided herein are devices wherein the solvent is trimethylacetonitrile. Further provided herein are devices wherein the solvent has a melting temperature of between 5 degrees C. to 18 degrees C. Further provided herein are devices wherein the solvent has a melting temperature of between 10 degrees C. to 18 degrees C. Further provided herein are devices wherein the solvent has a melting temperature of between 15 degrees C. to 18 degrees C. Further provided herein are devices wherein the device is used for polynucleotide synthesis, wherein polynucleotide synthesis comprises a plurality of elongation steps. Further provided herein are devices wherein the solvent is not removed during an elongation step. Further provided herein are methods for polynucleotide synthesis using the devices described herein.

Provided herein are devices for polynucleotide synthesis comprising: a solid support comprising a surface; a plurality of structures for polynucleotide extension located on the surface, wherein each structure has a width of about 10 nm to about 1000 nm, wherein each structure is in contact with a heating unit, and wherein the heating unit comprises at least one electrode; and a solvent distributed across the surface, wherein the solvent has a melting temperature of no more than about 18 degrees C. Further provided herein are devices wherein the surface comprises at least 30,000 loci for nucleic acid synthesis. Further provided herein are devices wherein the surface comprises at least 50,000 loci for nucleic acid synthesis. Further provided herein are devices wherein the surface comprises at least 100,000 loci for nucleic acid synthesis. Further provided herein are devices wherein the surface comprises at least 200,000 loci for nucleic acid synthesis. Further provided herein are devices wherein the surface comprises at least 1,000,000 loci for nucleic acid synthesis. Further provided herein are devices wherein the one or more electrodes are addressable electrodes that heats one or more individual loci. Further provided herein are devices wherein the solid support further comprises a cooling unit. Further provided herein are devices wherein the distance between the centers of any two structures is about 10 nm to about 1000 nm. Further provided herein are devices wherein the distance between the centers of any two structures is about 100 nm to about 500 nm. Further provided herein are devices wherein the distance between the centers of any two structures is about 20 nm to about 300 nm. Further provided herein are devices wherein the distance between the centers of any two structures is about 100 nm. Further provided herein are devices wherein the distance between the centers of any two structures is about 200 nm. Further provided herein are devices wherein the distance between the centers of any two structures is about 500 nm. Further provided herein are devices wherein each structure comprises a 3-dimensional structure, wherein the 3-dimensional structure is a nanowell, a nanowire, a nanopost, or a nanorod. Further provided herein are devices wherein the solvent has a density of about 0.5 to about 1.5 g/mL. Further provided herein are devices wherein the solvent is a polar solvent. Further provided herein are devices wherein the solvent comprises a nitrile group. Further provided herein are devices wherein the solvent is trimethylacetonitrile. Further provided herein are devices wherein the solvent has a melting temperature of between 5 degrees C. to 18 degrees C. Further provided herein are devices wherein the solvent has a melting temperature of between 10 degrees C. to 18 degrees C. Further provided herein are devices wherein the solvent has a melting temperature of between 15 degrees C. to 18 degrees C. Further provided herein are devices wherein the device is used for polynucleotide synthesis, wherein polynucleotide synthesis comprises a plurality of elongation steps. Further provided herein are devices wherein the solvent is not removed during an elongation step. Further provided herein are methods for polynucleotide synthesis using the devices described herein.

Provided herein are devices for polynucleotide synthesis comprising: a solid support comprising a surface; a plurality of structures for polynucleotide extension located on the surface, wherein each structure has a width of about 10 nm to about 1000 nm, wherein each structure is in contact with a heating unit, and wherein the heating unit comprises at least one electrode; and a solvent distributed across the surface, wherein the solvent has a boiling temperature of no more than about 82 degrees C. Further provided herein are devices wherein the surface comprises at least 30,000 loci for nucleic acid synthesis. Further provided herein are devices wherein the surface comprises at least 50,000 loci for nucleic acid synthesis. Further provided herein are devices wherein the surface comprises at least 100,000 loci for nucleic acid synthesis. Further provided herein are devices wherein the surface comprises at least 200,000 loci for nucleic acid synthesis. Further provided herein are devices wherein the surface comprises at least 1,000,000 loci for nucleic acid synthesis. Further provided herein are devices wherein the one or more electrodes are addressable electrodes that heats one or more individual loci. Further provided herein are devices wherein the solid support further comprises a cooling unit. Further provided herein are devices wherein the distance between the centers of any two structures is about 10 nm to about 1000 nm. Further provided herein are devices wherein the distance between the centers of any two structures is about 100 nm to about 500 nm. Further provided herein are devices wherein the distance between the centers of any two structures is about 20 nm to about 300 nm. Further provided herein are devices wherein the distance between the centers of any two structures is about 100 nm. Further provided herein are devices wherein the distance between the centers of any two structures is about 200 nm. Further provided herein are devices wherein the distance between the centers of any two structures is about 500 nm. Further provided herein are devices wherein each structure comprises a 3-dimensional structure, wherein the 3-dimensional structure is a nanowell, a nanowire, a nanopost, or a nanorod. Further provided herein are devices wherein the solvent has a density of about 0.5 to about 1.5 g/mL. Further provided herein are devices wherein the solvent has a boiling temperature of between 0 degrees C. to 82 degrees C. Further provided herein are devices wherein the solvent has a boiling temperature of between 30 degrees C. to 82 degrees C. Further provided herein are devices wherein the solvent has a boiling temperature of between 55 degrees C. to 82 degrees C. Further provided herein are devices wherein the device is used for polynucleotide synthesis, wherein polynucleotide synthesis comprises a plurality of elongation steps. Further provided herein are devices wherein the solvent is not removed during an elongation step. Further provided herein are methods for polynucleotide synthesis using the devices described herein.

Provided herein are methods for polynucleotide synthesis, comprising: providing predetermined sequences for a library of polynucleotides; providing a substrate comprising a surface; and synthesizing the library of polynucleotides extending from the surface, wherein different nucleotides are sequentially added before a deblocking step occurs. Further provided herein are methods wherein synthesizing further comprises a solvent, wherein the solvent undergoes at least one phase change. Further provided herein are methods wherein the solvent is a polar solvent. Further provided herein are methods wherein the solvent is trimethylacetonitrile. Further provided herein are methods wherein the solvent has a melting temperature between 15 degrees C. to 18 degrees C. Further provided herein are methods wherein the solvent has a density of between 0.5 and 1.5 g/mL. Further provided herein are methods wherein polynucleotide synthesis further comprises a plurality of elongation steps. Further provided herein are methods wherein the solvent is not removed during an elongation step. Further provided herein are methods wherein at least 2 different nucleotides are sequentially added before a deblocking step occurs. Further provided herein are methods wherein at least 3 different nucleotides are sequentially added before a deblocking step occurs. Further provided herein are methods wherein at least 4 different nucleotides are sequentially added before a deblocking step occurs. Further provided herein are methods wherein all of the surface is contacted with an identical nucleotide during an elongation step. Further provided herein are methods wherein the at least one phase change is melting or freezing. Further provided herein are methods wherein the at least one phase change is boiling or condensing.

Provided herein are methods for polynucleotide synthesis using the devices described herein.

Provided herein are methods for polynucleotide synthesis, the method comprising: providing predetermined sequences for a library of polynucleotides; providing a substrate comprising a surface; synthesizing the library of polynucleotides extending from the surface, wherein a solvent in the solid phase prevents deblocking of at least one polynucleotide extending from the at least one region of the surface, wherein the solvent has a melting temperature of no more than about 18 degrees C. Further provided herein are methods wherein synthesizing the library of polynucleotides extending from the surface comprises contacting the surface with a first nucleotide phosphoramidite. Further provided herein are methods wherein synthesizing the library of polynucleotides extending from the surface further comprises contacting the surface with a second nucleotide phosphoramidite, wherein the solvent is not removed between contact with the first nucleotide phosphoramidite and the second nucleotide phosphoramidite. Further provided herein are methods wherein synthesizing the library of polynucleotides extending from the surface further comprises melting the solvent present at the at least one region of the surface, and deblocking at least one extended polynucleotide extending from the surface in the at least one region. Further provided herein are methods wherein the solvent has a melting temperature of no more than about 15 degrees C. Further provided herein are methods wherein the solvent has a melting temperature of no more than about 10 degrees C. Further provided herein are methods wherein the solvent has a melting temperature of between 5 degrees C. to 18 degrees C. Further provided herein are methods wherein the solvent has a melting temperature of between 10 degrees C. to 18 degrees C. Further provided herein are methods wherein the solvent has a melting temperature of between 15 degrees C. to 18 degrees C. Further provided herein are methods wherein the surface comprises at least 30,000 loci for nucleic acid synthesis. Further provided herein are methods wherein the surface comprises at least 50,000 loci for nucleic acid synthesis. Further provided herein are methods wherein the surface comprises at least 100,000 loci for nucleic acid synthesis. Further provided herein are methods wherein the surface comprises at least 200,000 loci for nucleic acid synthesis. Further provided herein are methods wherein the surface comprises at least 1,000,000 loci for nucleic acid synthesis.

Provided herein are methods for polynucleotide synthesis, the method comprising: providing predetermined sequences for a library of polynucleotides; providing a substrate comprising a surface; synthesizing the library of polynucleotides extending from the surface, wherein a solvent in the gas phase prevents deblocking of at least one polynucleotide extending from the at least one region of the surface, wherein the solvent has a boiling temperature no more than about 82 degrees C. Further provided herein are methods wherein synthesizing the library of polynucleotides extending from the surface comprises contacting the surface with a first nucleotide phosphoramidite. Further provided herein are methods wherein synthesizing the library of polynucleotides extending from the surface further comprises contacting the surface with a second nucleotide phosphoramidite, wherein the solvent is not removed between contact with the first nucleotide phosphoramidite and the second nucleotide phosphoramidite. Further provided herein are methods wherein synthesizing the library of polynucleotides extending from the surface further comprises condensing the solvent present at the at least one region of the surface, and deblocking at least one extended polynucleotide extending from the surface in the at least one region. Further provided herein are methods wherein the solvent has a boiling temperature no more than about 75 degrees C. Further provided herein are methods wherein the solvent has a boiling temperature no more than about 65 degrees C. Further provided herein are methods wherein the solvent has a boiling temperature of between 0 degrees C. to 82 degrees C. Further provided herein are methods wherein the solvent has a boiling temperature of between 30 degrees C. to 82 degrees C. Further provided herein are methods wherein the solvent has a boiling temperature of between 55 degrees C. to 82 degrees C. Further provided herein are methods wherein the surface comprises at least 30,000 loci for nucleic acid synthesis. Further provided herein are methods wherein the surface comprises at least 50,000 loci for nucleic acid synthesis. Further provided herein are methods wherein the surface comprises at least 100,000 loci for nucleic acid synthesis. Further provided herein are methods wherein the surface comprises at least 200,000 loci for nucleic acid synthesis. Further provided herein are methods wherein the surface comprises at least 1,000,000 loci for nucleic acid synthesis.

INCORPORATION BY REFERENCE

All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

BRIEF DESCRIPTION OF THE DRAWINGS

The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:

FIG. 1 depicts a rigid structure, having flat features (loci), channels, or wells, respectively.

FIG. 2 depicts a schematic for the generation of polynucleotide libraries from cluster amplification.

FIG. 3A depicts a front cross section of a heated nanowell structure, having addressable wells.

FIG. 3B depicts a right cross section of a heated nanowell structure, having addressable wells.

FIG. 4A depicts a front cross section of a heated nanowell structure, having addressable wells.

FIG. 4B depicts a front cross section of a heated nanopost structure, having addressable nanoposts.

FIG. 5 depicts a front cross section of a heated nanorod structure, having addressable nanorods.

FIG. 6 depicts a front cross section of a nanowire structure attached to an addressable bottom contact.

FIG. 7 depicts a polynucleotide synthesis material deposition device.

FIG. 8 depicts a polynucleotide synthesis workflow.

FIG. 9 depicts a computer system.

FIG. 10 depicts a block diagram illustrating the architecture of a computer system.

FIG. 11 depicts a network configured to incorporate a plurality of computer systems, a plurality of cell phones and personal data assistants, and Network Attached Storage (NAS).

FIG. 12 depicts a multiprocessor computer system using a shared virtual address memory space.

DETAILED DESCRIPTION OF THE INVENTION Definitions

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which these inventions belong.

Throughout this disclosure, numerical features are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of any embodiments. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range to the tenth of the unit of the lower limit unless the context clearly dictates otherwise. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual values within that range, for example, 1.1, 2, 2.3, 5, and 5.9. This applies regardless of the breadth of the range. The upper and lower limits of these intervening ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention, unless the context clearly dictates otherwise.

The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of any embodiment. As used herein, the singular forms “a,” “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms “comprises” and/or “comprising,” when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof. As used herein, the term “and/or” includes any and all combinations of one or more of the associated listed items.

Unless specifically stated or obvious from context, as used herein, the term “about” in reference to a number or range of numbers is understood to mean the stated number and numbers+/−10% thereof, or 10% below the lower listed limit and 10% above the higher listed limit for the values listed for a range.

As used herein, the terms “preselected sequence”, “predefined sequence” or “predetermined sequence” are used interchangeably. The terms mean that the sequence of the polymer is known and chosen before synthesis or assembly of the polymer. In particular, various aspects of the invention are described herein primarily with regard to the preparation of nucleic acids molecules, the sequence of the oligonucleotide or polynucleotide being known and chosen before the synthesis or assembly of the nucleic acid molecules.

Provided herein are methods and compositions for production of synthetic (i.e. de novo synthesized or chemically synthesizes) polynucleotides. The term oligonucleotide, oligo, and polynucleotide are defined to be synonymous throughout. Libraries of synthesized polynucleotides described herein may comprise a plurality of polynucleotides collectively encoding for one or more genes or gene fragments. In some instances, the polynucleotide library comprises coding or non-coding sequences. In some instances, the polynucleotide library encodes for a plurality of cDNA sequences. Reference gene sequences from which the cDNA sequences are based may contain introns, whereas cDNA sequences exclude introns. Polynucleotides described herein may encode for genes or gene fragments from an organism. Exemplary organisms include, without limitation, prokaryotes (e.g., bacteria) and eukaryotes (e.g., mice, rabbits, humans, and non-human primates). In some instances, the polynucleotide library comprises one or more polynucleotides, each of the one or more polynucleotides encoding sequences for multiple exons. Each polynucleotide within a library described herein may encode a different sequence, i.e., non-identical sequence. In some instances, each polynucleotide within a library described herein comprises at least one portion that is complementary to sequence of another polynucleotide within the library. Polynucleotide sequences described herein may, unless stated otherwise, comprise DNA or RNA. Provided herein are methods and compositions for production of synthetic (i.e. de novo synthesized) genes. Libraries comprising synthetic genes may be constructed by a variety of methods described in further detail elsewhere herein, such as PCA, non-PCA gene assembly methods or hierarchical gene assembly, combining (“stitching”) two or more double-stranded polynucleotides to produce larger DNA units (i.e., a chassis). Libraries of large constructs may involve polynucleotides that are at least 1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 250, 300, 400, 500 kb long or longer. The large constructs can be bounded by an independently selected upper limit of about 5000, 10000, 20000 or 50000 base pairs. The synthesis of any number of polypeptide-segment encoding nucleotide sequences, including sequences encoding non-ribosomal peptides (NRPs), sequences encoding non-ribosomal peptide-synthetase (NRPS) modules and synthetic variants, polypeptide segments of other modular proteins, such as antibodies, polypeptide segments from other protein families, including non-coding DNA or RNA, such as regulatory sequences e.g. promoters, transcription factors, enhancers, siRNA, shRNA, RNAi, miRNA, small nucleolar RNA derived from microRNA, or any functional or structural DNA or RNA unit of interest. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, intergenic DNA, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), small nucleolar RNA, ribozymes, complementary DNA (cDNA), which is a DNA representation of mRNA, usually obtained by reverse transcription of messenger RNA (mRNA) or by amplification; DNA molecules produced synthetically or by amplification, genomic DNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. cDNA encoding for a gene or gene fragment referred to herein, may comprise at least one region encoding for exon sequence(s) without an intervening intron sequence found in the corresponding genomic sequence. Alternatively, the corresponding genomic sequence to a cDNA may lack an intron sequence in the first place.

Devices for Polynucleotide Synthesis

Provided herein are processes and devices for the selective synthesis of polynucleotides in addressable locations based on a phase change process. The selectivity is achieved by blocking synthesis on an active polynucleotide synthesis surface, by converting a reaction solvent phase, such as a liquid solvent, in the reaction well to a non-reactive phase, such as a solid or gas which limits exposure to reagents in the surrounding solvent. Heating or cooling in the reaction well provides for a shift in the physical state of the solvent exposed to the polynucleotide synthesis surface. During an iterative synthetic protocol, structures such as nanostructures comprising local addressable heaters (heating units, comprising for example one or more electrodes or heating elements) are used to melt or boil the solvent, affording accessibility at defined locations on the synthesis surface for downstream interactions, such as nucleoside coupling and extension reactions.

Provided herein are structures having a surface with a plurality of features (loci) for polynucleotide synthesis or extension. Each feature on a structure in some instances comprises one or more smaller structures, such as a nanostructure, for controlling the phase of the surrounding solvent in a region of a feature. Each feature in a portion of the structure 101, may comprise a substantially planar feature 103, a well 105, or a channel. See FIG. 1. In one instance each feature of the structure has a width of about 10 nm to about 10 μm and a distance between the center of each feature of about 10 nm to about 10 μm. The cross sectional shape of the feature may comprise, without limitation, a circle, a rectangle, a triangle or a polygon. The shape of the feature may be tapered, round, a well, a channel, a wire, a rod, a pole, a cone, or any combination thereof.

In some instances, the polynucleotides are synthesized on a cluster of loci for polynucleotide extension, released and then subsequently subjected to an amplification reaction, e.g., PCR. An exemplary workflow of synthesis of polynucleotides from a cluster is depicted in FIG. 2. A silicon plate 201 includes multiple clusters 203. Within each cluster are multiple loci 221. Polynucleotides are synthesized 207 de novo on a plate 201 from the cluster 203. Polynucleotides are cleaved 211 and removed 213 from the plate to form a population of released polynucleotides 215. The population of released polynucleotides 215 are then amplified 217 to form a library of amplified polynucleotides 219.

In a first structure, a heated nanowell for solid-liquid phase control provides for polynucleotide synthesis. See FIG. 3A and FIG. 3B, device 300. Each feature in a portion of the structure 301, may be a substantially planar feature 303 (e.g., flat), a well 305, or a channel. In some instances, the substantially planar feature 303 comprises a first material 307, a second material 309, a third material 311 and a fourth material 313, wherein the third material 311 covers a first portion of the first material 307 and the second material 309, and wherein the fourth material 313 covers a second portion of the first material 307 and the second material 309. The first 307, second 309, third 311, and fourth 313 materials comprise conductors, semiconductors, or insulators. In some instances, the first material 307 comprises a semiconducting material, such as silicon. In some instances, the second material 309 forms two or more columns of bottom addressable electrodes. In some instances, the second material 309 comprises a conductor, such as a metal. In some instances the second material 309 comprises tungsten. In some instances, the third material 311 comprises an insulator, such as silicon dioxide. In some instances, the fourth material 313 forms two or more rows of top addressable electrodes. In some instances, the fourth material 313 comprises a conductor, such as a metal. In some instances the third material 311 comprises titanium nitride. Consistent with the specification, other metals, semi-conductors, and insulators are used.

In some instances, simultaneously applying a current to one or more of the columns of the bottom addressable electrodes 309, and one or more of the rows of the top addressable electrodes 313, heats one or more wells 305 associated with the intersection of the corresponding column of the one or more bottom electrodes 309, and the corresponding row of the one or more top electrodes 313. In some aspects, the first material 307 and the bottom electrodes 309 serve to conduct heat away from a synthesis surface 302 to a cooling element (or cooling unit, or cold chuck). In some instances, lined wells 305 act as a heater and are selective against the deposition of the nucleotide binding chemistry. In some instances, an insulator, such as SiO2 is used to thermally isolate the wells 305 and the top surface of the device 300. In some instances, a device for the selective synthesis of polynucleotides comprises one or more heating elements comprised of one or more addressable electrodes.

In a second structure, a heated nanowell for liquid-gas phase control provides for polynucleotide synthesis. See FIG. 4A. Each feature in a portion of the device 400, may be a well 401, or a channel. In some instances, the well is a cylinder shape. In some instances, the device 400 comprises a top contact 403, a first heating element 404, a first material 405, a second heating element 406, a bottom contact 408, and a second material 409 wherein the top contact 403 covers a first portion of the first material 405 and a first portion of the first heating element 404, wherein the first heating element 404 covers a first portion of the second heating element 406, and a second portion of the first material 405, wherein the first material 405 covers a first portion of the second material 409, and wherein the bottom contact 408 contacts both the second heating element 406 and the second material 409. In some instances, the top contact 403 and the bottom contact form top 403 and bottom 408 addressable contacts, respectively. In some instances, the top contact 403 and the bottom contact 408 comprise a conductor, such as a metal. In some instances, the first material 405 and the second material 409 comprise an insulating material, such as silicon dioxide. In some instances, the first heating element 404 and the second heating element 406 comprise semiconducting materials, such as silicon. The semiconducting material in some instances comprises one or more dopants, such as but not limited to phosphorus, antimony, arsenic, boron, aluminum, or indium. Alternately or in combination, the first heating element 404 and the second heating element 406 are conductors.

In some instances, simultaneously applying an electrical current to one or more of the bottom addressable contacts 408, and one or more of the top addressable contacts 403 to form an electrical path heats one or more wells 401 associated with the intersection of the corresponding one or more bottom contacts 408, and the corresponding one or more top contacts 403, such as at the first heating element 404 and the second heating element 406, respectively. In some instances, heating of a solvent 402 by applying an electrical current through the device causes solvent vaporization to form a vapor nanobubble 417 that prevents solvent contact with the synthesis surface 407, which collapses when the electrical current flow or heating is discontinued. In some instances, the electrical path includes at least one semiconductor junction, such as a p-n junction. In some instances, this junction determines the current intensity, and improves heating element stability. In some instances, the fourth material 406 forms a heating element, and comprises a doped semiconductor resistor.

In a third structure, a heated nanopost for liquid-gas phase control provides for polynucleotide synthesis. See FIG. 4B, device 410. Each feature in a portion of the device 410, may be a nanopost. In some instances, the feature 410 comprises a core contact 412, a first material 413, a surface contact 414, a heating element 415, and a second material 416 wherein the surface contact 414 covers a first portion of the first material 413, wherein the heating element 415 covers a first portion of the first material 413 and a first portion of the surface contact 414, wherein the second material 416 covers a first portion of the core contact 412 and a second portion of surface contact 414. In some instances, heating of a solvent 402 by applying an electrical current through the device causes solvent vaporization to form a gas bubble 417 which prevents solvent contact with the synthesis surface 407, and collapses when the electrical current flow or heating is discontinued. In some instances, the core contact 412, surface contact 414, and the heating element 415 comprise a conductor, such as a metal. In some instances, the first material 413 and the second material 416 comprise an insulating material. In some instances, the heating element 415 comprises a semiconducting material.

In some instances, simultaneously applying a current to one or more top surface contacts 414 and one or more conductive core contacts 412 heats one or more electrical resistor sidewalls (heating elements) 415. In some instances, heating of a solvent 402 by applying an electrical current through the device causes solvent vaporization to form a vapor nanobubble 417 that prevents solvent contact with the synthesis surface 407 and collapses when the electrical current flow or heating is discontinued.

In a fourth structure, a heated nanorod for liquid-gas phase control provides for polynucleotide synthesis. See FIG. 5, device 500. Each feature in a portion of the device 500, may comprise one or more nanorods 502, including but not limited to nanowires or carbon nanotubes. The location of polynucleotide synthesis or extension 507 in FIG. 5 is shown for illustration only; synthesis or extension may take place anywhere on the nanorod 502. In some instances, the device 500 is comprised of a heating element 501, a nanorod 502, a top contact 503, a first material 504, and a bottom contact 505 wherein the top contact 503 covers a first portion of first material 504, wherein the heating element 501 covers a second portion of the first material 504 and a first portion of the bottom contact 505, and wherein the nanorod 502 covers a third portion of the first material 504.

In some instances, the top contact 503 and the bottom contact 505 form top 503 and bottom 505 addressable contacts, respectively. In some instances, the top contact 503 and the bottom contact 505 comprise a conductor, such as a metal. In some instances, the first material 504 comprises an insulating material. In some instances, the heating element 501 comprises a semiconducting material, such as silicon. The semiconducting material in some instances comprises one or more dopants, such as but not limited to phosphorus, antimony, arsenic, boron, aluminum, or indium. In some instances, the heating element 501 comprises a conductor, such as a metal.

In some instances, simultaneously applying a current to one or more of the bottom addressable contacts 505, and one or more of the top addressable contacts 503 to form an electrical path through heating element 501 and solvent 506 heats the area surrounding one or more nanorods 502 or nanorod clusters. In some instances, heating a solvent 506 by applying an electrical current through the device causes solvent vaporization to form a vapor nanobubble 517 which collapses when the electrical current flow or heating is discontinued. The vapor bubble 517 separates the synthesis surface 507 from the solvent 506. In some instances, the electrical path includes at least one semiconductor junction, such as a p-n junction at the heating element 501. In some instances, this junction determines the current intensity, and improves heating element stability. In some instances, the heating element 501 comprises a doped semiconductor resistor. In some instances, the nanorod 502 provides increased surface area for nucleotide coupling, leading to higher polynucleotide yields. In some instances, the number and scale of nanorods 502 and electrodes may be reduced.

In a fifth structure, a nanorod on a contact provides for polynucleotide synthesis. See FIG. 6, device 600. Each feature in a portion of the device 600, may be one or more nanorods 603, including but not limited to nanowires or carbon nanotubes. In some instances, nanorods 603 are in contact with solvent 604. The location of polynucleotide synthesis or extension 607 in FIG. 6 is shown for illustration only; synthesis or extension may take place anywhere on the nanorod 603. In some instances, the substantially planar feature 600 comprises a bottom contact 601, one or more nanorods 603, and a first material 602, wherein the first material 602 covers a first portion of the bottom contact 601. In some instances, the bottom contact 601 forms a bottom addressable contact. In some instances, the bottom contact 601 comprises a conductor, such as a metal. In some instances, the nanorod 603 comprises a conductor or a semiconductor. In some instances, the first material 602 comprises an insulating material.

In some instances, the nanorods 603 comprise a conductive material. In some instances, the nanorod feature 607 provides increased surface area for nucleotide coupling, leading to higher polynucleotide yields. In some instances, the number and scale of nanorods and contacts may be reduced, for example, to one nanorod with one contact. In some instances, the bottom contact 601 is a thermal contact. In some instances, cooling of the bottom contact 601 cools one or more nanorods 607, and coats the one or more nanorods 603 with a layer of frozen solvent, that prevents solvent contact with the synthesis surface 607.

Structures for Polynucleotide Synthesis

In some instances, a well described herein has a width to depth (or height) ratio of 20 to 0.01, wherein the width is a measurement of the width at the narrowest segment of the well. In some instances, a well described herein has a width to depth (or height) ratio of 20 to 0.05, wherein the width is a measurement of the width at the narrowest segment of the well. In some instances, a well described herein has a width to depth (or height) ratio of 1 to 0.01, wherein the width is a measurement of the width at the narrowest segment of the well. In some instances, a well described herein has a width to depth (or height) ratio of 0.5 to 0.01, wherein the width is a measurement of the width at the narrowest segment of the well. In some instances, a well described herein has a width to depth (or height) ratio of about 0.01, 0.05, 0.1, 0.15, 0.16, 0.2, 0.5, 1, 2, 5, 10 or 20.

In some instances, a well described herein has a diameter to depth (or height) ratio of 20 to 0.01, wherein the diameter is a measurement of the diameter at the narrowest segment of the well. In some instances, a well described herein has a diameter to depth (or height) ratio of 20 to 0.05, wherein the diameter is a measurement of the diameter at the narrowest segment of the well. In some instances, a well described herein has a diameter to depth (or height) ratio of 1 to 0.01, wherein the diameter is a measurement of the diameter at the narrowest segment of the well. In some instances, a well described herein has a diameter to depth (or height) ratio of 0.5 to 0.01, wherein the diameter is a measurement of the diameter at the narrowest segment of the well. In some instances, a well described herein has a diameter to depth (or height) ratio of about 0.01, 0.05, 0.1, 0.15, 0.16, 0.2, 0.5, 1, 2, 5, 10, or 20.

In some instances, a structure described herein comprises a plurality of wells, wherein the height or depth of the well is from about 10 nm to about 10 μm, from about 10 nm to about 1 μm, from about 10 nm to about 500 nm, from about 10 nm to about 100 nm, from about 50 nm to about 700 nm, from about 50 nm to about 600 nm, from about 50 nm to about 500 nm, from about 50 nm to about 400 nm, from about 50 nm to about 300 nm, from about 50 nm to about 200 nm, or from about 50 nm to about 100 nm. In some instances, the height of a well is no more than 10 μm, 5 μm, 2 μm, 1 μm, 500 nm, 200 nm, 100 nm, 50 nm, 20 nm, or no more than 10 nm. In some instances, the well height is about 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 200 nm, 300 nm, 400 nm, 500 nm, 1 μm, 2 μm, 5 μm, 10 μm, or more than 10 μm.

In some instances, a structure described herein comprises a plurality of wells, wherein the width of the well is from about 10 nm to about 10 μm, from about 10 nm to about 1 μm, from about 10 nm to about 500 nm, from about 10 nm to about 100 nm, from about 50 nm to about 700 nm, from about 50 nm to about 600 nm, from about 50 nm to about 500 nm, from about 50 nm to about 400 nm, from about 50 nm to about 300 nm, from about 50 nm to about 200 nm, or from about 50 nm to about 100 nm. In some instances, the width of a well is no more than 10 μm, 5 μm, 2 μm, 1 μm, 500 nm, 200 nm, 100 nm, 50 nm, 20 nm, or no more than 10 nm. In some instances, well width is about 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 200 nm, 300 nm, 400 nm, 500 nm, 1 μm, 2 μm, 5 μm, 10 μm, or more than 10 μm.

In some instances, a structure described herein comprises a plurality of wells, wherein the diameter of the well is from about 10 nm to about 10 μm, from about 10 nm to about 1 μm, from about 10 nm to about 500 nm, from about 10 nm to about 100 nm, from about 50 nm to about 700 nm, from about 50 nm to about 600 nm, from about 50 nm to about 500 nm, from about 50 nm to about 400 nm, from about 50 nm to about 300 nm, from about 50 nm to about 200 nm, or from about 50 nm to about 100 nm. In some instances, the diameter of a well is no more than 10 μm, 5 μm, 2 μm, 1 μm, 500 nm, 200 nm, 100 nm, 50 nm, 20 nm, or no more than 10 nm. In some instances, well diameter is about 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 200 nm, 300 nm, 400 nm, 500 nm, 1 μm, 2 μm, 5 μm, 10 μm, or more than 10 μm.

In some instances, a spot or substantially planar feature described herein has a diameter from about 50 nm to about 1000 nm, from about 50 nm to about 900 nm, from about 50 nm to about 800 nm, from about 50 nm to about 700 nm, from about 50 nm to about 600 nm, from about 50 nm to about 500 nm, from about 50 nm to about 400 nm, from about 50 nm to about 300 nm, from about 50 nm to about 200 nm, or from about 50 nm to about 100 nm.

In some instances, a channel described herein has a width to depth (or height) ratio of 20 to 0.01, wherein the channel is a measurement of the width at the narrowest segment of the channel. In some instances, a channel described herein has a width to depth (or height) ratio of 20 to 0.05, wherein the width is a measurement of the width at the narrowest segment of the channel. In some instances, a channel described herein has a width to depth (or height) ratio of 1 to 0.01, wherein the width is a measurement of the width at the narrowest segment of the channel. In some instances, a channel described herein has a width to depth (or height) ratio of 0.5 to 0.01, wherein the width is a measurement of the width at the narrowest segment of the well. In some instances, a channel described herein has a width to depth (or height) ratio of about 0.01, 0.05, 0.1, 0.15, 0.16, 0.2, 0.5, 1, 2, 5, 10 or 20.

In some instances, a channel described herein has a diameter to depth (or height) ratio of 20 to 0.01, wherein the diameter is a measurement of the diameter at the narrowest segment of the channel. In some instances, a channel described herein has a diameter to depth (or height) ratio of 20 to 0.05, wherein the diameter is a measurement of the diameter at the narrowest segment of the channel. In some instances, a channel described herein has a diameter to depth (or height) ratio of 1 to 0.01, wherein the diameter is a measurement of the diameter at the narrowest segment of the channel. In some instances, a channel described herein has a diameter to depth (or height) ratio of 0.5 to 0.01, wherein the diameter is a measurement of the diameter at the narrowest segment of the channel. In some instances, a channel described herein has a diameter to depth (or height) ratio of about 0.01, 0.05, 0.1, 0.15, 0.16, 0.2, 0.5, 1, 2, 5, 10, or 20.

In some instances, a structure described herein comprises a plurality of channels, wherein the height or depth of the channel is from about 10 nm to about 10 μm, from about 10 nm to about 1 μm, from about 10 nm to about 500 nm, from about 10 nm to about 100 nm, from about 50 nm to about 700 nm, from about 50 nm to about 600 nm, from about 50 nm to about 500 nm, from about 50 nm to about 400 nm, from about 50 nm to about 300 nm, from about 50 nm to about 200 nm, or from about 50 nm to about 100 nm. In some instances, the height of a channel is no more than 10 μm, 5 μm, 2 μm, 1 μm, 500 nm, 200 nm, 100 nm, 50 nm, 20 nm, or no more than 10 nm. In some instances, channel height is about 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 200 nm, 300 nm, 400 nm, 500 nm, 1 μm, 2 μm, 5 μm, 10 μm, or more than 10 μm.

In some instances, a structure described herein comprises a plurality of channels, wherein the width of the channel is from about 10 nm to about 10 μm, from about 10 nm to about 1 μm, from about 10 nm to about 500 nm, from about 10 nm to about 100 nm, from about 50 nm to about 700 nm, from about 50 nm to about 600 nm, from about 50 nm to about 500 nm, from about 50 nm to about 400 nm, from about 50 nm to about 300 nm, from about 50 nm to about 200 nm, or from about 50 nm to about 100 nm. In some instances, the width of a channel is no more than 10 μm, 5 μm, 2 μm, 1 μm, 500 nm, 200 nm, 100 nm, 50 nm, 20 nm, or no more than 10 nm. In some instances, channel width is about 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 200 nm, 300 nm, 400 nm, 500 nm, 1 μm, 2 μm, 5 μm, 10 μm, or more than 10 μm.

In some instances, a structure described herein comprises a plurality of channels, wherein the diameter of the channel is from about 10 nm to about 10 μm, from about 10 nm to about 1 μm, from about 10 nm to about 500 nm, from about 10 nm to about 100 nm, from about 50 nm to about 700 nm, from about 50 nm to about 600 nm, from about 50 nm to about 500 nm, from about 50 nm to about 400 nm, from about 50 nm to about 300 nm, from about 50 nm to about 200 nm, or from about 50 nm to about 100 nm. In some instances, the diameter of a channel is no more than 10 μm, 5 μm, 2 μm, 1 μm, 500 nm, 200 nm, 100 nm, 50 nm, 20 nm, or no more than 10 nm. In some instances, well diameter is about 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 200 nm, 300 nm, 400 nm, 500 nm, 1 μm, 2 μm, 5 μm, 10 μm, or more than 10 μm.

In some instances, the width of a feature (e.g., substantially planar feature, well, channel, or other feature supporting polynucleotide synthesis) is from about 10 nm to about 10 μm, from about 100 nm to about 10 μm, from about 200 nm to about 1 μm, from about 50 nm to about 500 nm, from about 50 nm to about 200 μm, or from about 10 nm to about 100 nm, for example, about 10 μm, 5 μm, 2 μm, 1 μm, 500 nm, 200 nm, 100 nm, 50 nm, 20 nm, or 10 nm. In some instances, the width of a feature is no more than about 10 μm, 5 μm, 2 μm, 1 μm, 500 nm, 200 nm, 100 nm, 50 nm or 10 nm. In some instances, the distance between the center of two adjacent features is from about 10 nm to about 10 μm, 20 nm to about 5 μm, from about 50 nm to about 2 nm, from about 100 nm to about 1 μm, from about 200 nm to about 500 nm, from about 200 nm to about 1 μm, from about 200 nm to about 750 nm, or from about 300 nm to about 600 nm, for example, about 500 nm. In some instances, the total width of a feature is about 10 nm, 20 nm, 50 nm, 100 nm, 200 nm, 500 nm, 1 μm, 5 μm, 10 μm, 20 μm, 30 μm, 40 μm, 50 μm, 60 μm, 70 μm, 80 μm, 90 μm, or 100 μm. In some instances, the total width of a feature is about 10 nm to 1 μm, 20 nm to 500 nm, or 50 nm to 100 nm.

In some instances, the width of a structure (e.g., substantially planar structure, well, channel, nanowell, nanorod, nanopost, or other nanostructure supporting polynucleotide synthesis) is from about 10 nm to about 10 μm, from about 100 nm to about 10 μm, from about 200 nm to about 1 μm, from about 50 nm to about 500 nm, from about 50 nm to about 200 μm, or from about 10 nm to about 100 nm, for example, about 10 μm, 5 μm, 2 μm, 1 μm, 500 nm, 200 nm, 100 nm, 50 nm, 20 nm, or 10 nm. In some instances, the width of a structure is no more than about 10 μm, 5 μm, 2 μm, 1 μm, 500 nm, 200 nm, 100 nm, 50 nm or 10 nm. In some instances, the distance between the center of two adjacent structures is from about 10 nm to about 10 μm, 20 nm to about 5 μm, from about 50 nm to about 2 nm, from about 100 nm to about 1 μm, from about 200 nm to about 500 nm, from about 200 nm to about 1 μm, from about 200 nm to about 750 nm, or from about 300 nm to about 600 nm, for example, about 500 nm. In some instances, the total width of a structure is about 10 nm, 20 nm, 50 nm, 100 nm, 200 nm, 500 nm, 1 μm, 5 μm, 10 μm, 20 μm, 30 μm, 40 μm, 50 μm, 60 μm, 70 μm, 80 μm, 90 μm, or 100 μm. In some instances, the total width of a structure is about 10 nm to 1 μm, 20 nm to 500 nm, or 50 nm to 100 nm.

Surfaces for Polynucleotide Synthesis

In some instances, each feature supports the synthesis of a population of polynucleotides having a different sequence than a population of polynucleotides grown on another feature. Provided herein are surfaces which comprise at least 10, 100, 256, 500, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 11,000, 12,000, 13,000, 14,000, 15,000, 20,000, 30,000, 40,000, 50,000 or more clusters. Provided herein are surfaces which comprise more than 2,000; 5,000; 10,000; 20,000; 30,000; 50,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 5,000,000; or 10,000,000 or more distinct features. In some instances, each cluster includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 150, 200, 500 or more features. In some instances, each cluster includes 50 to 500, 50 to 200, 50 to 150, or 100 to 150 features. In some instances, each cluster includes 100 to 150 features. In exemplary arrangements, each cluster includes 109, 121, 130 or 137 features. In some instances, each structure within a feature (such as a nanostructure) supports the synthesis of a population of polynucleotides having a different sequence than a population of polynucleotides grown on another structure, within the same feature. Provided herein are features which in some instances each comprise at least 1; 2; 5; 10; 20; 50; 100; 200, 500, 1,000, 2,000, 5,000, 10,000, 20,000 or more than 200,000 distinct nanostructures. In some instances, each feature comprises about 10 to about 500, about 50 to about 250, about 10 to about 1000, or about 1 to about 50 nanostructures.

Provided herein are features having a width at the longest segment of 10 nm to 1 μm. In some instances, the features have a width at the longest segment of about 10, 20, 30, 35, 40, 45, 50, 55 or 60 nm. In some instances, the features are channels having multiple segments, wherein each segment has a center to center distance apart of 5 to 50 nm. In some instances, the center to center distance apart for each segment is about 5, 10, 15, 20 or 25 nm.

In some instances, the number of distinct polynucleotides synthesized on the surface of a structure described herein is dependent on the number of distinct features available in the substrate. In some instances, the density of features within a cluster of a substrate is at least or about 1 feature per mm2, 10 features per mm2, 25 features per mm2, 50 features per mm2, 65 features per mm2, 75 features per mm2, 100 features per mm2, 130 features per mm2, 150 features per mm2, 175 features per mm2, 200 features per mm2, 300 features per mm2, 400 features per mm2, 500 features per mm2, 1,000 features per mm2, 2,000 features per mm2, 5,000 features per mm2, 10,000 features per mm2, 100,000 features per mm2, 1,000,000 features per mm2 or more than 1,000,000 features per mm2. In some instances, a substrate comprises from about 10 features per mm2 to about 500 features per mm2, from about 25 features per mm2 to about 400 features per mm2, from about 50 features per mm2 to about 500 features per mm2, from about 100 features per mm2 to about 500 features per mm2, from about 150 features per mm2 to about 500 features per mm2, from about 10 features per mm2 to about 250 features per mm2, from about 50 features per mm2 to about 250 features per mm2, from about 10 features per mm2 to about 200 features per mm 2, or from about 50 features per mm2 to about 200 features per mm2. In some instances, the density of features within a cluster of a substrate is at least or about 1 feature per μm2, 10 features per μm2, 25 features per μm2, 50 features per μm2, 65 features per μm2, 75 features per μm2, 100 features per μm2, 130 features per μm2, 150 features per μm2, 175 features per μm2, 200 features per μm2, 300 features per μm2, 400 features per μm2, 500 features per μm2, 1,000 features per μm2, 2,000 features per μm2, 5,000 features per μm2, 10,000 features per μm2 100,000 features per μm2, 1,000,000 features per μm2 or more than 1,000,000 features per μm2. In some instances, a substrate comprises from about 10 features per μm2 to about 500 features per μm2, from about 25 features per μm2 to about 400 features per μm2, from about 50 features per μm2 to about 500 features per μm2, from about 100 features per μm2 to about 500 features per μm2, from about 150 features per μm2 to about 500 features per μm2, from about 10 features per μm2 to about 250 features per μm2, from about 50 features per μm2 to about 250 features per μm2, from about 10 features per μm2 to about 200 features per μm2, or from about 50 features per μm2 to about 200 features per μm2. In some instances, the distance between the centers of two adjacent features within a cluster is from about 10 μm to about 500 μm, from about 10 μm to about 200 μm, or from about 10 μm to about 100 μm. In some instances, the distance between two centers of adjacent features is greater than about 10 μm, 20 μm, 30 μm, 40 μm, 50 μm, 60 μm, 70 μm, 80 μm, 90 μm or 100 μm. In some instances, the distance between the centers of two adjacent features is less than about 200 μm, 150 μm, 100 μm, 80 μm, 70 μm, 60 μm, 50 μm, 40 μm, 30 μm, 20 μm or 10 μm. In some instances, the distance between the centers of two adjacent features within a cluster is from about 10 nm to about 1000 nm, from about 10 nm to about 500 nm, 10 nm to about 200 nm, or from about 10 nm to about 100 nm. In some instances, the distance between two centers of adjacent features is greater than about 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm or 100 nm. In some instances, the distance between the centers of two adjacent features is less than about 500 nm, 200 nm, 150 nm, 100 nm, 80 nm, 70 nm, 60 nm, 50 nm, 40 nm, 30 nm, 20 nm or 10 nm. In some instances, each square meter of a structure described herein allows for at least about 107, 108, 109, 1010, 1011, or at least about 1012 features, where each feature supports one polynucleotide. In some instances, each square meter of a structure described herein allows for at least about 107, 108, 109, 1010, 1011, or at least about 1012 features, where each feature supports a plurality of different polynucleotides. In some instances, 109 polynucleotides are supported on less than about 6, 5, 4, 3, 2 or 1 m2 of a structure described herein.

In some instances, a structure described herein provides support for the synthesis of more than 2,000; 5,000; 10,000; 20,000; 30,000; 50,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000; 100,000,000 or more non-identical polynucleotides. In some instances, the structure provides support for the synthesis of more than 2,000; 5,000; 10,000; 20,000; 50,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000; 100,000,000 or more polynucleotides encoding for distinct sequences. In some instances, at least a portion of the polynucleotides have an identical sequence or are configured to be synthesized with an identical sequence. In some instances, the structure provides a surface environment for the growth of polynucleotides having at least about 50, 60, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 1,000, 2,000 bases or more than 2,000 bases. In some instances, the structure provides a surface environment for the growth of polynucleotides having between 50 and 2,000, bases, 50 and 1,000, 50 and 500, 50 and 250, or between 100 and 1,000, 100 and 500, or between 100 and 300 bases.

In some instances, polynucleotides are synthesized on distinct features of a structure, wherein each feature supports the synthesis of a population of polynucleotides. In some instances, each feature supports the synthesis of a population of polynucleotides having a different sequence than a population of polynucleotides grown on another locus. In some instances, the features of a structure are located within a plurality of clusters. In some instances, a structure comprises at least 10, 500, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 11,000, 12,000, 13,000, 14,000, 15,000, 20,000, 30,000, 40,000, 50,000 or more clusters. In some instances, a structure comprises more than 2,000; 5,000; 10,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,100,000; 1,200,000; 1,300,000; 1,400,000; 1,500,000; 1,600,000; 1,700,000; 1,800,000; 1,900,000; 2,000,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; or 10,000,000 or more distinct features. In some instances, each cluster includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 150 or more features (loci). In some instances, each cluster includes 50 to 500, 100 to 150, or 100 to 200 features. In some instances, each cluster includes 109, 121, 130 or 137 features. In some instances, each cluster includes 5, 6, 7, 8, 9, 10, 11 or 12 features. In some instances, polynucleotides from distinct features within one cluster have sequences that, when assembled, encode for a contiguous longer polynucleotide of a predetermined sequence.

Structure Size

In some instances, a structure described herein is about the size of a standard 96 well plate, for example between about 100 and 200 mm by between about 50 and 150 mm. In some instances, a structure described herein has a diameter less than or equal to about 1000 mm, 500 mm, 450 mm, 400 mm, 300 mm, 250 nm, 200 mm, 150 mm, 100 mm or 50 mm. In some instances, the diameter of a substrate is between about 25 mm and 1000 mm, between about 25 mm and about 800 mm, between about 25 mm and about 600 mm, between about 25 mm and about 500 mm, between about 25 mm and about 400 mm, between about 25 mm and about 300 mm, or between about 25 mm and about 200. Non-limiting examples of substrate size include about 300 mm, 200 mm, 150 mm, 130 mm, 100 mm, 76 mm, 51 mm and 25 mm. In some instances, a substrate has a planar surface area of at least about 100 mm2; 200 mm2; 500 mm2, 1,000 mm2; 2,000 mm2; 5,000 mm2; 10,000 mm2; 12,000 mm2; 15,000 mm2; 20,000 mm2; 30,000 mm2; 40,000 mm2; 50,000 mm2 or more. In some instances, a substrate has a thickness between about 50 mm and about 2000 mm, between about 50 mm and about 1000 mm, between about 100 mm and about 1000 mm, between about 200 mm and about 1000 mm, or between about 250 mm and about 1000 mm. Non-limiting examples of thickness include 275 mm, 375 mm, 525 mm, 625 mm, 675 mm, 725 mm, 775 mm and 925 mm. In some instances, the thickness of the substrate varies with diameter and depends on the composition of the substrate. For example, a structure comprising materials other than silicon may have a different thickness than a silicon structure of the same diameter. Structure thickness may be determined by the mechanical strength of the material used and the structure must be thick enough to support its own weight without cracking during handling. In some instances, a structure is more than about 1, 2, 3, 4, 5, 10, 15, 30, 40, 50 feet in any one dimension.

In some instances, a structure described herein comprises a nanostructure, for example between about 10 and 200 nm by between about 10 and 150 nm. In some instances, a structure described herein has a diameter less than or equal to about 1000 nm, 500 nm, 450 nm, 400 nm, 300 nm, 250 nm, 200 nm, 150 nm, 100 nm or 50 nm. In some instances, the diameter of a structure is between about 10 nm and 1000 nm, between about 10 nm and about 800 nm, between about 10 nm and about 600 nm, between about 10 nm and about 500 nm, between about 10 nm and about 400 nm, between about 10 nm and about 300 nm, or between about 10 mm and about 200 nm. Non-limiting examples of structure size include about 300 nm, 200 nm, 150 nm, 130 nm, 100 nm, 76 nm, 51 nm 25 nm, and 10 nm. In some instances, a structure has a planar surface area of at least about 100 nm2; 200 nm2; 500 nm2; 1,000 nm2; 2,000 nm2; 5,000 nm2; 10,000 nm2; 12,000 nm2; 15,000 nm2; 20,000 nm2; 30,000 nm2; 40,000 nm2; 50,000 nm2 or more. In some instances, a structure has a thickness between about 10 nm and about 2000 nm, between about 50 nm and about 1000 mm, between about 100 nm and about 1000 nm, between about 200 nm and about 1000 nm, or between about 250 nm and about 1000 nm. Non-limiting examples of thickness include 50 nm, 100 nm, 275 nm, 375 nm 525 nm, 625 nm, 675 nm, 725 nm, 775 nm and 925 nm.

Materials

Provided herein are devices comprising a surface, wherein the surface is modified to support polynucleotide synthesis at predetermined locations and with a resulting low error rate, a low dropout rate, a high yield, and a high oligo representation. In some instances, surfaces of a device for polynucleotide synthesis provided herein are fabricated from a variety of materials capable of modification to support a de novo polynucleotide synthesis reaction. In some instances, the devices are sufficiently conductive, e.g., are able to form uniform electric fields across all or a portion of the device. A device described herein may comprise a flexible material. Exemplary flexible materials include, without limitation, modified nylon, unmodified nylon, nitrocellulose, and polypropylene. A device described herein may comprise a rigid material. Exemplary rigid materials include, without limitation, glass, fuse silica, silicon, silicon dioxide, silicon nitride, metal nitride, metal silicide, metal carbide, metal oxide, plastics (for example, polytetrafluoroethylene, polypropylene, polystyrene, polycarbonate, and blends thereof), and metals (for example, gold, platinum). In some instances, metal oxides include TiO2, Ta2O5, Nb2O5, Al2O3, BaO, Y2O3, HfO2, SrO or other metal oxide known in the art. In some instances, metal carbides include TiC, WC, ThC2, ThC, VC, W2C, ZrC, HfC, NbC, TaC, Ta2C, or other metal carbide known in the art. In some instances, metal nitrides include GaN, InN, BN, Be3N2, Cr2N, MoN, Si3N4, TaN, Th2N2, VN, ZrN, TiN, HfN, NbC, WN, TaN, or other metal nitride known in the art. Devices disclosed herein are in some instances fabricated from a material comprising silicon, polystyrene, agarose, dextran, cellulosic polymers, polyacrylamides, polydimethylsiloxane (PDMS), glass, or any combination thereof. In some instances, a device disclosed herein is manufactured with a combination of materials listed herein or any other suitable material known in the art.

A listing of tensile strengths for exemplary materials described herein is provides as follows: nylon (70 MPa), nitrocellulose (1.5 MPa), polypropylene (40 MPa), silicon (268 MPa), polystyrene (40 MPa), agarose (1-10 MPa), polyacrylamide (1-10 MPa), polydimethylsiloxane (PDMS) (3.9-10.8 MPa). Solid supports described herein can have a tensile strength from 1 to 300, 1 to 40, 1 to 10, 1 to 5, or 3 to 11 MPa. Solid supports described herein can have a tensile strength of about 1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 20, 25, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 270, or more MPa. In some instances, a device described herein comprises a solid support for polynucleotide synthesis that is in the form of a flexible material capable of being stored in a continuous loop or reel, such as a tape or flexible sheet.

Young's modulus measures the resistance of a material to elastic (recoverable) deformation under load. A listing of Young's modulus for stiffness of exemplary materials described herein is provides as follows: nylon (3 GPa), nitrocellulose (1.5 GPa), polypropylene (2 GPa), silicon (150 GPa), polystyrene (3 GPa), agarose (1-10 GPa), polyacrylamide (1-10 GPa), polydimethylsiloxane (PDMS) (1-10 GPa). Solid supports described herein can have a Young's moduli from 1 to 500, 1 to 40, 1 to 10, 1 to 5, or 3 to 11 GPa. Solid supports described herein can have a Young's moduli of about 1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 20, 25, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 400, 500 GPa, or more. As the relationship between flexibility and stiffness are inverse to each other, a flexible material has a low Young's modulus and changes its shape considerably under load.

In some instances, a device disclosed herein comprises a silicon dioxide base and a surface layer of silicon oxide. Alternatively, the device may have a base of silicon oxide. Surface of the device provided here may be textured, resulting in an increase overall surface area for polynucleotide synthesis. Devices described herein may comprise at least 5%, 10%, 25%, 50%, 80%, 90%, 95%, or 99% silicon. A device disclosed herein may be fabricated from a silicon on insulator (SOI) wafer.

Provided herein are devices for polynucleotide synthesis comprising a structure fabricated from any one or more of a variety of materials. In certain instances, the materials from which the substrates/solid supports comprise are fabricated to exhibit a low level of polynucleotide binding. In some situations, materials that are transparent to visible and/or UV light can be employed. Materials that are sufficiently conductive (conductors), e.g. those that can form uniform electric fields across all or a portion of the substrates/solids support described herein, can be utilized. In some instances, such materials may be connected to an electric ground. In some instances, the substrate or solid support can be heat conductive or insulated. The materials can be chemical resistant and heat resistant to support chemical or biochemical reactions such as a series of polynucleotide synthesis reactions.

In some instances, conductive or semiconductive materials (semiconductors) include but are not limited to one or more of titanium silicon nitride, titanium nitride, tungsten nitride, tantulum nitride, tantulum silicon nitride, titanium, platinum silicide, or other conductive materials. In instances materials include but are not limited to one or more of aluminumcarbides, carbides, nitrides, oxides, silicides, siliconitrides, phosphides, or other non-metal or metalloids used as components of conductive materials. In some instances, exemplary materials comprise (non-limiting) one or more of the elements of tungsten, cobalt, iridium, molybdenum, nickel, platinum, rhenium, ruthenium, tantulum, titanium, or other, metals used as components of conductive materials. In some instances, materials comprise mixtures of metals, non-metals, or metalloids. In some instances, dopants are added to the semiconductive material. Dopants include but are not limited to phosphorus, antimony, arsenic, boron, aluminum, indium, or other element consistent with the specification. For nanostructures such as nanorods, nanowires, or nanotubes, materials of interest include conductors, semiconductors, or insulators. This includes without limitation metallic elements (for example, nickel, copper, silver, gold, platinum), semiconducting materials (for example, silicon, zinc oxide, germanium, gallium phosphide, indium nitride), or insulating materials (for example, silicon dioxide, or titanium dioxide). Conductors, semiconductors, or insulators may be manufactured with a combination of materials listed herein or any other suitable material known in the art.

For rigid materials, specific materials of interest include: glass; fused silica; silicon, plastics (for example polytetraflouroethylene, polypropylene, polystyrene, polycarbonate, and blends thereof, and the like); metals (for example, gold, platinum, and the like). The structure can be fabricated from a material selected from the group consisting of silicon, polystyrene, agarose, dextran, cellulosic polymers, polyacrylamides, polydimethylsiloxane (PDMS), and glass. The substrates/solid supports, microstructures, reactors, or other polynucleotide synthesis structure therein may be manufactured with a combination of materials listed herein or any other suitable material known in the art.

Exemplary flexible materials for structures described herein include, without limitation, nylon (unmodified nylon, modified nylon, clear nylon), nitrocellulose, polypropylene, polycarbonate, polyethylene, polyurethane, polystyrene, acetal, acrylic, acrylonitrile, butadiene styrene (ABS), polyester films such as polyethylene terephthalate, polymethyl methacrylate or other acrylics, polyvinyl chloride or other vinyl resin, transparent PVC foil, transparent foil for printers, Poly(methyl methacrylate) (PMMA), methacrylate copolymers, styrenic polymers, high refractive index polymers, fluorine-containing polymers, polyethersulfone, polyimides containing an alicyclic structure, rubber, fabric, metal foils, and any combination thereof. Various plasticizers and modifiers may be used with polymeric substrate materials to achieve selected flexibility characteristics.

Flexible structures described herein may comprise a plastic material. In some instances, the structure comprises a thermoplastic material. Non-limiting examples of thermoplastic materials include acrylic, acrylonitrile butadiene styrene, nylon, polylactic acid, polybenzimidazole, polycarbonate, polyether sulfone, polyetherether ketone, polyetherimide, polyethylene, polyphenylene oxide, polyphenylene sulfide, polypropylene, polystyrene, polyvinyl chloride, and polytetrafluoroethylene. In some instances, the substrate comprises a thermoplastic material in the poly aryletherketone (PEAK) family. Non-limiting examples of PEAK thermoplastics include polyetherketone (PEK), polyetherketoneketone (PEKK), poly(ether ether ketone ketone) (PEEKK), polyether ether ketone (PEEK), and polyetherketoneetherketoneketone (PEKEKK). In some instances, the structure comprises a thermoplastic material compatible with toluene. In some instances, the flexibility of the plastic material is increased by the addition of a plasticizer. An example of a plasticizer is an ester-based plasticizer, such as phthalate. Phthalate plasticizers include bis(2-ethylhexyl) phthalate (DEHP), diisononly phthalate (DINP), di-n-butyl phthalate (DnBP, DBP), butyl benzyl phthalate (BBzP), diisodecyl phthalate (DIDP), dioctyl phthalate (DOP, DnOP), diisooctyl phthalate (DIOP), diethyl phthalate (DEP), diisobutyl phthalate (DIBP), and di-n-hexyl phthalate. In some instances, modification of the thermoplastic polymer through copolymerization or through the addition of non-reactive side chains to monomers before polymerization also increases flexibility.

Provided herein are flexible structures which may further comprise a fluoroelastomer. Materials having about 80% fluoroelastomers are designated as FKMs. Fluoroelastomers include perfluoro-elastomers (FFKMs) and tetrafluoroethylene/propylene rubbers (FEPM). Fluoroelastomers have five known types. Type 1 FKMs are composed of vinylidene fluoride (VDF) and hexafluoropropylene (HFP) and their fluorine content typically is around 66% by weight. Type 2 FKMs are composed of VDF, HFP, and tetrafluoroethylene (TFE) and typically have between about 68% and 69% fluorine. Type 3 FKMs are composed of VDF, TFE, and perfluoromethylvinylether (PMVE) and typically have between about 62% and 68% fluorine. Type 4 FKMs are composed of propylene, TFE, and VDF and typically have about 67% fluorine. Type 5 FKMs are composed of VDF, HFP, TFE, PMVE, and ethylene.

In some instances, a substrate disclosed herein comprises a computer readable material. Computer readable materials include, without limitation, magnetic media, reel-to-reel tape, cartridge tape, cassette tape, flexible disk, paper media, film, microfiche, continuous tape (e.g., a belt) and any media suitable for storing electronic instructions. In some instances, the substrate comprises magnetic reel-to-reel tape or a magnetic belt. In some instances, the substrate comprises a flexible printed circuit board.

Structures described herein may be transparent to visible and/or UV light. In some instances, structures described herein are sufficiently conductive to form uniform electric fields across all or a portion of a structure. In some instances, structures described herein are heat conductive or insulated. In some instances, the structures are chemical resistant and heat resistant to support a chemical reaction such as a polynucleotide synthesis reaction. In some instances, the substrate is magnetic. In some instances, the structures comprise a metal or a metal alloy.

Structures for polynucleotide synthesis may be over 1, 2, 5, 10, 30, 50 or more feet long in any dimension. In the case of a flexible structure, the flexible structure is optionally stored in a wound state, e.g., in a reel. In the case of a large structure, e.g., greater than 1 foot in length, the structure can be stored vertically or horizontally.

Material Deposition Systems

Provided herein are systems and devices for the deposition and storage of biomolecules on a structure described herein. In some instances, the biomolecules are polynucleotides that store encoded information in their sequences. In some instances, the system comprises a surface of a structure to support biomolecule attachment and/or a device for application of a biomolecule to the surface of the substrate. In an example, the device for biomolecule application is a polynucleotide synthesizer. In some instances, the system comprises a device for treating the substrate with a fluid, for example, a flow cell. In some instances, the system comprises a device for moving the substrate between the application device and the treatment device. For instances where the substrate is a reel-to-reel tape, the system may comprise two or more reels that allow for access of different portions of the substrate to the application and optional treatment device at different times.

A first example of a polynucleotide material deposition system for polynucleotide synthesis is shown in FIG. 7. The system includes a material deposition device that moves in the X-Y direction to align with the location of the substrate. The material deposition device can also move in the Z direction to seal with the substrate, forming a resolved reactor. A resolved reactor is configured to allow for the transfer of fluid, including polynucleotides and/or reagents, from the substrate to a capping element and/or vice versa. As shown in FIG. 7, fluid may pass through either or both the substrate and the capping element and includes, without limitation, coupling reagents, capping reagents, oxidizers, de-blocking agents, acetonitrile and nitrogen gas. Examples of devices that are capable of high resolution droplet deposition include the printhead of inkjet printers and laser printers. The devices useful in the systems and methods described herein achieve a resolution from about 100 dots per inch (DPI) to about 50,000 DPI; from about 100 DPI to about 20,000 DPI; from about 100 DPI to about 10,000 DPI; from about 100 DPI to about 5,000 DPI; from about 1,000 DPI to about 20,000 DPI; or from about 1,000 DPI to about 10,000 DPI. In some instances, the devices have a resolution at least about 1,000; 2,000; 3,000; 4,000; 5,000; 10,000; 12,000 DPI, or 20,000 DPI. The high resolution deposition performed by the device is related to the number and density of each nozzle that corresponds to a feature of the substrate.

An exemplary process workflow for de novo synthesis of a polynucleotide on a substrate using a polynucleotide synthesizer is shown in FIG. 8. Droplets comprising polynucleotide synthesis reagents are released from the material deposition device to the substrate in a stepwise manner, wherein the material deposition device has a piezo ceramic material and electrodes to convert electrical signals into a mechanical signal for releasing the droplets. The droplets are released to specific locations on the surface of the substrate one nucleobase at a time to generate a plurality of synthesized polynucleotides having predetermined sequences that encode data. In some instances, the synthesized polynucleotides are stored on the substrate. Nucleic acid reagents may be deposited on the substrate surface in a non-continuous, or drop-on-demand method. Examples of such methods include the electromechanical transfer method, electric thermal transfer method, and electrostatic attraction method. In the electromechanical transfer method, piezoelectric elements deformed by electrical pulses cause the droplets to be ejected. In the electric thermal transfer method, bubbles are generated in a chamber of the device, and the expansive force of the bubbles causes the droplets to be ejected. In the electrostatic attraction method, electrostatic force of attraction is used to eject the droplets onto the substrate. In some instances, the drop frequency is from about 5 KHz to about 500 KHz; from about 5 KHz to about 100 KHz; from about 10 KHz to about 500 KHz; from about 10 KHz to about 100 KHz; or from about 50 KHz to about 500 KHz. In some instances, the frequency is less than about 500 KHz, 200 KHz, 100 KHz, or 50 KHz.

The size of the droplets dispensed correlates to the resolution of the device. In some instances, the devices deposit droplets of reagents at sizes from about 0.01 pl to about 20 pl, from about 0.01 pl to about 10 pl, from about 0.01 pl to about 1 pl, from about 0.01 pl to about 0.5 pl, from about 0.01 pl to about 0.01 pl, or from about 0.05 pl to about 1 pl. In some instances, the droplet size is less than about 1 pl, 0.5 pl, 0.2 pl, 0.1 pl, or 0.05 pl. The size of droplets dispensed by the device is correlated to the diameters of deposition nozzles, wherein each nozzle is capable of depositing a reagent onto a feature of the substrate. In some instances, a deposition device of a polynucleotide synthesizer comprises from about 100 to about 10,000 nozzles; from about 100 to about 5,000 nozzles; from about 100 to about 3,000 nozzles; from about 500 to about 10,000 nozzles; or from about 100 to about 5,000 nozzles. In some instances, the deposition device comprises greater than 1,000; 2,000; 3,000; 4,000; 5,000; or 10,000 nozzles. In some instances, each material deposition device comprises a plurality of nozzles, where each nozzle is optionally configured to correspond to a feature on a substrate. Each nozzle may deposit a reagent component that is different from another nozzle. In some instances, each nozzle deposits a droplet that covers one or more features of the substrate. In some instances, one or more nozzles are angled. In some instances, multiple deposition devices are stacked side by side to achieve a fold increase in throughput. In some instances, the gain is 2×, 4×, 8× or more. An example of a deposition device is Samba Printhead (Fujifilm). A Samba Printhead may be used with the Samba Web Administration Tool (SWAT).

The number of deposition sites may be increased by using and rotating the same deposition device by a certain degree or saber angle. By rotating the deposition device, each nozzle is jetted with a certain amount of delay time corresponding to the saber angle. This unsynchronized jetting creates a cross talk among the nozzles. Therefore, when the droplets are jetting at a certain saber angle different from 0 degrees, the droplet volume from the nozzle could be different.

In some arrangements, the configuration of a polynucleotide synthesis system allows for a continuous polynucleotide synthesis process that exploits the flexibility of a substrate for traveling in a reel-to-reel type process. This synthesis process operates in a continuous production line manner with the substrate travelling through various stages of polynucleotide synthesis using one or more reels to rotate the position of the substrate. In an exemplary embodiment, a polynucleotide synthesis reaction comprises rolling a substrate: through a solvent bath, beneath a deposition device for phosphoramidite deposition, through a bath of oxidizing agent, through an acetonitrile wash bath, and through a deblock bath. Optionally, the tape is also traversed through a capping bath. A reel-to-reel type process allows for the finished product of a substrate comprising synthesized polynucleotides to be easily gathered on a take-up reel, where it can be transported for further processing or storage.

In some arrangements, polynucleotide synthesis proceeds in a continuous process as a continuous flexible tape is conveyed along a conveyor belt system. Similar to the reel-to-reel type process, polynucleotide synthesis on a continuous tape operates in a production line manner, with the substrate travelling through various stages of polynucleotide synthesis during conveyance. However, in a conveyor belt process, the continuous tape revisits a polynucleotide synthesis step without rolling and unrolling of the tape, as in a reel-to-reel process. In some arrangements, polynucleotide synthesis steps are partitioned into zones and a continuous tape is conveyed through each zone one or more times in a cycle. For example, a polynucleotide synthesis reaction may comprise (1) conveying a substrate through a solvent bath, beneath a deposition device for phosphoramidite deposition, through a bath of oxidizing agent, through an acetonitrile wash bath, and through a block bath in a cycle; and then (2) repeating the cycles to achieve synthesized polynucleotides of a predetermined length. After polynucleotide synthesis, the flexible substrate is removed from the conveyor belt system and, optionally, rolled for storage. Rolling may be around a reel, for storage.

In an exemplary arrangement, a flexible substrate comprising thermoplastic material is coated with nucleoside coupling reagent. The coating is patterned into features such that each feature has diameter of about 10 μm, with a center-to-center distance between two adjacent features of about 21 μm. In this instance, the feature size is sufficient to accommodate a sessile drop volume of 0.2 pl during a polynucleotide synthesis deposition step. In some instances, the feature density is about 2.2 billion features per m2 (1 feature/441×10−12 m2). In some instances, a 4.5 m2 substrate comprise about 10 billion features, each with a 10 μm diameter.

In another exemplary arrangement, a substrate comprising nanostructures is coated with nucleoside coupling reagent. The coating is patterned into features such that each feature has diameter of about 10 nm to about 200 nm, with a center-to-center distance between two adjacent features of about 10 nm to about 200 nm. In this instance, a plurality of features accommodates a sessile drop volume of 0.2 pl during a polynucleotide synthesis deposition step. In some instances, a feature diameter of about 50 nm and a center-to-center distance between two adjacent features of about 100 nm results in a feature density of about 10 billion features per m2 (1 feature/100×10−12 m2).

A material deposition device described herein may comprises about 2,048 nozzles that each deposit about 100,000 droplets per second at 1 nucleobase per droplet. For each deposition device, at least about 1.75×1013 nucleobases are deposited on the substrate per day. In some instances, 100 to 500 nucleobase polynucleotides are synthesized. In some instances, 200 nucleobase polynucleotides are synthesized. Optionally, over 3 days, at a rate of about 1.75×1013 bases per day, at least about 262.5×109 polynucleotides are synthesized.

In some arrangements, a device for application of one or more reagents to a substrate during a synthesis reaction is configured to deposit reagents and/or nucleotide monomers for nucleoside phosphoramidite based synthesis. Reagents for polynucleotide synthesis include reagents for polynucleotide extension and wash buffers. As non-limiting examples, the device deposits cleaning reagents, coupling reagents, capping reagents, oxidizers, de-blocking agents, acetonitrile, phase change solvents, gases such as nitrogen gas, and any combination thereof. In addition, the device optionally deposits reagents for the preparation and/or maintenance of substrate integrity. In some instances, the polynucleotide synthesizer deposits a drop having a diameter less than about 200 μm, 100 μm, or 50 μm in a volume less than about 1000, 500, 100, 50, or 20 pl. In some instances, the polynucleotide synthesizer deposits between about 1 and 10,000, 1 and 5,000, 100 and 5,000, or 1,000 and 5,000 droplets per second.

In some arrangement, during polynucleotide synthesis, the substrate is positioned within and/or sealed within a flow cell. The flow cell may provide continuous or discontinuous flow of liquids such as those comprising reagents necessary for reactions within the substrate, for example, oxidizers and/or solvents. The flow cell may provide continuous or discontinuous flow of a gas, such as nitrogen, for drying the substrate typically through enhanced evaporation of a volatile substrate. A variety of auxiliary devices are useful to improve drying and reduce residual moisture on the surface of the substrate. Examples of such auxiliary drying devices include, without limitation, a vacuum source, depressurizing pump and a vacuum tank. In some instances, a polynucleotide synthesis system comprises one or more flow cells, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, or 20 and one or more substrates, such as 2, 3, 4, 5, 6, 7, 8, 9, 10 or 20. In some instances, a flow cell is configured to hold and provide reagents to the substrate during one or more steps in a synthesis reaction. In some instances, a flowcell comprises a lid that slides over the top of a substrate and can be clamped into place to form a pressure tight seal around the edge of the substrate. An adequate seal includes, without limitation, a seal that allows for about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 atmospheres of pressure. In some instances, the lid of the flow cell is opened to allow for access to an application device such as a polynucleotide synthesizer. In some instances, one or more steps of a polynucleotide synthesis method are performed on a substrate within a flow cell, without the transport of the substrate.

In some arrangements, a device for treating a substrate with a fluid comprises a spray bar. Nucleotide monomers may be applied onto a substrate surface, and then a spray bar sprays the substrate surface with one or more treatment reagents using spray nozzles of the spray bar. In some arrangements, the spray nozzles are sequentially ordered to correlate with different treatment steps during polynucleotide synthesis. The chemicals used in different process steps may be changed in the spray bar to readily accommodate changes in a synthesis method or between steps of a synthesis method. In some instances, the spray bar continuously sprays a given chemistry on a surface of a substrate as the substrate moves past the spray bar. In some instances, the spray bar deposits over a wide area of a substrate, much like the spray bars used in lawn sprinklers. In some instances, the spray bar nozzles are positioned to provide a uniform coat of treatment material to a given area of a substrate.

In some instances, a polynucleotide synthesis system comprises one or more elements useful for downstream processing of synthesized polynucleotides. As an example, the system comprises a temperature control element such as a thermal cycling device. In some instances, the temperature control element is used with a plurality of resolved reactors to perform nucleic acid assembly such as PCA and/or nucleic acid amplification such as PCR.

De Novo Polynucleotide Synthesis Using a Temperature Controllable Device Provided herein are methods for phase change applications to regulate access of reagents during polynucleotide synthesis in a temperature specific manner (see Table 1). Exemplary melting temperatures for solvents described herein include about 10° C. to about 30° C., about 10° C. to about 18° C., about −30° C. to about 40° C., or about 5° C. to about 40° C. In some aspects, the phase change solvent has a melting temperature of about 15-16° C. In some aspects, the phase change solvent has a melting temperature of about 10-25° C. In some aspects, the phase change solvent has a melting temperature of about 15-25° C. In some aspects, the phase change solvent has a melting temperature of about 15-18° C. In some instances, the phase change solvent has a melting temperature of at least −20° C., or at least −15, −10, −5, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, or more than 40° C. In some instances, the phase change solvent has a melting temperature no more than −20° C., or no more than −15, −10, −5, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, or no more than 40° C. In some instances, the phase change solvent includes solvents containing about 5 to about 10 carbon atoms. In some instances, the phase change solvent is a polar solvent. In some instances, the phase change solvent is an ionic liquid. In some instances, the phase change solvent is a supercritical fluid. In some instances, the phase change solvent comprises one or more additives, such as salts, other solids, liquids, or dissolved gases that influence the solvent properties. Exemplary densities for phase change solvents described herein include about 0.5 g/mL to about 1.5 g/mL, or about 0.6 g/mL to about 1.4 g/mL, or about 0.7 g/mL to about 1.3 g/mL. In some instances, the phase change solvent is a solvent with a boiling point of no more than 82° C. In some instances, the phase change solvent is acetonitrile or an acetonitrile mixture.

In some instances, the phase change solvent is trimethylacetonitrile (TMACN). Other exemplary phase change solvents include but are not limited to trimethylacetonitrile (TMACN), dimethylsulfoxide (DMSO), p-xylene, cyclohexylcyanide, 2,5-dimethyl-2,4-hexadiene, cyclooctane, o-tolunitrile, acetophenone, cyclononane, p-methylbenzyl cyanide, propiophenone, m-nitrotoluene, o-dimethoxybenzene, m-chlorobenzaldehyde, o-chlorobenzaldehyde, cyclodecane, dimethyl succinate, butyrophenone, 4-ethoxybenzaldehyde, m-tolyl acetate, phenyl propionate, or mixtures thereof.

TABLE 1 Melting Temperature Phase Change Solvent (° C.) trimethylacetonitrile (TMACN) 15 dimethylsulfoxide (DMSO) 18 p-xylene 13 cyclohexylcyanide 11 2,5-dimethyl-2,4-hexadiene 13 cyclooctane 15 o-tolunitrile 13 acetophenone 20 cyclononane 11 p-methylbenzyl cyanide 18 propiophenone 19 m-nitrotoluene 16 o-dimethoxybenzene 15 m-chlorobenzaldehyde 18 o-chlorobenzaldehyde 11 cyclodecane 10 dimethyl succinate 19 butyrophenone 12 4-ethoxybenzaldehyde 14 m-tolyl acetate 12 phenyl propionate 20

In some instances, a polynucleotide synthesis method used herein comprises 1, 2, 3 or more sequential coupling steps. Prior to coupling, in many cases, the nucleoside bound to the substrate is de-protected by removal of a protecting group, where the protecting group functions to prevent polymerization. A common protecting group is 4,4′-dimethoxytrityl (DMT). In some instances, coupling steps are repeated two or more times without removal of a protecting group.

Following coupling, phosphoramidite polynucleotide synthesis methods optionally comprise a capping step. In a capping step, the growing polynucleotide is treated with a capping agent. A capping step generally serves to block unreacted substrate-bound 5′-OH groups after coupling from further chain elongation, preventing the formation of polynucleotides with internal base deletions. Further, phosphoramidites activated with 1H-tetrazole often react, to a small extent, with the O6 position of guanosine. Without being bound by theory, upon oxidation with 12/water, this side product, possibly via O6-N7 migration, undergoes depurination. The apurinic sites can end up being cleaved in the course of the final deprotection of the polynucleotide thus reducing the yield of the full-length product. The O6 modifications may be removed by treatment with the capping reagent prior to oxidation with I2/water. In some instances, inclusion of a capping step during polynucleotide synthesis decreases the error rate as compared to synthesis without capping. As an example, the capping step comprises treating the substrate-bound polynucleotide with a mixture of acetic anhydride and 1-methylimidazole. Following a capping step, the substrate is optionally washed.

Following addition of a nucleoside phosphoramidite, and optionally after capping and one or more wash steps, the substrate bound growing nucleic acid may be oxidized. The oxidation step comprises oxidizing the phosphite triester into a tetracoordinated phosphate triester, a protected precursor of the naturally occurring phosphate diester internucleoside linkage. In some instances, oxidation of the growing polynucleotide is achieved by treatment with iodine and water, optionally in the presence of a weak base such as a pyridine, lutidine, or collidine. Oxidation is sometimes carried out under anhydrous conditions using tert-Butyl hydroperoxide or (1S)-(+)-(10-camphorsulfonyl)-oxaziridine (CSO). In some methods, a capping step is performed following oxidation. A second capping step allows for substrate drying, as residual water from oxidation that may persist can inhibit subsequent coupling. Following oxidation, the substrate and growing polynucleotide is optionally washed. In some instances, the step of oxidation is substituted with a sulfurization step to obtain polynucleotide phosphorothioates, wherein any capping steps can be performed after the sulfurization. Many reagents are capable of the efficient sulfur transfer, including, but not limited to, 3-(Dimethylaminomethylidene)amino)-3H-1,2,4-dithiazole-3-thione, DDTT, 3H-1,2-benzodithiol-3-one 1,1-dioxide, also known as Beaucage reagent, and N,N,N′N′-Tetraethylthiuram disulfide (TETD).

For a subsequent cycle of nucleoside incorporation to occur through coupling, a protected 5′ end of the substrate bound growing polynucleotide must be removed so that the primary hydroxyl group can react with a next nucleoside phosphoramidite. In some instances, the protecting group is DMT and deblocking occurs with trichloroacetic acid in dichloromethane. Conducting detritylation for an extended time or with stronger than recommended solutions of acids may lead to increased depurination of solid support-bound polynucleotide and thus reduces the yield of the desired full-length product. Methods and compositions described herein provide for controlled deblocking conditions limiting undesired depurination reactions. In some instances, the substrate bound polynucleotide is washed after deblocking. In some instances, efficient washing after deblocking contributes to synthesized polynucleotides having a low error rate.

Methods for the synthesis of polynucleotides on the substrates described herein typically involve an iterating sequence of the following steps: application of a protected monomer to a surface of a substrate feature to link with either the surface, a linker or with a previously deprotected monomer; deprotection of the applied monomer so that it can react with a subsequently applied protected monomer; and application of another protected monomer for linking. One or more intermediate steps include oxidation and/or sulfurization. In some instances, one or more wash steps precede or follow one or all of the steps. In some instances, the last wash step comprises addition of a suitable phase change solvent. In some instances, a coupling step occurs without the removal of a phase change solvent. In some instances the reaction solvent is a phase change solvent.

In some aspects of the methods described herein, the phase of the reaction solvent is used to block or unblock specific sites on the surface of the device. In one example, the phase of the reaction solvent at a site is controlled by one or more addressable heating elements, and methods for the synthesis of polynucleotides comprises iteration of a sequence of one or more of the following steps: deprotection of an applied monomer or reactive group on the surface so that it can react with a subsequently applied protected monomer; optional cooling of the device surface; activation of all heater elements on the surface; addition of a phase change solvent, deactivation of all heating elements at device sites to be blocked and application of a protected monomer to a surface of a substrate feature to link with either the surface, a linker or with a previously deprotected monomer. One or more intermediate steps include activation of all heater elements, followed by oxidation and/or sulfurization. In some instances, one or more wash steps precede or follow one or all of the steps. In some instances, activation of all heating elements preceeds or follows one or more wash steps. In some instances, heating elements are activated at sites to be blocked.

Further described herein are methods wherein deactivation of one or more heater elements at one or more surface regions for polynucleotide synthesis causes solvent in these regions to freeze, forming a solid. In some instances, the solid solvent prevents contact of the synthesis surface region with additional reagents such as detritylation reagents, preventing deprotection. In some instances, activation of heating elements or deactivation of cooling elements causes the solid to melt, allowing reagents to contact the synthesis surface.

Further described herein are methods wherein activation of one or more heater elements at one or more surface regions for polynucleotide synthesis causes solvent in these regions to boil, forming a gaseous bubble. In some instances, the bubble of gaseous solvent prevents contact of the synthesis surface region with additional reagents such as detritylation reagents, preventing deprotection. In some instances, activation of cooling elements or deactivation of heating elements causes the bubble to collapse, allowing reagents to contact the synthesis surface.

In some instances, polynucleotides are synthesized with photolabile protecting groups, where the hydroxyl groups generated on the surface are blocked by photolabile-protecting groups. When the surface is exposed to UV light, such as through a photolithographic mask, a pattern of free hydroxyl groups on the surface may be generated. These hydroxyl groups can react with photoprotected nucleoside phosphoramidites, according to phosphoramidite chemistry. A second photolithographic mask can be applied and the surface can be exposed to UV light to generate second pattern of hydroxyl groups, followed by coupling with 5′-photoprotected nucleoside phosphoramidite. Likewise, patterns can be generated and oligomer chains can be extended. Without being bound by theory, the lability of a photocleavable group depends on the wavelength and polarity of a solvent employed and the rate of photocleavage may be affected by the duration of exposure and the intensity of light. This method can leverage a number of factors such as accuracy in alignment of the masks, efficiency of removal of photo-protecting groups, and the yields of the phosphoramidite coupling step. Further, unintended leakage of light into neighboring sites can be minimized. The density of synthesized oligomer per spot can be monitored by adjusting loading of the leader nucleoside on the surface of synthesis.

The surface of the substrate that provides support for polynucleotide synthesis may be chemically modified to allow for the synthesized polynucleotide chain to be cleaved from the surface. In some instances, the polynucleotide chain is cleaved at the same time as the polynucleotide is deprotected. In some instances, the polynucleotide chain is cleaved after the polynucleotide is deprotected. In an exemplary scheme, a trialkoxysilyl amine such as (CH3CH2O)3Si—(CH2)2—NH2 is reacted with surface SiOH groups of a substrate, followed by reaction with succinic anhydride with the amine to create an amide linkage and a free OH on which the nucleic acid chain growth is supported. Cleavage includes gas cleavage with ammonia or methylamine. In some instances, once released from the surface, polynucleotides are assembled into larger nucleic acids that are sequenced and decoded to extract stored information.

Provided herein are systems and methods for synthesis of a high density of polynucleotides on a substrate in a short amount of time. In some instances, the substrate is a flexible substrate. In some instances, at least about 1010, 1011, 1012, 1013, 1014, or 1015 bases are synthesized in one day. In some instances, at least about 10×108, 10×109, 10×1010, 10×1011, or 10×1012 polynucleotides are synthesized in one day. In some instances, each polynucleotide synthesized comprises at least about 20, 50, 100, 200, 300, 400 or 500 nucleobases. In some instances, these bases are synthesized with a total average error rate of less than about 1 in 100; 200; 300; 400; 500; 1000; 2000; 5000; 10000; 15000; 20000 bases. In some instances, these error rates are for at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, 99.5%, or more of the polynucleotides synthesized. In some instances, these at least 90%, 95%, 98%, 99%, 99.5%, or more of the polynucleotides synthesized do not differ from a predetermined sequence for which they encode. In some instances, the error rate for synthesized polynucleotides on a substrate using the methods and systems described herein is less than about 1 in 200. In some instances, the error rate for synthesized polynucleotides on a substrate using the methods and systems described herein is less than about 1 in 1,000. In some instances, the error rate for synthesized polynucleotides on a substrate using the methods and systems described herein is less than about 1 in 2,000. In some instances, the error rate for synthesized polynucleotides on a substrate using the methods and systems described herein is less than about 1 in 3,000. In some instances, the error rate for synthesized polynucleotides on a substrate using the methods and systems described herein is less than about 1 in 5,000. Individual types of error rates include mismatches, deletions, insertions, and/or substitutions for the polynucleotides synthesized on the substrate. The term “error rate” refers to a comparison of the collective amount of synthesized polynucleotide to an aggregate of predetermined polynucleotide sequences. In some instances, synthesized polynucleotides disclosed herein comprise a tether of 12 to 25 bases. In some instances, the tether comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more bases.

A suitable method for polynucleotide synthesis on a substrate of this disclosure is a phosphoramidite method comprising the controlled addition of a phosphoramidite building block, i.e. nucleoside phosphoramidite, to a growing polynucleotide chain in a coupling step that forms a phosphite triester linkage between the phosphoramidite building block and a nucleoside bound to the substrate (for example, an elongation step). In some instances, the nucleoside phosphoramidite is provided to the substrate activated. In some instances, the nucleoside phosphoramidite is provided to the substrate with an activator. In some instances, nucleoside phosphoramidites are provided to the substrate in a 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100-fold excess or more over the substrate-bound nucleosides. In some instances, the addition of nucleoside phosphoramidite is performed in an anhydrous environment, for example, in anhydrous acetonitrile. Following addition and linkage of a nucleoside phosphoramidite in the coupling step, the substrate is optionally washed. In some instances, the coupling step is repeated one or more additional times, optionally with a wash step between nucleoside phosphoramidite additions to the substrate.

Nucleic Acid Assembly

Polynucleotides may be designed to collectively span a large region of a predetermined sequence that encodes for information. In some instances, larger polynucleotides are generated through ligation reactions to join the synthesized polynucleotides. One example of a ligation reaction is polymerase chain assembly (PCA). In some instances, at least of a portion of the polynucleotides are designed to include an appended region that is a substrate for universal primer binding. For PCA reactions, the presynthesized polynucleotides include overlaps with each other (e.g., 4, 20, 40 or more bases with overlapping sequence). During the polymerase cycles, the polynucleotides anneal to complementary fragments and then are filled in by polymerase. Each cycle thus increases the length of various fragments randomly depending on which polynucleotides find each other. Complementarity amongst the fragments allows for forming a complete large span of double-stranded DNA. In some instances, after the PCA reaction is complete, an error correction step is conducted using mismatch repair detecting enzymes to remove mismatches in the sequence. Once larger fragments of a target sequence are generated, they can be amplified. For example, in some instances, a target sequence comprising 5′ and 3′ terminal adapter sequences is amplified in a polymerase chain reaction (PCR) which includes modified primers that hybridize to the adapter sequences. In some instances, the modified primers comprise one or more uracil bases. The use of modified primers allows for removal of the primers through enzymatic reactions centered on targeting the modified base and/or gaps left by enzymes which cleave the modified base pair from the fragment. What remains is a double-stranded amplification product that lacks remnants of adapter sequence. In this way, multiple amplification products can be generated in parallel with the same set of primers to generate different fragments of double-stranded DNA.

Error correction may be performed on synthesized polynucleotides and/or assembled products. An example strategy for error correction involves site-directed mutagenesis by overlap extension PCR to correct errors, which is optionally coupled with two or more rounds of cloning and sequencing. In certain instances, double-stranded nucleic acids with mismatches, bulges and small loops, chemically altered bases and/or other heteroduplexes are selectively removed from populations of correctly synthesized nucleic acids. In some instances, error correction is performed using proteins/enzymes that recognize and bind to or next to mismatched or unpaired bases within double-stranded nucleic acids to create a single or double-strand break or to initiate a strand transfer transposition event. Non-limiting examples of proteins/enzymes for error correction include endonucleases (T7 Endonuclease I, E. coli Endonuclease V, T4 Endonuclease VII, mung bean nuclease, Cell, E. coli Endonuclease IV, UVDE), restriction enzymes, glycosylases, ribonucleases, mismatch repair enzymes, resolvases, helicases, ligases, antibodies specific for mismatches, and their variants. Examples of specific error correction enzymes include T4 endonuclease 7, T7 endonuclease 1, S1, mung bean endonuclease, MutY, MutS, MutH, MutL, cleavase, CELI, and HINF1. In some instances, DNA mismatch-binding protein MutS (Thermus aquaticus) is used to remove failure products from a population of synthesized products. In some instances, error correction is performed using the enzyme Correctase. In some instances, error correction is performed using SURVEYOR endonuclease (Transgenomic), a mismatch-specific DNA endonuclease that scans for known and unknown mutations and polymorphisms for heteroduplex DNA.

Computer Systems

In various aspects, any of the systems described herein are operably linked to a computer and are optionally automated through a computer either locally or remotely. In various instances, the methods and systems of the invention further comprise software programs on computer systems and use thereof. Accordingly, computerized control for the synchronization of the dispense/vacuum/refill functions such as orchestrating and synchronizing the material deposition device movement, dispense action and vacuum actuation are within the bounds of the invention. In some instances, the computer systems are programmed to interface between the user specified base sequence and the position of a material deposition device to deliver the correct reagents to specified regions of the substrate.

The computer system 900 illustrated in FIG. 9 may be understood as a logical apparatus that can read instructions from media 911 and/or a network port 905, which can optionally be connected to server 909. The system, such as shown in FIG. 9 can include a CPU 901, disk drives 903, optional input devices such as keyboard 915 and/or mouse 916 and optional monitor 907. Data communication can be achieved through the indicated communication medium to a server at a local or a remote location. The communication medium can include any means of transmitting and/or receiving data. For example, the communication medium can be a network connection, a wireless connection or an internet connection. Such a connection can provide for communication over the World Wide Web. It is envisioned that data relating to the present disclosure can be transmitted over such networks or connections for reception and/or review by a party 922.

FIG. 10 is a block diagram illustrating a first example architecture of a computer system 1000 that can be used in connection with example instances of the present invention. As depicted in FIG. 10, the example computer system can include a processor 1002 for processing instructions. Non-limiting examples of processors include: Intel Xeon™ processor, AMD Opteron™ processor, Samsung 32-bit RISC ARM 1176JZ(F)-S v1.0™ processor, ARM Cortex-A8 Samsung S5PC100™ processor, ARM Cortex-A8 Apple A4™ processor, Marvell PXA 930™ processor, or a functionally-equivalent processor. Multiple threads of execution can be used for parallel processing. In some instances, multiple processors or processors with multiple cores can also be used, whether in a single computer system, in a cluster, or distributed across systems over a network comprising a plurality of computers, cell phones, and/or personal data assistant devices.

As illustrated in FIG. 10, a high speed cache 1004 can be connected to, or incorporated in, the processor 1002 to provide a high speed memory for instructions or data that have been recently, or are frequently, used by processor 1002. The processor 1002 is connected to a north bridge 1006 by a processor bus 1008. The north bridge 1006 is connected to random access memory (RAM) 1010 by a memory bus 1012 and manages access to the RAM 1010 by the processor 1002. The north bridge 1006 is also connected to a south bridge 1014 by a chipset bus 1016. The south bridge 1014 is, in turn, connected to a peripheral bus 1018. The peripheral bus can be, for example, PCI, PCI-X, PCI Express, or other peripheral bus. The north bridge and south bridge are often referred to as a processor chipset and manage data transfer between the processor, RAM, and peripheral components on the peripheral bus 1018. In some alternative architectures, the functionality of the north bridge can be incorporated into the processor instead of using a separate north bridge chip.

In some instances, system 1000 can include an accelerator card 1022 attached to the peripheral bus 1018. The accelerator can include field programmable gate arrays (FPGAs) or other hardware for accelerating certain processing. For example, an accelerator can be used for adaptive data restructuring or to evaluate algebraic expressions used in extended set processing.

Software and data are stored in external storage 1024 and can be loaded into RAM 1010 and/or cache 1004 for use by the processor. The system 1000 includes an operating system for managing system resources; non-limiting examples of operating systems include: Linux, Windows™, MACOS™, BlackBerry OS™, iOS™, and other functionally-equivalent operating systems, as well as application software running on top of the operating system for managing data storage and optimization in accordance with example instances of the present invention.

In this example, system 1000 also includes network interface cards (NICs) 1020 and 1021 connected to the peripheral bus for providing network interfaces to external storage, such as Network Attached Storage (NAS) and other computer systems that can be used for distributed parallel processing.

FIG. 11 is a diagram showing a network 1100 with a plurality of computer systems 1102a, and 1102b, a plurality of cell phones and personal data assistants 1102c, and Network Attached Storage (NAS) 1104a, and 1104b. In example instances, systems 1102a, 1102b, and 1102c can manage data storage and optimize data access for data stored in Network Attached Storage (NAS) 1104a and 1104b. A mathematical model can be used for the data and be evaluated using distributed parallel processing across computer systems 1102a, and 1102b, and cell phone and personal data assistant systems 1102c. Computer systems 1102a, and 1102b, and cell phone and personal data assistant systems 1102c can also provide parallel processing for adaptive data restructuring of the data stored in Network Attached Storage (NAS) 1104a and 1104b. FIG. 11 illustrates an example only, and a wide variety of other computer architectures and systems can be used in conjunction with the various instances of the present invention. For example, a blade server can be used to provide parallel processing. Processor blades can be connected through a back plane to provide parallel processing. Storage can also be connected to the back plane or as Network Attached Storage (NAS) through a separate network interface.

In some example instances, processors can maintain separate memory spaces and transmit data through network interfaces, back plane or other connectors for parallel processing by other processors. In other instances, some or all of the processors can use a shared virtual address memory space.

FIG. 12 is a block diagram of a multiprocessor computer system 1200 using a shared virtual address memory space in accordance with an example embodiment. The system includes a plurality of processors 1202a-f that can access a shared memory subsystem 1204. The system incorporates a plurality of programmable hardware memory algorithm processors (MAPs) 1206a-f in the memory subsystem 1204. Each MAP 1206a-f can comprise a memory 1208a-f and one or more field programmable gate arrays (FPGAs) 1210a-f. The MAP provides a configurable functional unit and particular algorithms or portions of algorithms can be provided to the FPGAs 1210a-f for processing in close coordination with a respective processor. For example, the MAPs can be used to evaluate algebraic expressions regarding the data model and to perform adaptive data restructuring in example instances. In this example, each MAP is globally accessible by all of the processors for these purposes. In one configuration, each MAP can use Direct Memory Access (DMA) to access an associated memory 1208a-f, allowing it to execute tasks independently of, and asynchronously from, the respective microprocessor 1202a-f. In this configuration, a MAP can feed results directly to another MAP for pipelining and parallel execution of algorithms.

The above computer architectures and systems are examples only, and a wide variety of other computer, cell phone, and personal data assistant architectures and systems can be used in connection with example instances, including systems using any combination of general processors, co-processors, FPGAs and other programmable logic devices, system on chips (SOCs), application specific integrated circuits (ASICs), and other processing and logic elements. In some instances, all or part of the computer system can be implemented in software or hardware. Any variety of data storage media can be used in connection with example instances, including random access memory, hard drives, flash memory, tape drives, disk arrays, Network Attached Storage (NAS) and other local or distributed data storage devices and systems.

The following examples are set forth to illustrate more clearly the principle and practice of instances disclosed herein to those skilled in the art and are not to be construed as limiting the scope of any claimed instances. Unless otherwise stated, all parts and percentages are on a weight basis.

EXAMPLES Example 1: Synthesis of 50-mer Sequence Polynucleotides on a Temperature Controllable Surface Utilizing a Phase Change Solvent

A polynucleotide synthesis device 101 (see FIG. 1), is assembled into a temperature controllable flowcell (FIG. 3A and FIG. 3B), which is connected to a flowcell (Applied Biosystems (ABI394 DNA Synthesizer”) as shown in in FIG. 7. The bottom surface of the well 305 (FIG. 3A and FIG. 3B), coated with SiO2, is uniformly functionalized with N-(3-TRIETHOXYSILYLPROPYL)-4-HYDROXYBUTYRAMIDE (Gelest, CAS No. 156214-80-1) and is used to synthesize an exemplary polynucleotide of 50 bp (“50-mer polynucleotide”) using polynucleotide synthesis methods described herein. The sequence of the 50-mer is as described in SEQ ID NO.: 1. 5′AGACAATCAACCATTTGGGGTGGACAGCCTTGACCTCTAGACTTCGGCAT ##TTTTT TTTTT3′ (SEQ ID NO.: 1), where #denotes Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes), which is a cleavable linker enabling the release of polynucleotides from the surface during deprotection.

The synthesis is done using standard DNA synthesis chemistry (coupling, capping, oxidation, and deblocking) according to the protocol in Table 2 and an ABI synthesizer, with modification: the chemical coupling reaction in each cell is controlled via a temperature controllable surface (see FIG. 8). The device temperature is lowered to about 5° C. below the freezing temperature of a phase change solvent with a cold chuck. During the coupling step, the phase change solvent is added immediately prior to addition of coupling reagents, and the phase change solvent freezes. Wells are activated for coupling by heating through addressable heating elements, which melt the solvent in individual wells. Remaining wells with frozen solvent do not react with liquid coupling reagents, and are inactive. Coupling steps are iterated, each with different DNA bases, for example A, T, G, and C, while changing the active wells for each coupling iteration. After all desired sites have been functionalized, all wells are activated by heating; global capping, oxidation, and deblocking are then conducted. This overall process is repeated until polynucleotides of the desired length are synthesized.

TABLE 2 Step Description 0 Deblock 1 Flush surface 2 Activate all heater elements 3 Flow phase change reagent 4 Deactivate heaters at device sites to be blocked 5 Flow nucleotide A and activator 6 Flush 7 Activate all heater elements 8 Flush 9 Flow phase change reagent 10 Deactivate heaters at device sites to be blocked 11 Flow nucleotide G and activator 12 Flush 13 Activate all heater elements 14 Flush 15 Flow phase change reagent 16 Deactivate heaters at device sites to be blocked 17 Flow nucleotide C and activator 18 Flush 19 Activate all heater elements 20 Flush 21 Flow phase change reagent 22 Deactivate heaters at device sites to be blocked 23 Flow nucleotide T and activator 24 Flush 25 Activate all heater elements 26 Flush 27 Oxidation

The device temperature is lowered to about 5° C. below the freezing temperature of a phase change solvent with a cold chuck. During the coupling step, the phase change solvent is added immediately prior to addition of coupling reagents, and the phase change solvent freezes. Wells are activated for coupling by heating through addressable heating elements, which melt the solvent in individual wells. Remaining wells with frozen solvent do not react with liquid coupling reagents, and are inactive towards coupling reagents. Coupling steps are iterated with different DNA bases, for example A, T, G, and C, while changing the active wells for each coupling iteration. After all desired sites have been functionalized, all wells are activated by heating; global capping, oxidation, and deblocking are then conducted. This overall process is repeated until polynucleotides of the desired length are synthesized.

Example 2: Synthesis of a 50-mer Sequence Polynucleotides on a Temperature Controllable Surface Utilizing a Solvent Vapor Bubble

A polynucleotide synthesis device 101 (see FIG. 1), is assembled into a temperature controllable flowcell (FIG. 4A), which is connected to a flowcell (Applied Biosystems (ABI394 DNA Synthesizer”) as shown in in FIG. 7. The bottom surface of the well 401 (FIG. 4A), is functionalized using the general methods from Example 1.

The synthesis is done using standard DNA synthesis chemistry (coupling, capping, oxidation, and deblocking) according to the protocol in Table 3 and an ABI synthesizer, with modification: the chemical coupling reaction in each cell is controlled via a temperature controllable surface (see FIG. 8).

TABLE 3 Step Description 0 Deblock 1 Flush surface 2 Deactivate all heater elements 3 Activate heaters at device sites to be blocked 4 Flow nucleotide A and activator 5 Flush 6 Deactivate all heater elements 7 Flush 8 Activate heaters at device sites to be blocked 9 Flow nucleotide G and activator 10 Flush 11 Deactivate all heater elements 12 Flush 13 Activate heaters at device sites to be blocked 14 Flow nucleotide C and activator 15 Flush 16 Deactivate all heater elements 17 Flush 18 Activate heaters at device sites to be blocked 19 Flow nucleotide T and activator 20 Flush 21 Deactivate all heater elements 22 Flush 23 Oxidation

Wells are blocked against coupling by heating through addressable heating elements, which vaporizes the solvent in individual wells, creating a bubble 417. Remaining wells with liquid solvent contacting the polynucleotide surface 407 for extension or synthesis react with liquid coupling reagents, and are active. Coupling steps are iterated with different DNA bases, for example A, T, G, and C, while changing the active wells for each coupling iteration. Inactive wells are activated by turning off heating elements at those wells, causing the vapor bubbles to collapse. After all desired sites have been functionalized, all wells are activated by turning off heating elements; global capping, oxidation, and deblocking are then conducted. This overall process is repeated until polynucleotides of the desired length are synthesized.

Example 3: Synthesis of 50-mer Sequence Polynucleotides on a Temperature Controllable Surface Utilizing Nanoposts

A polynucleotide synthesis device 101 (see FIG. 1), is assembled into a temperature controllable flowcell (FIG. 4B), which is connected to a flowcell (Applied Biosystems (ABI394 DNA Synthesizer”) as shown in in FIG. 7. The top surface of the nanopost 407 (FIG. 4B), is functionalized using the general methods from Example 1.

The synthesis is done using standard DNA synthesis chemistry (coupling, capping, oxidation, and deblocking) according to the protocol in Table 3 and an ABI synthesizer, with modification: the chemical coupling reaction in each cell is controlled via a temperature controllable surface (see FIG. 8), using the general method of Example 2.

Example 4: Synthesis of 50-mer Sequence Polynucleotides on a Temperature Controllable Surface Utilizing Nanowires

A polynucleotide synthesis device 101 (see FIG. 1), is assembled into a temperature controllable flowcell (FIG. 5), which is connected to a flowcell (Applied Biosystems (ABI394 DNA Synthesizer”) as shown in in FIG. 7. The surface of the nanorods 502 (FIG. 5), is functionalized using the general methods from Example 1.

The synthesis is done using standard DNA synthesis chemistry (coupling, capping, oxidation, and deblocking) according to the protocol in Table 3 and an ABI synthesizer, with modification: the chemical coupling reaction in each cell is controlled via a temperature controllable surface (see FIG. 8), using the general methods of Example 2.

Example 5: Synthesis of 50-mer Sequence Polynucleotides on a Surface Containing Nanorods and Utilizing a Phase Change Solvent

A polynucleotide synthesis device 101 (see FIG. 1), is assembled into a temperature controllable flowcell (FIG. 6), which is connected to a flowcell (Applied Biosystems (ABI394 DNA Synthesizer”) as shown in in FIG. 7. The surface of the nanorods 603 (FIG. 6), is functionalized using the general methods from Example 1.

The synthesis is done using standard DNA synthesis chemistry (coupling, capping, oxidation, and deblocking) according to the protocol in Table 4 and an ABI synthesizer, with modification: the chemical coupling reaction in each cell is controlled via a temperature controllable surface (see FIG. 8). During the coupling step, the phase change solvent is added immediately prior to addition of coupling reagents. Wells are deactivated for coupling by cooling through an addressable lower contact 601 connected to one or more nanorods, which freezes a layer of solvent around the nanorods. Remaining nanorods with liquid solvent react with liquid coupling reagents, and are active. Coupling steps are iterated with different DNA bases, for example A, T, G, and C, while changing the active wells for each coupling iteration. After all desired sites have been functionalized, all nanorods are activated by discontinuing cooling; global capping, oxidation, and deblocking are then conducted. This overall process is repeated until polynucleotides of the desired length are synthesized.

TABLE 4 Step Description 0 Deblock 1 Flush surface 2 Deactivate all cooling elements 3 Flow phase change reagent 4 Activate cooling at device sites to be blocked 5 Flow nucleotide A and activator 6 Flush 7 Deactivate all cooling elements 8 Flush 9 Flow phase change reagent 10 Activate cooling at device sites to be blocked 11 Flow nucleotide G and activator 12 Flush 13 Deactivate all cooling elements 14 Flush 15 Flow phase change reagent 16 Activate cooling at device sites to be blocked 17 Flow nucleotide C and activator 18 Flush 19 Deactivate all cooling elements 20 Flush 21 Flow phase change reagent 22 Activate cooling at device sites to be blocked 23 Flow nucleotide T and activator 24 Flush 25 Deactivate all cooling elements 26 Flush 27 Oxidation

While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

Claims

1. A device for polynucleotide synthesis comprising:

a. a solid support comprising a surface;
b. a plurality of structures for polynucleotide extension located on the surface, wherein each structure has a width of about 10 nm to about 1000 nm, wherein each structure is in contact with a heating unit, and wherein the heating unit comprises at least one electrode; and
c. a solvent distributed across the surface, wherein the solvent is a polar solvent.

2. A device for polynucleotide synthesis comprising:

a. a solid support comprising a surface;
b. a plurality of structures for polynucleotide extension located on the surface, wherein each structure has a width of about 10 nm to about 1000 nm, wherein each structure is in contact with a heating unit, and wherein the heating unit comprises at least one electrode; and
c. a solvent distributed across the surface, wherein the solvent has a melting temperature of no more than about 18 degrees C.

3. A device for polynucleotide synthesis comprising:

a. a solid support comprising a surface;
b. a plurality of structures for polynucleotide extension located on the surface, wherein each structure has a width of about 10 nm to about 1000 nm, wherein each structure is in contact with a heating unit, and wherein the heating unit comprises at least one electrode; and
c. a solvent distributed across the surface, wherein the solvent has a boiling temperature no more than about 82 degrees C.

4. The device of any one of claims 1 to 3, wherein the surface comprises at least 30,000 loci for nucleic acid synthesis.

5. The device of claim 1, wherein the surface comprises at least 50,000 loci for nucleic acid synthesis.

6. The device of any one of claims 1 to 3, wherein the surface comprises at least 100,000 loci for nucleic acid synthesis.

7. The device of any one of claims 1 to 3, wherein the surface comprises at least 200,000 loci for nucleic acid synthesis.

8. The device of any one of claims 1 to 3, wherein the surface comprises at least 1,000,000 loci for nucleic acid synthesis.

9. The device of any one of claims 1 to 3, wherein the one or more electrodes are addressable electrodes that heats one or more individual loci.

10. The device of any one of claims 1 to 3, wherein the solid support further comprises a cooling unit.

11. The device of any one of claims 1 to 3, wherein the distance between the centers of any two structures is about 10 nm to about 1000 nm.

12. The device of any one of claims 1 to 3, wherein the distance between the centers of any two structures is about 100 nm to about 500 nm.

13. The device of claim 1, wherein the distance between the centers of any two structures is about 20 nm to about 300 nm.

14. The device of any one of claims 1 to 3, wherein the distance between the centers of any two structures is about 100 nm.

15. The device of any one of claims 1 to 3, wherein the distance between the centers of any two structures is about 200 nm.

16. The device of any one of claims 1 to 3, wherein the distance between the centers of any two structures is about 500 nm.

17. The device of any one of the preceding claims, wherein each structure comprises a 3-dimensional structure, wherein the 3-dimensional structure is a nanowell, a nanowire, a nanopost, or a nanorod.

18. The device of claim 2, wherein the solvent is a polar solvent.

19. The device of claim 1 or 2, wherein the solvent comprises a nitrile group.

20. The device of claim 1, wherein the solvent is trimethylacetonitrile.

21. The device of claim 1 or 2, wherein the solvent has a melting temperature between 5 degrees C. to 18 degrees C.

22. The device of claim 1, wherein the solvent has a melting temperature of between 10 degrees C. to 18 degrees C.

23. The device of claim 1 or 2, wherein the solvent has a melting temperature of between 15 degrees C. to 18 degrees C.

24. The device of claim 1, wherein the solvent has a melting temperature of between 5 degrees C. to 30 degrees C.

25. The device of claim 3, wherein the solvent has a boiling temperature of between 0 degrees C. to 82 degrees C.

26. The device of claim 3, wherein the solvent has a boiling temperature of between 30 degrees C. to 82 degrees C.

27. The device of claim 3, wherein the solvent has a boiling temperature of between 55 degrees C. to 82 degrees C.

28. The device of any one of claims 1 to 3, wherein the solvent has a density of between 0.5 and 1.5 g/mL.

29. The device of any one of the preceding claims, wherein the device is used for polynucleotide synthesis, wherein polynucleotide synthesis comprises a plurality of elongation steps.

30. The device of claim 29, wherein the solvent is not removed during an elongation step.

31. A method for polynucleotide synthesis using the device of any one of claims 1-29.

32. A method for polynucleotide synthesis, the method comprising:

a. providing predetermined sequences for a library of polynucleotides;
b. providing a substrate comprising a surface;
c. synthesizing the library of polynucleotides extending from the surface, wherein a solvent in the solid phase prevents deblocking of at least one polynucleotide extending from the at least one region of the surface, wherein the solvent has a melting temperature of no more than about 18 degrees C.

33. The method of claim 32, wherein synthesizing the library of polynucleotides extending from the surface comprises contacting the surface with a first nucleotide phosphoramidite.

34. The method of claim 33, wherein synthesizing the library of polynucleotides extending from the surface further comprises contacting the surface with a second nucleotide phosphoramidite, wherein the solvent is not removed between contact with the first nucleotide phosphoramidite and the second nucleotide phosphoramidite.

35. The method of any one of claims 32-34, wherein synthesizing the library of polynucleotides extending from the surface further comprises melting the solvent present at the at least one region of the surface, and deblocking at least one extended polynucleotide extending from the surface in the at least one region.

36. The method of any one of claims 32-35, wherein the solvent has a melting temperature of no more than about 15 degrees C.

37. The method of any one of claims 32-36, wherein the solvent has a melting temperature of no more than about 10 degrees C.

38. The method of any one of claims 32-35, wherein the solvent has a melting temperature between 5 degrees C. to 18 degrees C.

39. The method of any one of claims 32-35, wherein the solvent has a melting temperature of between 10 degrees C. to 18 degrees C.

40. The method of any one of claims 32-35, wherein the solvent has a melting temperature of between 15 degrees C. to 18 degrees C.

41. The method of any one of claims 32-35, wherein the solvent has a melting temperature of between 5 degrees C. to 30 degrees C.

42. A method for polynucleotide synthesis, the method comprising:

d. providing predetermined sequences for a library of polynucleotides;
e. providing a substrate comprising a surface;
f. synthesizing the library of polynucleotides extending from the surface, wherein a solvent in the gas phase prevents deblocking of at least one polynucleotide extending from the at least one region of the surface, wherein the solvent has a boiling temperature no more than about 82 degrees C.

43. The method of claim 42, wherein synthesizing the library of polynucleotides extending from the surface comprises contacting the surface with a first nucleotide phosphoramidite.

44. The method of claim 43, wherein synthesizing the library of polynucleotides extending from the surface further comprises contacting the surface with a second nucleotide phosphoramidite, wherein the solvent is not removed between contact with the first nucleotide phosphoramidite and the second nucleotide phosphoramidite.

45. The method of any one of claims 42-44, wherein synthesizing the library of polynucleotides extending from the surface further comprises condensing the solvent present at the at least one region of the surface, and deblocking at least one extended polynucleotide extending from the surface in the at least one region.

46. The method of any one of claims 42-45, wherein the solvent has a boiling temperature no more than about 75 degrees C.

47. The method of any one of claims 42-46, wherein the solvent has a boiling temperature no more than about 65 degrees C.

48. The method of any one of claims 42-47, wherein the solvent has a boiling temperature of between 0 degrees C. to 82 degrees C.

49. The method of any one of claims 42-47, wherein the solvent has a boiling temperature of between 30 degrees C. to 82 degrees C.

50. The method of any one of claims 42-47, wherein the solvent has a boiling temperature of between 55 degrees C. to 82 degrees C.

51. The method of any one of claims 32 to 50, wherein the surface comprises at least 30,000 loci for nucleic acid synthesis.

52. The method of any one of claims 32 to 51, wherein the surface comprises at least 50,000 loci for nucleic acid synthesis.

53. The method of any one of claims 32 to 52, wherein the surface comprises at least 100,000 loci for nucleic acid synthesis.

54. The method of any one of claims 32 to 53, wherein the surface comprises at least 200,000 loci for nucleic acid synthesis.

55. The method of any one of claims 32 to 54, wherein the surface comprises at least 1,000,000 loci for nucleic acid synthesis.

Patent History
Publication number: 20240001325
Type: Application
Filed: Jun 30, 2023
Publication Date: Jan 4, 2024
Inventors: Eugene P. MARSH (El Granada, CA), Pierre F. INDERMUHLE (Berkeley, CA), Bill James PECK (Santa Clara, CA)
Application Number: 18/345,869
Classifications
International Classification: B01J 19/00 (20060101);