Prolactin as a vaccine adjuvant
The present invention relates to a composition for enhancing the immune response of an animal to an infectious disease vaccine wherein the composition comprises prolactin. Preferably, the composition is human prolactin and the animal to be vaccinated is, as well, human.The present invention further relates to a composition for enhancing the immune response of an animal to an infectious disease vaccine wherein the composition comprises prolactin cDNA. Human prolactin cDNA is preferred.
Latest Genzyme Corporation Patents:
- Chemical Process for the Synthesis of 4-(4-bromo-2-fluoroanilino)-6-methoxy-7-(1-methylpiperidin-4-ylmethoxy)quinazoline
- Gene therapy for neurodegenerative disorders
- Therapeutic tyrosine kinase inhibitors for relapsing multiple sclerosis (RMS)
- Gene therapy for neurometabolic disorders
- MODIFIED-IgG ANTIBODIES THAT BIND TRANSFORMING GROWTH FACTOR-BETA1 WITH HIGH AFFINITY, AVIDITY AND SPECIFICITY
The use of vaccines to prevent diseases in humans, farm livestock, sports animals and household pets is a common practice, and considerable effort has been, and is being, made to extend this practice to cover a more extensive array of diseases to which these patients are subject. For example, the use of rabies vaccine in animals is by now commonplace, and efforts are being made to obtain suitable vaccines to immunize animals against other diseases.
One problem that frequently is encountered in the course of active immunization is that the antigens used in the vaccine are not sufficiently immunogenic to raise the antibody titer to sufficient levels to provide protection against subsequent challenge or to maintain the potential for mounting these levels over extended time periods. Another problem is that the vaccine may be deficient in inducing cell-mediated immunity which is a primary immune defense against bacterial and viral infection.
In order to obtain a stronger humoral and/or cellular response, it is common to administer the vaccine in a formulation containing an adjuvant, a material which enhances the immune response of the patient to the vaccine. The most commonly used adjuvants for vaccines are oil preparations and alum. The mechanisms by which such adjuvants function are not understood, and whether or not a particular adjuvant preparation will be sufficiently effective in a given instance is not predictable.
In addition, with the advent of gene therapy it has been reported that some success has been accomplished with using genes or "naked DNA" as vaccines. However, as with some of the conventional vaccines, the immune response obtained was insufficient to afford immunization.
Accordingly, there is a need for additional effective adjuvant preparations which are suitable for potentiating vaccines for animals in general, and particularly in humans.
SUMMARY OF THE INVENTIONThe present invention relates to a composition for enhancing the immune response of an animal to an infectious disease vaccine wherein the composition comprises prolactin. Preferably, the composition is human prolactin and the animal to be vaccinated is, as well, human.
The present invention further relates to a composition for enhancing the immune response of an animal to an infectious disease vaccine wherein the composition comprises prolactin cDNA. Human prolactin cDNA is preferred.
In another aspect, the invention relates to a method of enhancing the immune response of a subject animal to an infectious disease vaccine comprising co-administering an effective amount of prolactin or prolactin cDNA along with a vaccine.
BRIEF DESCRIPTION OF THE DRAWINGFIG. 1 shows the amino acid sequence for the prolactin protein.
FIG. 2 shows the nucleic acid sequence for the prolactin cDNA.
FIG. 3 is a graph illustrating the Bovine serum albumin (BSA)-specific antibody response of rats immunized with BSA alone or BSA+prolactin.
FIG. 4 is a graph illustrating a comparison of the BSA-specific proliferative response of rat PBL, at 101 day time point, between four rats receiving BSA alone versus BSA+prolactin.
FIGS. 5 and 6 indicate that, overall, PBL rats immunized with B SAt 180 ug rh PRL displayed higher levels of BSA-specific proliferation than PBL from rats immunized with antigen alone.
DETAILED DESCRIPTION OF THE INVENTION DefinitionsAs used herein, "prolactin" refers to a polypeptide obtained from tissue cultures or by recombinant techniques and other techniques known to those of skill in the art, exhibiting the spectrum of activities characterizing this protein. The word includes not only human prolactin (hPRL), but also other mammalian prolactin such as, e.g., mouse, rat, rabbit, primate, pig and bovine prolactin. The amino acid sequence of a recombinant hPRL is shown in FIG. 1. The recombinant PRL (r-PRL) is preferred herein.
The term "recombinant prolactin", designated as r-PRL, preferably human prolactin, refers to prolactin having comparable biological activity to native prolactin prepared by recombinant DNA techniques known by those of skill in the art. In general, the gene coding for prolactin is excised from its native plasmid and inserted into a cloning vector to be cloned and then inserted into an expression vector, which is used to transform a host organism. The host organism expresses the foreign gene to produce prolactin under expression conditions.
As used herein, the term "adjuvant" has its conventional meaning, i.e., the ability to enhance the immune response to a particular antigen. Such ability is manifested by a significant increase in immune-mediated protection. Furthermore, the term "genetic adjuvant" refers to prolactin cDNA which comprises the complement to the DNA sequence encoding the prolactin protein as defined above. The sequence for prolactin cDNA is shown in FIG. 2.
General MethodFormulations containing prolactin for adjuvant purposes are most conveniently administered by intramuscular or subcutaneous injections or intraperitoneal although other methods of administration are possible.
Standard formulations are either liquid injectables or solids which can be taken up in suitable liquids as suspensions or solutions for injection. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, and so forth. Nontoxic auxiliary substances, such as wetting agents, buffers, or emulsifiers may also be added.
Sustained and continuous release formulations are of considerable variety and could be used in the method of the present invention, as is understood by those skilled in the art.
Prolactin can be administered separately from the vaccine or in combination with the vaccine. When prolactin is combined with the vaccine, the composition administered contains an immunogen that is effective in eliciting a specific response to a given pathogen or antigen, a pharmaceutically acceptable vaccine carrier and an immunopotentiating amount of prolactin. The vaccine will normally be administered per manufacturer's instructions. Other adjuvants may be administered either with the vaccine or together with the prolactin.
Prolactin will typically be used to enhance the protection afforded by animal or human vaccines that are considered "weak" (i.e., provide diminished protection in terms of level, extent, and/or duration). Examples of such vaccines are bacterins such as Pseudomonas Staphylococcal, Enterotoxin Streptococci, cytomegalovirus, HIV, Bordetella bacterin, Escherichia coli bacterins, Haemophilus bacterins, Leptospirosis vaccines, Moraxella bovis bacterin, Pasteurella bacterin and Vibrio fetus bacterin and attenuated live or killed virus products such as bovine respiratory disease vaccine (infectious bovine rhinotracheitis, parainfluenza-3, respiratory syncytial virus), bovine virus diarrhea vaccine, equine influenza vaccine, feline leukemia vaccine, feline respiratory disease vaccine (rhinotracheitis-calicipneumonitis viruses), canine parvovirus vaccine, transmissible gastroenteritis vaccine, pseudorabies vaccine, and rabies vaccine.
In addition, because we have demonstrated in vitro and in vivo data that indicate that prolactin can enhance the immune response to an immunogen and thereby function as a vaccine adjuvant, it is believed that the exogenous administration of the prolactin gene would result in the expression of prolactin in vivo which would be available to function as an adjuvant to any immunogen whether administered through conventional means or via gene inoculation. The "genetic adjuvant" could be produced by inserting prolactin cDNA into a DNA delivery vehicle (e.g., plasmid vectors, liposomes, viral vectors). This could be accomplished as described by Pellegrini I. , et al. , Molec. Endocrinolgy, 6, 1023 (1992), Maniatis T., et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press (1989) and Felger P., et al., Proc. Natl. Acad. Sci., 84, 7413, (1991). The "genetic adjuvant" is then administered along with either cDNA encoding the immunogen in an appropriate delivery vehicle or "naked" (i.e., solely the cDNA). In addition, the "genetic adjuvant" could be administered along with the immunogen itself. The injection sequence would be optimized per immunogen, i.e., the prolactin cDNA could be co-administered with the immunogen or immunogen cDNA, or administered in advance or subsequent to their administration. It is believed that the prolactin cDNA could be inserted into the same DNA delivery vehicle. Various routes of administration could be used.
EXAMPLE 1 Co-mitogenicity of recombinant human prolactin (r-hPRL).Peripheral blood lymphocytes (PBL) were isolated from the blood of normal human volunteers by density gradient centrifugation on Ficoll Paque (Pharmacia). Heparinized blood was diluted 3 fold in phosphate-buffered saline (PBS) and centrifuged at 2000 rpm for 20 minutes. The buffy coat, located on the surface of the red blood cell pellet and consisting of white blood cells, was collected and diluted with an equal volume of PBS. The diluted buffy coat was layered on Ficoll Paque (6 mls of buffy coat on 4 mls of Ficoll Paque in a 15 ml tube) and centrifuged for 30 minutes at 1400 rpm. The PBL layer, found at the Ficoll-plasma interface, was collected and the cells were washed three times in PBS. PBL were then resuspended at 2.times.10.sup.6 /ml in serum-free AIM-V medium from Gibco and added to the wells of round bottom 96 well microtiter plates in a 100 .mu.l volume (2.times.10.sup.5 PBL/well).
A suboptimal dose of the T cell mitogen concanavalin A (Con A; 0.2 .mu.g/ml) was added in a 50 .mu.l volume together with 50 .mu.l of varying concentrations of r-hPRL (0-1000 ng/ml final). Cultures were done in triplicate. The cells were incubated at 37.degree. C./5% CO.sub.2 for 72 hours and the amount of proliferation measured by tritiated thymidine incorporation. Tritiated thymidine (0.5 .mu. Ci/well) was added for the last 18 hours of incubation and cell-associated radioactivity was measured by scintillation counting after harvesting the cells onto glass fiber filters using a Skatron 96 well cell harvester.
Results, obtained with cells from different individuals, shown in Table 1 below, indicated that r-hPRL was able to enhance the proliferative response of T lymphocytes to a suboptimal concentration of Con A. This co-mitogenic activity was best observed with r-hPRL concentrations of 1-10 ng/ml, illustrated in FIG. 3.
TABLE 1
______________________________________
Co-mitogenic activity of recombinant
human prolactin (cpm +/- SEM)
Con A +
r-hPRL (ng/ml)
Donor 1 Donor 2 Donor 3
______________________________________
No prolactin
22323 .+-. 4585
35942 .+-. 810
16549 .+-. 1618
0.1 22949 .+-. 2003
34040 .+-. 1446
17083 .+-. 1895
1 35882 .+-. 3665
45839 .+-. 2137
27590 .+-. 3151
10 32832 .+-. 1972
37658 .+-. 150
22991 .+-. 2358
100 25963 .+-. 4855
35009 .+-. 2105
22674 .+-. 1662
1000 23990 .+-. 1534
35921 .+-. 1690
26646 .+-. 2574
______________________________________
EXAMPLE 2
Enhancement of antigen-specific proliferation by r-hPRL
To test the ability of r-hPRL to enhance the proliferative response of human T cells to a specific antigen, PBL were incubated with various concentrations of r-hPRL and streptokinase, a common antigen to which most individuals are exposed. Cultures were performed in triplicate in the wells of 96 well round bottom microtiter plates and consisted of 100 .mu.l PBL (2.times.10.sup.5 / well), 50 .mu.l streptokinase (25 .mu.g/ml final) and 50 .mu.l of r-hPRL at varying concentrations (0-1000 ng/ml final). Proliferation was measured by tritiated thymidine incorporation after 6 days of culture at 37.degree. C./5%CO.sub.2.
The results, shown in Table 2 below, indicated that r-hPRL, at a concentration of 1 ng/ml, significantly enhanced streptokinase-induced proliferation.
TABLE 2
______________________________________
Effect of recombinant human prolactin
on streptokinase-specific proliferation
Streptokinase + r-hPRL (ng/ml)
Proliferation (cpm +/- SEM)
______________________________________
No prolactin 31807 .+-. 4235
0.1 30220 .+-. 5448
1 50964 .+-. 6469
10 35620 .+-. 11318
100 36713 .+-. 2230
1000 33494 .+-. 7990
______________________________________
EXAMPLE 3
Effect of Prolactin in Enhancing the Immune Response to an Immunogen
Twenty-four 150 gram male Sprague-Dawley rats were divided into 4 groups. The control group received an intraperitoneal injection of 10 .mu.g BSA mixed with alum. The other 3 groups received intraperitoneal injections of 10 .mu.g BSA mixed with alum along with either 180 .mu.g prolactin, 375 .mu.g prolactin or 750 .mu.g prolactin. Tail vein bleeds were taken weekly for 4 weeks and the serum evaluated for antibody to BSA by a Radioimmunosorbent Assay (RIA). The animals were boosted after the 4th bleed with 10 .mu.g BSA mixed with alum. Tail vein bleeds were taken over a 7 week period to obtain serum which was evaluated for the development of antibody to BSA by RIA.
Bovine Serum Albumin (BSA)-Specific Proliferation of Peripheral Blood Lymphocytes from Rats Immunized with BSA+/-r-hPRLTo measure the effect of r-hPRL on the cellular response of rats immunized with BSA, blood was collected from individual animals sacrificed 101 days after boosting. To isolate peripheral blood lymphocytes (PBL), blood samples were diluted 4 fold in the phosphate-buffered saline (PBS) and centrifuged at 2000 rpm for 20 minutes. The buffy coat was collected and contaminating red blood cells were removed by the addition of Tris-ammonium chloride lysis buffer followed by a 10 minute incubation at 37.degree. C. PBL were then washed twice in PBS and resuspended at 5.times.10.sup.6 /ml in RPMI-1640 medium supplemented with 100 u/ml penicillin, 100 .mu.g/ml streptomycin, 20 mM Hepes buffer, 2 mM L-glutamine, 5.times.10.sup.-5 M 2-mercaptoethanol and 5% heat-inactivated fetal calf serum. PBL were added to the wells of flat bottom 96 well microtiter plates in a 100 .mu.l volume (5.times.10.sup.5 cells/well) and cultured in the presence of medium alone (background control) or 1000 .mu.g/ml BSA added in a 100 .mu.l volume. Cultures were done in triplicate. Proliferation was measured by tritiated thymidine incorporation after 5 days of culture at 37.degree. C./5% CO.sub.2.
The results indicated that, overall, PBL rats immunized with BSA+180 .mu.g rhPRL displayed higher levels of BSA-specific proliferation than PBL from rats immunized with antigen alone. This observation suggests that r-hPRL may act to enhance the cellular component of the immune response to an immunizing antigen. Results are compiled in Table 3 below and are illustrated in FIGS. 5 and 6.
TABLE 3
______________________________________
BSA-specific proliferation of rat PBL (cpm +/- SEM)
101 days after boosting
BSA-specific
Group Background response
______________________________________
BSA alone
Rat 1 918 .+-. 35 1236 .+-. 100
Rat 2 559 .+-. 169 1392 .+-. 185
Rat 3 614 .+-. 51 930 .+-. 265
Rat 4 242 .+-. 21 2122 .+-. 257
BSA + 180 .mu.g PRL
Rat 1 426 .+-. 99 2552 .+-. 30
Rat 2 269 .+-. 18 756 .+-. 37
Rat 3 723 .+-. 185 4328 .+-. 77
Rat 4 676 .+-. 29 2033 .+-. 397
______________________________________
Equivalents
Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims:
__________________________________________________________________________
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(iii) NUMBER OF SEQUENCES: 2
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 351 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(iv) ANTI-SENSE: NO
(v) FRAGMENT TYPE: N-terminal
(vi) ORIGINAL SOURCE:
(A) ORGANISM: human prolactin
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
ThrIleGlyPheHisMetProArgLeuCysHisGluCysLysPheArg
151015
MetThrThrArgAlaAsnSerLeuAlaThrGluPheHisMetProArg
202530
LeuSerGluGlnCysHisGluCysLysPheArgMetThrGlyGluAsn
354045
GluArgAlaThrGluAspSerTyrMetAsxLeuSerThrHisMetPro
505560
ArgLeuLeuCysSerHisMetProArgLeuAsxProMetArgAsnAla
65707580
GluAsnThrGluArgGluAspAspGluPheIleAsnIleThrIleAsn
859095
HisMetAlaAsnProArgGluProArgLeuAlaCysThrIleAsnPro
100105110
ArgLeuMetArgAsnAlaAlaCysCysGluSerSerIleAsnHisMet
115120125
ProArgLeuProGluProLeuGluAsnGlyThrHisLeuTyrCysHis
130135140
GluCysLysHisMetProArgLeuLeuProIleCysProGlyGlyAla
145150155160
AlaArgCysGlnValThrLeuArgAspLeuPheAspArgAlaValVal
165170175
LeuSerHisTyrIleHisAsnLeuSerSerGluMetPheSerGluPhe
180185190
AspLysArgTyrThrHisGlyArgGlyPheIleThrLysAlaIleAsn
195200205
SerCysHisThrSerSerLeuAlaThrProGluAspLysGluGlnAla
210215220
GlnGlnMetAsnGlnLysAspPheLeuSerLeuIleValSerIleLeu
225230235240
ArgSerTrpAsnGluProLeuTyrHisLeuValThrGluValArgGly
245250255
MetGlnGluAlaProGluAlaIleLeuSerLysAlaValGluIleGlu
260265270
GluGlnThrLysArgLeuLeuGluGlyMetGluLeuIleValSerGln
275280285
ValHisProGluThrLysGluAsnGluIleTyrProValTrpSerGly
290295300
LeuProSerLeuGlnMetAlaAspGluGluSerArgLeuSerAlaTyr
305310315320
TyrAsnLeuLeuHisCysLeuArgArgAspSerHisLysIleAspAsn
325330335
TyrLeuLysLeuLeuLysCysArgIleIleHisAsnAsnAsnCys
340345350
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1100 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
TGCCTCATTAACTAACCACTCACATTAAAAGAAATATAACATATATATTAAAAATAATCA60
TATCCTATAATAATTAACTCATCTAAAATACAACCTACTGTACCATATACTAACTGAATA120
AGACTAGCATTATTATTCAGGATAACTAAGTCCATAAGATATGTACCATATTATACACAT180
TTATAGCACGGATATTACTTACTGGATATACTTTGATCTATCTTGATATTTATTATTCAA240
AATACTACGTGATATATCGCATGTCCCAAACATGAACATCAAAGGATCGCCATGGAAAGG300
GTCCCTCCTGCTGCTGCTGGTGTCAAACCTGCTGCTGTGCCAGAGCGTGGCCCCCTTGCC360
CATCTGTCCCGGCGGGGCTGCCCGATGCCAGGTGACCCTTCGAGACCTGTTTGACCGCGC420
CGTCGTCCTGTCCCACTACATCCATAACCTCTCCTCAGAAATGTTCAGCGAATTCGATAA480
ACGGTATACCCATGGCCGGGGGTTCATTACCAAGGCCATCAACAGCTGCCACACTTCTTC540
CCTTGCCACCCCCGAAGACAAGGAGCAAGCCCAACAGATGAATCAAAAAGACTTTCTGAG600
CCTGATAGTCAGCATATTGCGATCCTGGAATGAGCCTCTGTATCATCTGGTCACGGAAGT660
ACGTGGTATGCAAGAAGCCCCGGAGGCTATCCTATCCAAAGCTGTAGAGATTGAGGAGCA720
AACCAAACGGCTTCTAGAGGGCATGGAGCTGATAGTCAGCCAGGTTCATCCTGAAACCAA780
AGAAAATGAGATCTACCCTGTCTGGTCGGGACTTCCATCCCTGCAGATGGCTGATGAAGA840
GTCTCGCCTTTCTGCTTATTATAACCTGCTCCACTGCCTACGCAGGGATTCACATAAAAT900
CGACAATTATCTCAAGCTCCTGAAGTGCCGAATCATCCACAACAACAACTGCTAAGCCCA960
CATCCATTTCATCTATTTCTGAGAAGGTCCTTAATGATCCGTTCCATTGCAAGCTTCTTT1020
TAGTTGTATCTCTTTTGAATCCATGCTTGGGTGTAACAGGTCTCCTCTTAAAAAATAAAA1080
ACTGACTCGTTAGAGACATC1100
__________________________________________________________________________
Claims
1. A composition for enhancing the immune response of an animal to an infectious disease vaccine, wherein the composition comprises prolactin and the infectious disease vaccine.
2. The composition of claim 1 wherein the prolactin is human prolactin.
3. A composition for enhancing the immune response in accordance with claim 1 wherein the animal is a human.
4. The composition of claim 1 wherein the prolactin comprises an amino acid sequence selected from all or a portion of the amino acid sequence of FIG. 1 (SEQ ID NO.:1).
5. A method of enhancing the immune response of a subject animal to an infectious disease vaccine comprising co-administering an effective amount of prolactin along with a vaccine.
6. The method of claim 5 wherein the prolactin is human prolactin.
7. A method for enhancing the immune response in accordance with claim 5 wherein the animal is a human.
8. The method of claim 5 wherein the prolactin comprises an amino acid sequence selected from all or a portion of the amino acid sequence of FIG. 1 (SEQ ID NO.:1).
- Nagy, E. and Berczi I. (1978) "Immunodeficiency in Hypophysectomized Rats" ACTA Endocrin, vol. 89:530-537. Spangelo, B. et al. (1987) "Stimulation of in-vivo antibody Production and Concanavalin-A-induced Mouse Spleen Cell Mitogenesis by Prolactin" Immunopharm., vol. 14:11-20. Felgner P. et al. (1987) "Lipofection: A Highly Efficient Lipid-mediated DNA-transfection Procedure" Proc. Natl. Acad. Sci. USA, 84(11):7413-7417. Bernton, E. et al. (1988) "Suppression of Macrophage Activation and T-Lymphocyte Function in Hypoprolactinemic Mice" Science, 239(1/22): 401-404. Mukherjee, P. et al. (1990) "Prolactin Induction of Interleukin-2 Receptors on Rat Splenic Lymphocytes" Endocrin., 126(1): 88-94. Clevenger, C. et al. (1990) "Regulation of Interleukin 2-driven T-lymphocyte Proliferation by Prolactin" Proc. Nat. Acad. Sci. USA 87(8): 6460-6464. Stephenson, J. et al. (1991) "Adjuvant Effect of Human Growth Hormone with an Inactivated Flavivirus Vaccine" J. Infec. Dis., 164: 188-191. Pellegrini, I. et al. (1992) "Expression of Prolactin and its Receptor in Human Lymphoid Cells" Mol. Endo., 6(7): 1023-1031. Ulmer, J. et al. (1993) "Heterologous Protection Against Influenza by Injection of DNA Encoding a Viral Protein" Science, 259(3/19): 1745-1749. Murphy, W. et al. (1993) "Differential Effects of Growth Hormone and Prolactin on Murine T Cell Development and Function" J. Exp. Med., 178(7): 231-236.
Type: Grant
Filed: Feb 14, 1994
Date of Patent: Dec 17, 1996
Assignee: Genzyme Corporation (Cambridge, MA)
Inventors: Susan Richards (Framingham, MA), Johanne Kaplan (Sherborn, MA), Richard Moscicki (Newton Center, MA)
Primary Examiner: Howard E. Schain
Attorney: F. Brad Salcedo
Application Number: 8/196,350
International Classification: A61K 3700; A61K 3818; A61K 3822;
